ArticlePDF Available

Responses of different geographic populations of two potato tuber moth species to genetic variants of Phthorimaea operculella granulovirus

Authors:
  • Research Institute for Development

Abstract and Figures

Phthorimaea operculella granulovirus (PhopGV) belongs to the genus Betabaculovirus of the arthropod- infecting Baculoviridae. PhopGV is able to infect several gelechiid species. Among them are the potato tuber moths Phthorimaea operculella Zeller and Tecia solanivora Povolny (both Lepidoptera: Gelechiidae). In various South American countries, PhopGV-based biopesticides are used to control either P. operculella or T. solanivora. Many trials have indicated that a particular viral isolate can exhibit very distinct pathogenicity when infecting different host species or different populations of one host species. In this study, we compared host–pathogen interactions using various PhopGV isolates and various populations of P. operculella and T. solanivora. Virus isolates from P. operculella were more pathogenic against their original host species than against T. solanivora. A PhopGV isolated from T. solanivora was less efficient against P. operculella. In addition, virus isolates differed in pathogenicity toward their hosts (i.e., lethal concentrations of isolates ranged from low to high). Unexpectedly, we also found that host populations of one species from distinct geographic origins did not differ significantly in susceptibility to the same PhopGV isolate. This was the case for both host species and for five PhopGV isolates. Comparative restriction fragment length polymorphism (RFLP) analyses of 11 isolates including those used in bio-assays indicated three main regions of variation in the genome of PhopGV, corresponding to the regions of open reading frame PhopGV046, gene PhopGV129 (egt), and repeat 9 (located between open reading frames PhopGV083 and PhopGV084). Comparison of the nucleotide sequences of the insertions/deletions present in these regions were carried out for the most variable isolate, JLZ9f. The results are discussed in the context of the production and use of PhopGV as a biological agent against these two pest species.
Content may be subject to copyright.
Responses of different g eogr aphic populations of two
potato tuber moth species to g enetic variants of
Phthorimaea operculella granulovirus
Jean-Louis Zeddam
1,2
*
§
,XavierL
ery
2,3§
,YanneryG
omez-Bonilla
4
, Carlos Espinel-
Correal
5
, David P
aez
1
,Franc
ß
ois Rebaudo
1,2
& Miguel L
opez-Ferber
6
1
Pontificia Universidad Cato
´
lica del Ecuador, Facultad de Ciencias Naturales y Biolo
´
gicas, Quito, Ecuador,
2
IRD, Institut de
RecherchepourleDe
´
veloppement, Laboratoire Evolution, G
enomes et Spe
´
ciation, Centre National de la Recherche
Scientifique (CNRS), UR 072, UPR 9034, 91198 Gif-sur-Yvette Cedex, France; et Universite
´
Paris-Sud 11, Orsay Cedex
91405, France,
3
Centre de Recherche, IRD, UR072, Saint-Christol-les-Ale
`
s 30380, France,
4
Instituto National de
Investigaci
on y Transferencia de Technologı
´
aAgropecuaria(INTA),SanJose
´
, Costa Rica,
5
Centro de Biotecnologı
´
ay
Bioindustria, CORPOICA, km 14
´
a Mosquera, Cundinamarca, Colombia, and
6
Ecole des Mines d’Ale
`
s, Centre LGEI,
6AvenuedeClavie
`
res, Al
es 30100, France
Accepted: 6 August 2013
Key words: Betabaculovirus, insect virus, bioassay, pathogenicity, viral variant, Tecia solanivora,
Lepidoptera, Gelechiidae, PhopGV, Baculoviridae
Abstract Phthorimaea operculella granulovirus (PhopGV) belongs to the genus Betabaculovirus of the arthro-
pod-infecting Baculoviridae. PhopGV is able to infect several gelechiid species. Among them are the
potato tuber moths Phthorimaea operculella Zeller and Tecia solanivora Povolny (both Lepidoptera:
Gelechiidae). In various South American countries, PhopGV-based biopesticides are used to control
either P. operculella or T. solanivora. Many trials have indicated that a particular viral isolate can
exhibit very distinct pathogenicity when infecting different host species or different populations of
one host species. In this study, we compared hostpathogen interactions using various PhopGV iso-
lates and various populations of P. operculella and T. solanivora. Virus isolates from P. operculella
were more pathogenic against their original host species than against T. solanivora. A PhopGV iso-
lated from T. solanivora was less efficient against P. operculella. In addition, virus isolates differed in
pathogenicity toward their hosts (i.e., lethal concentrations of isolates ranged from low to high).
Unexpectedly, we also found that host populations of one species from distinct geographic origins
did not differ significantly in susceptibility to the same PhopGV isolate. This was the case for both
host species and for five PhopGV isolates. Comparative restriction fragment length polymorphism
(RFLP) analyses of 11 isolates including those used in bio-assays indicated three main regions of vari-
ation in the genome of PhopGV, corresponding to the regions of open reading frame PhopGV046,
gene PhopGV129 (egt), and repeat 9 (located between open reading frames PhopGV083 and
PhopGV084). Comparison of the nucleotide sequences of the insertions/deletions present in these
regions were carried out for the most variable isolate, JLZ9f. The results are discussed in the context
of the production and use of PhopGV as a biological agent against these two pest species.
Introduction
Enveloped, rod-shaped viruses belonging to the family
Baculoviridae (baculoviruses) infect arthropods (insects
and crustaceans), mainly species in the orders Lepidoptera,
Hymenoptera, and Diptera (Theilmann et al., 2005). Four
genera are presently recognized within the family (Jehle
et al., 2006). The genus Alphabaculovirus (formerly
Nucleopolyhedrovirus,NPV)andthegenusBetabaculovirus
(formerly Granulovirus, GV) (Fauquet et al., 2005) are the
ones counting the most insect virus species (Granados &
Federici, 1986). Betabaculovirus species only infect Lepi-
doptera. Numerous baculoviruses cause epizootics among
the populations of their insect hosts (Evans, 1986; Fuxa,
*Correspondence and present address: Jean-Louis Zeddam, IRD-
DER, 911, Avenue Agropolis, BP 64501, Montpellier 34394, France.
E-mail: jean-louis.zeddam@ird.fr
§
Both authors contributed equally to this work.
138 © 2013 The Netherlands Entomological Society Entomologia Experimentalis et Applicata 149: 138–147, 2013
DOI: 10.1111/eea.12115
2004) and, thus, members of the group have been consid-
ered potentially interesting biological control agents. Since
decades, numerous studies have been carried out to
develop their use in pest management programs (Yearian
& Young, 1982; Huber, 1986; Lacey & Goettel, 1995; Mos-
cardi, 1999). However, just a few of them have been widely
used, in spite of social demand and the increasing develop-
ment of insect resistance to chemical pesticides, boosting
the interest for alternative control methods. Various fac-
tors can account for this limited use of baculoviruses
(Fuxa, 1991; Cunningham, 1995), such as a narrow host
range and a low killing speed. For this reason, more work
is needed to specify the conditions and limits of their use.
Phthorimaea operculella granulovirus (PhopGV; Reed &
Springett, 1971) is largely used for biocontrol purposes
(Raman, 1994; Kroschel et al., 1996; Sporleder & Kroschel,
2008; Moura Mascarin et al., 2010. PhopGV was first pro-
duced and applied to control the cosmopolitan potato
tuber moth, Phthorimaea operculella Zeller (Lepidoptera:
Gelechiidae) (Raman, 1994). More recently, PhopGV was
also used against the Guatemala potato moth, Tecia solani-
vora Povolny (Lepidoptera: Gelechiidae) (Espinel-Correal
et al., 2010), a species which extended its distribution area
considerably within the last few decades (Puillandre et al.,
2008). Tecia solanivora distribution partially overlaps with
that of P. operculella. In some locations the former dis-
placed the latter, in other locations the species coexist
(Dangles et al., 2008) in large areas of Central and South
America, P. operculella and T. solanivora can be found
infecting the same potato stores. Until now, little attention
has been paid to the comparative susceptibility of these
two species to the same PhopGV isolate and no compari-
son has been made of the pathogenicity of a given viral iso-
late among populations of a single host. These two aspects
are of major importance if the use of PhopGV is to be pro-
moted. It is essential to determine whether recommended
doses give the same level of control independent of the
host population considered. Also, in localities where the
two pests co-occur, it is essential to identify PhopGV iso-
lates that control both species effectively.
This study compiles 8 years of research in four coun-
tries to compare the pathogenicity of viral isolates among
different geographic populations of P. operculella and
T. solanivora. The objective was to test the hypothesis that
local viruses adapt to local host populations as well as to a
new invasive species. To that aim, four laboratory colonies
of P. operculella and three of T. solanivora were set up. To
make the results comparable between locations, we applied
a biological test that we have previously standardized
(Carrera et al., 2008). Aside from the phenotypic compari-
son, we analyzed viral genomes using restriction fragment
length polymorphism (RFLP) to determine whether
variation was randomly spread throughout the genome or
concentrated in particular regions. Identifying such vari-
able regions could be useful both for faster characteriza-
tion of new PhopGV isolates and for looking whether
sequence variations in determined regions could be related
to differences in virus phenotypes. According to this pro-
cess, we then compared the sequence of the variable
regions in two virus isolates showing clear differences in
pathogenicity (LC
50
), one isolate (1346) originating from
P. operculella and the other (JLZ9f) from T. solanivora.
Materials and methods
Insect colonies
Colonies of P. operculella and T. solanivora were estab-
lished from larva-infested potato tubers from Cartago,
Costa Rica (named Pop-CR and Tsol-CR, respectively),
San Gabriel del Carchi, Ecuador (Tsol-EC), Villapinz
on,
Colombia (Tsol-CO), and Beni Sueif, Egypt (Pop-EG).
Rearing protocols were similar to those reported by
G
omez-Bonilla et al. (2011) and Espinel-Correal et al.
(2012). The insect populations were reared on potato
tubers under controlled conditions of 27 2 °C,
60 10% r.h., and L16:D8 photoperiod.
Virus (PhopGV) isolation and purication
The Tunisian isolate (named 1346) of PhopGV was used
as the reference isolate (GenBank: AF499596.1). In addi-
tion, four other PhopGV isolates were used for bioassays,
namely 1390-2 and 1390-3 (both isolated independently
from Peruvian P. operculella larvae; Vickers et al., 1991),
GV003 (isolated from Colombian T. solanivora larva;
Espinel-Correal et al., 2010), JLZ9f (isolated from Ecuado-
rian T. solanivora larva), and PhopGVCR1 (isolated from
Costa Rica unidentified potato tuber moth (PTM) larva;
G
omez-Bonilla et al., 2011). Viruses were amplified on
their respective host species through potato surface con-
tamination. Tubers were disinfected with sodium hypo-
chloride, rinsed in distilled water, air-dried, and then
contaminated using 100500 larval equivalents per l
(G
omez-Bonilla et al., 2011). Viral occlusion bodies
(OBs) were purified on continuous 3070% (wt/vol)
sucrose gradient and quantified as previously described,
using the following formula: 6.8 9 10
8
9 OD
450
9 dilu-
tion = number of granules ml
1
(Zeddam et al., 2003;
Carpio et al., 2012). Purified virus aliquots were stored at
20 °C until use.
Biological assays of virus isolates
Free export or import of some virus isolates was impossible
due to local regulations. The same restrictions applied to
insecthost populations. Accordingly, the only way to pro-
Phenotypic and genetic variations of PhopGV isolates 139
ceed was to follow a standardized biological test and apply
it in local laboratories. Not all virus/host population combi-
nations could be tested (Table 1). Bioassays were carried
out on neonate larvae (less than 12 h post-emergence) fol-
lowing a previously published protocol (Espinel-Correal
et al., 2010). Briefly, a known amount of OBs was evenly
sprayed onto the tuber skin. Dilutions of purified OBs in
distilled water were applied homogeneously (1 9 10
5
to
1 9 10
10
) by a pulverization method with a nebulization
chamber leading to final concentrations of 0.110
4
OBs
mm
2
on the potato tubers (Carrera et al., 2008). For con-
trols, only distilled water was sprayed. Then, batches of 10
25 potato tuber moth neonates were deposited on each
treated tuber (two potato tubers per concentration; larval
density was kept under one individual per 2 g of tuber).
Finally, larval mortality was recorded for at least five virus
doses and a control. At least five independent tests were set
up. Total numbers of individuals used in bioassays were
6975P. operculella (5 875 treated and 1 101 controls) and
2620 T. solanivora (2 149 treated and 471 controls).
Dose-response curves based on probit analysis (Finney,
1952) were established by a logistic regression and adjusted
by maximum likelihood using Polo Plus software (LeOra
Software, 1987). Alternative models (logit and comple-
mentary loglog models) were tested and compared using
the Akaike information criterion (Akaike, 1980), revealing
that the probit model best fit the data sets. Extra-binomial
distribution was also checked revealing no overdispersion
in the data sets. The software was used to estimate the virus
concentration killing 50% of the larvae tested (LC
50
), the
95% fiducial limits of the LC
50
, the slope of the concentra-
tion-mortality line, and the standard error of the slope. It
was also used to compare (at the significance level of 0.05)
the respective LC
50
obtained for different viral isolate/host
combinations. Polo Plus was also used to calculate the rela-
tive LC
50
ratios between virus isolates. Ratios with 95%
confidence intervals which include 1.0 indicate no signifi-
cant difference between them (Robertson & Preisler, 1992).
Molecular characterization of PhopGV isolates
Each virus isolate was amplified on its original host and
OBs purified as previously described (Espinel-Correal
et al., 2010). An aliquot of each isolate was used for molec-
ular characterization. Viral OBs were dissolved in 0.1 M
Na
2
CO
3
(pH 11). Viral genomes (DNA) were extracted
from OB-released virions using Wizard Genomic DNA
Purification kits (Promega, Madison, WI, USA). DNA was
digested by BamHI, SmaI, HindIII, NsiI, NruI, NdeI, HpaI,
DraIII, MluI, BstEII, and BstApI restriction enzymes fol-
lowing manufacturer’s recommendations and then elec-
trophoresed on 1% (wt/vol) agarose gel (TAE buffer)
along with a molecular weight marker to determine band
sizes. Regions exhibiting insertion/deletion features com-
pared to reference isolate 1346 were amplified by PCR
using Promega PCR Master Mix. Cycling parameters were
94 °C denaturation (3 min), 35 cycles of 94 °C (45 s),
55 °C(45s),72°C (1 min), followed by a final 72 °C
extension (10 min). Primers used were: POGV46F: 5′–AA
CCCTGAGGATCGCGAAACTAACGAAG3 (nt 40500
40527 of the reference isolate 1346); POGV46R: 5′–GTTT
CATCGTATGCGCGTCTTTTGGTTC3 (nt 41632410
605); POGV84F: 5′–ATGTAGACGCGTCGTTAACCTGG
GTGTA3 (nt 7207572102); POGV84R: 5′–ATGAACT
GTTAAACGGCTTGAGTGAGCG3 (nt 72882728055);
POGV129F: 5′–GCGATGATGAGAATGGGAATGTGAA
GAC3 (nt 116465116692); and POGV129R: 5′–TGCC
TGCTGTGCTCGACAACAATAGACC3 (nt 117401
117374). Amplicons were sequenced in both directions by
the dideoxynucleotide chain termination method (Sanger
et al., 1977) in an ABI 377 DNA sequencer and sequences
were aligned with Clustal X.
Nucleotide sequence data from the PhopGV isolate
JLZ9f partially encompassing ORFs PhopGV046, Phop-
GV083, PhopGV084, and PhopGV129 were deposited in
the GenBank under accession numbers JX101761,
JX170206, and HQ317403.1, respectively.
Results
Response of different geographic Phthorimaea operculella and Tecia
solanivora populations to the same PhopGV isolates
All data sets discussed below appeared to be homogeneous
in the effectivity of the virus against a given host species,
allowing further comparisons.
Response from Phthorimaea operculella populat-
ions. Neonates from two geographically separated
Table 1 Bio-assays carried out during the study testing six
Phthorimaea operculella granulovirus (PhopGV) isolates against
populations of Phthorimaea operculella and Tecia solanivora of
various geographic origin
Virus isolate
Host species
P. operculella T. solanivora
CR EG CO CR CO EQ
1346 ++ + +
1390.2 ++ + +
1390.3 ++
PhopGVCR1 ++ +
GV003 ++
JLZ9f ++
CR, Costa Rica; EG, Egypt; CO, Colombia; EQ, Ecuador.
140 Zeddam et al.
populations (Costa Rica and Egypt) were challenged with
threePhopGVisolatesfromP. operculella in standardized
bioassays (Table 2). Differences existed in the respective
pathogenicity of these isolates, their LC
50
varying from 1.6
to 17 OB mm
2
. P. operculella populations from Egypt
and Costa Rica responded equally to a same virus isolate
(either 1346, 1390-2, or 1390-3).
In conclusion, bioassays showed a remarkable similarity
of the LC
50
calculated for each given viral isolate indepen-
dently of the geographic origin of the host used in the
experiment. This was true for both highly pathogenic
(1390-2) and medium pathogenic (1346 and 1390-3)
isolates.
Response from Tecia solanivora populations. When
neonate larvae of T. solanivora were challenged either with
isolate 1346 or with isolate 1390-2, no significant
difference in pathogenicity was noticed between
T. solanivora populations originating from Costa Rica or
Ecuador (Table 2). It thus appeared that the LC
50
of the
isolates tested were constant in T. solanivora whatever
populations were considered. However, in these cases the
slopes were unequal, indicating that the two populations
reacted differently, although this could also be due to the
higher than usual heterogeneity between replicates.
Comparative pathogenicity of viral isolates JLZ9f and 1346 in
Phthorimaea operculella and Tecia solanivora
The pathogenicity of each isolate appeared to be signifi-
cantly different for each host species (Table 3). Two
well-split groups of virus isolates were found, as the
95% confidence intervals of relative potencies did not
include 1; so it was assumed that the LC
50
for the two
species were significantly different (Robertson & Preis-
ler, 1992). The first group (1390-2, PhopGVCR1, and
1346) was more pathogenic for P. operculella than for
T. solanovira larvae, the relative potency ranged from
0.14 to 0.28. For GV003 and JLZ9f, the LC
50
was lower
(i.e., the isolate exhibited higher pathogenicity) in
T. solanivora than in P. operculella larvae. This resulted
in relative potencies of 3.55 (GV003) and 2.47 (JLZ9f),
which were very different from the results obtained for
the other isolates tested. With the exception of Phop-
GVCR1 (whose original host could have been wrongly
identified), all isolates were more pathogenic to their
original host than to the secondary one.
Genotypic differences between JLZ9f and 1346
Identification of variable zones in PhopGV genome. Purified
genomic DNA of isolates 1346 (reference isolate whose
complete sequence has been published) and JLZ9f,
individually cut by 11 restriction enzymes, exhibited clear
differences in their respective restriction pattern (Figure 1,
Table 4). This was also the case for 1390-2 and 1390-3
(data not shown). Using the published nucleotide
sequence from isolate 1346, it was found that most of the
variation in JLZ9f concentrated within three particular
zones rather than being scattered all over the genome.
These variable zones were located in gene 129 (as
previously reported in Carpio et al., 2012) and open
reading frame (ORF) 46 and in the repeated region ORF 9.
For isolates 1390.2 and 1390.3, only gene 129 (and not
ORFs 46 and 84) differed in size from those of 1346.
Because JLZ9f exhibited more differences than the other
isolates tested when compared to the reference isolate
1346, it was chosen for a deeper characterization.
Table 2 Medium lethal concentrations (LC
50
) and fit of probit lines of Phthorimaea operculella granulovirus (PhopGV) isolates applied to
neonates of distinct geographic populations of Phthorimaea operculella and Tecia solanivora
Host Viral isolate Host origin (name) n LC
50
Probit line
95% confidence rangeSlope SE v
2
(d.f.) P
P. operculella 1346 Costa Rica (Pop-CR) 347 17.7
1
0.459 0.082 0.416 (2) >0.1 6.143.0
Egypt (Pop-EG) 451 16.0
2
0.598 0.080 0.063 (2) >0.1 7.029.2
1390-2 Costa Rica (Pop-CR) 382 2.1 0.505 0.050 0.121 (2) >0.1 1.03.7
Egypt (Pop-EG) 630 1.6 0.504 0.052 0.231 (3) >0.1 0.73.0
1390-3 Costa Rica (Pop-CR) 413 16.3 0.394 0.038 2.852 (3) >0.1 8.229.7
Egypt (Pop-EG) 630 14.4
1
0.417 0.047 0.452 (3) >0.1 7.128.7
T. solanivora 1346 Costa Rica (Tsol-CR) 413 46.2
1
0.492 0.055 2.290 (3) >0.1 22.190.4
Ecuador (Tsol-EC) 454 46.7 0.820 0.069 3.291 (7) >0.1 31.471.7
1390-2 Costa Rica (Tsol-CR) 245 12.6 0.542 0.052 9.667 (3) <0.05 1.544.3
Ecuador (Tsol-EC) 167 13.0 0.887 0.074 4.29 (1) <0.05 1.030.0
n, number of larvae assayed. The value of LC
50
is expressed in number of virus occlusion bodies mm
2
. Using Polo Plus software (LeOra
Software, 1987) 95% confidence ranges were determined.
Recalculated values using raw data from
1
G
omez-Bonilla et al. (2011) and
2
Carrera et al. (2008).
Phenotypic and genetic variations of PhopGV isolates 141
Sequences of variable zones between JLZ9f and 1346. PCR
amplifications of the JLZ9f genome, the most variable of
the three isolates, were carried out using primers
encompassing zones where variability was detected by
RFLP. Sequences of amplicons were compared to those of
isolate 1346. Within ORF 46 (located from nt 39303 to
41735 in 1346), the 30-nucleotide sequence G
AATCAA
CA
AATCAGTCTATAGCTCAATCA starting at nt 41525
is repeated three times in a row in 1346 and only twice in
JLZ9f (the three pentamers AATCA found in this sequence
are underlined). The resulting predicted protein is thus 10
amino acids shorter than the one in 1346. The two
deduced proteins align perfectly except at the level of
the gap.
At the end of repeat 9 (from nt 72699 to 72829), JLZ9f
has a 91 nt extra sequence compared to 1346:
AAATACAAAACTTGAAACAATTATTAAACTTGAAAC
AATTATTCGTTTATTTTAA
AAATACAAAACTTAAAC
AATTATTCGTTTATTTTAA.
Repeated motifs of this latter sequence are two 13-mers
AAATACAAAACTT (underlined), two 11-mers AAACAA
TTATT (bold), and two 12-mers CGTTTATTTTAA
(italic). The putative protein encoded by the flanking ORF
84, which marginally overlaps with repeat 9, is not affected
by the extra sequence present in JLZ9f.
Finally, within gene 129 (on the complementary strand
from nt 116818 to 118122), an additional 86 nt sequence
was found in JLZ9f, starting at nt 116861, but this
sequence is missing in 1346 (Carpio et al., 2012):
GTGTTTTCATTTTAAATCGCAACACCCGGTTTGTGT
ACCAAATTGCGCGACGATAAC TCTTCATTGGCAAA
TCGTTTATCACTTGT. This modification in the
Table 3 Comparison of the medium lethal concentrations (LC
50
), expressed as number of virus occlusion bodies mm
2
,ofPhthorimaea
operculella granulovirus (PhopGV) isolates applied to neonates of Phthorimaea operculella (Pop) and Tecia solanivora (Tsol)
Viral isolate (original host species) Host population name LC
50
Relative potency (Pop/Tsol) 95% confidence interval (Pop/Tsol)
1346 (Pop) Pop-EG 16.0
1
0.28 0.0950.845
Tsol-CR 46.2
2
1390-2 (Pop) Pop-EG 1.6 0.14 0.0450.422
Tsol-CR 12.6
GV003 (Tsol) Pop-CO 24.7
3
3.55 1.8686.728
Tsol-CO 6.9
3
PhopGVCR1 (Tsol) Pop-CR 17.7
2
0.25 0.1310.478
Tsol-CR 69.1
2
Pop-EG 16.9
2
0.24 0.1190.473
Tsol-CR 69.1
JLZ9f (Tsol) Pop-EG 31.8 2.47 1.1395.361
Tsol-EC 10.0
4
Using Polo Plus software (LeOra Software, 1987) 95% confidence intervals of relative potency were determined. Intervals which include 1
indicate no significant difference between virus isolates (Robertson & Preisler, 1992).
Data from
1
Carrera et al. (2008);
2
G
omez-Bonilla et al. (2011);
3
Espinel-Correal et al. (2010);
4
Carpio et al. (2012).
Figure 1 Restriction profiles of the genomes of two PhopGV
isolates (JLZ9f and 1346) digested by NruI, and a molecular
weight marker (M) with bands of 23130, 9416, 6557, 4361, 2322,
and 2027 bp. Molecular weights of bands only present in one of
the PhopGV isolates are indicated on the right side.
142 Zeddam et al.
Table 4 Comparison of DNA banding patterns obtained for two isolates of Phthorimaea operculella granulovirus (PhopGV) after digestion of their genome by 11 restriction endonucleases.
1 = isolate 1346; 2 = isolate JLZ9f; all values in base pairs; FN, no. fragments; =, fragment of same size; ‘-’, fragment not present
SmaI BamHI HindIII NsiI NruI MluI DraIII NdeI HpaI BstEII BstApI
1212121212121212121212
A 74610 76250 29906 = 22634 = 23160 = 18349 = 20354 = 19485 = 23302 = 25448 = 23243 = 22736 =
B 26308 = 17766 = 14177 = 19681 = 14772 = 18078 = 16565 = 18456 14500 13198 = 17896 = 18509 =
C 10830 = 11561 = 10705 = 16857 = 14325 = 10707 = 14344 = 18165 = 13025 = 16610 = 14368 =
D 7469 5830 10577 10300 8969 8700 9925 = 10034 12016 10542 =
12533 = 9829 = 11563 = 12351 = 11466 =
E 10129 = 7248 = 6498 = 9333 = 9762 = 12448 = 9010 = 8285 = 12281 = 10606 =
F 8725 = 7126 = 6420 = 7210 = 6309 = 11449 = 8131 = 7597 7800 7668 = 10152 =
G 7792 = 6275 6100 4830 = 6996 = 5749 = 11356 = 6746 6600 6623 = 6590 = 9308 =
H 7789 = 5736 5900 4751 = 6399 6300 4676 = 8409 = 6463 = 4333 = 6218 6400 9297 =
I 6114 6400 4627 = 4439 = 6104 6250 4670 = 4168 4070 5994 = 4077 = 4614 4450 2978 =
J 2901 = 4020 = 4434 = 5511 5450 4381 = 3385 3433 5376 = 4061
= 4267 4325 2770 =
J’ 4120
K 2805 = 3644 = 3020 = 4541 = 4191 = 2494 = 3348 = 4008 = 3470 = 2434 2550
L 943 = 3474 = 2771 2925 4294 = 3620 3410 2096 = 1929 = 3584 = 1984 = 1800 1850
M 870 = 3298 3250 2094 = 2350 = 2953 = 1342 = 3566 3350 1869 = 955 =
N 712 = 3216 = 2084 = 2129 = 2929 = 1126 = 3284 = 166 = 874 =
O 626 = 2476 = 1886 = 2109 = 2848 = 2283 = 579 =
P 2072 = 1536 = 1982 ‘-’ 2513 = 1294 = 265 =
Q 2036 = 1504 = 1067 =
1365 = 1003 = 107 =
R 1449 1500 1488 = 895 = 1174 = 456 = 9 =
S 1441 = 1343 = 627 = 722 = 351 =
T 1266 = 456 = 180 = 620 =
U 881 = 579 =
V 812 = 475 650
W 791 =
X 384 =
Y 324 =
Z89=
AA 47 =
FN 4 4 15 15 27 27 20 20 20 19 22 22 12 12 14 15 19 19 14 14 18 18
Phenotypic and genetic variations of PhopGV isolates 143
sequence likely results in a change in the size of the trans-
lated protein due to the presence of an alternative stop
codon. Sequence comparison indicated that the two vari-
ants of ORFs 84 and 129 present in JLZ9f give rise to larger
proteins than in the case of 1346.
Discussion
As a recognized biocontrol agent, PhopGV was the object
of numerous studies dealing with its structure and histo-
pathology (Lacey et al., 2011), genomic characteristics
(Vickers et al., 1991; L
ery et al., 1998; Zeddam et al.,
1999; Taha et al., 2000), and efficiency to limit host popu-
lations (Reed, 1971; Raman, 1994; Kroschel et al., 1996;
Sporleder & Kroschel, 2008; Moura Mascarin et al., 2010).
PhopGV-based biopesticides are used in different coun-
tries, mainly to control P. operculella larvae in potato stor-
age. Recent studies carried out in Colombia, Ecuador, and
Costa Rica have shown that PhopGV is also effective in
controlling T. solanivora larvae (Espinel-Correal et al.,
2010; G
omez-Bonilla et al., 2011). PhopGV is also patho-
genic to the South American tomato leaf miner, Tuta abso-
luta (Meyrick) (Angeles & Alc
azar, 1995; Moura Mascarin
et al., 2010; Carpio et al., 2012), which causes considerable
damage to field- and greenhouse-grown tomatoes in vari-
ous countries, including some recently invaded areas
(Spain, Morocco, and Turkey) (Desneux et al., 2010).
However, to our knowledge, the only study dealing with
the comparative susceptibility of geographic populations
of one of these hosts to PhopGV dates back to the 1980’s
(Briese & Mende, 1981).
The data presented in this article show that P. operculella
populations from Costa Rica and Egypt did not differ sig-
nificantly in their response to the PhopGV isolates tested.
The same was found for T. solanivora populations from
Costa Rica and Ecuador. These results were unexpected
because of the large geographic distance separating the
insect populations considered. They contrast with those of
Briese & Mende (1981), who reported a more than 11-fold
difference in susceptibility to a given PhopGV isolate
among 16 Australian P. operculella populations, but they
are in accordance with those from Asser-Kaiser et al.
(2007), who found similar LC
50
’s for susceptible Cydia po-
monella (L.) populations when challenged with a Mexican
isolate of Cydia pomonella granulovirus (CpGV-M).
CpGV-M-resistant populations exhibited at least 1000-
fold higher LC
50
’s. Our results suggest that with the
PhopGV isolates we tested, little variation in pathogenicity
is to be expected when applied to populations of P. oper-
culella or T. solanivora. More work involving other PTM
populations and virus isolates is needed to confirm
whether a single bioinsecticide formulation would exhibit
the same efficacy over a large range of host populations.
What could explain the discrepancy between our results
and those obtained by Briese & Mende (1981)? The
authors indicate that a PhopGV-resistance gene was pres-
ent in Australian P. operculella populations; hence, the
variability in susceptibility to PhopGV may be related to
variability in presence of this gene among individuals.
That susceptibility to PhopGV of either P. operculella or
T. solanivora did not differ among geographic populations
of the pest species is of relevance for biological control pur-
poses, allowing the development of standardized Phop-
GV-formulations to be used in all PTM-infected localities.
Our laboratory data require further validation in potato
storages all over PTM distribution areas. Emergence of
resistance due to selection by repeated application of a
given virus isolate cannot be excluded. Previous works
have established that GV-resistant populations of the cod-
ling moth, C. pomonella, emerged following repetitive
treatments using CpGV (Fritsch et al., 2005; Sauphanor
et al., 2006). Resistance development in the case of Phop-
GV, especially considering that a PhopGV-resistance gene
was identified in P. operculella (Briese & Mende, 1981), is
a possibility. CpGV resistance of C. pomonella was broken
by the use of other isolates (Eberle et al., 2008; Berling
et al., 2009). Many PhopGV isolates are presently available
(Vickers et al., 1991; Espinel-Correal et al., 2010; Moura
Mascarin et al., 2010; G
omez-Bonilla et al., 2011; Carpio
et al., 2012) and could represent a valuable resource for
preventing resistance. It is thus important to compare
their respective pathogenicity as well as to establish their
genetic characteristics.
The relative potency of PhopGV toward P. operculella
and T. solanivora larvae depended greatly on the isolates
considered. One isolate (1390-2) exhibited a more than
seven-fold higher LC
50
in P. operculella than in T. solani-
vora, another (1346) only showed a three-fold increase,
and two other isolates (GV003 and JLZ9f) were much
more pathogenic to T. solanivora than to P. operculella.As
these two isolates were originally collected from T. solani-
vora larvae found dead in the wild, a possible explanation
for the difference in pathogenicity could be a better adap-
tation of the virus to its original host, as previously sug-
gested (Espinel-Correal et al., 2010). However, this should
be verified by testing more isolates. Because of the absence
of a suitable artificial diet for the hosts, our bioassays relied
on a medical compressor/nebulizer-based device which
was standardized to evenly deposit known amounts of the
virus onto the tuber skin (Carrera et al., 2008), allowing
the comparison of results from different laboratories. This
protocol differs from the one used by other authors
(Kroschel et al., 1996; Sporleder et al., 2004, 2005, 2007;
Sporleder & Kroschel, 2008; Moura Mascarin et al., 2010)
144 Zeddam et al.
who contaminated tubers by submersion in virus solutions
containing a known number of homogenized PhopGV-
infected larvae. In the latter case, amounts of OBs retained
at the potato surface were not quantified. Thus, it was not
pertinent to compare the respective pathogenicity of virus
isolates on the basis of LC
50
values obtained using these
different protocols.
With a genome of about 120 kbp (GenBank accession
number AF499596.1), complete genome sequencing and
analysis of PhopGV isolates would be both costly and time
consuming. For this reason, identifying regions of higher
variability within the genome of PhopGV could provide a
fast and cost-effective way for characterizing the virus iso-
lates. Preliminary assays indicated that three regions of the
genome contained most of the variation in RFLP profiles
of 11 isolates (data not shown). Those regions encompass
part of ORF 46 (encoding for a hypothetical protein of
unknown function), repeat 9, and gene 129 (encoding for
the enzyme ecdysteroid UDP-glucosyltransferase; O’Reilly
& Miller, 1989). Until now, only ORF 84 (G
omez-Bonilla
et al., 2011) and gene 129 (Espinel-Correal et al., 2010;
Carpio et al., 2012) were identified as variable in some
PhopGV isolates, but ORF 46 or repeat 9 were
not. Although the 3 end of ORF 84 slightly overlaps with
the 5 end of repeat 9, the sequence variation we found
does not modify the predicted ORF 84 product, which
would then be the same for JLZ9f and 1346. A deeper anal-
ysis of the sequences published by G
omez-Bonilla et al.
(2011) showed a similar pattern for their isolate PhopGV-
CR1. Increasing the number of PhopGV isolates tested
may lead to the identification of new variable regions,
allowing a more precise discrimination between isolates.
However, the three regions described here provide a useful
tool for genotyping available PhopGV isolates at reason-
able cost. Focusing on the screening of the virus variation
in these regions allowed discrimination between isolates
by sequencing a few PCR products of limited size. The
method is simple, fast, and cost effective and might be used
to monitor virus isolates used in biocontrol programs.
From a practical point of view, results obtained here pro-
vide an interesting background for future studies dealing
with the development of PhopGV-based biopesticides for
the control of lepidopteran (gelechiid) pests.
Acknowledgments
The authors acknowledge the McKnight Foundation’s
Collaborative Crop Research Program (USA) for funding
part of the study. They are very grateful to the Colombian,
Costa Rican, Ecuadorian, and Egyptian farmer communi-
ties for their help during sample collections. C. E. C.
received a PhD fellowship from the Ecole des Mines d’Al
es.
Y. G-B. received a scholarship from the Spanish National
Institute of Agricultured Research (INIA), the Costa Rica
Ministry of Science and Technology (CONICIT-MICIT)
and INTA.
References
Akaike H (1980) Likelihood and the Bayes procedure. Bayesian
Statistics (ed. by JM Bernardo, H DeGroot, DV Lindley &
AFM Smith), pp. 143166. University Press, Valencia, Spain.
Angeles I & Alc
azar J (1995) Susceptibilidad de la polilla Scropi-
palpuloides absoluta al virus de la granulosis de Phthorimaea
operculella (PoVG). Revista Peruana de Entomolog
ıa 38:
6570.
Asser-Kaiser S, Fritsch E, Undorf-Spahn K, Kienzle J, Eberle KE
et al. (2007) Rapid emergence of baculovirus resistance in cod-
ling moth due to dominant, sex-linked inheritance. Science
317: 19161918.
Berling M, Blachere-Lopez C, Soubabere O, Lery X, Bonhomme
A et al. (2009) Cydia pomonella granulovirus genotypes over-
come virus resistance in the codling moth and improve virus
efficiency by selection against resistant hosts. Applied and
Environmental Microbiology 75: 925930.
Briese DT & Mende HA (1981) Differences in susceptibility to a
granulosis virus between field populations of the potato moth,
Phthorimaea operculella (Zeller) (Lepidoptera: Gelechiidae).
Bulletin of Entomological Research 71: 1118.
Carpio C, Dangles O, Dupas S, L
ery X, L
opez-Ferber M et al.
(2012) Development of a viral biopesticide for the control of
the Guatemala potato tuber moth Tecia solanivora.Journalof
Invertebrate Pathology 112: 184191.
Carrera MV, Zeddam J-L, Pollet A, L
ery X & L
opez-Ferber M
(2008) Evaluation of the per os insecticidal activity of baculovi-
ruses by a nebulization method. IOBC/WPRS Bulletin 31:
4043.
Cunningham JC (1995) Baculoviruses as microbial insecticides.
Novel Approaches to Integrated Pest Management (ed. by
R Reuveni), pp. 261292. Lewis, Boca Raton, FL, USA.
Dangles O, Carpio C, Barrag
an AR, Zeddam JL & Silvain JF
(2008) Temperature as a key driver of ecological sorting among
invasive pest species in the tropical Andes. Ecological Applica-
tions 18: 17951809.
Desneux N, Wajnberg E, Wyckhuys KAG, Burgio G, Arpaia S
et al. (2010) Biological invasion of European tomato crops by
Tuta absoluta: ecology, geographic expansion and prospects
for biological control. Journal of Pest Science 83: 197215.
Eberle KE, Asser-Kaiser S, Sayed SM, Nguyen HT & Jehle JA
(2008) Overcoming the resistance of codling moth against con-
ventional Cydia pomonella granulovirus (CpGV-M) by a new
isolate CpGV-I12. Journal of Invertebrate Pathology 98: 293
298.
Espinel-Correal C, L
ery X, Villamizar L, G
omez J, Zeddam J-L
et al. (2010) Genetic and biological analysis of Colombian
Phthorimaea operculella granulovirus (PhopGV) isolated from
Tecia solanivora (Lepidoptera: Gelechiidae). Applied and Envi-
ronmental Microbiology 76: 76177625.
Phenotypic and genetic variations of PhopGV isolates 145
Espinel-Correal C, L
opez-Ferber M, Zeddam J-L, Villamizar L,
G
omez J et al. (2012) Experimental mixtures of Phthorimaea
operculella granulovirus isolates provide high biological efficacy
on both Phthorimaea operculella and Tecia solanivora (Lepi-
doptera: Gelechiidae). Journal of Invertebrate Pathology 110:
375381.
Evans HF (1986) Ecology and epizootiology of baculoviruses.
The Biology of Baculoviruses, Vol. 2: Practical Application
for Insect Control (ed. by RR Granados & BA Federici),
pp. 89132. CRC Press, Boca Raton, FL, USA.
Fauquet CM, Mayo MA, Maniloff J, Desselberger U & Ball LA
(2005) Virus Taxonomy. Eighth Report of the International
Committee on Taxonomy of Viruses. Springer, New York, NY,
USA.
Finney DJ (1952) Probit Analysis. Cambridge University Press,
Cambridge, UK.
Fritsch E, Undorf-Spahn K, Kienzle J, Zebitz CPW & Huber J
(2005) Apfelwickler-Granulovirus: Erste Hinweise auf Unter-
schiede in der Empfindlichkeit lokaler Apfelwicklerpopulatio-
nen. Nachrichtenblatt des Deutschen Pflanzenschutzdienstes
57: 2934.
Fuxa JR (1991) Insect control with baculoviruses. Biotechnology
Advances 9: 425442.
Fuxa JR (2004) Ecology of insect nucleopolyhedroviruses. Agri-
culture, Ecosystems & Environment 103: 2743.
G
omez-Bonilla Y, L
opez-Ferber M, Caballero P, L
ery X & Mu
~
noz
D (2011) Characterization of a Costa Rican granulovirus strain
highly pathogenic against its indigenous hosts, Phthorimaea
operculella and Tecia solanivora. Entomologia Experimentalis
et Applicata 140: 238246.
Granados RR & Federici BA (1986) The Biology of Baculoviruses.
CRC Press, Boca Raton, FL, USA.
Huber J (1986) Use of baculoviruses in pest management pro-
grams. The Biology of Baculoviruses, Vol. 2: Practical Applica-
tion for Insect Control (ed. by RR Granados & BA Federici),
pp. 181202. CRC Press, Boca Raton, FL, USA.
Jehle JA, Blissard GW, Bonning BC, Cory JS, Herniou EA et al.
(2006) On the classification and nomenclature of baculovirus-
es: a proposal for revision. Archives of Virology 151: 1257
1266.
Kroschel J, Kaack HJ, Fritsch E & Huber J (1996) Biological con-
trol of the potato tuber moth (Phthorimaea operculella Zeller)
in the Republic of Yemen using granulosis virus: propagation
and effectivity of the virus in field trials. Biocontrol Science and
Technology 6: 217226.
Lacey LA & Goettel MS (1995) Current developments in micro-
bial control of insect pests and prospects for the early 21st cen-
tury. Entomophaga 40: 327.
Lacey LA, Hoffmann DF & Federici BA (2011) Histopathology
and effect on development of the PhopGV on larvae of the
potato tubermoth, Phthorimaea operculella (Lepidoptera:
Gelechiidae). Journal of Invertebrate Pathology 108: 5255.
LeOra Software (1987) POLO-PC. A User’s Guide to Probit and
Logist Analysis. LeOra Software, Berkeley, CA.
Lery X, Abol-Ela S & Giannotti J (1998) Genetic heterogeneity of
Phthorimaea operculella granulovirus: restriction analysis of
wild-type isolates and clones obtained in vitro. Acta Virologica
42: 13
21.
Moura Mascarin G, Batista Alves S, Rampelotti-Ferreira FT,
Ragassi Urbano M, Dem
etrio CGB & Delalibera I (2010)
Potential of a granulovirus isolate to control Phthorimaea oper-
culella (Lepidoptera: Gelechiidae). BioControl 55: 657671.
Moscardi F (1999) Assessment of the application of baculoviruses
for control of Lepidoptera. Annual Review of Entomology 44:
257289.
O’Reilly DR & Miller LK (1989) A baculovirus blocks insect
moulting by producing ecdysteroid UDP-glucosyl transferase.
Science 245: 11101112.
Puillandre N, Dupas S, Dangles O, Zeddam JL & Capdevielle-Du-
lac C (2008) Genetic bottleneck in invasive species: the potato
tuber moth adds to the list. Biological Invasions 10: 319333.
Raman KV (1994) Pest management in developing countries.
Advances in Potato Pest Biology and Management (ed. by GW
Zehnder, ML Powelson, RK Jansson & KV Raman), pp. 583
596. American Phytopathological Society Press, St. Paul, MN,
USA.
Reed EM (1971) Factors affecting the status of a virus as a control
agent for the potato moth Phthorimaea operculella (Zell.)
(Lep., Gelechiidae). Bulletin of Entomological Research 61:
207222.
Reed EM & Springett BP (1971) A granulosis virus of potato
moth. Australian Journal of Science 31: 300301.
Robertson JL & Preisler HK (1992) Pesticide Bioassays with
Arthropods. CRC Press, Boca Raton, FL, USA.
Sanger F, Nicklen S & Coulson AR (1977) DNA sequencing with
chain-terminating inhibitors. Proceedings of the National
Academy of Sciences of the USA 74: 54635467.
Sauphanor B, Berling M, Toubon J-F, Reyes M, Delnatte J &
Allemoz P (2006) Carpocapse des pommes: cas de r
esistance
au virus de la granulose en vergers biologiques. Phytoma 590:
2427.
Sporleder M & Kroschel J (2008) The potato tuber moth granulo-
virus (PoGV): use, limitations and possibilities for field appli-
cations. Integrated pest management for the potato tuber
moth, Phthorimaea operculella Zeller apotatopestofglobal
importance. Tropical Agriculture 20, Advances in Crop
Research 10 (ed. by J Kroschel & L Lacey), pp. 4971. Margraf
Publishers, Weikersheim, Germany.
Sporleder M, Kroschel J, Quispe MRG & Lagnaoui A (2004) A
temperature-based simulation model for the potato tuber-
worm, Phthorimaea operculella Zeller (Lepidoptera; Gelechii-
dae). Environmental Entomology 33: 477486.
Sporleder M, Kroschel J, Huber J & Lagnaoui A (2005) An
improved method to determine the biological activity (LC
50
)
of the granulovirus PoGV in its host Phthorimaea operculella.
Entomologia Experimentalis et Applicata 116: 191197.
Sporleder M, Cauti EMR, Huber J & Kroschel J (2007) Suscepti-
bility of Phthorimaea operculella Zeller (Lepidoptera: Gelechii-
dae) to its granulovirus PoGV with larval age. Agricultural and
Forest Entomology 9: 271278.
Taha A, Nour-El-Din A, Croizier L, Ferber ML & Croizier G
(2000) Comparative analysis of the granulin regions of the
146 Zeddam et al.
Phthorimaea operculella and Spodoptera littoralis granuloviruses.
Virus Genes 21: 147155.
Theilmann DA, Blissard GW, Bonning B, Jehle J, O’Reilly DR
et al. (2005) Baculoviridae. Virus Taxonomy. VIIIth Report of
the International Committee on Taxonomy of Viruses (ed. by
CM Fauquet, MA Mayo, J Maniloff, U Desselberger & LA Ball),
pp. 11291185. Elsevier, New York, NY, USA.
Vickers JM, Cory JS & Entwistle PF (1991) DNA characterization
of eight geographic isolates of granulosis viruses from the
potato tuber moth Phthorimaea operculella (Zeller) (Lepido-
ptera, Gelechiidae). Journal of Invertebrate Pathology 57:
334342.
Yearian WC & Young SY (1982) Control of insect pests of agri-
cultural importance by viral insecticides. Microbial and Viral
Pesticides (ed. by E Kurstak), pp. 387423. Marcel Dekker,
New York, NY, USA.
Zeddam JL, Pollet A, Mangoendiharjo S, Ramadhan TH &
L
opez-Ferber M (1999) Occurrence and virulence of a
granulosis virus in Phthorimaea operculella (Lep., Gelechiidae)
populations in Indonesia. Journal of Invertebrate Pathology
74: 4854.
Zeddam JL, Vasquez Sober
on RM, Vargas Ramos Z & Lagnaoui
A (2003) Producci
on viral y tasas del granulovirus usado para
el control biol
ogico de las polillas de la papa Phthorimaea oper-
culella y Tecia solanivora (Lepidoptera: Gelechiidae). Bolet
ın
de Sanidad Vegetal Plagas 29: 657665.
Phenotypic and genetic variations of PhopGV isolates 147
... Previously, PhopGV isolates of different geographical origins were characterized by restriction endonuclease (REN) analysis of genomic DNA preparations, which provided only a limited view of genetic variability among different virus isolates [5,9,[19][20][21]. On the other hand, PhopGV isolates differed in their biological activity against various hosts reported for PTM, T. absoluta and T. solanivora in laboratory bioassays [4,14,19], indicating that there are differences in the genome that are not reflected in REN analysis patterns. ...
... Previously, PhopGV isolates of different geographical origins were characterized by restriction endonuclease (REN) analysis of genomic DNA preparations, which provided only a limited view of genetic variability among different virus isolates [5,9,[19][20][21]. On the other hand, PhopGV isolates differed in their biological activity against various hosts reported for PTM, T. absoluta and T. solanivora in laboratory bioassays [4,14,19], indicating that there are differences in the genome that are not reflected in REN analysis patterns. Nevertheless, genotype mixtures could be identified by analysing submolar bands in DNA REN patterns of PhopGV isolates and were eventually confirmed by PCR and sequencing of particular regions of the viral genome [4,19]. ...
... On the other hand, PhopGV isolates differed in their biological activity against various hosts reported for PTM, T. absoluta and T. solanivora in laboratory bioassays [4,14,19], indicating that there are differences in the genome that are not reflected in REN analysis patterns. Nevertheless, genotype mixtures could be identified by analysing submolar bands in DNA REN patterns of PhopGV isolates and were eventually confirmed by PCR and sequencing of particular regions of the viral genome [4,19]. These sequenced gene regions comprised PhopGV ORF 46, repeat region 9 (between PhopGV ORF 83 and 84), the intergenic region between PhopGV ORF 90 and ORF 91, as well as ORF 129. ...
Article
Twelve complete genome sequences of Phthorimaea operculella granulovirus (PhopGV) isolates from four different continents (Africa, South America, Asia and Europe) were analysed after Illumina next-generation sequencing (NGS). The isolates have a circular double-stranded DNA genome that is 118 355 to 119 177 bp in length and all of them encode 130 open reading frames (ORFs). Analysis of single-nucleotide polymorphisms (SNPs) revealed a unique set of SNP positions for every tested isolate. The genome sequences of the investigated PhopGV isolates were classified into a new system of four (1-4) groups according to the presence of group-specific SNPs as well as insertions and deletions. These genome groups correlated with phylogenetic lineages inferred from minimum-evolution trees of the whole-genome consensus nucleotide sequences. All members of group 3 originated from the Mediterranean area, whereas the geographical origin and the group assignment did not correlate for isolates belonging to genome groups 1, 2 or 4. The high degree of coverage facilitated the determination of variant nucleotide frequencies. We conclude that the geographical isolates of PhopGV are genetically highly similar. On the other hand, they were rarely genetically homogenous and in most cases appeared to be mixtures of multiple genotypes.
... PhopGV isolates from different hosts presented variations in egt gene (Carpio et al., 2012;Zeddam et al., 2013). Although not demonstrated, changes in this or other encoding sequences would lead to an increased larval size to achieve a greater amount of viral progeny virus and ensure high horizontal transmission, or can induce changes in insect behaviour to achieve the same outcome (Cory, 2015). ...
... of T. solanivora to new regions, many studies comparing the biological activity of PhopGV isolates against P. operculella and T. solanivora have been reported(Espinel-Correal et al., 2012;Gómez-Bonilla, López-Ferber, Caballero, Léry, & Muñoz, 2011;Mascarin et al., 2010;Zeddam et al., 2013). The recent expansion of T. absoluta distribution area overlapping those of the two precedent species raised the question of the possible adaptation of virus isolates to this new host, providing a tool for its control. ...
Article
The tomato leafminer Tuta absoluta (Meyrick 1917) (Lepidoptera:Gelechiidae) is a devastating pest, causing losses of up to 100%. An interesting tool for its control is the use of the insect specific viruses of Baculoviridae family. Despite its high potential, its use on T. absoluta larvae has been poorly studied. In this work, Colombian granuloviruses VG013 and VG003 isolated from T. absoluta and Tecia solanivora (Lepidoptera:Gelechiidae) larvae sampled in tomato and potato crops, respectively, were morphologically, biologically and molecularly characterized. Occlusion bodies showed ovoid shape containing one nucleocapsid. Restriction endonuclease analysis revealed a pattern similar to Phthorimaea operculella granulovirus and bioinformatics studies showed that both isolates are variants of that baculovirus specie. Similar mean lethal concentrations (LC50) on T. absoluta larvae were estimated for both viruses, although VG013 exhibited shorter mean time to death than VG003. The latter reached a higher OBs yield in comparison with VG013. These results demonstrated an interesting potential of evaluated betabaculoviruses to control T. absoluta populations and pointed key features to its use under field conditions.
... Toutes ces méthodes, peu onéreuses pour les agriculteurs, contribueraient à ne pas mettre en danger leur santé, ni celle de ceux qui consomment leurs produits. On pourrait également ajouter à ces propositions le développement de la lutte biologique, au moyen de virus destiné à éliminer les ravageurs, qui a démontré son efficacité en Équateur ; Carpio et al. 2013; Zeddam et al. 2013. ...
Article
Full-text available
In Ecuador, the debate on the future of family farming is still very important because of the high vulnerability of peasant communities, particularly in the Andean region, and of the worrying food situation in rural areas. In this context, the fight against crop pests, identified by the FAO as a priority to reduce food insecurity of farmers in the South, appears to be a major challenge for farming communities of the Ecuadorian sierra. However, the success of this struggle still remains limited because of the weak coordination of the farmers. Based on fieldwork conducted in the province of Cotopaxi, this paper points out the determinants of the lack of collective action against crop pests as it opens a discussion on the need of a greater collaboration between environmental and social sciences in order to consider the most effective strategies to strengthen the farmers coordination in the fight against crop pests and to increase their food security.
... It is well established that different PhopGV isolates vary in their activity against different populations of P. operculella and alternate hosts [95][96][97][98]. PhopGV is able to infect other species of Gelechiidae, such as Tuta (Scrobipalpuloides) absoluta (Meyrick) and T. solanivora [99][100][101][102][103], and with the aim to find isolates also effective against these species, there is a renewed interest in characterization and evaluation of new isolates in several countries, in order to develop new biopesticidal products. ...
Article
Full-text available
Baculoviruses are known to regulate many insect populations in nature. Their host-specificity is very high, usually restricted to a single or a few closely related insect species. They are amongst the safest pesticides, with no or negligible effects on non-target organisms, including beneficial insects, vertebrates and plants. Baculovirus-based pesticides are compatible with integrated pest management strategies and the expansion of their application will significantly reduce the risks associated with the use of synthetic chemical insecticides. Several successful baculovirus-based pest control programs have taken place in Latin American countries. Sustainable agriculture (a trend promoted by state authorities in most Latin American countries) will benefit from the wider use of registered viral pesticides and new viral products that are in the process of registration and others in the applied research pipeline. The success of baculovirus-based control programs depends upon collaborative efforts among government and research institutions, growers associations, and private companies, which realize the importance of using strategies that protect human health and the environment at large. Initiatives to develop new regulations that promote the use of this type of ecological alternatives tailored to different local conditions and farming systems are underway.
Article
Full-text available
This study is part of a BMELV (German Federal Ministry for, Food, Agriculture and Consumer Protection) project on prevention of codling moth damage by long-term population control on large areas. Local codling moth (CM) populations were collected in autumn 2003 from three different orchards in the South of Germany; two of them having been treated with granulovirus of codling moth for many years and one since two years. In autumn 2004, in addition to the three locations from the previous year, specimens from populations in four other orchards with serious CM problems were collected. The susceptibility of the offsprings of the overwintering larvae to CpGV was investigated in the spring of the following year in bioassays on artificial diet and compared to a laboratory strain of the codling moth. The results indicated significant differences in sensitivity to the virus between the local codling moth populations. The LC50-values showed that two of the populations sampled in 2003 were more than thousand fold less susceptible than the third population and the laboratory strain. The results from the bioassays from the descendents of the diapausing larvae sampled in 2004 and 2005 confirmed the low susceptibility of two already in 2003 sampled populations and showed an up to thousand fold resistance also for the larvae from the new locations. For the time being, the problem of reduced sensitivity to the virus seems to be limited to a few orchards in Germany, the majority of orchards being not affected. Einleitung: Das Apfelwickler-Granulovirus (CpGV) wird im Ökologischen Obstbau schon seit über einem Jahrzehnt mit großem Erfolg eingesetzt. In den letzten Jahren wurde es auch im integrierten Anbau in den meisten Regionen Deutschlands zum festen Bestandteil der Apfelwicklerbekämpfung. Im Vordergrund der Strategien steht oft nicht nur die direkte Reduktion des Fruchtschadens, sondern auch die Reduktion der Population für die Folgegeneration.
Conference Paper
Full-text available
Precise evaluation of the biological activity of Baculoviruses by the usual droplet method is not appropriate for boring insect larvae that remain on plant surfaces for a limited time before penetrating the substrate. Alternative systems using surface contamination of the substrate (Potter tower, immersion) are often expensive and/or difficult to implement and are not always sufficiently reliable because they produce non homogeneous and non reproducible results. A new system was developed for evaluating precisely the biological activity of several granulovirus isolates on potato tuber moths. In this system. the spraying of viral suspensions was carried out by a Pulmo-Aide Sunrise® Compressor/Nebulizer usually used for the treatment of pulmonary infections. This system delivered small drops by the Venturi effect. PVC tubes directed the aerosol to the potato surface where it is deposited homogeneously. The system worked well in different locations where the atmospheric pressures were significantly different. To provide an internal control, we used samples of purified viral suspensions at appropriate dilutions mixed with Coomassie blue. Spectophotometer measurements of the optical density of the colorant deposited on the surface after nebulization showed that the reproducibility of the method was always greater than 95 %. This method is reliable, inexpensive and easy to use.
Article
Full-text available
The Guatemala potato tuber moth Tecia solanivora (Povolny) (Lep. Gelechiidae) is an invasive species from Mesoamerica that has considerably extended its distribution area in recent decades. While this species is considered to be a major potato pest in Venezuela, Colombia, and Ecuador, currently no specific control methods are available for farmers. To address this issue we developed a biopesticide formulation to be used in integrated pest management of T. solanivora, following three steps. First, search for entomopathogenic viruses were carried out through extensive bioprospections in 12 countries worldwide. As a result, new Phthorimaea operculella granulovirus (PhopGV) isolates were found in T. solanivora and five other gelechid species. Second, twenty PhopGV isolates, including both previously known and newly found isolates, were genetically and/or biologically characterized in order to choose the best candidate for a biopesticide formulation. Sequence data were obtained for the ecdysteroid UDP-glucosyltransferase (egt) gene, a single copy gene known to play a role in pathogenicity. Three different sizes (1086, 1305 and 1353 bp) of egt were found among the virus isolates analyzed. Unexpectedly, no obvious correlation between egt size and pathogenicity was found. Bioassays on T. solanivora neonates showed more than 14-fold differences in pathogenicity among the eight PhopGV isolates tested. The most pathogenic PhopGV isolate, JLZ9f, had a medium lethal concentration (LC(50)) of 10 viral occlusion bodies per square mm of consumed tuber skin. Third, we tested biopesticide dust formulations by mixing a dry carrier (calcium carbonate) with different adjuvants (magnesium chloride or an optical brightener or soya lecithin) and different specific amounts of JLZ9f. During laboratory experiments, satisfactory control of the pest (>98% larva mortality compared to untreated control) was achieved with a formulation containing 10 macerated JLZ9f-dead T. solanivora larvae per kg of calcium carbonate mixed with 50 mL/kg of soya lecithin. The final product provides an interesting alternative to chemical pesticides for Andean farmers affected by this potato pest.
Article
This is the standard and definitive reference for virus taxonomy, generated by the ICTV approximately every 3 years. The VIII ICTV Virus Taxonomy Report provides information on 3 orders of viruses, 73 families, 9 subfamilies, 287 genera and 1938 virus species, illustrated by more than 429 pictures and diagrams, most of them in color.
Book
This book is divided into 11 parts with the following headings: (I) introduction; (II) advances in potato pest biology and management: insects; (III) advances in potato pest biology and management: viruses and associated insect vectors; (IV) advances in potato pest biology and management: bacteria and fungi; (V) advances in potato pest biology and management: nematodes; (VI) pesticide resistance and resistance management; (VII) alternative management strategies for potato pests: cultural and biological control; (VIII) alternative management strategies for potato pests: host plant resistance; (IX) modeling and expert systems in potato pest management; (X) application of biotechnology in potato pest management; and (XI) potato pest management: a global view. It is concluded that the data, results and recommendations presented in this book provide valuable guidelines for evaluation and further experimentation in the fields of potato farmers all over the world.