Subgenomic Reporter RNA System for Detection of Alphavirus Infection in Mosquitoes

Article (PDF Available)inPLoS ONE 8(12):e84930 · December 2013with39 Reads
DOI: 10.1371/journal.pone.0084930 · Source: PubMed
Abstract
Current methods for detecting real-time alphavirus (Family Togaviridae) infection in mosquitoes require the use of recombinant viruses engineered to express a visibly detectable reporter protein. These altered viruses expressing fluorescent proteins, usually from a duplicated viral subgenomic reporter, are effective at marking infection but tend to be attenuated due to the modification of the genome. Additionally, field strains of viruses cannot be visualized using this approach unless infectious clones can be developed to insert a reporter protein. To circumvent these issues, we have developed an insect cell-based system for detecting wild-type sindbis virus infection that uses a virus inducible promoter to express a fluorescent reporter gene only upon active virus infection. We have developed an insect expression system that produces sindbis virus minigenomes containing a subgenomic promoter sequence, which produces a translatable RNA species only when infectious virus is present and providing viral replication proteins. This subgenomic reporter RNA system is able to detect wild-type Sindbis infection in cultured mosquito cells. The detection system is relatively species specific and only detects closely related viruses, but can detect low levels of alphavirus specific replication early during infection. A chikungunya virus detection system was also developed that specifically detects chikungunya virus infection. Transgenic Aedes aegypti mosquito families were established that constitutively express the sindbis virus reporter RNA and were found to only express fluorescent proteins during virus infection. This virus inducible reporter system demonstrates a novel approach for detecting non-recombinant virus infection in mosquito cell culture and in live transgenic mosquitoes.
Subgenomic Reporter RNA System for Detection of
Alphavirus Infection in Mosquitoes
J. Jordan Steel
1
, Alexander W. E. Franz
3
, Irma Sanchez-Vargas
1
, Ken E. Olson
1
, Brian J. Geiss
1,2*
1 Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, Colorado, United States of America, 2 Department of
Biochemistry and Molecular Biology, Colorado State University, Fort Collins, Colorado, United States of America, 3 Department of Veterinary Pathobiology,
University of Missouri, Columbia, Missouri, United States of America
Abstract
Current methods for detecting real-time alphavirus (Family Togaviridae) infection in mosquitoes require the use of
recombinant viruses engineered to express a visibly detectable reporter protein. These altered viruses expressing
fluorescent proteins, usually from a duplicated viral subgenomic reporter, are effective at marking infection but tend to
be attenuated due to the modification of the genome. Additionally, field strains of viruses cannot be visualized using
this approach unless infectious clones can be developed to insert a reporter protein. To circumvent these issues, we
have developed an insect cell-based system for detecting wild-type sindbis virus infection that uses a virus inducible
promoter to express a fluorescent reporter gene only upon active virus infection. We have developed an insect
expression system that produces sindbis virus minigenomes containing a subgenomic promoter sequence, which
produces a translatable RNA species only when infectious virus is present and providing viral replication proteins.
This subgenomic reporter RNA system is able to detect wild-type Sindbis infection in cultured mosquito cells. The
detection system is relatively species specific and only detects closely related viruses, but can detect low levels of
alphavirus specific replication early during infection. A chikungunya virus detection system was also developed that
specifically detects chikungunya virus infection. Transgenic Aedes aegypti mosquito families were established that
constitutively express the sindbis virus reporter RNA and were found to only express fluorescent proteins during virus
infection. This virus inducible reporter system demonstrates a novel approach for detecting non-recombinant virus
infection in mosquito cell culture and in live transgenic mosquitoes.
Citation: Steel JJ, Franz AWE, Sanchez-Vargas I, Olson KE, Geiss BJ (2013) Subgenomic Reporter RNA System for Detection of Alphavirus Infection in
Mosquitoes. PLoS ONE 8(12): e84930. doi:10.1371/journal.pone.0084930
Editor: John E. Tavis, Saint Louis University, United States of America
Received August 29, 2013; Accepted November 29, 2013; Published December 19, 2013
Copyright: © 2013 Steel et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was funded by National Institutes of Health grant #AI046435 to KEO and BJG. The funders had no role in study design, data collection
and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
* E-mail: Brian.Geiss@colostate.edu
Introduction
Alphaviruses are mosquito-borne pathogens that can cause
severe human and veterinary disease, several of which are
considered potential biological weapons [2,3]. Alphaviruses are
a major global health concern due to the widespread
prevalence of arthropod vectors and limited prevention and
treatment options for infection [4]. Alphavirus infection results in
a wide range of clinical symptoms, including fatal encephalitis
or long-term arthritis [2,4,5].
Defining how alphaviruses infect the mosquito vector and
transmit to mammalian hosts is an active area of study, but the
tools for monitoring alphavirus infection in mosquitoes have
largely relied on postmortem analysis or using recombinant
viruses engineered to express fluorescent or luminescent
proteins from duplicated subgenomic promoters (SGP) [6].
Although recombinant alphaviruses are useful tools in various
applications, this approach requires that an infectious clone of
the particular strain of virus be available and that the clone be
engineered to express a reporter protein suitable for use in the
study. Another complicating factor is that modifications to the
viral genome can increase the viral genome size by over 10%
and often leads to a reduction in viral replication kinetics that
attenuates virulence in the mammalian and/or arthropod hosts
[1,6-8] . These issues demonstrate that alternative approaches
for detection of wild-type alphavirus infection in mosquito cells
need to be developed to provide more physiologically relevant
data. A system that would allow live visual detection of SINV
infection in the mosquito vector would be a valuable tool for
further understanding the transmission and infection of
alphaviruses.
Alphaviruses (Family Togaviridae, genus alphavirus) are
positive strand RNA viruses with a genome size of ~12Kb
containing a 5’ RNA cap and a 3’ polyadenylated tail [9].
Sindbis virus is considered a prototypical alphavirus and has
been used extensively to understand alphavirus replication.
PLOS ONE | www.plosone.org
1 December 2013 | Volume 8 | Issue 12 | e84930
The 5’ two-thirds of the genome encodes a polyprotein of
nonstructural proteins (nsP) 1 through 4 that are required for
viral RNA replication. The nsP1-4 polyprotein is initially
translated from the viral genomic RNA to form the nsP1-2-3 /
nsP4 complex that produces a negative strand copy of the
genomic RNA. The nonstructural polyprotein is cleaved to
nsp1/nsP2/nsP3/nsP4 to form the positive strand replicase
complex, which produces new genomic RNAs. The positive
strand replicase complex also produces 26S RNAs from a
subgenomic promoter present on the negative strand RNA later
in infection [9]. The structural proteins are translated from the
26S subgenomic RNA to express capsid, E2, and E1
glycoproteins that form virus particles.
Production of the subgenomic 26S RNA is dependent on the
viral replicase complex binding to the 3’ end of the viral RNA
and synthesizing a negative sense RNA [9] . The requirement
for the viral nonstructural protein replication complex to express
proteins encoded on the subgenomic RNA provides a
mechanism for expressing foreign genes only during infection
(when the replication complex is present). By inserting the
subgenomic promoter sequence upstream of a reporter protein
(such as fluorescent proteins or luciferase enzymes), the
reporter will only be expressed when virus is actively replicating
within a cell, providing the replication complex in trans. The
alphavirus subgenomic promoter has been used in alphavirus
expression systems, which utilize a duplicated subgenomic
promoter to express a gene of interest concurrent with virus
replication [6,7,10]. These double subgenomic recombinant
alphaviruses are efficient at expressing reporters, but because
the reporter is inserted directly into the viral genome, this
approach is limited to virus strains with infectious clones and
applies an extra genetic load to the recombinant virus
replication. Instead of inserting the reporter into the viral
genome (11.7 kb), we inserted the reporter into the mosquito
genome (1.38 billion bp), which applies a reduced genetic
burden and allows detection of unlabeled, non-recombinant
wild-type viruses [11]. Inserting the reporter RNA into the cell
genome instead of the viral genome allows mosquito cells to
express the reporter RNA constitutively, and upon virus
infection, the subgenomic RNA can be synthesized and the
reporter protein translated. Olivo et al previously used a similar
system to express a luciferase protein in BHK cells during
Sindbis virus infection; however, their system was not designed
for mosquito cells and the use of luciferase did not allow for
visual detection of real-time infection [12-14]. Alphaviruses are
transmitted mainly by mosquito vectors and better tools are
needed to monitor transmission between mosquitoes and
vertebrate hosts. We have adapted the system described by
Olivo et al to function in mosquito cells. Although the luciferase
reporter functioned well in BHK cell culture, we sought to
develop a system that would produce fluorescence within
mosquitoes when infected by alphaviruses. A fluorescent
reporter was used instead of the luciferase to provide real-time
visual detection and avoid the difficulty of injecting mosquitoes
with luciferin in order to detect the luciferase reporter. The
fluorescent reporter protein provides a convenient way to
monitor infection as it progresses through the mosquito.
To visually track alphavirus infection in mosquitoes, we used
insect specific promoters to constitutively transcribe reporter
RNA constructs in mosquito cells. The reporter RNAs can be
replicated by transcomplementing viral proteins and produce a
fluorescent reporter protein only during infection. Here we show
the ability of our subgenomic reporter constructs to detect
alphavirus infection in mosquito cell culture and in transgenic
mosquitoes. These results represent the first time a replication-
competent alphavirus RNA has been launched from DNA in
mosquito cells and demonstrates a new method for detecting
alphavirus infection in mosquitoes.
Materials and Method
Plasmid Constructs
Reporter RNA constructs were engineered with the
baculovirus immediate early promoter (IE3) [15] for
transcription in C6/36 cell culture and the Ae. aegypti poly-
ubiquitin (PUb) promoter [16] to transcribe the reporter RNA in
transformed Ae. aegypti mosquitoes. The reporter constructs
were developed from SINV sequences using the TE3’2J/TR339
strain of Sindbis and from SINV replicon pBG254 and pBG60
previously described [17,18]. The 5’ and 3’ UTR sequences
were included from SINV (5’ end to the start of the
nonstructural protein and the 3’ end from the c-terminus of E1
through the poly A tail). The first 143 residues of nsP1 were
inserted in frame with an enhanced Green fluorescent protein
(eGFP) gene followed by stop codons used to identify
transfected cells and stop translation initiated from the 5’ end of
the reporter RNA. We then inserted the subgenomic promoter
sequence followed by the mCherry gene, which will produce a
subgenomic RNA that mCherry can be translated from in the
presence of transcomplemented nsP1-4 proteins. 50
adenosine residues were added downstream of the 3’ UTR to
produce a polyadenylated end (pBG426) as previously
described [19].
eGFP was removed from pBG426 by BglII restriction enzyme
digest and the plasmid was re-ligated to produce plasmid
pBG446. Alternatively, eGFP was removed from pBG426 with
BglII and replaced with the antibiotic resistance gene
puromycin acetyltransferase (PAC) [20], which had been
amplified with primers containing BglII sites (BG661-
ATGCAGATCTTTCGTGAAGACCC and BG662-
CCTGAGATCTGGCACCGGGCTTGC). The PAC gene was
ligated into the BglII site, producing plasmid pBG461.
pBG460 was designed using the West African strain of
Chikungunya virus (CHIKV) 37997(pCHIK-37997–5GFP,
GenBank accession number EU224271) [21]. The CHIKV
sequence included identical regions (5’ UTR, nsP1, SGP) as
the SINV sequence (pBG426) and was synthesized by
GenScript. The CHIKV reporter sequence was amplified from
the synthesized plasmid using a reverse primer with a 5’ end
XhoI site and a forward primer with the 5’ end having 20bp
overlap with the 3’ end of the IE promoter (BG657-
GTTCATGTTGGATATTGTTTCATGGCTGCGTGAGACACAC
G and BG658-CGGGCCCTCAAGACTCGAG ). The IE
promoter was amplified with a forward primer containing a 5’
NheI site and reverse primer with 5’ overlap of the 5’ CHIKV
Subgenomic Reporter RNAs for Alphavirus Detection
PLOS ONE | www.plosone.org 2 December 2013 | Volume 8 | Issue 12 | e84930
UTR (BG655-GTCGGGTCCATTGTCCGTGTG and BG656-
CGTGTGTCTCACGCAGCCATGAAACAATATCCAACATGAA
C). The two PCR products were the templates for fusion PCR
for 10 rounds followed by addition of primers BG655 and
BG658 for 30 more cycles. The resulting full-length fragment
was ligated into the NheI and XhoI sites in pBG426.
Additional subgenomic promoters from Western equine
encephalitis virus (WEEV)) (pBG447) or CHIKV (pBG448) were
inserted into pBG446 by ligating a virus specific SGP/mCherry
PCR product into the XbaI site. The WEEV and CHIKV SGPs
were amplified with forward primers containing 5’ XbaI sites
(BG582- TACATCTAGACTCTACGGCTGACCTAAATAGG and
BG581- TACATCTAGACTGTACGGTGGTCCTAAATAGG).
The reverse primer annealed to the 3’ end of mCherry and had
a 5’ XbaI site (BG576-
ATATTCTAGACTACTTGTACAGCTCGTCCATGC).
The IE3 promoter was replaced with the Ae. aegypti poly
ubiquitin promoter (PUb) [16] and inserted into the transposon
backbone containing the 3xP3 promoter and an eGFP gene for
mosquito transgenesis [22]. The IE3 promoter was replaced
with the PUb promoter through overlapping PCR amplification.
The SINV reporter construct was amplified with a forward
primer containing 5’ 19bp overlap with the PUb and a reverse
primer with a terminal AscI site (BG 671-
GCAAAGGCAAAACCAGCTCATTGACGGCGTAGTACACAC
and BG 675-CTGGCGCGCCGCCCTCAAGACTCGAG ). The
PUb fragment was amplified with a forward primer containing a
5’ AscI site and a reverse primer with 5’ 20bp overlap with the
beginning of the reporter construct. (BG669-
CTGGCGCGCCTATCTTTACATGTAGC and BG670-
GTGTGTACTACGCCGTCAATGAGCTGGTTTTGCCTTTGC).
The two PCR fragments were fused for 10 rounds, then
primers BG669 and BG675 were added to amplify the fusion
PCR product. The PCR product and destination plasmid were
digested with AscI and ligated into the transposon backbone
(pMos[3xP3-eGFPaf]) resulting in pBG471 [22]. All clones were
verified with sequencing.
Cell Culture, Transfection, and Viruses
C6/36 Aedes albopictus cells were grown in 6-well cell
culture plates with L-15 media containing 10% FBS, 100U/ml
penicillin/streptomycin, and 5% NaHCO3. Cells were
maintained in a 28°C incubator. C6/36 cells were transfected
with Mirus 293T transfection reagent following manufacturer’s
protocols for 1µg DNA. 12 hours post transfection; the cells
were infected with SINV at an MOI of 10. At 36-48 hours post
infection, the cells were examined for mCherry expression.
Stable reporter expressing cells were selected with 2µg/ml of
Puromycin and drug was replaced every 3-4 days.
TE3’2J SINV virus stocks for in vitro infections were
produced from plasmid transfection into Baby Hamster Kidney
(BHK) cells [8] . MRE16 5’ds GFP and MRE16 5’ds were
generated from infectious clones [23,24]. Chikungunya virus
(La Reunion strain LR2006-OPY-1) and Western Equine
Encephalitis virus (McMillian strain) infections were performed
in biosafety level 3 [25,26]. The CHIKV LR strain was used
because we had access to an infectious clone containing a 5’
duplicated subgenomic promoter and GFP gene for visual
detection of infection. Sindbis and West Nile virus (Kunjin
subtype) (KUNV) infections were performed at biosafety level 2
[27]. 24 hours after plating cells or 12 hours post transfection,
cells were infected by replacing media and adding in sufficient
amounts of virus for desired MOI.
Fluorescence quantification
Fluorescent images were acquired with a Nikon Diaphot 200
inverted fluorescent microscope. Images were analyzed and
fluorescence was quantified using Image J software [28,29].
Specifically, images were separated to RGB color channels.
The red or green stack was selected and the threshold was
adjusted to detect only fluorescent cells that were brighter than
negative controls. Following the threshold adjustment,
fluorescent cells were analyzed for pixel counts, total area,
average size, area fraction, and integrated density. Relative
fluorescence corresponds to integrated density (intDen) value.
Fold change in fluorescence was determined by dividing intDen
values of infected images by the uninfected control.
RNA and Protein quantification
RNA was extracted using Trizol reagent as previously
described [30] . Northern Blots to detect RNAs were performed
with DIG-labeled RNA probes (Roche DIG Northern kit) specific
for the mCherry gene in the reporter and subgenomic RNA
[31]. qRT-PCR was performed using the Brilliant III Ultra-Fast
SYBR Green QPCR kit (Stratagene, Agilent Technologies) with
primers corresponding to the mCherry gene. Total protein was
extracted from triturated mosquitoes in PBS. Primary rabbit
anti-GFP antibody (Cat#ab290, Abcam, Cambridge, MA) or
mouse anti-mCherry antibody (ab125096, Abcam, Cambridge,
MA) were used to detect GFP and mCherry in western blot
assays. Secondary goat polyclonal antibodies conjugated to
horseradish peroxidase that are anti-rabbit (anti-rabbit,
Cat#ab97051; anti-mouse; Cat#ab97023 Abcam, Cambridge,
MA) were used to detect primary antibodies. Northern and
Western blots were imaged using a Chemidoc XRS for
chemiluminescent detection with HRP peroxide/luminol
(Thermo-Scientific, Rockford IL) and CDP-Star (Sigma-Aldrich,
St. Louis MO).
Aedes aegypti transformation
Aedes aegypti mosquitoes from the Higgs White Eye Strain
(HWE) [32] were hatched and allowed to mature to adulthood.
Females were given a bloodmeal consisting of defibrinated
sheep’s blood (Colorado Serum Company. Denver, CO) 4 days
before oviposition. On the day of injection, females were
presented with an oviposition paper inside a 50ml conical tube,
and eggs were collected for injection [33]. 1,736 eggs were
injected at the posterior pole with plasmid pBG471 (Mariner
Mos1 and reporter construct) and a helper plasmid containing
the mariner transposase gene using an Eppendorf FemptoJet
injector [34]. Following injection, eggs were returned to
oviposition paper for 4-5 days to mature. The 327-hatched
larvae (18% survival) were grown and separated into individual
containers as pupae. The emerged adults were pooled
together into 65 families depending on gender (1 male with 15
HWE wild-type (wt) females, or 12 female with 3 HWE wt
Subgenomic Reporter RNAs for Alphavirus Detection
PLOS ONE | www.plosone.org 3 December 2013 | Volume 8 | Issue 12 | e84930
males). Each of the 65 families was bloodfed three times and
eggs were collected. The eggs were hatched and screened for
eGFP expression in the eyes of the larvae on a fluorescent
dissecting microscope. Nine families contained positive larvae
and were outcrossed with HWE for 3 generations then were
intercrossed for subsequent generations. Two families did not
produce viable offspring, but the remaining 7 lines were stable
through at least 10 generations. Each generation is screened
for positive GFP eye expression as a marker for the presence
of the transposon.
Mosquito infections
7-14 day old mosquitoes were orally infected with a blood
meal containing GFP-expressing SINV (MRE16 5’dsGFP) [8].
Virus for bloodfeeds was prepared by infecting Vero cells with
the respective virus 36-48 hours prior to bloodfeeds [35,36].
The virus was collected prior to feeding by scraping cells,
centrifuging supernatant, removing media to desired volume
(5mls) and then mixed with 5 ml sheep’s blood and 1 ml ATP
[37]. Mosquitoes were fed through an artificial glass feeder with
hog’s gut as the membrane. Bloodfed mosquitoes were
separated and maintained following the feeding and the
bloodmeal was titered to verify virus titers. Mosquitoes
engorged with a bloodmeal were assumed infected, and at 7dpi
and 14dpi the mosquitoes were screened for GFP (infection)
and mCherry (reporter of infection) using a dissecting
fluorescence microscope. Midguts were dissected from whole
mosquitoes to examine reporter protein expression within
internal tissues. Alternatively, whole mosquitoes were
triturated, supernatant was filtered through 0.2uM syringe filter,
and samples were assayed for virus titers by plaque assay
[30].
Results
Rationale for design of Sindbis virus subgenomic
reporter constructs
Sindbis virus infection was detected by utilizing the viral
subgenomic promoter to induce synthesis of a subgenomic
RNA expressing mCherry only during active virus replication.
Plasmids were engineered to contain alphavirus RNA elements
(5’ UTR, SGP, 3’ UTR) with reporter proteins replacing the viral
proteins. The 5’ end of the reporter genome was aligned with
the transcription start site of the DNA pol II baculovirus IE
promoter to allow full-length reporter RNAs to be transcribed in
mosquito cells [8] . The 5’ and 3’ UTRs were maintained to
allow the reporter RNA to be replicated in the presence of viral
non-structural proteins [38,39]. The nonstructural proteins were
removed from the 5’ open reading frame, except for the first
143 amino acids of nsP1 which contain conserved sequence
elements required for RNA replication [9] (Figure 1). Initial
constructs contained an eGFP gene fused to the nsP1
fragment that allowed for visual detection of cells expressing
the full-length reporter RNA (Figure 1 and 2). The structural
proteins, which are encoded from a subgenomic RNA at the 3’
end of the genome, were replaced with a mCherry fluorescent
protein under control of the subgenomic promoter. The IE
promoter drives expression of the reporter RNA in transfected
cells which was evident by visual detection of eGFP expression
(Figure 2A). Open reading frames located at the 3’ end of the
genome cannot be translated from the full length reporter RNA
due to stop codons upstream of the subgenomic promoter.
Transcription from the subgenomic promoter, which is initiated
by the nonstructural protein replication complex, generates a
short subgenomic RNA that is competent for mCherry
translation. The full-length reporter RNAs do not contain the
open reading frames for the nonstructural proteins, so the
reporter RNA can only be replicated and produce a
subgenomic RNA only when replication competent virus infects
the cell and provides the nsP1-4 proteins in trans. The infecting
virus translates its own nonstructural replication complexes,
which bind to the full-length reporter RNAs already present in
the cell and replicates the reporter RNA. The subgenomic RNA
is transcribed from the negative strand copy of the replicating
full-length reporter RNA, and the fluorescent mCherry protein is
translated from the newly synthesized subgenomic RNA
(Figure 1B).
Reporter RNA constructs can detect infection in
mosquito cells
Reporter RNA expressing plasmids transiently transfected
into Aedes albopictus C6/36 cells show eGFP expression
within 6 hours after transfection, indicating transcription of the
reporter RNA is occurring within the transfected cells. The low
number of eGFP positive cells reflects the low transfection
efficiencies we commonly observe with C6/36 cell transfection.
mCherry expression is not observed in uninfected cells,
whereas mCherry fluorescence can be observed following
infection with Sindbis virus (Figure 2A). Interestingly, we
observed that cells that strongly expressed eGFP tended to
have reduced mCherry expression upon infection, and
conversely observed that cells expressing low levels of eGFP
tended to display higher levels of mCherry following infection.
mCherry fluorescence was quantified from images collected at
given time points and multiplicity of infections. Significant
expression of the reporter was detected with a virus MOI of as
little as 0.02 at 36 hrs post infection and infection with an MOI
of 10 provided significant mCherry fluorescence at 3 hours post
infection (Figure 2B and 2C). These results indicate that
infectious Sindbis virus can provide the replication complex in
trans to activate the subgenomic promoter on reporter RNAs
and express subgenomic RNA encoded proteins. We removed
the eGFP to simplify the system (pBG446), and consistently
observed mCherry expression during SINV infection but not in
the absence of SINV (data not shown). Therefore, this system
is able to visually detect SINV infection in cultured mosquito
cells.
Reporter RNA expression is virus specific
To determine if activation of the subgenomic promoter on the
reporter constructs is virus specific, we tested if related
alphaviruses or unrelated flaviviruses could activate the Sindbis
virus subgenomic promoter. C6/36 cells were transfected with
pBG446 and infected with different viruses. mCherry
expression was visually detected by fluorescence microscopy
at 36 hours post infection (MOI 10) and fluorescence intensity
Subgenomic Reporter RNAs for Alphavirus Detection
PLOS ONE | www.plosone.org 4 December 2013 | Volume 8 | Issue 12 | e84930
was calculated. Infection with two strains of SINV (TE and
MRE) resulted in a significant increase in mCherry expression,
indicating that the detection was not strain specific (Figure 3A).
However, infection with a flavivirus (KUNV) or a New World
alphavirus (WEEV) [40] did not result in detectible mCherry
expression (Figure 3A). Old World Chikungunya virus (CHIKV)
was able to induce expression of mCherry, although to a lesser
extent than Sindbis virus infection. This confirms that the viral
replication complex has specificity for binding to the reporter
RNA sequences, likely the 5’ or 3’ UTR in conjunction with the
SGP, and that some cross-reactivity can be observed between
related alphaviruses [38,39].
The subgenomic promoter is not sufficient to induce
subgenomic RNA synthesis
To determine if this system could detect a broad range of
alphaviruses, an additional subgenomic promoter was inserted
behind the SINV SGP. Theoretically, a reporter system with
multiple SGPs from different viruses would be able to detect
infection of any of the viruses. The WEEV or CHIKV
subgenomic promoter sequence was added 3’ to the SINV
subgenomic promoter in the SINV construct (pBG447 and
pBG448- Figure 1). C6/36 cells transfected with pBG447 or
pBG448 and infected with WEEV or CHIKV respectively, did
not result in significant expression of mCherry (Figure 3B).
However, a construct that was engineered and developed
entirely based on CHIKV sequences showed detectable
amounts of mCherry fluorescence during CHIKV infection but
not with other viruses (Figure 3B). These results indicate that
virus specific 5’ UTR, 3’ UTR, and subgenomic promoters are
all required for the production of the 26S RNA from the reporter
RNA and subsequent protein expression.
Stable cell line expressing reporter RNA
To determine if mosquito cells could be stably transformed to
express alphavirus reporter RNAs, C6/36 cells were
transfected with reporter constructs containing a puromycin
acetyltransferase (PAC) gene (pBG461- Figure 1) and
transfected cells were selected with puromycin. A bulk stable
cell line was established that expressed the reporter RNA and
detectable amounts of mCherry reporter protein only when
infected with SINV but not in untransfected C636 or uninfected
control cells (data not shown). Reporter detection was
significantly higher with the stable cell line (pBG461) than
transient transfection (pBG446) during SINV infection (Figure
4A and 4B). Infections were performed with a recombinant
double subgenomic sindbis virus that expresses eGFP (SINV-
GFP) to visually track infection (green) and confirm the reporter
(red). Interestingly, cells that are not highly infected (low
amounts of SINV-GFP) tend to have higher reporter mCherry
expression. Although the entire stable cell line is resistant to
puromycin, indicating that all cells are transformed with our
construct, only 5-6% of infected cells expressed detectable
amounts of mCherry (Figure 4C). This implies that there is an
intricate balance of reporter RNA and infection that needs to be
achieved in order for the reporter to be detected. The cell line
has been maintained for over 18 months, with consistent ability
to detect SINV infection (data not shown). These results
Figure 1. Diagram of Subgenomic reporter RNA constructs. A) Transcription of each reporter RNA is initiated from the
baculovirus IE promoter (IE), with 5’ UTR, 3’ UTR, and subgenomic promoter sequences derived from SINV (pBG426, 446, 447,
448, and 461) or CHIKV (pBG460). All constructs include the first 143 residues of nsP1 to provide conserved RNA sequence
elements and 50 adenosines at the 3’ terminus. pBG426 encodes eGFP fused to nsP1 for detection of transfected cells expressing
the reporter RNA. pBG446 does not contain GFP and is a simplified construct compared to pBG426. pBG447 and 448 have an
additional virus specific (WEEV or CHIKV) subgenomic promoter inserted downstream of the SINV SGP. pBG461 contains the
puromycin acetyltransferase gene fused to nsP1 for selection in stable cell lines. pBG460 is a CHIKV specific reporter construct
engineered directly from CHIKV sequences. B) Diagram of reporter RNA replication and mCherry expression.
doi: 10.1371/journal.pone.0084930.g001
Subgenomic Reporter RNAs for Alphavirus Detection
PLOS ONE | www.plosone.org 5 December 2013 | Volume 8 | Issue 12 | e84930
indicate that reporter RNAs can be stably expressed in
mosquito cells and detect alphavirus RNA replication.
Development of Reporter RNA Expressing Transgenic
Aedes aegypti Mosquitoes.
Based on our in vitro results it seemed likely that this system
could be used in mosquitoes to detect specific alphavirus
infections. We developed transgenic mosquitoes that express
SINV reporter RNAs and can express mCherry in response to
infection in vivo. We utilized the Mariner transposon system
(Mos1) to establish transgenic Ae. aegypti mosquitoes [41-44].
We replaced the IE3 promoter with an Ae. aegypti poly
ubiquitin promoter (PUb) to provide more stable expression
throughout the mosquito midgut than has been observed with
the IE3 promoter [16]. The poly ubiquitin promoter construct
(pBG471, Figure 5A) worked in vitro similar to the previous IE3
construct (pBG446) (data not shown). The transposon
contained an eye-specific 3xp3 promoter that expressed eGFP
in eyes to identify transgenic mosquitoes [22] . The reporter
RNA sequence was inserted into the mariner transposon,
which was co-injected with a helper plasmid expressing the
mariner transposase [45] into 1,736 pre-dermoblast mosquito
embryos. 327(18%) of the injected eggs were viable and
hatched, were individually raised, screened for the eGFP eye
marker, and outcrossed with wild type Higgs White Eye (HWE)
Figure 2. Expression of Alphavirus Reporter RNAs in SINV Infected Cells results in mCherry Production. C6/36 cells were
transfected with pBG426 and subsequently infected with pBG167 TE3’2J SINV for 36 hrs. A) Brightfield, GFP, and mCherry
fluorescence was determined for each sample. Uninfected (top) and infected (bottom). B) Fluorescence increase with different MOIs
of SINV. C6/36 cells were transfected with pBG446 and infected for 36 hrs at the indicated MOI. Images were collected from each
experimental well and the mCherry fluorescence was quantified. C) Increased fluorescence with increased infection times. C6/36
cells were transfected with pBG446 and infected at MOI = 10. Images were collected at the indicated times and fluorescence
quantified.
doi: 10.1371/journal.pone.0084930.g002
Subgenomic Reporter RNAs for Alphavirus Detection
PLOS ONE | www.plosone.org 6 December 2013 | Volume 8 | Issue 12 | e84930
Figure 3. Sindbis subgenomic reporter detects infection with different SINV strains and similar old world alphaviruses, but
not new world alphavirus or flavivirus infections. A) C6/36 cells were transfected with pBG446 and then infected with different
viruses (SINV (TE3’2J strain), SINV (MRE16 strain), CHIKV (La Reunion strain), WEEV (McMillan strain), and West Nile (Kunjin
subtype). B) Virus-specific subgenomic promoter constructs for WEEV and CHIKV (pBG447 and pBG448), pBG446 (SINV specific),
and pBG460 (CHIKV specific) were transfected into C6/36 cells and subsequently infected with SINV, CHIKV, WEEV, or uninfected
mock control. All Images were taken at 36hrs post infection and mCherry fluorescence was quantified.
doi: 10.1371/journal.pone.0084930.g003
Subgenomic Reporter RNAs for Alphavirus Detection
PLOS ONE | www.plosone.org 7 December 2013 | Volume 8 | Issue 12 | e84930
Ae. aegypti mosquitoes. Each of the sindbis-induced mCherry
(SIM) transgenic mosquito lines was separately hatched,
screened, and females were bloodfed to maintain transgenic
populations. Transgenic lines were verified by consistent eye
specific eGFP expression and detection of the reporter DNA in
the mosquito genomic DNA (Figure 5A).
Sindbis virus can activate reporter RNAs in transgenic
mosquitoes
To test if Sindbis infection could activate the subgenomic
reporter RNA in the transgenic lines, we infected the transgenic
mosquitoes with an eGFP expressing SINV (MRE16 5’dsGFP)
by feeding female mosquitoes a bloodmeal containing 7 logs of
infectious virus [36,46]. Visibly engorged mosquitoes were
collected after the bloodmeal and kept for 4, 7, or 14 days post-
infection. At the indicated times mosquitoes were cold
anesthetized and eGFP and mCherry expression was
assessed under a dissecting fluorescence microscope.
Mosquitoes that were visibly infected with the SINV-GFP were
sacrificed and dissected midguts were imaged. We were able
to detect mCherry expression in a fraction of infected
transgenic mosquitoes Approximately 2-4% of the SINV-
infected transgenic mosquitoes displayed detectable mCherry
expression. Similar low levels of reporter fluorescence was
detected in the stable C636 cell line, indicating that this system
needs to be further optimized to be effective at sensitive
diagnostics and modeling of infection. However, despite the
low level of reporter expression, mCherry fluorescence was
positively detected in bodies and midguts of a subset of
mosquitoes (Figure 5B, line SIM 177 shown). mCherry
expression by fluorescence or Western blot was never
observed in uninfected mosquitoes, indicating that reporter
RNA activation and mCherry expression was specific to SINV
infection.
Figure 4. Stably Transformed C6/36 cells express reporter mCherry during SINV infection A). Brightfield, GFP, mCherry, and
overlay images are shown from SINV-GFP infected C636 cells that are pBG446 transiently transfected (top) or pBG461 stably
selected cells (bottom). Infected with an MOI of 10. Images collected at 48hours post infection. B) Average mCherry fluorescence is
significantly higher in pBG461 stably transformed C6/36 cells than transiently transfected cells. C) Averages of total red
fluorescence was calculated as a percent of total green fluorescence and is displayed for pBG446 transfected, pBG461stably
selected, or C636 mock cells.
doi: 10.1371/journal.pone.0084930.g004
Subgenomic Reporter RNAs for Alphavirus Detection
PLOS ONE | www.plosone.org 8 December 2013 | Volume 8 | Issue 12 | e84930
Discussion
This report describes a novel approach for detecting and
monitoring Sindbis virus infection in mosquito cell culture and in
live Ae. aegypti mosquitoes. We have developed a reporter
RNA system that expresses an engineered alphavirus RNA in
mosquito cells that only produces a subgenomic RNA and
reporter protein in the presence of actively replicating
alphaviruses. Initial work by Olivo et al. designed a reporter
RNA system that expressed luciferase in BHK cells [12]. We
have modified their method to be more applicable for studying
alphaviruses in the natural mosquito vector and provide a way
to visually track infection with a fluorescent reporter. This new
system allows for rapid and simple visual detection of wild-type
alphaviruses in mosquito cells. Transiently transfected or stably
selected C6/36 cells expressing reporter RNAs expressed
significant levels of reporter genes during infection and were
only activated by related alphaviruses. Transgenic Ae. aegypti
mosquitoes expressing a SINV reporter RNA were sensitive to
replicating SINV, which triggered mCherry expression. This
indicates that subgenomic reporter RNAs can diagnose
alphavirus infections in live mosquitoes.
Figure 5. Transgenic Aedes aegypti express mCherry following SINV infection. Verification of transgenic mosquitoes. A)
Green eye marker for transgenesis in SIM mosquito line and Reporter DNA in transgenic mosquitoes. Genomic DNA was extracted
from whole mosquitoes and used as template in PCR reaction with primers directed to the nsP1 and the SINV subgenomic
promoter. The 600bp amplicon was present in SIM transgenic mosquitoes but not HWE mosquitoes. B) Transgenic Ae. aegypti
expressing the mCherry reporter during SINV infection. SIM 177 transgenic family (left) and Higgs White Eye wt (right) infected with
SINV-GFP are shown. 7 days post infection, images of dissected midguts with GFP (SINV) (top panels) and then the corresponding
mCherry reporter expression (bottom panels).
doi: 10.1371/journal.pone.0084930.g005
Subgenomic Reporter RNAs for Alphavirus Detection
PLOS ONE | www.plosone.org 9 December 2013 | Volume 8 | Issue 12 | e84930
The sensitivity and quick detection of the fluorescent
subgenomic reporter RNA system in cell culture provides
potential applications for diagnostic tests to quickly and
accurately identify virus infection. Standard diagnostics require
significant time and resources to identify an infecting virus.
With the subgenomic reporter RNA system, virus specific
constructs (SINV, CHIKV, WEEV) could be developed that
would express a visibly detectable fluorescent reporter during
specific viral infections within hours and with small samples,
providing a novel method for diagnosing alphavirus infections
The species of alphavirus that activated the reporter RNAs
was relatively narrow. The SINV reporter RNAs expressed
significant levels of mCherry during infection by two different
strains of SINV and a lower level of mCherry during CHIKV
infection, but were not able to produce mCherry when infected
by WEEV. SINV and CHIKV are both Old World alphaviruses,
indicating some level of functional conservation between the
SINV and CHIKV replicase complexes and RNA elements.
New World alphaviruses such as WEEV (whose nonstructural
replicase proteins are derived from Eastern Equine
Encephalitis virus) were not able to induce mCherry
expression, indicating that Old and New World alphavirus
replicase complexes are not interchangeable. The observation
that addition of a virus-specific subgenomic promoter to the
SINV reporter construct did not result in mCherry expression
indicates that the virus specific 5’ and 3’ UTRs are required for
negative strand RNA and subgenomic RNA synthesis. A
CHIKV specific reporter RNA showed similar specificity as the
SINV system, demonstrating that this approach is applicable to
different types of alphaviruses and that species specificity can
be achieved with this approach. A potential application in future
systems is to integrate multiple species-specific reporter RNAs
with different fluorescent proteins into mosquito genomes that
would be able to detect multiple alphavirus species in the same
mosquito. Because the RNA expressed in this system is very
small compared to the full-length alphavirus genome, it will
prove a useful tool for dissecting the RNA and protein
requirements for alphavirus RNA replication in mosquito cells in
addition to its utility in identifying viral species.
Interestingly, when we expressed reporter RNAs in C6/36
cells by transient transfection, the cells with the highest levels
of eGFP expression did not express the reporter mCherry well
when infected. Cells that displayed low amounts of eGFP
expression (and by extension lower amounts of reporter RNA)
expressed higher levels of mCherry upon infection. We have
not yet determined the reason for this dichotomy, but there are
several possibilities for this effect. The Sindbis virus 5’ and 3’
UTR present on the reporter RNA bind to the viral non-
structural proteins, and an excess of the reporter RNA may
sequester the non-structural proteins away from the full length
RNA genome and reduce viral RNA replication. However, our
stable cell line does not show a reduction in virus replication
when compared to control C6/36 cells. Alternatively, high levels
of the reporter RNA may reduce the overall level of translation
in cells and reduce translation of the viral genomes to produce
nonstructural proteins [47]. It may prove beneficial in
subsequent versions of this system to use a less robust
promoter to drive reporter RNA transcription and decrease the
level of subgenomic reporter RNA. Regardless of the
variability, we consistently see activation of the subgenomic
promoter and expression of the reporter protein during infection
in cell culture.
Transformation of Ae. aegypti using the Mariner Mos1
transposase system with our reporter constructs inserted into
the transposon resulted in transgenic lines that transcribe the
SINV reporter RNA. We detected mCherry expression in a
subset of infected transgenic mosquitoes, but did not detect
mCherry expression in all infected transgenic mosquitoes.
mCherry reporter expression was never detected in wild type or
uninfected transgenic mosquitoes, indicating that activation of
the reporter RNA was specific to virus infection. The fact that
mCherry expression was detected in some but not all of the
infected transgenic mosquitoes indicates that the reporter
RNAs may not be active in all transgenic mosquitoes. In the
stable cell lines we observed a similar effect, with some stable
cells expressing mCherry during infection and others not
expressing mCherry. These in vitro and in vivo findings indicate
that there are mechanisms at play in mosquito cells limiting the
ability of the reporter RNAs to be replicated in the presence of
infecting alphaviruses. A possible mechanism for limiting the
activity of the system in mosquitoes is induction of the RNA
interference pathway by replication of the reporter RNA [48]
[34]. The transgenic mosquitoes we present in this manuscript
should be considered a proof-of-concept system that
demonstrate that reporter RNA expression is a viable approach
for detecting wild-type alphaviruses in mosquitoes, but this
system will need to be further optimized for more efficient
detection of SINV infection in live mosquitoes. Future
optimization approaches will include the use of site-directed
transgenesis systems, determining if RNAi affects production of
reporter RNAs, and investigating different constitutive or
inducible promoters, such as the Ae aegypti Heat Shock
promoter [49] to optimize expression and minimize cellular
interference.
The reporter RNAs used in this study express fluorescent
proteins during infection and allow visual confirmation of
Sindbis virus infection. However, a system similar to this could
be engineered to express other proteins only during active
virus replication. An interesting application for this technology
would be to engineer reporter RNAs that encode a cytotoxic or
mosquitocidal gene, which would only be expressed concurrent
with virus infection. For example, expression of the Saporin
ribosomal toxin gene [50] during infection may result in abortive
alphavirus infection of midgut cells and block transmission of
the virus. The transgenic reporter RNA system we describe
may be amenable to this approach, and we are actively
examining this possibility.
The subgenomic reporter RNA system we present can detect
alphavirus infection in cell culture systems and in transgenic
mosquitoes. Once optimized, this novel system will provide a
valuable method to visually monitor dissemination of wild-type
alphaviruses throughout insect cells and be useful for
monitoring the transmission of alphaviruses from mosquitoes to
mammalian hosts, increasing our understanding of viral
transmission cycle.
Subgenomic Reporter RNAs for Alphavirus Detection
PLOS ONE | www.plosone.org 10 December 2013 | Volume 8 | Issue 12 | e84930
Acknowledgements
We would like to thank Monica Heersink, Tyler Dalby, Becky
Gullberg, and Bejan Saeedi for providing critical help rearing,
screening, and maintaining transgenic mosquito lines. We
would also like to thank the Foy and Olson labs for providing
virus stocks.
Author Contributions
Conceived and designed the experiments: JJS KEO BJG.
Performed the experiments: JJS AWEF IS. Analyzed the data:
JJS BJG. Contributed reagents/materials/analysis tools: JJS
AWEF IS KEO BJG. Wrote the manuscript: JJS BJG.
References
1. Foy BD, Myles KM, Pierro DJ, Sanchez-Vargas I, Uhlírová M et al.
(2004) Development of a new Sindbis virus transducing system and its
characterization in three Culicine mosquitoes and two Lepidopteran
species. Insect Mol Biol 13: 89–100. doi:10.1111/j.
1365-2583.2004.00464.x. PubMed: 14728670.
2.
Atkins GJ (2013) The Pathogenesis of Alphaviruses. ISRN Virology
2013: 1–22 doi:10.1128/JVI.00851-10.
3. Weaver SC, Ferro C, Barrera R, Boshell J, Navarro J-C (2004)
Venezuelan equine encephalitis. Annu Rev Entomol 49: 141–174. doi:
10.1146/annurev.ento.49.061802.123422. PubMed: 14651460.
4. Porretta D, Mastrantonio V, Bellini R, Somboon P, Urbanelli S (2012)
Glacial history of a modern invader: phylogeography and species
distribution modelling of the Asian tiger mosquito Aedes albopictus.
PLOS ONE 7: e44515. doi:10.1371/journal.pone.0044515. PubMed:
22970238.
5.
Marimoutou C, Vivier E, Oliver M, Boutin J-P, Simon F (2012) Morbidity
and impaired quality of life 30 months after chikungunya infection:
comparative cohort of infected and uninfected French military
policemen in Reunion Island. Medicine (Baltimore) 91: 212–219. doi:
10.1097/MD.0b013e318260b604. PubMed: 22732952.
6. Phillips A, Mossel E, Sanchez-Vargas I, Foy B, Olson K (2010)
Alphavirus transducing system: tools for visualizing infection in
mosquito vectors. J Vis Exp: ([MedlinePgn:]) doi:10.3791/2363.
PubMed: 21178952.
7. Wiley MR, Roberts LO, Adelman ZN, Myles KM (2010) Double
subgenomic alphaviruses expressing multiple fluorescent proteins
using a Rhopalosiphum padi virus internal ribosome entry site element.
PLOS ONE 5: e13924. doi:10.1371/journal.pone.0013924. PubMed:
21085714.
8.
Steel JJ, Henderson BR, Lama SB, Olson KE, Geiss BJ (2011)
Infectious Alphavirus Production from a Simple Plasmid Transfection.
Virol J 8: 356. doi:10.1186/1743-422X-8-356. PubMed: 21771308.
9. Strauss JH, Strauss EG (1994) The alphaviruses: gene expression,
replication, and evolution. Microbiology and Molecular Biology Reviews
58: 491–562. PubMed: 7968923.
10. Foy BD, Olson KE (2008) Alphavirus transducing systems. Adv Exp
Med Biol, 627: 19–34. PubMed: 18510011.
11.
Nene V, Wortman JR, Lawson D, Haas B, Kodira C et al. (2007)
Genome Sequence of Aedes aegypti, a Major Arbovirus Vector.
Science 316: 1718–1723. doi:10.1126/science.1138878. PubMed:
17510324.
12.
Olivo PD, Frolov I, Schlesinger S (1994) A cell line that expresses a
reporter gene in response to infection by Sindbis virus: a prototype for
detection of positive strand RNA viruses. Virology 198: 381–384. doi:
10.1006/viro.1994.1046. PubMed: 8259675.
13.
Li J, Zhu W, Wang H, Li J, Zhang Q et al. (2012) Rapid, specific
detection of alphaviruses from tissue cultures using a replicon-defective
reporter gene assay. PLOS ONE 7: e33007. doi:10.1371/journal.pone.
0033007. PubMed: 22427930.
14.
Olivo PD (1996) Transgenic cell lines for detection of animal viruses.
Clin Microbiol Rev 9: 321–334. PubMed: 8809463.
15. Jarvis DL, Fleming JA, Kovacs GR, Summers MD, Guarino LA (1990)
Use of early baculovirus promoters for continuous expression and
efficient processing of foreign gene products in stably transformed
lepidopteran cells. Biotechnology (NY) 8: 950–955. doi:10.1038/
nbt1090-950. PubMed: 1367473.
16. Anderson MAE, Gross TL, Myles KM, Adelman ZN (2010) Validation of
novel promoter sequences derived from two endogenous ubiquitin
genes in transgenic Aedes aegypti. Insect Mol Biol 19: 441–449. doi:
10.1111/j.1365-2583.2010.01005.x. PubMed: 20456509.
17. Hahn CS, Hahn YS, Braciale TJ, Rice CM (1992) Infectious Sindbis
virus transient expression vectors for studying antigen processing and
presentation. Proc Natl Acad Sci U S A 89: 2679–2683. doi:10.1073/
pnas.89.7.2679. PubMed: 1372987.
18. Lustig S, Jackson AC, Hahn CS, Griffin DE, Strauss EG et al. (1988)
Molecular basis of Sindbis virus neurovirulence in mice. J Virol 62:
2329–2336. PubMed: 2836615.
19. Avadhanula V, Weasner BP, Hardy GG, Kumar JP, Hardy RW (2009) A
novel system for the launch of alphavirus RNA synthesis reveals a role
for the Imd pathway in arthropod antiviral response. PLOS Pathog 5:
e1000582. doi:10.1371/journal.ppat.1000582.
20.
Geiss BJ, Shimonkevitz LH, Sackal CI, Olson KE (2007)
Recombination-ready Sindbis replicon expression vectors for transgene
expression. Virol J 4: 112. doi:10.1186/1743-422X-4-112. PubMed:
17963504.
21. Tsetsarkin KA, Vanlandingham DL, McGee CE, Higgs S (2007) A
single mutation in chikungunya virus affects vector specificity and
epidemic potential. PLoS Pathog 3: e201. doi:10.1371/journal.ppat.
0030201. PubMed: 18069894.
22.
Berghammer AJ, Klingler M, Wimmer EA (1999) A universal marker for
transgenic insects. Nature 402: 370–371. doi:10.1038/46463. PubMed:
10586872.
23.
Pierro DJ, Powers EL, Olson KE (2008) Genetic determinants of
Sindbis virus mosquito infection are associated with a highly conserved
alphavirus and flavivirus envelope sequence. J Virol, 82: 2966–74.
PubMed: 18160430.
24.
Myles KM, Pierro DJ, Olson KE (2004) Comparison of the transmission
potential of two genetically distinct Sindbis viruses after oral infection of
Aedes aegypti (Diptera: Culicidae). J Med Entomol 41: 95–106. doi:
10.1603/0022-2585-41.1.95. PubMed: 14989352.
25.
Tsetsarkin K, Higgs S, McGee CE, De Lamballerie X, Charrel RN et al.
(2006) Infectious clones of Chikungunya virus (La Réunion isolate) for
vector competence studies. Vector Borne Zoonotic Dis 6: 325–337. doi:
10.1089/vbz.2006.6.325. PubMed: 17187566.
26.
Mossel EC, Ledermann JP, Phillips AT, Borland EM, Powers AM et al.
(2013) Molecular determinants of mouse neurovirulence and mosquito
infection for Western equine encephalitis virus. PLOS ONE 8: e60427.
doi:10.1371/journal.pone.0060427. PubMed: 23544138.
27.
Stahla-Beek HJ, April DG, Saeedi BJ, Hannah AM, Keenan SM et al.
(2012) Identification of a novel antiviral inhibitor of the flavivirus
guanylyltransferase enzyme. J Virol 86: 8730–8739. doi:10.1128/JVI.
00384-12. PubMed: 22674988.
28.
Collins TJ (2007) ImageJ for microscopy. BioTechniques 43: 25–30.
doi:10.2144/000112517. PubMed: 17936939.
29. Kim JY, Kim N, Zheng Z, Lee JE, Yenari MA (2013) The 70kD heat
shock protein protects against experimental traumatic brain injury.
Neurobiology of Disease.
30. Khoo CCH, Piper J, Sanchez-Vargas I, Olson KE, Franz AWE (2010)
The RNA interference pathway affects midgut infection- and escape
barriers for Sindbis virus in Aedes aegypti. BMC Microbiol 10: 130. doi:
10.1186/1471-2180-10-130. PubMed: 20426860.
31. Kim SW, Li Z, Moore PS, Monaghan AP, Chang Y et al. (2010) A
sensitive non-radioactive northern blot method to detect small RNAs.
Nucleic Acids Res 38: e98. doi:10.1093/nar/gkp1235. PubMed:
20081203.
32. Adelman ZN, Jasinskiene N, Vally KJM, Peek C, Travanty EA et al.
(2004) Formation and loss of large, unstable tandem arrays of the
piggyBac transposable element in the yellow fever mosquito, Aedes
aegypti. Transgenic Res 13: 411–425. doi:10.1007/s11248-004-6067-2.
PubMed: 15587266.
33.
Adelman ZN, Jasinskiene N, James AA (2002) Development and
applications of transgenesis in the yellow fever mosquito, Aedes
aegypti. Mol Biochem Parasitol 121: 1–10. doi:10.1016/
S0166-6851(02)00028-2. PubMed: 11985858.
34.
Franz AW, Sanchez-Vargas I, Adelman ZN, Blair CD, Beaty BJ et al.
(2006) Engineering RNA interference-based resistance to dengue virus
type 2 in genetically modified Aedes aegypti. Proc Natl Acad Sci U S A
103: 4198–4203. doi:10.1073/pnas.0600479103. PubMed: 16537508.
35. Pierro DJ, Powers EL, Olson KE (2008) Genetic determinants of
Sindbis virus mosquito infection are associated with a highly conserved
Subgenomic Reporter RNAs for Alphavirus Detection
PLOS ONE | www.plosone.org 11 December 2013 | Volume 8 | Issue 12 | e84930
alphavirus and flavivirus envelope sequence. J Virol 82: 2966–2974.
doi:10.1128/JVI.02060-07. PubMed: 18160430.
36. Seabaugh RC, Olson KE, Higgs S, Carlson JO, Beaty BJ (1998)
Development of a chimeric sindbis virus with enhanced per Os infection
of Aedes aegypti. Virology 243: 99–112. doi:10.1006/viro.1998.9034.
PubMed: 9527919.
37. Franz AWE, Sanchez-Vargas I, Piper J, Smith MR, Khoo CCH et al.
(2009) Stability and loss of a virus resistance phenotype over time in
transgenic mosquitoes harbouring an antiviral effector gene. Insect Mol
Biol 18: 661–672. doi:10.1111/j.1365-2583.2009.00908.x. PubMed:
19754743.
38. Hardy RW, Rice CM (2005) Requirements at the 3' end of the sindbis
virus genome for efficient synthesis of minus-strand. RNA - Journal of
Virology 79: 4630–4639. doi:10.1128/JVI.79.8.4630-4639.2005.
39. Frolov I, Hardy R, Rice CM (2001) Cis-acting RNA elements at the 5'
end of Sindbis virus genome RNA regulate minus- and plus-strand
RNA synthesis. RNA 7: 1638–1651. doi:10.1017/S135583820101010X.
PubMed: 11720292.
40. Weaver SC, Hagenbaugh A, Bellew LA, Netesov SV, Volchkov VE et
al. (1993) A comparison of the nucleotide sequences of eastern and
western equine encephalomyelitis viruses with those of other
alphaviruses and related RNA viruses. Virology 197: 375–390. doi:
10.1006/viro.1993.1599. PubMed: 8105605.
41.
Franz AW, Sanchez-Vargas I (2006) Engineering RNA interference-
based resistance to dengue virus type 2 in genetically modified Aedes
aegypti. PubMed: 16537508
42.
Franz AWE, Jasinskiene N, Sanchez-Vargas I, Isaacs AT, Smith MR et
al. (2011) Comparison of transgene expression in Aedes aegypti
generated by mariner Mos1 transposition and ΦC31 site-directed
recombination. Insect Mol Biol 20: 587–598. doi:10.1111/j.
1365-2583.2011.01089.x. PubMed: 21699593.
43. Coates CJ, Jasinskiene N, Morgan D, Tosi LR, Beverley SM et al.
(2000) Purified mariner (Mos1) transposase catalyzes the integration of
marked elements into the germ-line of the yellow fever mosquito,
Aedes aegypti. Insect Biochem Mol Biol 30: 1003–1008. doi:10.1016/
S0965-1748(00)00110-7. PubMed: 10989286.
44. Atkinson PW, Pinkerton AC, O'Brochta DA (2001) Genetic
transformation systems in insects. Annu Rev Entomol 46: 317–346. doi:
10.1146/annurev.ento.46.1.317. PubMed: 11112172.
45. Jasinskiene N, Juhn J, James AA (2007) Microinjection of A. aegypti
embryos to obtain transgenic mosquitoes. … of visualized experiments:
JoVE.
46. Pierro DJ, Myles KM, Foy BD, Beaty BJ, Olson KE (2003) Development
of an orally infectious Sindbis virus transducing system that efficiently
disseminates and expresses green fluorescent protein in Aedes
aegypti. Insect Mol Biol 12: 107–116. doi:10.1046/j.
1365-2583.2003.00392.x. PubMed: 12653932.
47. Patel RK, Burnham AJ, Gebhart NN, Sokoloski KJ, Hardy RW (2013)
Role for subgenomic mRNA in host translation inhibition during Sindbis
virus infection of mammalian cells. Virology 441: 171–181. doi:10.1016/
j.virol.2013.03.022. PubMed: 23601784.
48.
Cirimotich CM, Scott JC, Phillips AT, Geiss BJ, Olson KE (2009)
Suppression of RNA interference increases alphavirus replication and
virus-associated mortality in Aedes aegypti mosquitoes. BMC Microbiol
9: 49. doi:10.1186/1471-2180-9-49. PubMed: 19265532.
49.
Carpenetti TLG, Aryan A, Myles KM, Adelman ZN (2012) Robust heat-
inducible gene expression by two endogenous hsp70-derived
promoters in transgenic Aedes aegypti. Insect Mol Biol 21: 97–106. doi:
10.1111/j.1365-2583.2011.01116.x. PubMed: 22142225.
50.
Fabbrini MS, Rappocciolo E, Carpani D, Solinas M, Valsasina B et al.
(1997) Characterization of a saporin isoform with lower ribosome-
inhibiting activity. Biochem J 322 ( 3): 719–727. PubMed: 9148741.
Subgenomic Reporter RNAs for Alphavirus Detection
PLOS ONE | www.plosone.org 12 December 2013 | Volume 8 | Issue 12 | e84930
    • "Finally, a trans-replication system can also be developed specifically to be used in insect cells. Interestingly, constructs expressing short template RNAs for CHIKV replicase have been previously tested both in cultivated mosquito cells and in vivo [67]. However, the amplification/transcription of the template RNA achieved using the previous system was less than 20-fold, much less prominent compared to at least 10 3 -fold amplification observed in the current study (Fig 2). "
    [Show abstract] [Hide abstract] ABSTRACT: Chikungunya virus (CHIKV; genus Alphavirus, family Togaviridae) has recently caused several major outbreaks affecting millions of people. There are no licensed vaccines or antivirals, and the knowledge of the molecular biology of CHIKV, crucial for development of efficient antiviral strategies, remains fragmentary. CHIKV has a 12 kb positive-strand RNA genome, which is translated to yield a nonstructural (ns) or replicase polyprotein. CHIKV structural proteins are expressed from a subgenomic RNA synthesized in infected cells. Here we have developed CHIKV trans-replication systems, where replicase expression and RNA replication are uncoupled. Bacteriophage T7 RNA polymerase or cellular RNA polymerase II were used for production of mRNAs for CHIKV ns polyprotein and template RNAs, which are recognized by CHIKV replicase and encode for reporter proteins. CHIKV replicase efficiently amplified such RNA templates and synthesized large amounts of subgenomic RNA in several cell lines. This system was used to create tagged versions of ns proteins including nsP1 fused with enhanced green fluorescent protein and nsP4 with an immunological tag. Analysis of these constructs and a matching set of replicon vectors revealed that the replicases containing tagged ns proteins were functional and maintained their subcellular localizations. When cells were co-transfected with constructs expressing template RNA and wild type or tagged versions of CHIKV replicases, formation of characteristic replicase complexes (spherules) was observed. Analysis of mutations associated with noncytotoxic phenotype in CHIKV replicons showed that a low level of RNA replication is not a pre-requisite for reduced cytotoxicity. The CHIKV trans-replicase does not suffer from genetic instability and represents an efficient, sensitive and reliable tool for studies of different aspects of CHIKV RNA replication process.
    Full-text · Article · Mar 2016
  • [Show abstract] [Hide abstract] ABSTRACT: Cell-based reporter systems have facilitated studies of viral replication and pathogenesis, virus detection, and drug susceptibility testing. There are three types of cell-based reporter systems that express certain reporter protein for positive-sense single strand RNA virus infections. The first type is classical reporter system, which relies on recombinant virus, reporter virus particle, or subgenomic replicon. During infection with the recombinant virus or reporter virus particle, the reporter protein is expressed and can be detected in real time in a dose-dependent manner. Using subgenomic replicon, which are genetically engineered viral RNA molecules that are capable of replication but incapable of producing virions, the translation and replication of the replicon could be tracked by the accumulation of reporter protein. The second type of reporter system involves genetically engineered cells bearing virus-specific protease cleavage sequences, which can sense the incoming viral protease. The third type is based on viral replicase, which can report the specific virus infection via detection of the incoming viral replicase. This review specifically focuses on the major technical breakthroughs in the design of cell-based reporter systems and the application of these systems to the further understanding and control of viruses over the past few decades.
    Article · Jan 2016