Content uploaded by Paul-André Risse
Author content
All content in this area was uploaded by Paul-André Risse on Jan 02, 2014
Content may be subject to copyright.
R E S E A R C H Open Access
IL-22 contributes to TGF-β1-mediated
epithelial-mesenchymal transition in asthmatic
bronchial epithelial cells
Jill R Johnson
1
, Michiyoshi Nishioka
1
, Jamila Chakir
2
, Paul-André Risse
1
, Ibrahim Almaghlouth
1
,
Ahmad N Bazarbashi
1
, Sophie Plante
2
, James G Martin
1
, David Eidelman
1
and Qutayba Hamid
1*
Abstract
Background: Allergic asthma is characterized by airway inflammation in response to antigen exposure, leading to
airway remodeling and lung dysfunction. Epithelial-mesenchymal transition (EMT) may play a role in airway remodeling
through the acquisition of a mesenchymal phenotype in airway epithelial cells. TGF-β1 is known to promote EMT;
however, other cytokines expressed in severe asthma with extensive remodeling, such as IL-22, may also contribute to
this process. In this study, we evaluated the contribution of IL-22 to EMT in primary bronchial epithelial cells from
healthy and asthmatic subjects.
Methods: Primary bronchial epithelial cells were isolated from healthy subjects, mild asthmatics and severe asthmatics
(n=5 patients per group). The mRNA and protein expression of epithelial and mesenchymal cell markers and
EMT-associated transcription factors was evaluated following stimulation with TGF-β1, IL-22 and TGF-β1+IL-22.
Results: Primary bronchial epithelial cells stimulated with TGF-β1 underwent EMT, demonstrated by decreased
expression of epithelial markers (E-cadherin and MUC5AC) and increased expression of mesenchymal markers
(N-cadherin and vimentin) and EMT-associated transcription factors. IL-22 alone had no effect on epithelial or
mesenchymal gene expression. However, IL-22+TGF-β1 promoted the expression of some EMT transcription factors
(Snail1 and Zeb1) and led to a more profound cadherin shift, but only in cells obtained from severe asthmatics.
Conclusion: The impact of IL-22 on airway epithelial cells depends on the cytokine milieu and the clinical phenotype
of the patient. Further studies are required to determine the molecular mechanism of IL-22 and TGF-β1 cooperativity in
driving EMT in primary human bronchial epithelial cells.
Introduction
Inflammation in allergic asthma reflects complex activa-
tion of the adaptive and innate immune systems [1]. The
classical Th2 paradigm, which suggests that asthma is
driven by interleukins (IL)-4, -5 and −13, is mostly associ-
ated with mild to moderate allergic asthma [2]. However,
it fails to explain more severe forms of asthma that are
often associated with the expression of Th1 cytokines such
as interferon-γand the more recently described Th17-
associated cytokines IL-17 and IL-22 [3-6]. Strategies to
treat asthma with targeted therapies against Th2 cytokines
have not been successful or have been effective only in
highly selected subsets of patients [7-10]. One explanation
for this limited success may be that other T cell subsets
play a role, such as Th17 cells, as they have been impli-
cated in other inflammatory processes [11-13]. It is im-
portant to investigate these novel subsets of T cells at
various stages of disease pathobiology. IL-22 is a Th17
cytokine predominantly expressed by memory CD4+ T
cells with both reparative and pro-inflammatory properties
[14]. However, the role of this mediator in asthma is
poorly understood. The distribution of the IL-22 receptor
suggests that IL-22 signals predominantly in non-immune
cells [15] and therefore holds particular interest for certain
features of asthma, including airway remodeling. A major
feature of asthmatic airway remodeling is an increase
in airway smooth muscle (ASM) mass that occurs in
parallel with the severity of asthma [16-19], although
* Correspondence: qutayba.hamid@mcgill.ca
1
Meakins-Christie Laboratories, McGill University, 3626 St. Urbain Street,
Montréal, QC H2X 2P2, Canada
Full list of author information is available at the end of the article
© 2013 Johnson et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Johnson et al. Respiratory Research 2013, 14:118
http://respiratory-research.com/content/14/1/118
the mechanisms responsible for this increase in ASM
mass are still under investigation.
Epithelial-mesenchymal transition (EMT) is a mechan-
ism that may account for the accumulation of subepithe-
lial mesenchymal cells, thereby contributing to increased
contractile cell mass and airway hyperresponsiveness. Dur-
ing EMT, epithelial cells lose their typical cell-cell junc-
tions and cell polarity and acquire a more mesenchymal
phenotype [20]. EMT is mainly characterized by the loss
of epithelial markers such as cytokeratins, tight junction
proteins and E-cadherin, the acquisition of mesenchymal
markers such as vimentin and N-cadherin, and increased
expression of the Snail, Twist and Zeb transcription fac-
tors [20]. A recent study in a mouse model of chronic
house dust mite-driven allergic airway inflammation dem-
onstrated the capacity of airway epithelial cells to acquire
mesenchymal characteristics under these conditions [21].
This process was associated with increased airway smooth
muscle mass and elevated TGF-β1 signalling in the lung.
However, as evidence of EMT in this model was only
observed at more severe stages of the disease, we were in-
terested in ascertaining the contribution of cytokines
expressed in severe asthma on the induction of EMT. As
previous reports have demonstrated that IL-17A promotes
EMT in airway epithelial cells in a TGF-β1-dependent
manner [22] and contributes to airway remodeling in a
mouse model of allergic airway inflammation [23], the aim
of this study was to elucidate the in vitro impact of IL-22
in conjunction with TGF-β1ontheinductionofamesen-
chymal phenotype in primary human bronchial epithelial
cells derived from healthy control subjects and patients
with either mild or severe allergic asthma.
Materials and methods
Bronchial biopsies and immunohistochemistry
Tissue samples were provided from the Tissue Bank of
the Respiratory Health Network of the FRSQ, MUHC
site (http://swrsr.crc.chus.qc.ca/). Patients provided in-
formed consent (approved by the local ethics commit-
tee) for bronchoscopy and the use of their samples.
Biopsies were taken from the bronchi of healthy con-
trols (n=5), mild asthmatics (n=5) and severe asth-
matics (n=5) by fiberoptic bronchoscopy. Patient
characteristics are provided in Table 1. The biopsies
were fixed immediately in 10% formalin overnight,
processed and embedded in paraffin to form blocks.
Blocks were cut into 5 μm thick sections with a micro-
tome and H&E staining was performed every 25–30
slides for the assessment of tissue morphology.
Immunohistochemistry
Biopsy sections were deparaffinized and rehydrated using
xylene and a graded ethanol series (100%, 90% and 70%
ethanol), followed by washing in PBS (three times for five
minutes each). Antigen retrieval was performed by im-
mersing the tissue sections in a pressure cooker filled with
citrate buffer (pH 6.0) and heated for 15 minutes. Tissues
were then permeabilized using 2% Triton-X for 30 mi-
nutes, then incubated with 5% hydrogen peroxide for
30 minutes to reduce the activity of endogenous peroxi-
dases. Tissue sections were then blocked with blocking
buffer (Dako) for 30 minutes followed by primary antibody
incubation (polyclonal goat anti-human IL-22, 1:300,
Abcam, catalog #ab18498) overnight at 4°C. Next, the
secondary antibody (biotinylated polyclonal rabbit anti-goat
IgG, 1:100, Dako, catalog #E0466) was added to the tissue
for 45 minutes followed by another 45 minutes of
incubation with HRP (1:100, Vector Laboratories, catalog
# SA-5004). Washing was carried out after each step.
Under a light microscope, DAB was added to each slide
and staining development was observed to avoid over
exposure. The reaction was stopped using deionized
water. Sections were finally counterstained with hema-
toxylin (3 sec) followed by lithium carbonate (20 sec)
and dehydrated in 90%-100% ethanol for 1 min then of
xylene for 4 min. Slides were coverslipped using
CytoSeal-60 Mounting Medium (Fisher Scientific).
Slides were left to dry and visualized by light micros-
copy under 400× magnification. IL-22 positive cells
were enumerated by counting the number of IL-22 posi-
tive cells (in brown) per mm
2
of tissue.
Epithelial cell culture
Epithelial cells were isolated from bronchial biopsies of
healthy subjects, mild steroid-naïve asthmatics and severe
asthmatic subjects. Subjects were recruited from the
Asthma Clinic at l’Institut Universitaire de Cardiologie et
de Pneumologie de Québec (Québec, QC, Canada). The
ethics committee board approved the study and all
subjects provided written informed consent. The asth-
matic subjects were diagnosed according to the American
Thoracic Society criteria [24]. The characteristics of the
subjects are summarized in Table 1. Severe asthmatics
were defined according to the ATS refractory asthma def-
inition [25] and were on continuous treatment with high
doses of inhaled CS and long-acting β
2
-agonists. Their
asthma was stable with no exacerbations in the preceding
four months. All subjects were non-smokers. Epithelial
cells were isolated and characterized by immunofluores-
cence and flow cytometry using an anti-cytokeratin anti-
body from Calbiochem (San Diego, CA) as previously
described [26,27]. Epithelial cells from asthmatic (mild n=5
and severe n=5) and normal (n=5) subjects were cultured
in 6-well (for Western blot analysis) and 12-well (for RNA
analysis) plates. Briefly, cells were stimulated with IL-22,
TGF-β1 (both 10 ng/ml) or both cytokines together for a
period of 3 (RNA analysis) or 5 (protein analysis) days.
Johnson et al. Respiratory Research 2013, 14:118 Page 2 of 12
http://respiratory-research.com/content/14/1/118
Cytokine stimulation
Cells were seeded onto 12- and 6-well plates as described
above and grown in bronchial epithelial growth medium
(BEGM, Lonza) supplemented with a bullet kit containing
bovine pituitary extract, insulin, hydrocortisone, gentamy-
cin/amphotericin, retinoic acid, transferrin, epinephrine
and hEGF (Lonza). Additionally, medium was supple-
mented with heat-inactivated fetal bovine serum (10% in
the growth medium, 1% in starvation medium). At conflu-
ence, cells were starved for 24 h (BEGM + 1% FBS), then
treated daily with IL-22 (10 ng/ml), TGF-β1(10ng/ml)or
a combination of IL-22 and TGF-β1 (both 10 ng/ml) for a
period of 3 (RNA analysis) or 5 (protein analysis) days.
The concentrations of IL-22 and TGF-β1usedforepi-
thelial cell stimulation and the time points used for
assessments were determined in a pilot study.
Protein quantification and immunoblotting
Primary bronchial epithelial cells were lysed in 100 μLof
lysis buffer (50 mM Tris–HCl pH 7.5, 1 mM EGTA,
1 mM EDTA, 1% (v/v) Triton X-100, 1 mM sodium ortho-
vanadate, 5 mM sodium pyrophosphate, 50 mM sodium
fluoride, 0.27 M sucrose, 5 mM sodium pyrophosphate
decahydrate and protease inhibitors). Protein concen-
trations were quantified using the BCA Protein Assay
Kit (ThermoScientific) according to the manufacturer’s
instructions. Fifty micrograms of protein were boiled and
separated on a 10% Pro-Pure Next Gel with Pro-Pure
Running Buffer (Amresco, Solon, OH). After transferring
proteins to nitrocellulose, membranes were blocked for
1 hour at room temperature in Odyssey Blocking Buffer
(Li-Cor Biosciences, Lincoln, NE). Blots were then incu-
bated with a goat anti-human IL-22 receptor antibody
(1 μg/ml, AF2770, R&D Systems, Minneapolis, MN),
a mouse anti-human E-cadherin antibody (1:600,
ab1416, Abcam, Cambridge, MA), a rabbit anti-human
N-cadherin antibody (1:1000, ab76057, Abcam) or a
mouse anti-human GAPDH antibody (1:1500, MAB374,
Millipore, Billerica, MA) overnight at 4°C. Donkey anti-
goat IgG (1:15,000, #35518, DyLight™680, Thermo
Scientific), donkey anti-goat IgG IRDye (1:15,000, #926-
32214, Li-Cor) secondary antibody, goat anti-mouse IgG
(1:15,000, #35518, DyLight™680, Thermo Scientific) secon-
dary antibody or goat anti-rabbit IgG (1:15,000, #35571,
DyLight™800, Thermo Scientific) secondary antibody was
applied for 1 hour in the dark at room temperature
(1:15,000). The signal was detected and quantified using a
LI-COR Odyssey imaging system (LI-COR Biosciences).
All samples were normalized to GAPDH and expressed as
a ratio relative to the control sample.
Real time RT-PCR
Total RNA was isolated from cultured primary bronchial
epithelial cells and purified using the RNeasy Mini Kit
(Qiagen, Toronto, Canada), supplemented with the RNase-
Free DNase Set (Qiagen). cDNA was obtained using the
QuantiTect Reverse Transcription cDNA Synthesis Kit
(Qiagen), and the absence of DNA contamination was veri-
fied by excluding the reverse transcriptase from subsequent
PCR reactions. cDNA was subjected to PCR using the
Power SYBR Green PCR Master Mix (Applied Biosystems,
Foster City, CA) to amplify human transcripts of E-
cadherin, MUC5AC, N-cadherin, vimentin, Snail1, Snail2,
Twist1, Twist2, Zeb1, Zeb2 and GAPDH using primers
from Invitrogen (Table 2). Each PCR reaction was carried
out as follows: 15 min at 95°C, 15 sec at 94°C, 30 sec at
Table 1 Subject characteristics for bronchial biopsies primary bronchial epithelial cells
Healthy controls Mild asthmatics Severe asthmatics
Biopsies for immunohistochemical staining
Age (years) 30.3 ± 15.2 34.2 ± 13.1 50.2 ± 15.0
Sex 1 M/4 F 3 M/2 F 4 M/1 F
FEV1 (%) 105.8 ± 6.42 95.6 ± 13.4 56.8 ± 23.2
Atopy 2 5 5
Medication (μg/day) 890 ± 690/200
(inhaled corticosteroid/ long-acting β
2
agonist)
Primary bronchial epithelial cells
Age (years) 28.8 ± 11.0 21.8 ± 1.5 49.8 ± 16.0
Sex 4 M/1 F 2 M/3 F 2 M/3 F
PC
20
(mg/ml) 135.0 ± 68.8 4.2 ± 3.9 ND
FEV1 (%) 96.0 ± 13.7 95.0 ± 5.1 54.0 ± 17.0
Atopy 0 5 4 yes/1 no
Medication (μg/day) 1050 ± 255/100
(inhaled corticosteroid/ long-acting β
2
agonist)
Johnson et al. Respiratory Research 2013, 14:118 Page 3 of 12
http://respiratory-research.com/content/14/1/118
60°C, and 30 sec at 72°C. Each cycle was repeated 40 times
following the manufacturer's recommendations using a
7500 Fast Real-Time PCR System (Applied Biosystems)
thermal cycler. Based on the comparative Ct method, gene
expression levels were calculated and GAPDH was used
as the housekeeping gene. Untreated control samples for
each cell line were set to 100% and the fold change in
expression in following treatment is represented in the bar
graphs as mean ± standard error of the mean. Each con-
dition was assessed based on three replicates with n=4-5
patients per group.
Statistical analysis
Statistical analysis was performed using GraphPad
Prism version 6. For statistical analyses between two
groups, t-tests were used. Comparisons between more
than two groups were performed by ANOVA, followed
by a Tukey post-hoc test. A p-value of < 0.05 was con-
sidered to be statistically significant. Data are expressed
as mean ± standard error of the mean.
Results
Increased expression of IL-22 and the IL-22 receptor in
severe asthmatics
Bronchial biopsies were obtained from healthy controls,
mild asthmatics and severe asthmatics. Sections were
stained by immunohistochemistry (negative control,
Figure 1A) for the expression of IL-22 (Figure 1B-C),
demonstrating a significantly greater influx of IL-22 ex-
pressing cells in the bronchi of severe asthmatics com-
pared to mild asthmatics and healthy controls (Figure 1E;
p < 0.05). The number of IL-22 positive cells was also
normalized to the degree of inflammation in the biopsy
using counts of IL-33 positive cells; the trends between
groups and statistical significance remained consistent
(data not shown).
Primary bronchial epithelial cells obtained from healthy
controls, mild asthmatics and severe asthmatics were cul-
tured and stimulated with IL-22, TGF-β1 or IL-22+
TGF-β1 and assessed for their expression of the IL-22
receptor by immunoblotting (Figure 1F). Expression levels
relative to the loading control (GAPDH) were assessed by
densitometry, revealing significantly higher expression of
the IL-22 receptor in unstimulated primary bronchial
epithelial cells obtained from severe asthmatics compared
to mild asthmatics and healthy controls (Figure 1G;
p < 0.05). Stimulation with IL-22, TGF-β1 or IL-22+
TGF-β1in vitro for 5 days did not have a significant
effect on the level of IL-22 receptor expression (data not
shown).
Exposure to TGF-β1in vitro induces a mesenchymal
phenotype in primary bronchial epithelial cells from mild
and severe asthmatics
Cells were cultured for 5 days and treated with IL-22,
TGF-β1orIL-22+TGF-β1 (Figure 2). IL-22 alone did
not have a discernible effect on the morphology of cul-
tured primary bronchial epithelial cells taken from nor-
mal subjects or those obtained from patients with mild
and severe asthma (Figure 2B, F, J). Conversely, an ap-
parent morphological change was induced by TGF-β1,
either with (Figure 2C, G, K) or without concomitant
IL-22 treatment (Figure 2D, H, L). The most complete
change to a mesenchymal phenotype was observed in
Table 2 Primers used for qPCR analysis
Gene name Target gene Forward primer Reverse primer Amplicon size (nt)
Epithelial genes
human E-cadherin hCDH1 GCCGAGAGCTACACGTTCA GACCGGTGCAATCTTCAAA 88
human mucin hMUC5AC TTCCATGCCCGGGTACCTG CAGGCTCAGTGTCACGCTCTT 200
Mesenchymal genes
human N-cadherin hCDH2 CTCCATGTGCCGGATAGC CGATTTCACCAGAAGCCTCTAC 92
human vimentin hVIM GTTTCCCCTAAACCGCTAGG AGCGAGAGTGGCAGAGGA 68
Transcription factor genes
human Snail1 hSNAI1 GCTGCAGGACTCTAATCCAGA ATCTCCGGAGGTGGGATG 84
human Snail2 hSNAI2 TGGTTGCTTCAAGGACACAT GTTGCAGTGAGGGCAAGAA 66
human Twist1 hTWIST1 AAGGCATCACTATGGACTTTCTCT GCCAGTTTGATCCCAGTATTTT 96
human Twist2 hTWIST2 TCTGAAACCTGAACAACCTCAG CTGCTGTCCCTTCTCTCGAC 70
human Zeb1 hZEB1 GCTAAGAACTGCTGGGAGGAT ATCCTGCTTCATCTGCCTGA 79-82
human Zeb2 hZEB2 AAGCCAGGGACAGATCAGC CCACACTCTGTGCATTTGAACT 74
Housekeeping gene
human glyceraldehyde 3-phosphate
dehydrogenase
hGAPDH AGCCACATCGCTCAGACAC GCCCAATACGACGACCAAATCC 46
Johnson et al. Respiratory Research 2013, 14:118 Page 4 of 12
http://respiratory-research.com/content/14/1/118
E
FG
Sev ere asth matic
Mil d asth matic
GAPDH 37 kDa
Healthy con trol
IL-22 (10 n g/ml)
TGF -β1 (10 n g/ml)
+-+-
+--+
+-+-
+--+
+-+-
+--+
IL-22 R 65 kDa
*
0
50
100
150
200
IL-22 positive cells per mm2
0.000
0.010
0.020
0.030
0.040
IL-22R/GAPDH
*
Healthy
controls
Mild
asthmatics
Severe
asthmatics
Healthy
controls
Mild
asthmatics
Severe
asthmatics
Figure 1 IL-22 and IL-22 receptor expression levels increase in the airways of asthmatic subjects. (A-D) Bronchial biopsies were obtained
from healthy controls, mild asthmatics and severe asthmatics and stained (A, negative control) for IL-22 expression (in brown) by immunohisto-
chemistry. Scale bar 50 μm. (E) The number of IL-22 positive cells was determined per mm
2
of biopsy tissue. n=5 per group, *p<0.05 vs. healthy
control. (F) Primary bronchial epithelial cells were obtained from healthy controls, mild asthmatics and severe asthmatics and assessed for IL-22
receptor expression by Western blot. Cells were allowed to grow to confluence, serum starved overnight and stimulated with IL-22, TGF-β1
(10 ng/mL each) or both cytokines for 5 days before Western blot analysis. (G) Expression levels of the IL-22 receptor in unstimulated cells were
quantified relative to GAPDH expression. n=5 per group, *p<0.05 vs. healthy control.
Control TGF- 1IL-22 IL-22 +TGF- 1
Severe asthmatic Mild asthmatic Healthy control
A B C D
E F G H
I J K L
Figure 2 TGF-β1 induces variable morphological changes in cultured primary epithelial cells. Primary bronchial epithelial cells were
obtained from healthy controls (A-D), mild asthmatics (E-H) and severe asthmatics (I-L), grown to confluence, serum starved overnight and
stimulated with IL-22, TGF-β1 (10 ng/mL each) or both cytokines for 5 days before evaluating morphological changes. Scale bar 10 μm.
Johnson et al. Respiratory Research 2013, 14:118 Page 5 of 12
http://respiratory-research.com/content/14/1/118
cells obtained from severe asthmatics, with a high pro-
portion of spindle-shaped cells seen in cultures from
this group of patients following 5 days of TGF-β1and
IL-22+TGF-β1 stimulation (Figure 2K, L).
TGF-β1 suppresses epithelial gene expression in primary
bronchial epithelial cells
In order to quantify the changes in epithelial gene expres-
sion in cultured primary bronchial epithelial cells, qPCR
analysis was performed for the epithelial genes MUC5AC
and E-cadherin, following 3 days of stimulation with IL-22,
TGF-β1 or IL-22+TGF-β1 (Figure 3). MUC5AC expression
was profoundly affected by stimulation with TGF-β1, with
or without IL-22 stimulation; IL-22 stimulation in the con-
text of TGF-β1 had no additional effect on the expression
of MUC5AC (Figure 3A). E-cadherin mRNA expression
was decreased in cells derived from normal subjects after
3 days of stimulation with TGF-β1 and IL-22+TGF-β1
(Figure 3B). No differences in E-cadherin mRNA expres-
sion were observed in cells derived from mild asthmatics
following stimulation with TGF-β1 and IL-22+TGF-β1
(Figure 3B). Cells derived from severe asthmatics showed
reduced relative expression of E-cadherin mRNA following
stimulation with IL-22+TGF-β1 (Figure 3B).
IL-22 stimulation does not affect mesenchymal gene
expression in primary bronchial epithelial cells
Changes in the relative expression of mesenchymal genes
in cultured primary bronchial epithelial cells were eva-
luated by qPCR analysis for vimentin and N-cadherin
mRNA, following 3 days of stimulation with IL-22,
TGF-β1 or IL-22+TGF-β1 (Figure 4). As expected, TGF-β1
stimulation led to a significant increase in the expression
of vimentin (Figure 4A) and N-cadherin (Figure 4B) in
primary bronchial epithelial cells derived from healthy
controls, mild asthmatics and severe asthmatics. IL-22
stimulation, either alone or in combination with TGF-β1,
had no effect on the expression of vimentin or N-cadherin
mRNA in primary bronchial epithelial cells from all three
groups of subjects. The highest level of expression of both
vimentin and N-cadherin was found in cells derived from
severe asthmatics (Figure 4A, B).
IL-22 cooperates with TGF-β1 in reducing E-cadherin protein
expression in asthmatic primary bronchial epithelial cells
Protein was collected from cultured cells after 5 days of
treatment with IL-22, TGF-β1orIL-22+TGF-β1 and eval-
uated by immunoblotting for the expression of E-cadherin
and N-cadherin (Figure 5A). E-cadherin expression was
decreased in response to TGF-β1 stimulation in cells de-
rived from severe asthmatics, with a trend for a further
decrease in E-cadherin expression with IL-22+TGF-β1
(Figure 5B; p=0.08). TGF-β1 stimulation induced a vari-
able increase in N-cadherin expression in cells obtained
from healthy controls, mild asthmatics and severe
asthmatics relative to the housekeeping gene GAPDH
(Figure 5C). The cadherin switch, indicative of epithelial-to-
mesenchymal transition, was observed in all cells stimu-
lated with TGF-β1andIL-22+TGF-β1 for 5 days, although
the most profound cadherin switch was observed in cells
derived from severe asthmatics with an additive effect of
IL-22+TGF-β1 in these cells (p < 0.05; Figure 6A).
IL-22 cooperates with TGF-β1 in enhancing the expression
of the EMT-associated transcription factors in primary
bronchial epithelial cells from severe asthmatics
The transcriptional regulation of EMT in human primary
bronchial epithelial cells was investigated following stimu-
lation with IL-22, TGF-β1 or IL-22+TGF-β1 (Figure 7).
The results of qPCR analysis of the mRNA expression
levels of the EMT-associated transcription factors Snail1,
Snail2, Twist1, Twist2, Zeb1 and Zeb2 show a significant
upregulation of all transcription factors in response to
stimulation with TGF-β1 (Figure 7A-F), most notably in
cells derived from severe asthmatics. Interestingly, despite
a significant increase in Twist1 and Twist2 expression
MUC5AC E-cadherin
Relative expression
Relative expression
AB
0.0
0.5
1.0
1.5
2.0
2.5
Control IL-22 TGF-βIL-22+TGF-β
Healthy controls
Mild asthmatics
Severe asthmatics
*
0.0
0.2
0.4
0.6
0.8
1.0
1.2
Control IL-22 TGF-βIL-22+TGF-β
Healthy controls
Mild asthmatics
Severe asthmatics
*
*§
*†
*†*†*†
*†*†
Figure 3 Stimulation with TGF-β1 + IL-22 reduces MUC5AC and E-cadherin mRNA expression in primary bronchial epithelial cells.
Primary bronchial epithelial cells were obtained from healthy controls, mild asthmatics and severe asthmatics, grown to confluence, serum
starved overnight and stimulated with IL-22, TGF-β1 (10 ng/mL each) or both cytokines for 5 days before evaluating E-cadherin (A) and MUC5AC
(B) mRNA expression. Expression levels are relative to GAPDH expression. n=4-5 per group, *p<0.05 vs. control unstimulated cells, †p<0.05 vs.
IL-22 stimulated cells, §p<0.05 vs. TGF-β1 stimulated cells.
Johnson et al. Respiratory Research 2013, 14:118 Page 6 of 12
http://respiratory-research.com/content/14/1/118
following TGF-β1 stimulation, Twist transcription fac-
tor expression was relatively lower when cells were
treated with IL-22+TGF-β1comparedtoTGF-β1alone
(Figure 7C, D). Conversely, Snail1 and Zeb1 mRNA ex-
pression was significantly increased in cells from severe
asthmatics treated with IL-22+TGF-β1comparedto
TGF-β1 alone (Figure 7A, E). Stimulation with IL-22
alone led to a significant increase in the expression of
the Zeb transcription factors in cells derived from all
patient groups (Figure 7E, F).
Discussion
The results of this study show that IL-22 and its receptor
are highly expressed in the airways of severe asthmatics,
0
1
2
3
4
5
6
7
Control IL-22 TGF-βIL-22+TGF-β
Healthy controls
Mild asthmatics
Severe asthmatics
0
10
20
30
40
50
60
70
80
Control IL-22 TGF-βIL-22+TGF-β
Healthy controls
Mild asthmatics
Severe asthmatics
vimentin N-cadherin
Relative expression
AB
Relative expression
*
*
*†
*†
*†
*†
*†
*†
*†
*†*†
*†
Figure 4 TGF-β1, but not IL-22, increases the mRNA expression of mesenchymal genes in primary bronchial epithelial cells. Primary
bronchial epithelial cells were obtained from healthy controls, mild asthmatics and severe asthmatics, grown to confluence, serum starved
overnight and stimulated with IL-22, TGF-β1 (10 ng/mL each) or both cytokines for 5 days before evaluating vimentin (A) and N-cadherin (B)
mRNA expression. Expression levels are relative to GAPDH expression. n=4-5 per group, *p<0.05 vs. control unstimulated cells, †p<0.05 vs. IL-22
stimulated cells.
E-cadherin/GAPDH
N-cadherin
Severe asthmatic Mild asthmatic
N-cadherin 130 kDa
E-cadherin 110 kDa
GAPDH 37 kDa
Healthy control
IL-22 (10 ng/ml)
TGF-β1 (10 ng/ml)
+-+-
+--+
+-+-
+--+
+-+-
+--+
E-cadherin
0.0
0.5
1.0
1.5
2.0
Control IL-22 TGF-βIL-22+TGF-β
Healthy control
Mild asthmatic
Severe asthmatic
0
1
2
3
4
5
6
Control IL-22 TGF-βIL-22+TGF-β
Healthy control
Mild asthmatic
Severe asthmatic
**
***
§
N-cadherin/GAPDH
A
BC
*
*
†
†
†
*
††
Figure 5 IL-22 cooperates with TGF-β1 in reducing E-cadherin protein expression in asthmatic primary bronchial epithelial cells.
Primary bronchial epithelial cells were obtained from healthy controls, mild asthmatics and severe asthmatics, grown to confluence, serum
starved overnight and stimulated with IL-22, TGF-β1 (10 ng/mL each) or both cytokines for 5 days before evaluating (A) E-cadherin and
N-cadherin protein expression by Western blot. (B, C) Quantification of E-cadherin and N-cadherin expression levels is shown relative to GAPDH
expression. n=4-5 per group, *p<0.05 vs. control unstimulated cells, †p<0.05 vs. IL-22 stimulated cells, §p=0.08 vs. TGF-β1 stimulated cells.
Johnson et al. Respiratory Research 2013, 14:118 Page 7 of 12
http://respiratory-research.com/content/14/1/118
and that bronchial epithelial cells from severe asthmatics
are more sensitive to the effects of IL-22 stimulation in
the context of TGF-β1 exposure, thus supporting a role
for this cytokine in more severe, steroid refractory pheno-
types of this disease.
It has become clear in recent years that different phe-
notypes of asthma are differentially regulated by cyto-
kines. While Th2 cytokines are involved in milder forms
of allergic asthma, Th17 cytokines (IL-17A, IL-17 F and
IL-22) are more strongly associated with severe, difficult
to treat asthma [3-6]. However, there is currently limited
information on the role of Th17 associated cytokines, in-
cluding IL-22, in human asthma. Zhao et al. demonstrated
that the percentage of Th17 cells and plasma concentra-
tions of IL-17 and IL-22 are increased in proportion to the
severity of allergic airway disease [6]. In vitro, it has been
shown that IL-22 promotes the proliferation and migra-
tion of airway smooth muscle cells [28,29]. It has also been
shown that ovalbumin (OVA)-sensitized and challenged
Balb/C mice express IL-22 in the lung, whereas this cyto-
kine is undetectable in control animals [30]. Thus, it is
likely that the co-expression of IL-22 along with other cy-
tokines, for example IL-17A or TGF-β1, may have differ-
ent effects than if IL-22 is expressed alone. In severe
asthma, there is significantly higher expression of TGF-β1
compared to milder forms of asthma [31], suggesting the
possibility that, in severe asthma, IL-22 may have different
effects than in acute or mild disease because of the associ-
ated expression of TGF-β1. TGF-β1 is a potent promoter
of EMT in airway epithelial cells [32]. Recently, it has been
shown that TGF-β1-induced EMT in human bronchial
epithelial cells is enhanced by IL-1β[33] and TNF-α[34],
but the role of other cytokines such as IL-22 in the induc-
tion of EMT has not been explored.
The results from this study corroborate the findings of
Zhao et al. [6] as IL-22 expression was predominantly
detected in the subepithelial region of inflamed airways
in severe asthma patients. As further support for the
increased activity of IL-22 in severe asthma, primary
bronchial epithelial cells obtained from severe asthmatics
expressed significantly higher levels of the IL-22 receptor.
Taken together, these results suggest that IL-22 expression
and signaling is associated with severe allergic airway dis-
ease rather than milder forms of asthma. However, as some
studies have demonstrated a tissue-protective role of IL-22
in terms of reducing the expression of proinflammatory
cytokines such as IFN-γ[35] and enhancing barrier func-
tion [36], it was important to evaluate the impact of IL-22
stimulation on airway epithelial cells, both alone and in the
context of stimulation with TGF-β1, a cytokine that is
closely associated with severe asthma and tissue remo-
deling due to its role in the induction of EMT.
Previous studies have demonstrated that well-
differentiated airway epithelial cell cultures from asth-
matics undergo EMT more readily compared to control
subjects, suggesting that epithelial repair in asthmatic
airways is dysregulated [32], a finding which is sup-
ported by the results of the current study. Based on cel-
lular morphology following 5 days of stimulation with
TGF-β1, either with or without concomitant IL-22 stimula-
tion, primary epithelial cells derived from patients with se-
vere asthma underwent a more complete transition to a
mesenchymal phenotype compared to cells from mild
asthmatics and normal control subjects. This change from
a typical epithelial cobblestone-like morphology to spindle-
shaped mesenchymal cells driven by TGF-β1iswell-
described in the literature, not only regarding airway epi-
thelial cells in the context of asthma [17,32], but also in the
context of tumor cell metastasis [37]. The results of this
study show that the morphological change induced by
TGF-β1 in airway epithelial cells is a factor of disease se-
verity in the patients from whom the cells were derived,
supporting previous studies [32], but covering a broader
range of disease severity.
The switch from an epithelial to a mesenchymal pheno-
type was assessed by evaluating changes in the expression
of epithelial E-cadherin and mesenchymal N-cadherin by
qPCR, along with the expression of MUC5AC, an airway
epithelial marker, and vimentin, a mesenchymal marker
which is frequently investigated in studies on EMT [21].
TGF-β1 robustly decreased the expression of MUC5AC
(by 80-90%) in primary bronchial epithelial cells from all
subjects, demonstrating the loss of a characteristic airway
epithelial cell marker under these conditions, although no
further reduction in MUC5AC levels was observed when
IL-22 was given to these cells along with TGF-β1.
0
5
10
15
20
25
30
Control IL-22 TGF IL-22 + TGF
Healthy controls
Mild asthmatics
Severe asthmatics
N-cadherin/E-cadherin
*†
§
*†
*†
*†
*†
*†
Figure 6 Primary bronchial epithelial cells from severe
asthmatics undergo a more profound cadherin switch in
response to TGF-β1 and IL-22 stimulation. Primary bronchial
epithelial cells were obtained from healthy controls, mild asthmatics
and severe asthmatics, grown to confluence, serum starved overnight
and stimulated with IL-22, TGF-β1 (10 ng/mL each) or both cytokines
for 5 days. (A) The switch in cadherin expression from E-cadherin
(epithelial) to N-cadherin (mesenchymal) was assessed by Western blot.
n=4-5 per group, *p<0.05 vs. control unstimulated cells, †p<0.05 vs.
IL-22 stimulated cells, §p<0.05 vs. TGF-β1 stimulated cells.
Johnson et al. Respiratory Research 2013, 14:118 Page 8 of 12
http://respiratory-research.com/content/14/1/118
Conversely, TGF-β1 stimulation induced a milder (~50%)
reduction in E-cadherin mRNA expression, which was
only significant in cells from healthy control and severe
asthmatics, suggesting that E-cadherin is more robustly
expressed and tightly regulated than mucin genes under
EMT conditions. IL-22 stimulation in the context of TGF-
β1 exposure led to a further reduction in the expression of
E-cadherin mRNA, although these changes were only
statistically significant in cells derived from severe asth-
matics. qPCR analysis was also performed for N-cadherin
and vimentin to evaluate the impact of IL-22 and TGF-β1
stimulation on the expression of mesenchymal genes in
bronchial epithelial cells. As expected, a significant upre-
gulation in N-cadherin and vimentin mRNA was seen in
the cells from all three patient groups following 3 days of
stimulation with TGF-β1, while no effects of IL-22 were
observed on the expression of mesenchymal genes, either
when given alone or in combination with TGF-β1. These
results demonstrate that, unlike TGF-β1, IL-22 is not a
bona fide EMT-inducing cytokine, as it does not appear to
induce a global change in epithelial and mesenchymal
gene expression as observed in cells treated with TGF-β1.
0
20
40
60
80
100
120
Control IL-22 TGF-βIL-22+TGF-β
Relative expression (vs. GAPDH)
0
1
2
3
4
5
6
7
8
9
Control IL-22 TGF-βIL-22+TGF-β
Relative expression (vs. GAPDH)
Snail1 Snail2
0
1
2
3
4
5
6
7
Control IL-22 TGF-βIL-22+TGF-β
Relative expression (vs. GAPDH)
0
1
2
3
4
5
6
7
8
Control IL-22 TGF-βIL-22+TGF-β
Relative expression (vs. GAPDH)
0
5
10
15
20
25
30
35
40
Control IL-22 TGF-βIL-22+TGF-β
Relative expression (vs. GAPDH)
0
2
4
6
8
10
12
Control IL-22 TGF-βIL-22+TGF-β
Relative expression (vs. GAPDH)
Twist1 Twist2
Zeb1 Zeb2
*†
*†
*†
*†*†
*†
*†
*†
*†
*†
*†
*
*
*‡
*
**
*
*
***‡
*
†
*
†
*‡
§
*
**
*‡
*
*
*‡
*
*
*
*
Figure 7 IL-22 cooperates with TGF-β1 in promoting the expression of EMT-associated transcription factors. Primary bronchial epithelial
cells were obtained from healthy controls, mild asthmatics and severe asthmatics, grown to confluence, serum starved overnight and stimulated with
IL-22, TGF-β1 (10 ng/mL each) or both cytokines for 5 days. The mRNA expression levels of transcription factor essential in epithelial-mesenchymal transition
were assessed by qPCR. n=4-5 per group, *p<0.05 vs. control unstimulated cells, †p<0.05 vs. IL-22 stimulated cells, §p<0.05 vs. TGF-β1 stimulated cells,
‡p<0.05 vs. healthy control.
Johnson et al. Respiratory Research 2013, 14:118 Page 9 of 12
http://respiratory-research.com/content/14/1/118
However, the further decrease in E-cadherin mRNA ex-
pression in severe asthmatic cells when IL-22 was added
with TGF-β1 suggests that IL-22 may facilitate EMT in se-
vere disease by further depressing E-cadherin expression.
This finding was supported by Western blot analysis of
the cadherin switch in these cells, with significantly higher
levels of N-cadherin and a virtual disappearance of E-
cadherin seen in the cells from severe asthmatics following
stimulation with TGF-β1. As seen on the mRNA level, a
trend for a further decrease in E-cadherin expression was
observed in severe asthmatic cells treated with both IL-22
and TGF-β1 compared to expression levels following TGF-
β1 stimulation alone. This effect was more evident when
the ratio of E-cadherin to N-cadherin was determined in
these cells, as severe asthmatic cells demonstrated a more
profound cadherin switch when IL-22 stimulation occurred
in the context of TGF-β1 exposure. These results confirm
that TGF-β1 potently suppresses the expression of epithe-
lial adherens junction proteins in primary bronchial epithe-
lial cells, and that concurrent stimulation with IL-22
contributes to this suppression, predominantly in cells
taken from patients with severe asthma pathology. This
finding is especially interesting given previous studies
showing impaired intestinal epithelial barrier function in
IL-22 deficient mice [36]. In the present study, treatment
with IL-22 led to a slight but not significant increase in the
expression of E-cadherin protein levels in healthy control
cells; however, an assessment of barrier function in cul-
tured airway epithelial cells was not within the scope of the
present investigation.
The effects of TGF-β1 on epithelial and mesenchymal
gene expression in human airway epithelial cells have
been explored in a number of studies [21,32,33,38,39].
The results obtained in this study, with decreased ex-
pression of E-cadherin as well as increased expression of
vimentin and N-cadherin, agree with these previous re-
ports. However, the role of IL-22 in EMT, either alone
or in the context of TGF-β1 stimulation, has not yet
been investigated. This study provides novel results in
that the combined impact of IL-22 with TGF-β1was
associated with an additive effect on the suppression of
E-cadherin in primary bronchial epithelial cells, thus
promoting the loss of adherens junctions in these cells,
which has been previously described as an early event in
the process of EMT [37]. It is important to highlight the
fact that IL-22 mediated its most robust effects in the
context of TGF-β1 stimulation in cells obtained from se-
vere asthmatics. This result corroborates previous stu-
dies showing that asthmatic epithelial cells more readily
progress through EMT [32], but provide novel insight
into the mechanism by which this occurs. As IL-22 is
highly expressed in severe asthmatics compared to mild
asthmatics and normal control subjects, exposure to IL-22
in vivo may increase the sensitivity of these cells to EMT-
promoting stimuli such as TGF-β1in vitro. Further studies
are certainly warranted to investigate the molecular mech-
anisms responsible for this, as well as the impact of other
cytokines expressed in severe asthma, such as IL-17A,
on the ability of bronchial epithelial cells to progress
through EMT.
IL-22 mediates its signaling through a heterodimeric re-
ceptor composed of the IL-22R1 chain and the IL-10R2
chain [40]; downstream signaling is mediated predomin-
antly via STAT3 [41]. Conversely, TGF-β1signalsthrough
thetypeIITGF-βreceptor (TGF-βRII), which then phos-
phorylates and activates signaling Smads such as Smad2,
Smad3 and Smad4. Once activated, these Smads translocate
to the nucleus to mediate their effects on the transcription
of target genes [42]. To investigate the transcriptional regu-
lation of EMT in primary bronchial epithelial cells stimu-
lated with IL-22, TGF-β, and IL-22+TGF-β1, changes in
the expression of EMT-associated transcription factors
were investigated by qPCR. As expected, TGF-β1stimula-
tion alone potently upregulated the mRNA expression of
all these transcription factors, most notably in cells derived
from severe asthmatics. Costimulation with IL-22 and
TGF-β1 had variable effects, with no change in the expres-
sion of Snail2 and Zeb2, a trend for a reduction in the ex-
pression of Twist1 and Twist2, and a significant increase in
the expression of Snail1 and Zeb1 relative to expression
levels following stimulation with TGF-β1 alone. Interest-
ingly, the highest levels of Snail1 and Zeb1 were observed
in cells obtained from severe asthmatics, with evidence of a
synergistic effect of IL-22 and TGF-β1onthemRNAex-
pression of these key EMT-associated transcription factors
in severe asthmatic bronchial epithelial cells, which may ex-
plain the profound cadherin switch observed in these cells.
Previous studies have demonstrated that Snail1 forms a
transcriptional repressor complex with Smad3 and Smad4
to promote EMT in epithelial cells; suppression of both
Snail and Smad4 by siRNA potently suppressed the induc-
tion of EMT, supporting the key role played by these tran-
scription factors in this process [43]. In the present study,
concurrent stimulation of severe asthmatic bronchial epi-
thelial cells with IL-22 and TGF-β1 led to a robust upregu-
lation in Snail1 expression. This result may explain the
effect of combined IL-22/TGF-β1 stimulation on E-
cadherin repression in severe asthmatic cells, as this gene is
highly sensitive to repression by the Snail1/Smad complex
[43], whereas Twist transcription factors have been found
to affect E-cadherin expression only indirectly [44].
Taken together, the results of this study suggest that the
process of EMT as a factor contributing to the development
of airway remodeling may only be clinically meaningful in
patients with severe asthma. However, a strategy to inhibit
the expression or signaling of cytokines that play a role in
this process in milder stages of the disease may have
a beneficial impact on lung structure and function by
Johnson et al. Respiratory Research 2013, 14:118 Page 10 of 12
http://respiratory-research.com/content/14/1/118
impeding this process. Further in vivo investigations are re-
quired to establish the effect of IL-22 inhibition on the pro-
gression of airway remodeling in chronic allergic asthma.
Competing interests
The authors declare that they have no competing interests.
Authors’contributions
JRJ contributed to the design of the study, carried out cell culture experiments,
performed PCR, analyzed the data, prepared the figures and drafted the
manuscript; MN carried out cell culture experiments, performed PCR and
immunoblotting and analyzed the data; JC provided primary cell cultures,
contributed to the design of the study and contributed to manuscript
preparation; PR contributed to the design of the study, carried out cell culture
experiments, performed PCR and analyzed the data; IA carried out cell culture
experiments and performed PCR; ANB carried out cell culture experiments and
performed PCR; SP contributed to the design of the study; JM provided
intellectual contributions and contributed to manuscript preparation; DE
provided intellectual contributions and contributed to manuscript preparation;
QH contributed to the design of the study, provided intellectual contributions,
contributed to manuscript preparation and provided funding for the study. All
authors read and approved the final manuscript.
Acknowledgments
The technical assistance of Fazila Chouiali is gratefully acknowledged. The
authors also thank Dr. Michel Laviolette for performing the bronchoscopies
and Sabrina Biardel from the Tissue Bank of the Respiratory Health Network
of the FRSQ, Laval site. Financial support for this study was provided by the
Richard and Edith Strauss Canada Foundation and the Canadian Institutes for
Health Research.
This study was financially supported by the Strauss Foundation and the
Canadian Institutes for Health Research.
Author details
1
Meakins-Christie Laboratories, McGill University, 3626 St. Urbain Street,
Montréal, QC H2X 2P2, Canada.
2
Centre de recherche de l'institut
universitaire de cardiologie et de pneumologie de Québec, Québec, Canada.
Received: 21 June 2013 Accepted: 20 September 2013
Published: 1 November 2013
References
1. Kim HY, DeKruyff RH, Umetsu DT: The many paths to asthma: phenotype
shaped by innate and adaptive immunity. Nat Immunol 2010, 11:577–584.
2. Lloyd CM, Hessel EM: Functions of T cells in asthma: more than just T(H)2
cells. Nat Rev Immunol 2010, 10:838–848.
3. Al-Ramli W, Prefontaine D, Chouiali F, Martin JG, Olivenstein R, Lemiere C,
Hamid Q: T(H)17-associated cytokines (IL-17A and IL-17F) in severe
asthma. J Allergy Clin Immunol 2009, 123:1185–1187.
4. Bullens DM, Truyen E, Coteur L, Dilissen E, Hellings PW, Dupont LJ,
Ceuppens JL: IL-17 mRNA in sputum of asthmatic patients: linking T cell
driven inflammation and granulocytic influx? Respir Res 2006, 7:135.
5. Wong CK, Lun SW, Ko FW, Wong PT, Hu SQ, Chan IH, Hui DS, Lam CW:
Activation of peripheral Th17 lymphocytes in patients with asthma.
Immunol Invest 2009, 38:652–664.
6. Zhao Y, Yang J, Gao YD, Guo W: Th17 immunity in patients with allergic
asthma. Int Arch Allergy Immunol 2010, 151:297–307.
7. Borish LC, Nelson HS, Corren J, Bensch G, Busse WW, Whitmore JB,
Agosti JM: Efficacy of soluble IL-4 receptor for the treatment of adults
with asthma. J Allergy Clin Immunol 2001, 107:963–970.
8. Corren J, Busse W, Meltzer EO, Mansfield L, Bensch G, Fahrenholz J,
Wenzel SE, Chon Y, Dunn M, Weng HH, Lin SL: A randomized, controlled,
phase 2 study of AMG 317, an IL-4Ralpha antagonist, in patients with
asthma. Am J Respir Crit Care Med 2010, 181:788–796.
9. Leckie MJ, ten Brinke A, Khan J, Diamant Z, O'Connor BJ, Walls CM, Mathur AK,
Cowley HC, Chung KF, Djukanovic R, et al:Effects of an interleukin-5 blocking
monoclonal antibody on eosinophils, airway hyper-responsiveness, and the
late asthmatic response. Lancet 2000, 356:2144–2148.
10. Nair P, Pizzichini MM, Kjarsgaard M, Inman MD, Efthimiadis A, Pizzichini E,
Hargreave FE, O'Byrne PM: Mepolizumab for prednisone-dependent
asthma with sputum eosinophilia. N Engl J Med 2009, 360:985–993.
11. Lubberts E: Th17 cytokines and arthritis. Semin Immunopathol 2010, 32:43–53.
12. Blaschitz C, Raffatellu M: Th17 cytokines and the gut mucosal barrier.
J Clin Immunol 2010, 30:196–203.
13. Fitch E, Harper E, Skorcheva I, Kurtz SE, Blauvelt A: Pathophysiology of
psoriasis: recent advances on IL-23 and Th17 cytokines. Curr Rheumatol
Rep 2007, 9:461–467.
14. Zenewicz LA, Flavell RA: Recent advances in IL-22 biology. Int Immunol
2011, 23:159–163.
15. Zenewicz LA, Flavell RA: IL-22 and inflammation: leukin' through a glass
onion. Eur J Immunol 2008, 38:3265–3268.
16. Dunnill MS, Massarella GR, Anderson JA: A comparison of the quantitative
anatomy of the bronchi in normal subjects, in status asthmaticus, in
chronic bronchitis, and in emphysema. Thorax 1969, 24:176–179.
17. Kuwano K, Bosken CH, Pare PD, Bai TR, Wiggs BR, Hogg JC: Small airways
dimensions in asthma and in chronic obstructive pulmonary disease.
Am Rev Respir Dis 1993, 148:1220–1225.
18. Benayoun L, Druilhe A, Dombret MC, Aubier M, Pretolani M: Airway
structural alterations selectively associated with severe asthma.
Am J Respir Crit Care Med 2003, 167:1360–1368.
19. Pepe C, Foley S, Shannon J, Lemiere C, Olivenstein R, Ernst P, Ludwig MS,
Martin JG, Hamid Q: Differences in airway remodeling between subjects
with severe and moderate asthma. J Allergy Clin Immunol 2005, 116:544–549.
20. Kalluri R, Neilson EG: Epithelial-mesenchymal transition and its
implications for fibrosis. J Clin Investig 2003, 112:1776–1784.
21. Johnson JR, Roos A, Berg T, Nord M, Fuxe J: Chronic respiratory
aeroallergen exposure in mice induces epithelial-mesenchymal transition
in the large airways. PLoS One 2011, 6:e16175.
22. Kalluri R, Weinberg RA: The basics of epithelial-mesenchymal transition.
J Clin Investig 2009, 119:1420–1428.
23. Zhao J, Lloyd CM, Noble A: Th17 responses in chronic allergic airway
inflammation abrogate regulatory T-cell-mediated tolerance and
contribute to airway remodeling. Mucosal Immunol 2012, 6(2):335–346.
24. Bateman ED, Hurd SS, Barnes PJ, Bousquet J, Drazen JM, FitzGerald M,
Gibson P, Ohta K, O'Byrne P, Pedersen SE, et al:Global strategy for asthma
management and prevention: GINA executive summary. Eur Respir J 2008,
31:143–178.
25. Proceedings of the ATS workshop on refractory asthma: current
understanding, recommendations, and unanswered questions: American
Thoracic Society. Am J Respir Crit Care Med 2000, 162:2341–2351.
26. Goulet F, Boulet LP, Chakir J, Tremblay N, Dube J, Laviolette M, Boutet M,
Xu W, Germain L, Auger FA: Morphologic and functional properties of
bronchial cells isolated from normal and asthmatic subjects. Am J Respir
Cell Mol Biol 1996, 15:312–318.
27. Darveau ME, Jacques E, Rouabhia M, Hamid Q, Chakir J: Increased T-cell
survival by structural bronchial cells derived from asthmatic subjects cul-
tured in an engineered human mucosa. J Allergy Clin Immunol 2008,
121:692–699.
28. Chang Y, Al-Alwan L, Risse PA, Halayko AJ, Martin JG, Baglole CJ, Eidelman
DH, Hamid Q: Th17-associated cytokines promote human airway smooth
muscle cell proliferation. FASEB J 2012, 26:5152–5160.
29. Chang Y, Al-Alwan L, Risse PA, Roussel L, Rousseau S, Halayko AJ, Martin JG,
Hamid Q, Eidelman DH: TH17 cytokines induce human airway smooth muscle
cell migration. J Allergy Clin Immunol 2011, 127:1046–1053. e1041-1042.
30. Schnyder B, Lima C, Schnyder-Candrian S: Interleukin-22 is a negative
regulator of the allergic response. Cytokine 2010, 50:220–227.
31. Halwani R, Al-Muhsen S, Al-Jahdali H, Hamid Q: Role of transforming
growth factor-beta in airway remodeling in asthma. Am J Respir Cell Mol
Biol 2011, 44:127–133.
32. Hackett TL, Warner SM, Stefanowicz D, Shaheen F, Pechkovsky DV,
Murray LA, Argentieri R, Kicic A, Stick SM, Bai TR, Knight DA: Induction of
epithelial-mesenchymal transition in primary airway epithelial cells from
patients with asthma by transforming growth factor-beta1. Am J Respir
Crit Care Med 2009, 180:122–133.
33. Doerner AM, Zuraw BL: TGF-beta1 induced epithelial to mesenchymal
transition (EMT) in human bronchial epithelial cells is enhanced by
IL-1beta but not abrogated by corticosteroids. Respir Res 2009, 10:100.
34. Camara J, Jarai G: Epithelial-mesenchymal transition in primary human
bronchial epithelial cells is Smad-dependent and enhanced by fibronectin
and TNF-alpha. Fibrogenesis & Tissue Repair 2010, 3:2.
35. Pennino D, Bhavsar PK, Effner R, Avitabile S, Venn P, Quaranta M,
Marzaioli V, Cifuentes L, Durham SR, Cavani A, et al:IL-22 suppresses
Johnson et al. Respiratory Research 2013, 14:118 Page 11 of 12
http://respiratory-research.com/content/14/1/118
IFN-gamma-mediated lung inflammation in asthmatic patients.
J Allergy Clin Immunol 2013, 131:562–570.
36. Hanash AM, Dudakov JA, Hua G, O'Connor MH, Young LF, Singer NV,
West ML, Jenq RR, Holland AM, Kappel LW, et al:Interleukin-22 protects
intestinal stem cells from immune-mediated tissue damage and
regulates sensitivity to graft versus host disease. Immunity 2012,
37:339–350.
37. Rodriguez FJ, Lewis-Tuffin LJ, Anastasiadis PZ: E-cadherin's dark side:
Possible role in tumor progression. Biochim Biophys Acta 1826,
2012:23–31.
38. Kamitani S, Yamauchi Y, Kawasaki S, Takami K, Takizawa H, Nagase T,
Kohyama T: Simultaneous stimulation with TGF-beta1 and TNF-alpha
induces epithelial mesenchymal transition in bronchial epithelial cells.
Int Arch Allergy Immunol 2011, 155:119–128.
39. Heijink IH, Postma DS, Noordhoek JA, Broekema M, Kapus A: House dust
mite-promoted epithelial-to-mesenchymal transition in human bronchial
epithelium. Am J Respir Cell Mol Biol 2010, 42:69–79.
40. Kotenko SV, Izotova LS, Mirochnitchenko OV, Esterova E, Dickensheets H,
Donnelly RP, Pestka S: Identification of the functional interleukin-22
(IL-22) receptor complex: the IL-10R2 chain (IL-10Rbeta ) is a common
chain of both the IL-10 and IL-22 (IL-10-related T cell-derived inducible
factor, IL-TIF) receptor complexes. J Biol Chem 2001, 276:2725–2732.
41. Lejeune D, Dumoutier L, Constantinescu S, Kruijer W, Schuringa JJ,
Renauld JC: Interleukin-22 (IL-22) activates the JAK/STAT, ERK, JNK, and
p38 MAP kinase pathways in a rat hepatoma cell line. Pathways that are
shared with and distinct from IL-10. J Biol Chem 2002, 277:33676–33682.
42. Rosendahl A, Pardali E, Speletas M, Ten Dijke P, Heldin CH, Sideras P:
Activation of bone morphogenetic protein/Smad signaling in bronchial
epithelial cells during airway inflammation. Am J Respir Cell Mol Biol 2002,
27:160–169.
43. Vincent T, Neve EP, Johnson JR, Kukalev A, Rojo F, Albanell J, Pietras K,
Virtanen I, Philipson L, Leopold PL, et al:A SNAIL1-SMAD3/4 transcriptional
repressor complex promotes TGF-beta mediated epithelial-mesenchymal
transition. Nat Cell Biol 2009, 11:943–950.
44. Yang J, Weinberg RA: Epithelial-mesenchymal transition: at the crossroads
of development and tumor metastasis. Dev Cell 2008, 14:818–829.
doi:10.1186/1465-9921-14-118
Cite this article as: Johnson et al.:IL-22 contributes to TGF-β1-mediated
epithelial-mesenchymal transition in asthmatic bronchial epithelial cells.
Respiratory Research 2013 14:118.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Johnson et al. Respiratory Research 2013, 14:118 Page 12 of 12
http://respiratory-research.com/content/14/1/118
