ArticlePDF Available

DNA barcoding and morphology reveal three cryptic species of Anania (Lepidoptera: Crambidae: Pyraustinae) in North America, all distinct from their European counterpart

Authors:
  • Northwest A&F University

Abstract and Figures

Anania coronata (Hufnagel), a Holarctic species of pyraustine crambid moth, has long been treated as having two geographically separated subspecies – the nominotypical Anania coronata in the Palaearctic Region and Anania coronata tertialis (Guenée) in the Nearctic Region. Maximum likelihood and Bayesian inference analysis of mitochondrial DNA barcodes both recover four well-supported, reciprocally monophyletic groups within Anania coronata. Qualitative and quantitative analyses of genital structures reveal diagnostic differences that correspond to the four barcode lineages. On the basis of both molecular and morphological evidence, we conclude that Anania coronata is actually a complex of four species. Anania coronata (Hufnagel) is restricted to Europe, whereas three species occur in North America: Anania tertialis (Guenée), Anania plectilis (Grote & Robinson) and Anania tennesseensissp.n. Yang.
Content may be subject to copyright.
Systematic Entomology (2012), 37, 686 705
DNA barcoding and morphology reveal three cryptic
species of Anania (Lepidoptera: Crambidae:
Pyraustinae) in North America, all distinct from their
European counterpart
ZHAOFU YANG
1,9, JEAN-FRANC¸ OIS LANDRY
2,LOUIS
HANDFIELD
3, YALIN ZHANG
1,M.ALMASOLIS
4, DANIEL
HANDFIELD
5, BRIAN G. SCHOLTENS
6, MARKO MUTANEN
7,
MATTHIAS NUSS
8and PAUL D. N. HEBERT
9
1Key laboratory of Plant Protection Resources and Pest Management, Ministry of Education; Entomological Museum, Northwest
A&F University, Yangling, China, 2Agriculture and Agri-Food Canada, Eastern Cereal and Oilseed Research Centre, C.E.F.,
Ottawa, Ontario K1A 0C6, Canada, 3133 rue Messier, #301, Mont-Saint-Hilaire, Qu´
ebec J3H 2W8, Canada, 4Systematic
Entomology Laboratory, USDA, c/o Smithsonian Institution, National Museum Natural History, Washington, DC 20013-7012,
U.S.A., 5Chemin des Grands Coteaux, Saint-Mathieu-de-Beloeil, Qu´
ebec, Canada, 6Department of Biology, College of
Charleston, SC, U.S.A., 7Department of Biology, University of Oulu, Zoological Museum, Oulu, Finland, 8Museum of Zoology,
Senckenberg Natural History Collections Dresden, K¨
onigsbr¨
ucker Landstrasse 159, 01109 Dresden, Germany and 9Biodiversity
Institute of Ontario, University of Guelph, Guelph, Ontario N1G 2W1, Canada
Abstract. Anania coronata (Hufnagel), a Holarctic species of pyraustine crambid
moth, has long been treated as having two geographically separated subspecies – the
nominotypical Anania coronata in the Palaearctic Region and Anania coronata tertialis
(Guen´
ee) in the Nearctic Region. Maximum likelihood and Bayesian inference analysis
of mitochondrial DNA barcodes both recover four well-supported, reciprocally
monophyletic groups within Anania coronata. Qualitative and quantitative analyses
of genital structures reveal diagnostic differences that correspond to the four barcode
lineages. On the basis of both molecular and morphological evidence, we conclude that
Anania coronata is actually a complex of four species. Anania coronata (Hufnagel) is
restricted to Europe, whereas three species occur in North America: Anania tertialis
(Guen´
ee), Anania plectilis (Grote & Robinson) and Anania tennesseensis sp.n. Yang.
Introduction
Anania coronata (Hufnagel) is a Holarctic species that ranges
from Europe through Asia to Japan, and to North America
(Munroe, 1976; Inoue, 1982; Speidel, 1996; Sinev, 2008).
Munroe (1954, 1976) and Munroe et al. (1995) treated
North American populations as a distinct subspecies, Anania
coronata tertialis (Guen´
ee). Two other North American
Correspondence: Yalin Zhang, Key laboratory of Plant Protection
Resources and Pest Management, Ministry of Education, Entomolog-
ical Museum, Northwest A&F University, Yangling 712100, China.
E-mail: yalinzh@yahoo.com
taxa have long been regarded as synonyms of Anania
coronata tertialis:Botys plectilis Grote & Robinson and
Botys syringicola Packard (Dyar, 1903; McDunnough, 1938;
Munroe, 1976; Munroe et al., 1995; Hodges et al., 1983).
Munroe (1976) indicated that more than one species might
be included within Anania coronata because of its Holarctic
distribution and morphological variation, but he did not analyse
it in detail. Following an examination of some North American
specimens in the Mus´
eum d’histoire naturelle de Paris, Leraut
(2005) raised both tertialis and plectilis to full species rank
separate from coronata and illustrated male genital characters
distinguishing them from the nominal coronata and from each
other. However, Leraut did not examine any type specimens
©2012 The Authors
686 Systematic Entomology ©2012 The Royal Entomological Society
DNA barcoding reveals three cryptic species of Anania 687
and appeared to rely entirely on the identifications of specimens
in the Paris Museum to revise the status of these species.
He retained Botys syringicola as a synonym of Anania
tertialis.
Despite the great value of genital characters for species
recognition, the preparation of genitalia is so time consuming
that it limits the use of this approach for large-scale specimen
sorting and examination. As a consequence, cryptic species
are commonly overlooked, particularly in taxa with broad
distributions (Smith et al., 2006; Burns et al., 2007; Kristensen
et al., 2007). The recent integration of morphological and
DNA-based approaches has revealed an effective way to
accelerate species discovery and description (Dayrat, 2005;
Lumley & Sperling, 2010; Padial & De La Riva, 2010;
Padial et al., 2010; Schlick-Steiner et al., 2010), as well as
assist in detecting previously unsuspected cryptic species
(Hebert et al., 2004; Wilson et al., 2010; Mutanen et al.,
2012). Comprehensive studies of lepidopteran faunas have
revealed 90–98% discrimination of species in varied settings
(Hajibabaei et al., 2006a; Hebert et al., 2010; Dinca et al.,
2011; deWaard et al., 2011).
The present investigation was prompted by results obtained
during an effort to barcode all Lepidoptera species in the
Holarctic region (see http://www.lepbarcoding.org/) which
revealed that specimens of Anania coronata from North
America and Europe separated into four sequence clusters.
This paper examines the geographic distribution of these
four lineages and the morphological divergence among them.
We compare phenotypic characters and COI sequences to
illuminate species differences among North American and
European samples, and to clarify the nomenclature of this
species complex.
Material and methods
Taxon sampling
Eighty-nine specimens of Anania coronata from Europe
and North America (Fig. 1) were analysed as well as 20
specimens from three congeneric taxa – Anania quebecensis
(Munroe), Anania perlucidalis (H ¨
ubner) and Anania stach-
ydalis (Germar). Table 1 summarizes information on these
specimens whereas more complete details including images,
GPS coordinates and information on the institution hold-
ing each specimen are available in the project ‘Ana-
nia coronata ANAN’ on BOLD (www.boldsystems.org).
A paralectotype of Ebulea tertialis in the USNM and
the holotype of Botys plectilis in the AMNH were also
analysed.
Morphological characters and morphometric analysis
Eight female genitalia characters and 14 male genitalia
characters were compared among individuals in each of
the four different lineages of the Anania coronata com-
plex (7 traits for females and 11 characters for males were
analysed morphometrically) (Fig. 2). In total, 11 females and
23 males (Table 2) were dissected, including the female
holotype of Botys plectilis and a female paralectotype of
Fig. 1. Distribution of collection localities of analysed specimens of Anania coronata species complex in this study. Each lineage is represented
by a symbol. The symbol refers to the geographical range to which the genetic lineage belongs: European lineage (22); North American
lineage (47); Eastern North American lineage (19); Tennessee, USA (1).
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
688 Z. Yang et al.
Table 1. Sample information for the Anania specimens included in the sequence.
Taxon
Bold project
code Process ID Specimen ID Haplotype Country State/province Depository
Sequence
length
GenBank
acession
tennesseensis LGSMG LGSMG172-07 BGS03493 Hap1 United States Tennessee USNM 658 JQ348047
coronata CGUKB CGUKB608-09 UKLB18A09 Hap2 United Kingdom England BMNH 658 JQ348024
coronata CGUKC CGUKC074-09 UKLB23A04 Hap2 United Kingdom England BMNH 658 JQ348023
coronata FBLMS FBLMS201-09 BC ZSM Lep 23012 Hap2 Germany Bavaria RCTG 658 HM901988
coronata FBLMU FBLMU401-09 BC ZSM Lep 27051 Hap2 Germany Bavaria ZSC 658 GU707126
coronata LEFIR LEFIA713-10 MM01868 Hap2 Finland Savonia australis UO 658 HM386857
coronata LEFIR LEFIA714-10 MM01869 Hap2 Finland Savonia australis UO 658 HM386858
coronata LEFIR LEFIE721-10 MM09813 Hap2 Finland Aland UO 658 HM874441
coronata PYRG PYRG083-09 BC MTD 00171 Hap2 Poland Podlachien MTD 658 GU700961
coronata PYRG PYRG084-09 BC MTD 00172 Hap2 Germany Baden-Wuerttemberg MTD 658 GU700962
coronata RDNMH RDNMH541-09 CNCLEP00057860 Hap2 Germany Saxony MTD 658 GU679045
coronata RDNMH RDNMH543-09 CNCLEP00057862 Hap2 Germany Saxony MTD 658 GU679039
coronata CGUKA CGUKA485-09 UKLB6B04 Hap3 United Kingdom England BMNH 596 JQ348031
coronata CGUKC CGUKC224-09 UKLB24F02 Hap4 United Kingdom England BMNH 640 JQ348030
coronata CGUKA CGUKA820-09 UKLB9F10 Hap5 United Kingdom BMNH 658 JQ348022
coronata CGUKB CGUKB328-09 UKLB15A11 Hap5 United Kingdom England BMNH 658 JQ348028
coronata CGUKB CGUKB606-09 UKLB18A07 Hap5 United Kingdom England BMNH 658 JQ348027
coronata CGUKB CGUKB607-09 UKLB18A08 Hap5 United Kingdom England BMNH 658 JQ348026
coronata CGUKB CGUKB787-09 UKLB19H12 Hap5 United Kingdom England BMNH 658 JQ348025
coronata CGUKD CGUKD126-09 UKLB34B05 Hap5 United Kingdom England BMNH 658 JQ348029
coronata FBLMS FBLMS057-09 BC ZSM Lep 22980 Hap6 Germany Bavaria RCAH 636 GU706308
coronata FBLMS FBLMS200-09 BC ZSM Lep 23011 Hap7 Germany Bavaria RCTG 624 GU706543
coronata RDNMH RDNMH542-09 CNCLEP00057861 Hap8 Germany Saxony MTD 658 GU679038
plectilis ZYPAN ZYPAN066-10 CNCLEP00074266 Hap9 United States Minnesota CNC 658 HQ987640
plectilis BBLPE BBLPE524-09 09BBELE-2524 Hap9 Canada Newfoundland and Labrador BIO 658 HM416114
plectilis BBLPE BBLPE498-09 09BBELE-2498 Hap10 Canada Newfoundland and Labrador BIO 658 HM416092
plectilis BBLPE BBLPE507-09 09BBELE-2507 Hap11 Canada Newfoundland and Labrador BIO 658 HM416100
plectilis BLTIB BLTIB483-08 BL732 Hap12 Canada Ontario UG 658 JQ348041
plectilis LGSMG LGSMG267-07 BGS03588 Hap13 United States Tennessee CC 658 JQ348040
plectilis LGSMB LGSMB024-04 DNA-ATBI-0873 Hap14 United States North Carolina RCBS 658 GU089510
plectilis LGSMB LGSMB025-04 DNA-ATBI-0874 Hap15 United States North Carolina RCBS 591 GU089511
plectilis LPOKA LPOKA445-09 MDOK-0445 Hap16 United States Oklahoma BIO 658 JQ348043
plectilis LPOKC LPOKC816-09 MDOK-2893 Hap17 United States Oklahoma BIO 658 GU801599
plectilis LPSOD LPSOD766-09 08BBLEP-00548 Hap18 Canada Ontario BIO 658 JQ348044
plectilis RDLQD RDLQD767-06 MDH002015 Hap19 Canada Quebec RCDH 656 JQ348039
plectilis MECD MECD251-06 jflandry2823 Hap19 Canada Quebec CNC 656 JQ348042
plectilis MEC MEC583-04 jflandry0583 Hap20 Canada Quebec CNC 597 GU096009
plectilis ZYPAN ZYPAN061-10 CNCLEP00074261 Hap21 Canada Newfoundland and Labrador CNC 658[1n] HQ987635
plectilis ZYPAN ZYPAN062-10 CNCLEP00074262 Hap22 Canada Newfoundland and Labrador CNC 658 HQ987636
plectilis ZYPAN ZYPAN070-10 CNCLEP00074270 Hap22 Canada Quebec CNC 658 HQ987644
plectilis ZYPAN ZYPAN063-10 CNCLEP00074263 Hap23 Canada Newfoundland and Labrador CNC 658 HQ987637
plectilis ZYPAN ZYPAN069-10 CNCLEP00074269 Hap24 United States Florida CNC 658 HQ987643
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
DNA barcoding reveals three cryptic species of Anania 689
Table 1. Continued.
Taxon
Bold project
code Process ID Specimen ID Haplotype Country State/province Depository
Sequence
length
GenBank
acession
tertialis LBCB LBCB325-05 HLC-21265 Hap25 Canada British Columbia BIO 658 JQ348054
tertialis BLTIB BLTIB381-08 BL611 Hap26 Canada Ontario UG 658 JQ348051
tertialis LBCA LBCA537-05 HLC-20537 Hap26 Canada British Columbia BIO 658 JQ348052
tertialis LPMN LPMN599-08 08BBLEP-01400 Hap26 Canada Manitoba BIO 658 JQ348053
tertialis RWWB RWWB779-10 RWWA-1778 Hap26 United States Washington BIO 658 HQ971973
tertialis LGSMC LGSMC324-05 DNA-ATBI-2324 Hap26 United States Tennessee BIO 658 GU089162
tertialis LGSMC LGSMC323-05 DNA-ATBI-2323 Hap26 United States Tennessee BIO 658 GU089161
tertialis LGSMC LGSMC325-05 DNA-ATBI-2325 Hap26 United States Tennessee BIO 658 GU089160
tertialis RWWA RWWA588-09 RWWA-0606 Hap26 United States Washington BIO 658 GU803197
tertialis RWWA RWWA632-09 RWWA-0650 Hap26 United States Washington BIO 658 GU802611
tertialis RWWA RWWA176-09 RWWA-0176 Hap26 United States Washington BIO 658 GU802869
tertialis RWWA RWWA200-09 RWWA-0200 Hap26 United States Washington BIO 658 GU802845
tertialis RWWA RWWA342-09 RWWA-0342 Hap26 United States Washington BIO 658 GU802798
tertialis RWWA RWWA357-09 RWWA-0357 Hap26 United States Washington BIO 658 GU802781
tertialis RWWA RWWA390-09 RWWA-0390 Hap26 United States Washington BIO 658 GU802750
tertialis XAK XAK207-06 2006-ONT-1202 Hap26 Canada Ontario BIO 658 JQ348049
tertialis LBCD LBCD557-05 HLC-23377 Hap27 Canada British Columbia BIO 658 JQ348062
tertialis LBCD LBCD543-05 HLC-23363 Hap27 Canada British Columbia BIO 658 JQ348063
tertialis LBCD LBCD542-05 HLC-23362 Hap27 Canada British Columbia BIO 658 JQ348064
tertialis LBCA LBCA011-05 HLC-20011 Hap27 Canada British Columbia BIO 658 JQ348058
tertialis LBCA LBCA002-05 HLC-20002 Hap27 Canada British Columbia BIO 658 JQ348059
tertialis TMNBB TMNBB689-06 MNBTT-1629 Hap27 Canada New Brunswick BIO 658 JQ348069
tertialis LBCA LBCA001-05 HLC-20001 Hap27 Canada British Columbia BIO 658 JQ348060
tertialis RDLQE RDLQE558-06 MDH002561 Hap27 Canada Quebec RCDH 658 JQ348071
tertialis LBCA LBCA536-05 HLC-20536 Hap27 Canada British Columbia BIO 658 JQ348061
tertialis LBCF LBCF023-07 07-JDWBC-0072 Hap27 Canada British Columbia RCJD 658 JQ348073
tertialis LPMN LPMN864-08 08BBLEP-02223 Hap27 Canada Manitoba BIO 658 JQ348066
tertialis BLTIB BLTIB387-08 BL617 Hap27 Canada Ontario UG 658 JQ348057
tertialis LPMN LPMN841-08 08BBLEP-01644 Hap27 Canada Manitoba BIO 658 JQ348067
tertialis ZYPAN ZYPAN065-10 CNCLEP00074265 Hap27 Canada Nova Scotia CNC 658 HQ987639
tertialis ZYPAN ZYPAN068-10 CNCLEP00074268 Hap27 United States Minnesota CNC 658 HQ987642
tertialis LBCE LBCE014-05 HLC-23774 Hap28 Canada British Columbia BIO 655 JQ348065
tertialis MNAC MNAC760-07 CNCLEP00027498 Hap28 Canada Quebec CNC 655 JQ348068
tertialis LBCA LBCA924-05 HLC-20924 Hap29 Canada British Columbia BIO 606 JQ348070
tertialis LGSMC LGSMC633-05 DNA-ATBI-2633 Hap30 United States Tennessee BIO 658 GU089163
tertialis LPSOC LPSOC438-08 PPBP-2437 Hap31 Canada Ontario BIO 658 JQ348050
tertialis LPSOC LPSOD178-09 08BBLEP-04003 Hap32 Canada Ontario BIO 658 JQ348056
tertialis LPSOB LPSOB853-08 PPBP-1852 Hap33 Canada Ontario BIO 658 JQ348072
tertialis MEC MEC656-04 jflandry0656 Hap34 Canada Quebec CNC 658 GU096010
tertialis MEC MEC660-04 jflandry0660 Hap35 Canada Quebec CNC 658 GU096011
tertialis MNAC MNAC761-07 CNCLEP00027499 Hap36 Canada Quebec CNC 655 JQ348055
tertialis RDLQD RDLQD766-06 MDH001560 Hap37 Canada Quebec RCDH 657 JQ348048
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
690 Z. Yang et al.
Table 1. Continued.
Taxon
Bold project
code Process ID Specimen ID Haplotype Country State/province Depository
Sequence
length
GenBank
acession
tertialis XAE XAE382-04 Moth4382.03 Hap38 Canada Ontario BIO 568 GU092590
tertialis XAC XAC686-04 04HBL006686 Hap39 Canada Ontario BIO 658 GU093571
tertialis ZYPAN ZYPAN064-10 CNCLEP00074264 Hap40 Canada Nova Scotia CNC 658 HQ987638
tertialis ZYPAN ZYPAN067-10 CNCLEP00074267 Hap41 United States Minnesota CNC 658 HQ987641
tertialis ZYPAN ZYPAN071-10 CNCLEP00074271 Hap42 Canada New Brunswick CNC 307 JQ348074
perlucidalis CGUKB CGUKB585-09 UKLB17G10 Hap43 United Kingdom England BMNH 658 JQ348032
perlucidalis CGUKB CGUKB584-09 UKLB17G09 Hap43 United Kingdom England BMNH 658 JQ348037
perlucidalis CGUKC CGUKC290-09 UKLB25C10 Hap43 United Kingdom England BMNH 658 JQ348034
perlucidalis CGUKC CGUKC928-09 UKLB32A10 Hap43 United Kingdom England BMNH 658 JQ348033
perlucidalis LEFIR LEFIA709-10 MM01864 Hap43 Finland Savonia australis UO 658 HM386854
perlucidalis LEFIR LEFIA710-10 MM01865 Hap43 Finland Savonia australis UO 658 HM386855
perlucidalis CGUKB CGUKB780-09 UKLB19H05 Hap43 United Kingdom England BMNH 658 JQ348035
perlucidalis LEFIR LEFIF771-10 MM12996 Hap43 Finland Regio aboensis UO 658 HM875455
perlucidalis CGUKC CGUKC239-09 UKLB24G05 Hap44 United Kingdom England BMNH 638 JQ348038
perlucidalis CGUKB CGUKB781-09 UKLB19H06 Hap45 United Kingdom England BMNH 658 JQ348036
quebecensis ZYPAN ZYPAN072-10 CNCLEP00074272 Hap46 Canada New Brunswick CNC 307 JQ348046
quebecensis ZYPAN ZYPAN074-10 CNCLEP00074274 Hap47 Canada New Brunswick CNC 307 JQ348045
stachydalis CNPYD CNPYD1599-10 Pyr001599 Hap48 China Shanxi NWAFU 658 HM908380
stachydalis CNPYD CNPYD1601-10 Pyr001601 Hap48 China Shanxi NWAFU 658 HM908381
stachydalis CNPYD CNPYD1602-10 Pyr001602 Hap48 China Shanxi NWAFU 658 HM908382
stachydalis CNPYD CNPYD1603-10 Pyr001603 Hap48 China Shanxi NWAFU 658 HM908383
stachydalis CNPYD CNPYD1604-10 Pyr001604 Hap48 China Shanxi NWAFU 658 HM908384
stachydalis LEFIR LEFIC910-10 MM05244 Hap49 Finland Regio aboensis UO 637 HM872727
stachydalis LEFIR LEFID662-10 MM06695 Hap50 Finland Aland UO 658 HM873424
stachydalis LEFIR LEFIG61710 MM14831 Hap50 Finland Karelia australis UO 658 HM876283
SpecimenIDs are specimen identifiers. ProcessIDs are sequence identifiers. Details of collecting data, images, sequences, and trace files for the 109 specimens listed are available in the Barcode
of Life Database (BOLD) (www.barcodinglife.org) in the project codes indicated. Abbreviations for specimen depositories:
BIO, Biodiversity Institute of Ontario, Guelph, Canada; BMNH, The Natural History Museum, London, UK; CNC, Canadian National Collection of Insects, Ottawa, Canada; RCAH, Research
Collection of Alfred Haslberger, Teisendorf, Germany; RCBS, Research Collection of Brian Scholtens, Charleston, USA; RCDH, Research Collection of Daniel Handfield, Qu´
ebec, Canada;
RCJD, Research Collection of Jeremy deWaard, Vancouver, Canada; RCTG, Research Collection of Theo Gruenewald, Germany; MTD, Museum of Zoology, Dresden, Germany; UG, University
of Guelph, Guelph, Canada; UO, University of Oulu, Oulu, Finland; USNM, National Museum of Natural History, Washington, USA; ZSC, Zoological State Collection, Munich, Germany.
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
DNA barcoding reveals three cryptic species of Anania 691
A
C
B
Fig. 2. Morphological traits measured in the present study. (A) Male genitalia; (B) Phallus; (C) Female genitalia. DASA, diameter of accessory
sac; DBUR, diameter of corpus bursae; LAAP, length of anterior apophyses; LDUC, length of ductus bursae; LPAP, Length of posterior apophyses;
LPHA, length of phallus; LSAC, length of sacculus; LSIG, length of signum; LUNC, length of uncus; LUTV, length from uncus to vinculum;
LVAL, length of valva; LVPR, length of ventral process of editum; PEDI, perimeter of editum; WPHA, width of phallus; WSAC, width of sacculus;
WSIG, width of signum; WUNC, width of uncus; WVAL, width of valva.
Ebulea tertialis. Genital preparations were stained with
Orange G in lactic acid, and characters were measured
before mounting on a microscope slide in Euparal. Each
of the slide-mounted genitalia was photographed with a
Nikon AZ100 Multi-Zoom microscope, and deep-focus images
were produced by stacking approximately 14 images using
Combine Z (http://www.hadleyweb.pwp.blueyonder.co.uk)
(Hadley, 2010). Techniques for preparation of the genitalia
slides and photography followed Landry (2007) whereas gen-
ital terminology follows Munroe (1976), Kristensen (2003)
and Nuss & Speidel (2005). Sets of distance and perime-
ter measurements were taken from the structures of female
and male genitalia using ImageJ v1.43u Java (http://rsbweb.
nih.gov/ij/). Statistical comparisons of female and male gen-
italia were performed using Statistica v8.0 for Windows
(Statsoft Inc., 1999). Whereas principal components analy-
sis (PCA) was performed to summarize patterns of variation
in female and male genitalia, discriminant function analysis
(DFA) was used to determine the morphological variables that
best discriminate individuals of the four barcode lineages. Both
PCA and DFA were performed separately for females and
males. Canonical analysis was conducted in order to maximize
the separation between groups and to determine differences that
best separate them.
DNA extraction and PCR amplification
Barcode records were obtained from 109 specimens by
extracting DNA from a single leg from each individual. All
samples were processed at the Canadian Centre for DNA Bar-
coding (CCDB) using a silica-based 96-well extraction automa-
tion protocol for DNA extraction (Ivanova et al., 2006). The
658 base pair (bp) barcode region of COI (Hebert et al., 2003)
was usually amplified with the LepF1/LepR1 primers (Hebert
et al., 2004), but two additional primer pairs LepF1/MLepR1
and MLepF1/LepR1, which target shorter amplicons (307 bp,
408 bp), were used for some older specimens (Hajibabaei
et al., 2006b). For the two type specimens, we used whole
abdomens for DNA extraction before removing the geni-
talia for dissection (Kn¨
olke et al., 2005). COI sequences were
assembled from shorter amplicons using primer sets designed
for work on specimens with degraded DNA (R. Rougerie and
S. Prosser, personal communication).
The 12.5-μL PCR reaction mixes contained 2.5 mmMgCl2,
1.25 pmof each primer, 50 μmdNTPs, 10 mmTrisHCl
(pH 8.3), 50 mmKCl, 10–20 ng (1–2 μL) of genomic DNA
and 0.3 U of Ta q DNA polymerase (Platinum Ta q DNA
polymerase; Invitrogen, Burlington, Ontario, Canada). The
thermocycling profile consisted of one initial denaturation step
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
692 Z. Yang et al.
Table 2. Genitalia preparations measured in this study.
SpecimenID Slide no. Sex
BGS03493 BIOZY00021 m
CNCLEP00074270 ZY00046 m
09BBELE-1930 BIOZY00015 m
09BBELE-2507 BIOZY00018 m
09BBELE-2524 BIOZY00019 m
09BBELE-2498 BIOZY00020 m
jflandry0583 PYR519 m
MM01869 BIOZY00022 m
MM01868 BIOZY00023 m
MM09813 BIOZY00024 m
CNCLEP00057860 PYR565 m
Moth4382.03 BIOZY00001 m
DNA-ATBI-2324 BIOZY00003 m
DNA-ATBI-2633 BIOZY00005 m
2006-ONT-1202 BIOZY00006 m
HLC-20001 BIOZY00008 m
08BBLEP-01400 BIOZY00009 m
08BBLEP-04003 BIOZY00010 m
08BBLEP-01644 BIOZY00013 m
RWWA-0357 BIOZY00016 m
RWWA-0176 BIOZY00017 m
CNCLEP00074268 ZY00045 m
CNCLEP00027499 PYR521 m
CNCLEP00074266 ZY00044 f
MDOK-0445 BIOZY00011 f
MDOK-2893 BIOZY00012 f
09BBELE-1953 BIOZY00014 f
jflandry2823 PYR520 f
04HBL006686 BIOZY00002 f
DNA-ATBI-2323 BIOZY00004 f
HLC-20002 BIOZY00007 f
CNCLEP00027498 PYR522 f
BC MTD 00172 AT 31 f
CNCLEP00077265 JFL1691 f
of 1 min at 94C, followed by five cycles of 40 s at 94C,
40 s at 45C and 1 min at 72C, followed by 35 cycles of
40 s at 94C, 40 s at 51C and 1 min at 72C, with a final
extension of 5 min at 72C. For mini-barcode fragments, we
used the touch-up profile (Meusnier et al., 2008): a hot start
for 2 min at 94C, followed by denaturation (40 s at 94C),
annealing for 1 min at 46C, extension for 30 s at 72C,
the last three steps cycled five times, then denaturation for
40 s at 94C, annealing for 1 min at 53C, extension for
30 s at 72C, the last three steps cycled 35 times, followed
by a final extension for 30 s at 72C. PCR products were
visualized on a 2% agarose E-Gel 96-well system (Invitrogen).
Unpurified samples revealing faint to strong bands were cycle
sequenced bidirectionally (with the same primers used for
the PCR reactions) in 10 μL reaction volumes containing:
0.25 μL of BigDye®v3.1 (Applied Biosystems, Foster City,
CA), 1.875 μLof5×ABI sequencing buffer, 5 μL of 10%
trehalose, 1 μLof10μmprimer, 0.875 μL of ultra-pure water
and 1 μL of PCR product. The following thermocycling profile
was used for all products: initial denaturation at 96Cfor
2 min, followed by 30 cycles of 96C for 30 s, annealing at
55C for 15 s and extension at 60C for 4 min. Sequences
were generated on an ABI 3730xl DNA Analyser (Applied
Biosystems) after clean-up with Sephadex (Sigma-Aldrich,
St. Louis, MO) (Hajibabaei et al., 2005). The sequences
were managed in SeqScape v2.1.1 (Applied Biosystems)
and Sequencher v4.5 (Gene Code Corporation, Ann Arbor,
MI) and aligned using BioEdit v7.0.5.3 (Hall, 1999) and
MEGA v5.0 (Tamura et al., 2011). Sequences generated in this
study together with collateral information on the specimens
are deposited in BOLD and in GenBank (see Table 1 for
accession numbers). The sequence alignment (FASTA format)
is available as File S1.
Molecular and phylogenetic analysis
Sequences were aligned using CLUSTAL W and genetic
distances within and among lineages were estimated using
the Kimura 2-parameter (K2P) algorithm in MEGA v5.0,
including all sites with the pairwise deletion option. Boot-
strap values were calculated with 1000 replicates (Kimura,
1980; Tamura et al., 2011), and neighbour-joining (NJ) and
minimum-evolution (ME) trees based on distance were con-
structed in MEGA software. We selected Anania perlucidalis,
A. stachydalis and A. quebecensis, which are morphologically
and genetically the most similar members of the genus, as the
primary outgroup to root the trees. The number of haplotypes
was calculated with DnaSP v5.10 (Rozas et al., 2003). BioEdit
v7.0.5.3 in Conservation Plot mode, was used to visualize and
analyse diagnostic characters.
Phylogenies were inferred using Maximum likelihood (ML)
and Bayesian Inference (BI), using PhyML v.3.0 (Guindon &
Gascuel, 2003) and MrBayes v3.1.2 (Ronquist & Huelsenbeck,
2003), respectively. For the parameter values (e.g. sensitivity
to codon bias and unequal rates of evolution) considered, the
statistical inconsistency of Maximum parsimony (MP) method
can occur and was not performed in this study. For ML
analyses, we employed the approximate likelihood ratio test
(aLRT; Anisimova & Gascuel, 2006) to estimate node support.
Nucleotide substitution model parameters were estimated
using jMODELTEST v0.1.1 (Guindon & Gascuel, 2003;
Posada, 2008). In the Bayesian analysis we produced posterior
probability distributions by allowing four incrementally heated
Markov chains (using default heating values) to proceed for
4 000 000 generations, with sampling occurring every 1000
generations. The first 1000 trees were discarded as burn-in,
and those remaining were used to estimate topology and tree
parameters, producing a 50% majority rule consensus tree with
bipartition frequencies equal to posterior probability values
(Ronquist & Huelsenbeck, 2003).
Abbreviations used in the text and figures are as follows:
AMNH (American Museum of Natural History, New York,
USA); BMNH (Natural History Museum, London, UK); CNC
(Canadian National Collection of Insects, Ottawa, Canada);
ENA (Eastern North America); EU (Europe); NA (North
America); TN (Tennessee, USA); USNM (National Museum
of Natural History, Washington, USA).
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
DNA barcoding reveals three cryptic species of Anania 693
Table 3. Kimura 2-parameter genetic distances calculated within (in bold) and between each lineages/species of Anania.
tennesseensis (TN) coronata (EU) plectilis (ENA) tertialis (NA) perlucidalis quebecensis stachydalis
tennesseensis (TN) — 0.0063 0.0053 0.0070 0.0108 0.0175 0.0123
coronata (EU) 0.0287 0.0011 0.0050 0.0068 0.0108 0.0175 0.0129
plectilis (ENA) 0.0240 0.0217 0.0046 0.0071 0.0103 0.0161 0.0125
tertialis (NA) 0.0322 0.0331 0.0368 0.0019 0.0098 0.0163 0.0127
perlucidalis 0.0784 0.0714 0.0687 0.0676 0.0003 0.0123 0.0122
quebecensis 0.0849 0.0871 0.0783 0.0809 0.0491 0.0033 0.0166
stachydalis 0.1027 0.1061 0.1039 0.1095 0.0971 0.0835 0.0071
The diagonal row of values (in bold) indicates intraspecific distances, the values below the diagonal indicates mean interspecific distances and
values above the diagonal indicates SE estimates obtained by bootstrap procedure (1000 replicates) as implemented in MEGA 5.0. The four lineages
of the Anania coronata complex were defined using the 2.0% divergence.
Results
DNA barcoding and genetic distance analysis
The 109 COI sequences ranged in length from 307 to
658 bp (mean length =644 bp) and variation was detected
at 109 sites (16.6%). The pairwise genetic distances within
and between these lineages are shown in Table 3. The mean
genetic distance between lineages ranged from 2.17 to 10.95%,
whereas intralineage variation ranged from 0.03 to 0.71%. On
average, members of different species showed approximately
13×higher divergence (4.16%) than within species (0.30%).
The highest genetic distance among species was between the
NA lineage of Anania coronata and Anania stachydalis from
Eurasia. Four distinct and well-supported clades were observed
within the A. coronata group and these groups (EU, NA, ENA,
TN) are hereafter treated as four putative species. The highest
genetic distance (3.68%) among the four A. coronata lineages
was less than the mean distance among congeneric species,
but the mean genetic distance (2.96%) between different
lineages was 11×higher than that within lineages (0.25%).
Excluding the TN lineage (not determined because there was
a single specimen), the EU lineage (0.11%) showed the lowest
intraspecific divergence whereas the NA and ENA lineages
had slightly deeper divergences (0.19 and 0.46%, respectively).
Geographically separated lineages of A. stachydalis from
Finland and China showed 1.43% divergence, suggesting
the need for more intensive sampling of this species. In
contrast, the divergence between any pair of A. coronata
lineages regardless of geographic area exceeded 2.00%. In
general, divergence levels of COI within each lineage were
low, whereas high divergences existed between lineages. ME
yielded the similar results to those of NJ based on K2P model,
and the same NJ tree topology was produced under K2P and
Tamura 3-parameter (T3P) substitution models (Fig. 3A).
The assignment of mini-barcodes from 144-year-old type
specimens
A 130-bp fragment of COI barcode region was successfully
recovered from the >144-year-old type of Botys plectilis.We
associated the sequence from this specimen by including it
in an overall NJ analysis with all 109 ingroup and outgroup
A
B
Fig. 3. (A) Neighbour-joining tree (K2P) for 109 barcodes COI
sequences including Anania coronata species complex, rooted with
Anania perlucidalis, Anania quebecensis and Anania stachydalis as
outgroup. The depth of each branch shows divergence within lineages;
(B) Neighbour-joining tree (K2P) for 110 barcodes COI sequences
shows that the mini-barcodes of holotype Botys plectilis clustered
in ENA lineages, rooted with A. perlucidalis,A. quebecensis and
A. stachydalis as outgroup. The depth of each branch shows divergence
within lineages. Minimum-evolution (ME) based on K2P yielded the
same tree topology as NJ and is not presented.
sequences. Figure 3B shows that the sequence from the
holotype of B. plectilis clustered with members of the ENA
lineage, congruent with the phenetic results below.
Phylogenetic analysis of COI gene
The overall COI alignment was 658 bp long, including
109 variable and 101 parsimony-informative sites. We detected
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
694 Z. Yang et al.
Fig. 4. Majority rule consensus trees based on Bayesian (MB) phylogenetic analyses of COI of 50 haplotypes for this study. The node support:
bootstrap ML/Bayesian posterior probabilities. Single values on the MB tree correspond to Bayesian posterior probabilities. Question marks
representing the bootstrap values less than 50.
50 different haplotypes among the 109 barcode sequences,
with 42 haplotypes from the four lineages of A. coronata and
8 haplotypes from the three outgroup species (Anania per-
lucidalis, Anania quebecensis, A. stachydalis). Seven haplo-
types from Europe (EU lineage, corresponding to A. coronata)
and 35 haplotypes from North America were observed for
A. coronata s.l. There was 1 unique haplotype for the TN lin-
eage (Anania tennesseensis sp.nov., see below), 16 haplotypes
for ENA (corresponding to Anania plectilis) and 18 haplotypes
for NA (corresponding to Anania tertialis). All haplotype
sequences were included in the phylogenetic analyses. The
best-fit model of nucleotide substitution selected by jMOD-
ELTEST v0.1.1 was TPM2uf +I with a relative AIC weight
of 0.1747. ML and BI analyses recovered the same topology,
and all haplotypes were assigned to the same major clades
(Fig. 4).
In ML and BI analyses, the major clades were well-
supported, reciprocally monophyletic groups with high
bootstrap support and posterior probabilities. The EU and ENA
clades were sister groups with moderate support values, but
TN +(ENA +EU)cladesaswellasNA+(ENA +EU +
TN) clades were observed with high support values. The ENA
clade included two distinct subclades with a high level of sup-
port, one occurring in Oklahoma and Florida, and the other
with a broad distribution in eastern North America. The NA
clade contained four well-supported subclades: the first two
included specimens from Ontario and Tennessee, respectively,
whereas the last two were widely distributed across North
America (Table 1, Fig. 4).
In arthropods, mitochondrial inheritance can be impacted by
symbiont Wolbachia infections associated with male killing,
cytoplasmic imcompatibility and feminization, as well as high
divergence in host mtDNA (Braig et al., 1998; Hurst & Jiggins,
2005; Fr´
ezal & Leblois, 2008; Smith & Fisher, 2009; Mu˜
noz
et al., 2011). We considered, but ruled out, the possibility that
the barcode of the single individual of the TN lineage might
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
DNA barcoding reveals three cryptic species of Anania 695
Table 4. Results of principal component analyses of 11 male genital measurements of 23 specimens of the Anania coronata complex.
Component 1 Component 2 Component 3 Variable importance (power)
Eigenvalues 5.520 1.536 1.227
% total variance 50.180 13.963 11.159
Cumulative eigenvalue 5.520 7.056 8.283
Cumulative % 50.180 64.143 75.302
Component loadings
LUNC 0.697 0.159 0.564 0.830
WUNC 0.795 0.333 0.188 0.778
DUTV 0.789 0.105 0.301 0.727
LVAL 0 .859 0.134 0.000 0.757
LSAC 0.939 0.085 0.226 0.940
WVAL 0.384 0.785 0.099 0.773
WSAC 0.043 0.776 0.328 0.709
PEDI 0.672 0.056 0.584 0.795
LVPR 0.647 0.192 0.490 0.695
LPHA 0.724 0.237 0.034 0.582
WPHA 0.784 0.224 0.182 0.697
DUTV, distance from uncus to vinculum; LPHA, length of phallus; LSAC, length of sacculus; LUNC, length of uncus; LVAL, length of valva;
LVPR, length of ventral process in editum; PEDI, perimeter of editum; WPHA, width of phallus; WSAC, width of sacculus; WUNC, width of
uncus; WVAL, width of valva.
derive from the recovery of a symbiont such as Wolbachia (as
has been shown in butterflies; Narita et al., 2006; Russell et al.,
2009; Mu˜
noz et al., 2011). In particular, our morphological
analysis showed four distinct groups that were congruent with
the four genetic lineages of the Anania coronata complex as
below. In other words, the validity of none of the species
is justified by barcodes only, but all species show diagnostic
morphological differences.
Morphological characters and morphometric analysis
Comparisons of qualitative morphological characters showed
four distinct groups that were congruent with the four genetic
lineages of the coronata complex. For example, the male gen-
italia of the ENA lineage are strikingly different from those
of the other lineages as the phallus is deeply divided into two
arms without serrations (Fig. 8B), whereas those of the other
three species have three arms with serrations (Fig. 8A, C, D).
Females of the ENA lineage and the holotype of B. plectilis
have very similar genital structure as they lack the spinulose,
ribbon-like sclerite in the distal part of ductus bursae, present
in the EU and NA lineages (similar characteristics are present
in the paralectotype of Ebulea tertialis) (Fig. 9A– D). On this
basis, we call the ENA cluster Anania plectilis.
Based on the qualitative morphological analysis, we selected
7 female (LAAP, length of anterior apophyses; LPAP, length
of posterior apophyses; LDUC, length of ductus bursae; LSIG,
length of signum; WSIG, width of signum; DBUR, diameter
of corpus bursae; DASA, diameter of accessory sac) and
11 male (LUNC, length of uncus; WUNC, width of uncus;
DUTV, distance from uncus to vinculum; LVAL, length of
valva; LSAC, length of sacculus; WVAL, width of valva;
WSAC, width of sacculus; PEDI, perimeter of editum; LVPR,
length of ventral process in editum; LPHA, length of phallus;
Table 5. Results of principal component analyses of 7 female genital
measurements of 11 specimens of the Anania coronata complex.
Component 1 Component 2
Variable
importance
(power)
Eigenvalues 2.907 2.547
% total variance 41.535 36.381
Cumulative eigenvalue 2.907 5.454
Cumulative % 41.535 77.916
Component loadings
LAAP 0.603 0.701 0.860
LPAP 0.567 0.614 0.704
LDUC 0.737 0.343 0.664
LSIG 0.604 0.453 0.568
WSIG 0.638 0.701 0.892
DBUR 0.122 0.906 0.834
DASA 0.945 0.204 0.932
DASA, diameter of accessory sac; DBUR, diameter of corpus bursae;
LAAP, length of anterior apophyses; LDUC, length of ductus bursae;
LPAP, length of posterior apophyses; LSIG, length of signum; WSIG,
width of signum.
WPHA, width of phallus) genital features for quantitative
morphological multivariate analyses and added one female
(RLSB, ribbon-like sclerotized band) and three male characters
(NSED, number of scales on editum; NSSA, number of spines
on sacculus; CLEF, phallus cleft) for supplementary variables
(except that no female of the TN lineage was available
for analysis). The PCA of these variables is summarized in
Tables 4 and 5. The results show that the first two components
of PCA together explain 77.9 and 64.1% of the total variance
for the female and male, respectively. Four female genital
variables (DASA, WSIG, LAAP, DBUR) and six male genital
variables (LSAC, LUNC, PEDI, WUNC, WVAL, LVAL) have
their highest loadings on the first component (P>0.75).
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
696 Z. Yang et al.
AB
CD
Fig. 5. Principal component analysis (PCA) scatter plot comparing variation of the first two principal components for all morphological characters
analysed (A) males; (B) females and scatter plot of the canonical measures calculated after the discriminant function analysis (DFA) for the
morphometric data along the frist roots (C) males; (D) females. Four female genital variables (DASA, WSIG, LAAP, DBUR) and six male genital
variables (LSAC, LUNC, PEDI, WUNC, WVAL, LVAL) have their highest loadings on the first component (P>0.75).
This analysis nearly distinguishes lineages ENA, TN, NA
andEUfromeachother(Fig.5A,B).InDFA,themost
significant diagnostic variables for adult males were LUNC
(F=10.9, P<0.004) and LSAC (F=6.4, P<0.022). For
adult females, there were no significant diagnostic variables
after DFA, but combining those variables enables specimens
from the four separate groups to be distinguished. Moreover,
the first roots of canonical analysis yielded similar results,
separating the lineages into four groups (Fig. 5C, D).
Biogeographical patterns
The coronata complex is more diverse (three species) in
the Nearctic than in the Palearctic (one species) (Fig. 1).
COI sequence variation in the European lineage was less
than in both North American lineages represented by multiple
individuals, and there were no sequence haplotypes shared
between the two continents. Lineage EU is widely distributed
in central and northern Europe (e.g. UK, Germany, Poland,
Finland), whereas two of the three North American lineages
have restricted distributions: the TN lineage was found only in
the area of Great Smoky Mountains, Tennessee, which was a
major North American Pleistocene refuge and harbours a large
number of endemic species (Scholtens & Wagner, 2007); and
the ENA lineage was nearly restricted to the eastern part of
North America. By contrast, the NA lineage was found across
the continent.
Taxonomy of Anania coronata species complex
All four species recognized here are supported by both
molecular and morphological evidence. Morphologically, they
possess the diagnostic characters of the genitalia characteristic
of Anania: a digitiform sclerotization in the female antrum and
a strong, elongated, asymmetric sclerite in the phallic apodeme
(Leraut, 2005; Tr¨
ankner et al., 2009).
Measurements of male and female genitalia are presented in
Tab le 6 .
Anania coronata (EU lineage)
(Figs 6A, 7A, 8A, 9A)
Phalaena coronata Hufnagel, 1767: 616. Type locality:
Berlin, Germany. Type lost.
Pyralis sambucalis Denis & Schifferm ¨
uller, 1775, 122. Type
locality: Vicinity of Vienna, Austria. Type lost.
Phalaena sambuci Retzius, 1783: 49. Type locality:
Unknown
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
DNA barcoding reveals three cryptic species of Anania 697
Table 6. Measurements (in mm, means ±SE) of male and female genitalia in four species of the Anania coronata complex.
SpecimenID tennesseensis male holotype coronata tertialis plectilis plectilis female holotype
Male measurements N =1N=4N=12 N =6
LUNC 0.46 0.49 ±0.02 0.48 ±0.01 0.58 ±0.01
WUNC 0.38 0.43 ±0.02 0.41 ±0.01 0.46 ±0.01
DUTV 1.28 1.28 ±0.02 1.19 ±0.03 1.28 ±0.02
LVAL 1.71 1.73 ±0.02 1.64 ±0.03 1.79 ±0.02
WVAL 0.48 0.50 ±0.01 0.51 ±0.01 0.53 ±0.02
LSAC 0.81 0.86 ±0.01 0.79 ±0.02 0.95 ±0.01
WSAC 0.26 0.26 ±0.01 0.29 ±0.01 0.27 ±0.01
PEDI 1.23 1.28 ±0.01 1.20 ±0.02 1.25 ±0.04
LVPR 0.34 0.36 ±0.01 0.34 ±0.00 0.36 ±0.01
LPHA 1.20 1.34 ±0.01 1.22 ±0.02 1.34 ±0.03
WPHA 0.24 0.22 ±0.01 0.20 ±0.01 0.28 ±0.01
NSED 8–12 12–13 8–12 12–19
NSSA 4 3– 5 3 –5 4 5
CLEF 3 3 3 2
Female measurements N =1N=4N=5N=1
LAAP 0.38 0.32 ±0.01 0.39 ±0.02 0.35
LPAP 0.42 0.42 ±0.02 0.58 ±0.01 0.5
LDUC 2.61 2.47 ±0.17 2.90 ±0.19 2.13
LSIG 0.63 0.63 ±0.01 0.62 ±0.06 0.44
WSIG 0.77 0.64 ±0.02 0.66 ±0.05 0.48
DBUR 1.17 1.32 ±0.11 1.11 ±0.12 0.98
DASA 0.63 0.49 ±0.02 0.60 ±0.05 0.42
RLSB 1100
Male measurements: CLEF, phallus cleft; DUTV, distance from uncus to vinculum; LPHA, length of phallus; LSAC, length of sacculus; LUNC,
length of uncus; LVAL, length of valva; LVPR, length of ventral process in editum; NSED, number of scales on editum; NSSA, number of spines
on sacculus; PEDI, perimeter of editum; WPHA, width of phallus; WSAC, width of sacculus; WUNC, width of uncus; WVAL, width of valva.
Female measurements: DASA, diameter of accessory sac; DBUR, diameter of corpus bursae; LAAP, length of anterior apophyses; LDUC,
length of ductus bursae; LPAP, length of posterior apophyses; LSIG, length of signum; RLSB, ribbon-like sclerotized band; WSIG, width of
signum.
Phalaena sambucaria Fabricius, 1787: 186. Type locality:
Unknown
Diagnosis. The fuscous areas of the forewings are darker
and more contrasting with the pale patches than in the North
American members of the complex. In male genitalia, the
apex of the phallus is deeply notched with the edge of
the notches finely serrated and the tip of the projections
moderately tapered; the only other member of the complex
with deep apical notches is Anania plectilis but the edges are
smooth and the tip of the projections is sharply spiniform;
the vesica is armed with several short spiniform setae but
without large cornuti. (However, cornuti may be deciduous
and lacking in mated males so their number must be used
with caution in diagnosis.) In female genitalia, the ductus
bursae has a strongly spinulose, ribbon-like sclerotized band
in the anterior section which is extended as a dense and broad
patch onto the corpus bursae; a similar ribbon-like band is
present in the female of Anania tertialis but with coarser
spinulation.
Length of forewing. 11.67 ±0.11 mm (N=21).
Barcode. Barcodes ranged from 596 to 658 bp long.
Underlined bold nucleotides highlight diagnostic substitutions
between species, three autapomorphies shown in italics for this
species are located at nucleotide positions 212 C (cytosine),
476 A (adenine), 619 G (guanine).
AACATTATATTTTATTTTTGGAATTTGAAGAGGAATA
GTTGGAACATCTTTAAGTTTATTAATTCGAGCTGAATT
AGGAAATCCTGGATCATTAATTGGAGATGATCAAATTT
ATAACACAATTGTTACAGCCCATGCATTTATTATAATTT
TTTTTATAGTTATACCTATTATAATTGGAGGGTTTGGAA
ATTGATTAGTGCCTCTTATACTAGGAGCCCCTGATATA
GCATTTCCACGAATAAATAACATAAGATTTTGATTACTA
CCACCTTCTTTAACCCTTTTAATTTCAAGAAGTATTGTA
GAAAATGGAGCAGGAACTGGATGAACTGTTTACCCCC
CTCTTTCTTCAAACATTGCTCATGGAGGAAGATCAGTA
GATTTAGCAATCTTTTCTTTACATTTAGCTGGTATTTCT
TCAATTTTAGGAGCAATTAATTTTATTACTACAATTATT
AATATACGAATTAATAGATTATCTTTUTUGATCAAATAC
CATTATTTGTATGAGCAGTAGGAATTACAGCCTTATTAT
TATTATTATCTCTTCCTGTATTAGCTGGTGCTATTACCAT
ATTATTAACTGACCGAAATTTAAATACATCTTTTTTTGA
TCCGGCTGGTGGGGGAGATCCAATCTT ATACCAACAT
CTATTT
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
698 Z. Yang et al.
A
B
C
D
E
F
Fig. 6. Adults of Anania coronata species complexes. (A) Anania coronata (Europe: Finland, male specimen MM09813, forewing
length =12.0 mm); (B) holotype female of Botys plectilis (forewing length =11.5 mm); (C) Anania plectilis (Canada: Quebec, female spec-
imen jflandry2823, forewing length =11.5 mm); (D) Anania tennesseensis, holotype male (USA: Tennessee, specimen BGS03493, forewing
length =9.0 mm); (E) paralectotype female of Ebulea tertialis (forewing length =10.8 mm); (F) Anania tertialis (Canada: Quebec, female spec-
imen CNCLEP00027498, forewing length =10.0 mm).
Distribution. Widespread in Europe (Speidel, 1996), east-
wards to Russian Far East (Kirpichnikova, 1999; Sinev, 2008).
However, we studied specimens from UK, Germany, Poland,
Finland only. It is not known whether further cryptic diver-
sity may be encompassed within the traditional boundaries of
Anania coronata over its entire Palearctic range.
Anania plectilis (ENA lineage)
(Figs 6B, C, 7B, 8B, 9B, C)
Botys plectilis Grote & Robinson, 1867: 27.
Phlyctaenia tertialis (Guen ´
ee): Dyar, 1903: 388; McDun-
nough 1938: 15; Munroe 1976: 31; Munroe 1978: 70. Holotype
in AMNH (examined). Type locality: USA, Pennsylvania.
Anania plectilis: Leraut, 2005: 126– 128.
Diagnosis. Larger in size (mean FWL =11.5 mm) than the
other two North American members of the complex (mean
FWL <10 mm). The male genitalia have the uncus and sac-
culus slightly longer than in the other three species. The
apical portion of the sacculus is a smoothly rounded cone,
and the spines in the basal portion are not aggregated into a
protrusion (as in the other three species) and somewhat sep-
arated from each other. The ventral lobe of the editum is the
widest and largest of the four species, tongue-shaped. The apex
of the phallus affords the most distinctive difference, being
deeply notched with smooth edges (serrated in the other three
species) and the terminal points are large and sharply spini-
form (rounded in Anania coronata, sharp but proportionally
much shorter in Anania tennesseensis and Anania tertialis ).
The ductus bursae in the female genitalia is also very distinc-
tive, without a ribbon-like sclerotized band (present in Anania
coronata and Anania tertialis) and the corpus bursae has a dif-
fuse, very finely spinulose patch (patch sharply delineated and
strongly developed in Anania coronata and Anania tertialis ).
Forewing length. 11.55 ±0.16 mm (N =11).
Barcode. Barcodes ranged from 591 to 658 bp long. The
fragment (130 bp) in grey highlight was obtained from the
holotype of Botys plectilis and italic bold nucleotides show
variable sites. Underlined bold nucleotides show diagnostic
substitutions between species, three autapomorphies shown in
italics are located at nucleotide positions 232 C (cytosine),
517 G (guanine), 616 C (cytosine).
AACATTATATTTTATTTTTGGAATTTGAAGAGGAATA
GTTGGAACATCTTTAAGTTTATTAATTCGAGCTGAATT
AGGAAATCCTGGATCATTAATTGGAGATGATCAAATTT
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
DNA barcoding reveals three cryptic species of Anania 699
BA
DC
Fig. 7. Male genitalia. (A) Anania coronata (genitalia slide PYR565, CNC); (B) Anania plectilis (genitalia slide PYR519, CNC); (C) Anania
tennesseensis (holotype genitalia slide BIOZY00021, USNM); (D) Anania tertialis (genitalia slide PYR521, CNC).
ATA A CACAATTGTTACAGCCCATGCATTTATTATAATTT
TTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAA
TTGATTAGTGCCTCTTATATTAGGAGCCCCTGATATAGC
CTTCCCACGAATAAATAACATAAGATTTTGATTACTTCC
ACCTTCTTTAACCCTTTTAATTTCAAGAAGTATTGTAG
AAAATGGAGCAGGAACTGGATGAACTGTTTACCCCCC
TCTTTCTTCAAACATTGCTCATGGAGGAAGATCAGTAG
ATTTAGCAATCTTTTCTTTACATTTAGCTGGTATTTCTTC
AATTTTAGGAGCAATTAATTTTATTACTACAATTATTAAT
ATACGAATTAATGGATTATCTTTCGATCAAATACCATTA
TTTGTATGAGCAGTGGGAATTACAGCCTTATTATTATTA
TTATCTCTTCCTGTATTAGCTGGTGCTATTACAATATTAT
TAACTGACCGAAATTTAAATACATCTTTTTTTGACCCA
GCTGGTGGGGGAGATCCAATCTTATATCAACATCTATTT
Type material examined. Holotype, , USA: Pennsylva-
nia (AMNH). Labelled, ‘Pa.’ [brown, printed]; ‘No. 23005
Grote & Robin’ [white, printed with numbers handwritten],
‘TYPE No. A.M.N.H.’ [red, printed,]; ‘B. plectilis’ [white,
handwritten]; ‘in coll. as P. tertialis Gn.’ [white, handwritten].
Genitalia dissected and mounted on slide JFL 1691.
Distribution. Eastern Nearctic region [United States (Min-
nesota, Oklahoma, Tennessee, North Carolina, Florida), Canada
(Ontario, Quebec, Newfoundland, Labrador)]
Remarks. Because he did not study types, Leraut (2005)
misinterpreted the identity of this species and his diagnosis
and illustration of the male phallus (fig. 8, p.126) are those of
Anania tertialis.
Anania tennesseensis Yang, sp.nov. (TN lineage)
(Figs 6D, 7C, 8C)
Type material examined. Holotype, , USA: Tennessee,
Cocke Co., Foothills Pkwy., 2nd pkglot nr. Cosby, 13.VIII.
2006 (John W Brown) (USNM). Labelled, BOLD sample ID
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
700 Z. Yang et al.
A
B
C
D
Fig. 8. Phallus. (A) Anania coronata (genitalia slide PYR565, CNC); (B) Anania plectilis (genitalia slide PYR519, CNC); (C) Anania tennesseensis
(holotype genitalia slide BIOZY00021, USNM); (D) Anania tertialis (genitalia slide PYR521, CNC).
and process ID: BGS03493, LGSMG172-07. [white, printed];
Genitalia slide number: BIOZY00021. |BIOZY00021 [pale
green, printed]; ‘HOLOTYPE|Anania tennesseensis|Yang 2011
|by ZF Yang 2011’ [red, partly printed, partly handwritten].
The holotype is provisionally deposited at the USNM, Wash-
ington, DC, pending agreement with the U.S. National Park
Service regarding specimen deposition. For additional type
locality information, see Table 1.
Etymology. Named after the state where the type specimen
was collected.
Diagnosis. This is the smallest species of the complex
(forewing length 9 mm) based on our sampling, however the
size difference is small, especially compared to Anania ter-
tialis (mean FWL 9.8 mm) and would have to be assessed on
greater sampling. The uncus is slightly shorter (0.46 mm) and
narrower (0.38 mm) than in the other three species; the saccu-
lus length (0.81 mm) is intermediate between that of Anania
tertialis (shorter at 0.79 mm) and Anania coronata,Anania
plectilis (both longer at 0.86 and 0.95 mm, respectively); the
dorsal edge of the sacculus has more protruded and more
densely aggregated spines basally with spines of uneven sizes
and some more protruded, and the distal portion of the saccu-
lus has coarse, blunt serrations (serrations ill-defined in Anania
tertialis); the ventral process of editum is narrow, similar to
that of Anania tertialis; phallus length/width ratio c. 5.0 (6.0
in Anania tertialis); apex of phallus resembling that of Anania
tertialis in being shallowly notched with serrated edges but
with the notches more pronounced; vesica with two long and
thin cornuti.
Description. Forewing length 9.0 mm. Labial palpus por-
rect, third segment exposed and porrect, distal part with fus-
cous color. Body and wings pale buff, with strongly con-
trasting pale patches on infuscated ground. Forewing with
antemedial line fuscous, somewhat indistinct or obsolete. Post-
medial line fuscous, strongly and regularly dentate. Beyond
the postmedial a fuscous, strongly dentate, subterminal shade.
Terminal line fuscous, broken between the veins; fringe
concolorous with wing. Hindwing antemedial, medial line
and postmedial, subterminal, and terminal markings as on
forewing.
Male genitalia. Uncus subtriangular. Transtilla incomplete
medially. Juxta lunular. Vinculum ventrally rounded. Valva
tapered somewhat in distal half; base of costa weakly
inflated; sacculus inflated and spinulose dorsally, distal
part with several dorsally-projected small spines, spines
aggregated at base; basal pad of editum with a crest of
8–12 dorsally directed scales, ventral process narrow. Phal-
lus with apex broad and moderately indented, with three
roughly serrated notches; vesica with two slender, spiniform
cornuti.
Female genitalia. Unknown.
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
DNA barcoding reveals three cryptic species of Anania 701
AB CD
Fig. 9. Female genitalia. (A) Anania coronata (genitalia slide AT31, MTD); (B) holotype of Botys plectilis (genitalia slide JFL1691, AMNH);
(C) Anania plectilis (genitalia slide PYR520, CNC); (D) Anania tertialis (genitalia slide PYR522, CNC).
Barcode. A 658 bp barcode was obtained from the holo-
type. Underlined bold nucleotides highlight those diagnostic
substitutions from other members of the complex, four autapo-
morphies shown in italics are located at nucleotide positions
25 C (cytosine), 151 C (cytosine), 433 G (guanine), 625 C
(cytosine).
AACATTATATTTTATTTTTGGAATCTGAAGAGGAATA
GTTGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTA
GGAAATCCTGGATCATTAATTGGAGATGATCAAATTTA
TAACACAATTGTTACAGCCCATGCATTTATTATAATCTT
TTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAAT
TGATTAGTACCTCTTATATTAGGGGCCCCTGATATAGCA
TTTCCACGAATAAATAACATAAGATTTTGATTACTTCCA
CCTTCTTTAACCCTTCTAATTTCAAGAAGTATTGTAGA
AAATGGAGCAGGAACTGGATGAACTGTTTATCCCCCT
CTTTCTTCAAACATTGCTCATGGGGGAAGATCAGTAG
ATTTAGCAATCTTTTCTTTACATTTAGCTGGTATTTCTTC
AATTTTAGGGGCAATTAATTTTATTACTACAATTATTAA
TATACGAATTAATGGATTATCTTTCGACCAAATACCATT
ATTTGTATGAGCAGTAGGAATTACAGCCTTATTATTATT
ATTATCTCTTCCTGTATTAGCTGGTGCTATTACCATATTA
TTAACTGACCGAAATTTAAATACATCTTTTTTTGATCCA
GCTGGCGGAGGAGATCCAATCTTATATCAACATCTATTT
Distribution. Known only from the Great Smoky Mountains
in Tennessee, U.S.A.
Anania tertialis (NA lineage)
(Figs 6E, F, 7D, 8D, 9D)
Ebulea tertialis Guen ´
ee, 1854: 364. Lectotype in BMNH
(examined, see below). Type locality: North America.
Botys syringicola Packard, 1870: 250. Dyar, 1903: 388 [as a
synonym of tertialis]; McDunnough 1938: 15 [as a synonym of
tertialis]. Munroe 1976: 31; Munroe 1978: 70 [as a synonym
of coronata tertialis]. Location of type material unknown. Type
locality: USA, New York [state].
Phlyctaenia tertialis; Dyar 1903: 388.
Phlyctaenia coronata tertialis; Munroe 1954: 429.
Anania tertialis; Leraut, 2005: 126 128.
Diagnosis. Intermediate in size between Anania tennesseen-
sis (9.0 mm) and Anania plectilis (11.5 mm). In male genitalia,
spines of sacculus aggregated both basally and distally; dorsal
lobe of editum somewhat rounded with nearly straight ventral
margin (margin concave in Anania plectilis); apex of phallus
resembling that of Anania tennesseensis with shallow, serrated
notches and one sharply spiniform but short point (rounded in
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
702 Z. Yang et al.
Anania coronata, smooth and long in Anania plectilis). Female
genitalia similar to Anania coronata.
Forewing length. 9.80 ±0.11 mm (N=15)
Barcode. Barcodes range from 307 to 658 bp long. Under-
lined bold nucleotides highlight diagnostic differences with
other species, five autapomorphies shown in italics are located
at nucleotide positions 91 C (cytosine), 181 G (guanine),
190 G (guanine), 202 C (cytosine), 514 G (guanine).
AACATTATATTTTATTTTTGGAATTTGAAGAGGAATA
GTTGGAACATCTTTAAGTTTATTAATTCGAGCTGAATT
AGGTAATCCTGGATCCTTAATTGGAGATGATCAAATTT
ATA A TACAATTGTTACAGCCCATGCATTTATTATAATTT
TTTTTATAGTTATACCTATTATAATTGGGGGGTTTGGGA
ATTGATTAGTCCCTCTTATATTAGGAGCCCCTGATATAG
CATTTCCACGAATAAATAACATAAGATTTTGATTACTTC
CACCTTCTTTAACTCTTCTAATTTCAAGAAGTATTGTA
GAAAATGGAGCAGGAACTGGATGAACTGTTTACCCCC
CTCTTTCATCAAACATTGCTCATGGAGGAAGATCAGTA
GATTTAGCAATCTTTTCTTTACATTTAGCTGGTATTTCT
TCAATTTTAGGAGCAATTAATTTTATTACTACAATTATTA
ATATACGAATTAATGGATTATCTTTCGACCAAATACCAT
TATTTGTATGAGCGGTAGGAATTACAGCTTTATTATTAC
TACTATCTCTTCCTGTATTAGCTGGTGCTATTACCATATT
ATTAACTGACCGAAATTTAAATACATCTTTTTTTGATCC
TGCTGGTGGAGGAGATCCAATCTTATACCAACATCTA
TTT
Type material examined. There are two syntypes of Ebulea
tertialis, one in the BMNH and one in the USNM. Solis
selected the BMNH specimen as the lectotype.
Lectotype, , here designated (BMNH). Labelled: ‘Ex.
Musaeo|Ach. Gu´
en´
ee’ [white, printed]; ‘Tertialis|Gn. Am. bor’
[white, handwritten]; ‘Oberthur|Collection’ [pale yellow with
red print]; ‘Ebulea|tertialis,Guen
´
ee|Sp. G. VIII-446’ [white
with black border, handwritten]; ‘plectilis|gr. Fr.’ [white,
handwritten]; ‘LECTOTYPE |Ebulea|tertialis Guen ´
ee, 1854|
det. M. A. Solis 2011’ [red, printed].
Paralectotype, , in USNM. Labelled: ‘Ex. Musaeo|Ach.
Gu´
en´
ee’ [white, printed]; ‘Oberthur|Collection’ [pale yellow
with red print]’; ‘Barnes|Collection’ [printed in red]; ‘PAR-
ALECTOTYPE |Ebulea|tertialis Guen ´
ee, 1854|det. M. A.
Solis 2011’ [blue, printed]; genitalia on slide USNM 130208.
The location of the type of Botys syringicola, which was
described from New York state, is unknown. Despite extensive
searches in the USNM, as well as inquiries with the AMNH,
New York State Museum (Albany, NY) and Academy of
Natural Sciences (Philadelphia), we were unable to locate the
type specimens. The synonymy of syringicola goes back at
least to Dyar (1903) (not Munroe, 1976, as stated incorrectly by
Leraut, 2005), but hitherto seems to have remained unverified.
The type material, probably made up of a single specimen, was
reared from a larva boring into a branch of lilac (Syringa sp.,
Oleaceae). Lilac is not native to North America and represents
an unusual host record. Larvae of the North American
subspecies are known to be leaf-webbers or shoot borers on
Sambucus species (Caprifoliaceae), the same host used by
the nominate subspecies Anania coronata in Europe (Goater,
1986). There are discrepancies between Packard’s description
of syringicola that suggest a difference from the superficial
appearance of all nominal species treated here. For instance,
Packard described the hindwing as ‘yellow, with four sharply
zigzag dark gray lines’, a characterization that is somewhat
difficult to reconcile with the extensive dark peppering with
a contrasting large pale yellowish (or whitish) patch that
strikingly mark tertialis or coronata complex specimens.
These discrepancies coupled with the odd host record suggest
that syringicola might be another species altogether, or might
not even belong to Anania. For the time being, it is better to
leave it in its current synonymy until the type is discovered or
matching specimens are found.
Distribution. Eastern and western Nearctic region [United
States (Washington, Minnesota, Tennessee), Canada (British
Columbia, Manitoba, Ontario, Quebec, New Brunswick, Nova
Scotia)].
Remarks. Because he did not study types, Leraut (2005)
misinterpreted the identity of this species and his diagnosis
and illustration of the male phallus (fig. 7, p. 126) are those of
Anania plectilis.
Discussion
Many recent commentaries (Goldstein & DeSalle, 2010; Lum-
ley & Sperling, 2010; Padial et al., 2010) and ever increasing
studies in Lepidoptera (Hebert et al., 2004; Wilson et al., 2010;
Mutanen et al., 2012) have either discussed and/or illustrated
the power of ‘integrative taxonomy’. This integrated study uti-
lizing morphological and molecular characters revealed that
Anania coronata is really four well-supported, reciprocally
monophyletic groups. The molecular analysis indicated that
the North American Anania plectilis and Anania tennesseen-
sis, and the European A. coronata form a monophyletic cluster
that is rather distant to the third North American species, Ana-
nia tertialis. The same result was obtained regardless of the
method and substitution model. The quantitative morphologi-
cal analysis revealed that genital differences are correlated with
the genetic differences.
Integration by congruence has a ‘long tradition in system-
atics’ and promotes taxonomic stability, but it runs the risk
of underestimating species numbers because characters do not
change at all levels and the rates of character change are hetero-
geneous (Padial et al., 2010). Interestingly, A. tertialis displays
the closest morphological similarity to A. coronata, in contrast
to their marked COI divergence. In contrast to the species
group analysed in this study, Tr¨
ankner et al. (2009) illustrated
that many Anania species in Europe are externally strikingly
morphologically divergent. Padial et al. (2010) stated that gen-
ital structures of arthropods would be the most important char-
acters to study because they contribute to the reproduction of
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
DNA barcoding reveals three cryptic species of Anania 703
the species. This has not always been the case in the Pyraloidea.
Studies of pyraloid adult morphological characters, most par-
ticularly the genital characters upon which the nomenclature
is based, at taxonomic levels higher than species have yielded
very few informative characters either due to homoplasy or
a dearth of morphological divergence (Solis & Maes, 2002;
Regier et al., in press). In some pyraloid groups, the adults
can exhibit obvious gaps in the external morphology, but no
appreciable divergence in internal morphology of structures
such as genitalia, or the reverse. Unfortunately, many genera
(e.g. Ostrinia; Mutuura & Munroe, 1970) in the Pyraustinae
are plagued with a lack of obvious divergence in both external
and internal characters. The use of molecular characters will
greatly accelerate the discovery of characters, new species and
relationships between species in the Pyraustinae.
The relatively small haplotype variation was probably due
to a limited sample size and collecting efforts in the middle
and southern Appalachian areas to obtain more specimens
of A. tennesseensis, including females, could provide greater
resolution. Further studies in phylogeographic patterns should
attempt to examine more specimens from the East Palaearctic
Region, such as the Russian Far East, China and Japan. Nuclear
markers (e.g. RpS5, CAD, EF-1a and D2 loop of 28S rRNA)
would be helpful in further understanding species divergence
and relationships within the Anania coronata species complex.
This study solves a relatively small problem in species
numbers that had been suspected for many decades; Munroe
(1976) stated ‘further work may show that more than one
species have been included under this name’. It is easy
find such statements for most genera of the Pyraloidea in
the literature. For taxonomists who study hyperdiverse taxa
the ‘taxonomic impediment’ is the magnitude of known and
potentially undiscovered species. In hyperdiverse taxa even
genera can consist of hundreds of species. Anania is one
of the largest genera in Pyraustinae with 114 species (Nuss
et al., 2009; Tr¨
ankner et al., 2009; Tr¨
ankner & Nuss, 2010).
Only with a project such as the Lepidoptera Barcode of
Life (http://www.lepbarcoding.org/), that to date has produced
624 163 sequences for 73 186 species, can taxonomists who
study hyperdiverse groups such as Lepidoptera (157 424
species; van Nieukerken et al., 2011) take long leaps to
pinpoint interesting questions, and, as in this study, discover
and validate cryptic species.
Supporting Information
Additional Supporting Information may be found in the online
version of this article under the DOI reference:
10.1111/j.1365-3113.2012.00637.x
File S1. COI allingment as FASTA file.
Please note: Neither the Editors nor Wiley-Blackwell
are responsible for the content or functionality of any
supporting materials supplied by the authors. Any queries
(other than missing material) should be directed to the
corresponding author for the article.
Acknowledgements
We thank colleagues at the Biodiversity Institute of Ontario
for assistance with DNA sequencing. We thank Vazrick Nazari
for assistance with photography of the genitalia at the CNC,
and Mark Metz for measurement and photography of the
type specimen at the USNM. We thank Andreas Segerer,
Brandon Laforest, Evgeny Zakharov and Jeremy deWaard
for permission to access their data. We are also grateful
to Suzanne Rab Green and David Grimaldi (AMNH) for
permission to analyse the type specimen, J. Donald Lafontaine
who aided work on the type specimen in the British Museum
of Natural History, and Tim McCabe, NY State Museum
(Albany), for searching the collection under his care for
possible types. This study was supported by The Ministry of
Science and Technology of the People’s Republic of China
(2011FY120200) and by grants from NSERC, and from the
government of Canada through Genome Canada and the
Ontario Genomics Institute in support of the International
Barcode of Life project to PDNH. Z. Yang thanks the China
Scholarship Council for its support.
Authors contributions
Conceived and designed molecular analysis: ZFY, YLZ,
PDNH. Conceived and performed molecular and morphome-
tric analyses: ZFY. Provided morphological data: ZFY, JFL,
LH. Analysed morphological data: ZFY. Studied type speci-
mens: JFL, MAS. Contributed specimens and/or observations:
DH, BGS, MAS, MM, MN, PDNH. Wrote and/or edited the
manuscript: ZFY, JFL, YLZ, MAS, MM, PDNH. Prepared
illustrations: ZFY. The authors have declared that no com-
peting interests exist.
References
Anisimova, M. & Gascuel, O. (2006) Approximate likelihood-ratio
test for branches: a fast, accurate, and powerful alternative.
Systematic Biology,55, 539– 552.
Braig, H.R., Zhou, W., Dobson, S.L. & O’Neill, S.L. (1998) Cloning
and characterization of a gene encoding the major surface protein
of the bacterial endosymbiont Wolbachia pipientis.Journal of
Bacteriology,180, 2373– 2378.
Burns, J.M., Janzen, D.H., Hajibabaei, M., Hallwachs, W. & Hebert,
P.D.N. (2007) DNA barcodes of closely related (but morpho-
logically and ecologically distinct) species of skipper butterflies
(Hesperiidae) can differ by only one to three nucleotides. Journal
of the Lepidopterists’ Society,61, 138– 153.
Dayrat, B. (2005) Toward integrative taxonomy. Biological Journal of
the Linnaean Society,85, 407– 415.
Denis, J.N.C.M. & Schifferm¨
uller, I. (1775) Ank¨undung eines system-
atischen Werkes von den Schmetterlingen der Wienergegend her-
ausgegeben von einigen Lehrern am k.k. Theresianum. Augustin
Bernardi, Wien. frontispiece, 1– 323, pls. 1–3. [1776 edition seen].
Dinca, V., Zakharov, E.V., Hebert, P.D.N. & Vila, R. (2011) Com-
plete DNA barcode reference library for a country’s butterfly
fauna reveals high performance for temperate Europe. Philosoph-
ical Transactions of the Royal Society B: Biological Sciences,278,
347– 355.
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
704 Z. Yang et al.
Dyar, H.G. (1903) A list of North American Lepidoptera. Bulletin of
the United States National Museum (Washington, DC),52,ixix,
1– 723.
Fabricius, J.C. (1787) Mantissa Insectorum sistens species nuper detec-
tas adiectis synonymis, observationibus, descriptionibus, emenda-
tionibus. Christian Gottlieb Proft, Hafniae.
Fr´
ezal, L. & Leblois, R. (2008) Four years of DNA barcoding:
current advances and prospects. Infection, Genetics and Evolution,
8, 727– 736.
Goater, B. (1986) British Pyralid Moths. A Guide to their Identification.
Harley Books, Colchester.
Goldstein, P.Z. & DeSalle, R. (2010) Integrating DNA barcode data
and taxonomic practice: determination, discovery, and description.
Bioessays,33, 135– 147.
Grote, A.R. & Robinson, C.T. (1867) Descriptions of American
Lepidoptera. Transactions of the American Entomological Society,
Philadelphia,1, 1– 30, pls 1 –2; 171 192, pl. 4.
Guen´
ee, A. (1854) Species G´en ´eral des L´epidopt`eres,Tome Huiti`eme,
Deltoïdes et Pyralites. Librairie Encyclop´
edique Roret, Paris.
Guindon, S. & Gascuel, O. (2003) A simple, fast, and accurate
algorithm to estimate large phylogenies by maximum likelihood.
Systematic Biology,52, 696– 704.
Hadley, A. (2010) Combine ZP Sofware, New Version [WWW docu-
ment]. URL http://www.hadleyweb.pwp.blueyonder.co.uk/CZP/
News.htmH [accessed on 20 January 2011].
Hajibabaei, M., deWaard, J.R., Ivanova, N.V. et al. (2005) Critical
factors for assembling a high volume of DNA barcodes. Philosoph-
ical Transactions of the Royal Society B: Biological Sciences,360,
1959– 1967.
Hajibabaei, M., Janzen, D.H., Burns, J.M., Hallwachs, W. & Hebert,
P.D.N. (2006a) DNA barcodes distinguish species of tropical
Lepidoptera. Proceedings of the National Academy of Sciences of
the United States of America,103, 968– 971.
Hajibabaei, M., Smith, A., Janzen, D.H., Rodriguez, J.J., Whitfield, J.
& Hebert, P.D.N. (2006b) A minimalist barcode can identify a
specimen whose DNA is degraded. Molecular Ecology Notes,6,
959– 964.
Hall, T.A. (1999) BioEdit: a user-friendly biological sequence align-
ment editor and analysis program for Windows 95/98/NT. Nucleic
Acids Symposium Series,41, 95– 98.
Hebert, P.D.N., Cywinska, A., Ball, S.L. & deWaard, J.R. (2003)
Biological identifications through DNA barcodes. Philosophical
Transactions of the Royal Society B: Biological Sciences,270,
313– 321.
Hebert, P.D.N., Penton, E.H., Burns, J.M., Janzen, D.H. &
Hallwachs, W. (2004) Ten species in one: DNA barcoding reveals
cryptic species in the neotropical skipper butterfly Astraptes fulger-
ator.Proceedings of the National Academy of Sciences of the United
States of America,101, 14812– 14817.
Hebert, P.D.N., deWaard, J.R. & Landry, J.F. (2010) DNA barcodes
for 1/1000 of the animal kingdom. Biology Letters,6, 359– 362.
Hodges, R.W., Dominick, T., Davis, D.R., Ferguson, D.C., Fran-
clemont, J.G., Munroe, E.G. & Powell, J.A. (1983) Check List
of the Lepidoptera of North America North of Mexico. E.W.
Classey and The Wedge Entomological Research Foundation,
London.
Hufnagel, J.S. (1767) Fortsetzung der Tabelle von den Nachtv ¨
ogeln,
welche die 3te Art derselben, nehmlich die Spannenmesser (Phalae-
nas Geometras Linnaei) enth¨
alt. Berlinisches Magazin,4, 504– 527;
599– 626.
Hurst, G.D.D. & Jiggins, F.M. (2005) Problems with mitochondrial
DNA as a marker in population, phylogeographic and phylogenetic
studies: the effects of inherited symbionts. Philosophical Transac-
tions of the Royal Society B: Biological Sciences,272, 1525– 1534.
Inoue, H. (1982) Pyralidae. Moths of Japan 1+2(ed.byH.Inoue,
S. Sugi, H. Kuroko, et al.), pp. vol. 1: 307– 404; vol. 2: 223– 254;
pls. 36– 48, 228, 296 –314. Kodansha, Tokyo.
Ivanova, N.V., deWaard, J.R. & Hebert, P.D.N. (2006) An inexpen-
sive, automation-friendly protocol for recovering high-quality DNA.
Molecular Ecology Notes,6, 998– 1002.
Kimura, M. (1980) A simple model for estimating evolutionary rates
of base substitutions through comparative studies of nucleotide
sequences. Journal of Molecular Evolution,16, 111– 120.
Kirpichnikova, V. A. (1999) Pyraloidea [sine Phycitinae]. Key to the
insects of Russian Far East 5(2) (in Russian) (ed. by P. A. Ler),
pp. 320– 443. Dalnauka, Vladivostok.
Kn¨
olke, S., Erlacher, S., Hausmann, A., Miller, M.A. & Segerer, A.H.
(2005) A procedure for combined genitalia dissection and DNA
extraction in Lepidoptera. Insect Systematics & Evolution,35,
401– 409.
Kristensen, N.P. (2003) Skeleton and muscles: adults. Lepidoptera:
Moths and Butterflies,Handbook of Zoology, Volume 2: Morphology,
Physiology, and Development (ed. by N.P. Kristensen), pp. 39– 131.
Walter de Gruyter, Berlin and New York, NY.
Kristensen, N.P., Scoble, M.J. & Karsholt, O. (2007) Lepidoptera
phylogeny and systematics: the state of inventorying moth and
butterfly diversity. Zootaxa,1668, 699– 747.
Landry, J.F. (2007) Taxonomic review of the leek moth genus
Acrolepiopsis (Lepidoptera: Acrolepiidae) in North America. The
Canadian Entomologist,139, 319– 353.
Leraut, P.J.A. (2005) Contribution `
al
´
etude de quelques genres et
esp`
eces de Pyraustinae (Lepidoptera: Crambidae). Nouvelle Revue
d’Entomologie,22, 123– 139.
Lumley, L.M. & Sperling, F.A.H. (2010) Integrating morphology and
mitochondrial DNA for species delimitation within the spruce
budworm (Choristoneura fumiferana) cryptic species complex
(Lepidoptera: Tortricidae). Systematic Entomology,35, 416–428.
McDunnough, J. (1938). A Checklist of the Lepidoptera of Canada and
the United States of America. Memoirs of the Southern California
Academy of Sciences,1, 1– 275.
Meusnier, I., Singer, G.A.C., Landry, J.F., Hickey, D.A., Hebert,
P.D.N. & Hajibabaei, M. (2008) A universal DNA mini-barcode
for biodiversity analysis. BMC Genomics,9, 214.
Mu˜
noz, A.G., Baxter, S.W., Linares, M. & Jiggins, C.D. (2011) Deep
mitochondrial divergence within a Heliconius butterfly species is
not explained by cryptic speciation or endosymbiotic bacteria. BMC
Evolutionary Biology,11, 358.
Munroe, E.G. (1954) A new Phlyctaenia, with notes on two related
species (Lepidoptera: Pyralidae). The Canadian Entomologist,86,
428– 431.
Munroe, E.G. (1976) Pyraloidea Pyralidae comprising the subfamily
Pyraustinae tribe Pyraustini (part). The Moths of America North of
Mexico 13.2A (ed. by R.B. Dominick, T. Dominick, D.C. Ferguson
et al.), pp. 1–78, pls 1 4, A-H. E.W. Classey Ltd. and The Wedge
Entomological Research Foundation, London.
Munroe, E.G. (1978) Epicorsia H¨
ubner and allied neotropical genera:
supplementary notes and descriptions (Lepidoptera: Pyralidae:
Pyraustinae). The Canadian Entomologist,110, 673– 695.
Munroe, E.G., Becker, V.O., Shaffer, J.C., Shaffer, M. & Solis, M.A.
(1995) Pyraloidea. Atlas of Neotropical Lepidoptera. Checklist: Part
2. Hyblaeoidea – Pyraloidea – Tortricoidea (ed. by J.B. Heppner),
pp. 34–105. Association for Tropical Lepidoptera, Gainesville, FL.
Mutanen, M., Aarvik, L., Huemer, P., Kaila, L., Karsholt, O. &
Tuck, K. (2012) DNA barcodes reveal that the widespread Euro-
pean tortricid moth Phalonidia manniana (Lepidoptera: Tortricidae)
is a mixture of two species. Zootaxa,3262, 1–21.
Mutuura, A. & Munroe, E.G. (1970) Taxonomy and distribution of the
European corn borer and allied species: genus Ostrinia [H¨
ubner]
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
DNA barcoding reveals three cryptic species of Anania 705
(Lepidoptera: Pyralidae). Memoirs of the Entomological Society of
Canada,71, 1– 112.
Narita, S., Nomura, M., Kato, Y. & Fukatsu, T. (2006) Genetic
structure of sibling butterfly species affected by Wolbachia infection
sweep: evolutionary and biogeographical implications. Molecular
Ecology,15, 1095– 1108.
van Nieukerken, E.J., Kaila, L., Kitching, I.J. et al. (2011) Order
Lepidoptera Linnaeus, 1758. In: Zhang, Z.-Q. (Ed.) Animal
Biodiversity: An Outline Of Higher-Level Classification and Survey
Of Taxonomic Richness.Zootaxa,3148, 212–221.
Nuss, M. & Speidel, W. (2005) Introduction. In: B. Goater, M. Nuss
and W. Speidel, ed. Pyraloidea I,Microlepidoptera of Europe,
Vol. 4 (ed. by P. Huemer and O. Karsholt), pp. 7– 20. Apollo Books,
Stenstrup.
Nuss, M., Landry, B., Vegliante, F. et al. (2009) Global Informa-
tion System on Pyraloidea (GlobIZ) [WWW document]. URL
www.pyraloidea.org [accessed on 29 April 2011].
Packard, A.S. (1870) Injurious insects, new and little known. Seven-
teenth Annual Report of the Secretary of the Massachusetts Board
of Agriculture for 1869. pp. 235 –263, 1 plate. Wright & Potter,
Boston.
Padial, J.M. & De La Riva, I. (2010) A response to recent proposals for
integrative taxonomy. Biological Journal of the Linnaean Society,
101, 747– 756.
Padial, J.M., Miralles, A., De la Riva, I. & Vences, M. (2010) The
integrative future of taxonomy. Frontiers in Zoology,7, 16.
Posada, D. (2008) jModelTest: phylogenetic model averaging. Molec-
ular Biology & Evolution,25, 1253– 1256.
Regier, J.C., Mitter, C., Solis, M.A. et al. (2012). A molecular phy-
logeny for the pyraloid moths (Lepidoptera: Pyraloidea) and its
implications for higher-level classification. Systematic Entomology,
in press.
Retzius, A.I. (1783) Caroli Lib. Bar. de Geer ... Genera et species
insectorum e generosissimi auctoris scriptis extraxit, digessit, latine
quoad partem reddidit, et terminologiam insectorum Linneanam
addidit. Lipsiae, Apud Sigfried Lebrecht Crusium.
Ronquist, F. & Huelsenbeck, J.P. (2003) MRBAYES 3: bayesian
phylogenetic inference under mixed models. Bioinformatics,19,
1572– 1574.
Rozas, J., Sanchez-Delbarrio, J.C., Messeguer, X. & Rozas, R. (2003)
DnaSP, DNA polymorphism analyses by the coalescent and other
methods. Bioinformatics,19, 2496– 2497.
Russell, J.A., Goldman-Huertas, B., Moreau, C.S. et al. (2009) Spe-
cialization and geographic isolation among Wolbachia symbionts
from ants and lycaenid butterflies. Evolution,63, 624– 640.
Schlick-Steiner, B.C., Steiner, F.M., Seifert, B., Stauffer, C., Chris-
tian, E. & Crozier, R.H. (2010) Integrative taxonomy: a multisource
approach to exploring biodiversity. Annual Review of Entomology,
55, 421– 438.
Scholtens, B.G. & Wagner, D.L. (2007) Lepidoptera of Great Smoky
Mountains National Park: methods and results of the inventory.
Southeastern Naturalist,6, 193– 206.
Sinev, S.Yu. (2008) Crambidae. Catalogue of the Lepidoptera of
Russia (ed. by S.Y. Sinev), pp. 170 187. KMK Scientific Press,
St. Petersburg and Moscow.
Smith, M.A. & Fisher, B.L. (2009) Invasions, DNA barcodes, and
rapid biodiversity assessment using ants of Mauritius. Frontiers in
Zoology,6, 31.
Smith, M.A., Woodley, N.E., Janzen, D.H., Hallwachs, W. & Hebert,
P.D.N. (2006) DNA barcodes reveal cryptic host-specificity within
the presumed polyphagous members of a genus of parasitoid flies
(Diptera: Tachinidae). Proceedings of the National Academy of
Sciences of the U.S.A.,103, 3657– 3662.
Solis, M.A. & Maes, K.V.N. (2002) Preliminary phylogenetic analysis
of the subfamilies of Crambidae (Pyraloidea: Lepidoptera). Belgian
Journal of Entomology,4, 53– 95.
Speidel, W. (1996) Family Pyralidae. The Lepidoptera of Europe,
a Distributional Checklist (ed. by O. Karsholt and J. Razowski),
pp. 166– 196. Apollo Books, Stenstrup.
StatSoft Inc. (1999) STATISTICA for Windows [Computer Program
Manual]. StatSoft Inc., Tulsa, OK.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. &
Kumar, S. (2011) MEGA5: molecular evolutionary genetics anal-
ysis using maximum likelihood, evolutionary distance, and max-
imum parsimony methods. Molecular Biology and Evolution,28,
2731– 2739.
Tr¨
ankner, A. & Nuss, M. (2010) Anania ochrofascialis (Christoph)
comb. n. and A. murcialis (Ragonot) comb. n. – two vicarious
species from the western Palaearctic region (Pyraloidea: Crambidae:
Pyraustinae). Nota lepidopterologica,33, 59– 65.
Tr¨
ankner, A., Li, H. & Nuss, M. (2009) On the systematics of
Anania H¨
ubner, 1823 (Pyraloidea: Crambidae: Pyraustinae). Nota
lepidopterologica,32, 63– 80.
de Waard, J.R., Hebert, P.D.N. & Humble, L.M. (2011) A com-
prehensive DNA barcode library for the looper moths (Lepi-
doptera: Geometridae) of British Columbia, Canada. PLoS ONE,6,
e18290.
Wilson, J.J., Landry, J.F., Janzen, D.H., Hallwachs, W., Nazari, V.,
Hajibabaei, M. & Hebert, P.D.N. (2010) Identity of the ailanthus
webworm moth (Lepidoptera, Yponomeutidae), a complex of two
species: evidence from DNA barcoding, morphology and ecology.
ZooKeys,46, 41– 60.
Accepted 30 April 2012
©2012 The Authors
Systematic Entomology ©2012 The Royal Entomological Society, Systematic Entomology,37, 686–705
... Integrative taxonomy is becoming a widely accepted and reliable approach of species delineation to extract convincing evidence and diagnoses of the differences among the closely related and cryptic species. As part of integrative taxonomy, many recent studies in Lepidoptera have discussed the power of DNA-based approach as an effective way to assist in discovering previously unrecognised cryptic species (Dincă et al. 2011;Huemer and Mutanen 2012;Mutanen et al. 2012Mutanen et al. , 2015van Nieukerken et al. 2012;Yang et al. 2012;Huemer et al. 2013Huemer et al. , 2014Landry and Hebert 2013;Kozlov et al. 2017). ...
... Protocols for the preparation and photography of genitalic slides followed Landry (2007), whereas genital terminology followed Munroe (1976) and Kristensen (2003). Variation in genital features was assessed with quantitative multivariate analyses following Yang et al. (2012). Principal components analysis was used to study the patterns of covariation among the features of female and male genitalia. ...
... In this study, both morphological and molecular analyses revealed that what has long been known as A. hortulata actually comprises two superficially indistinguishable species, A. hortulata and A. sinensis. Several other studies have used DNA barcodes effectively as an initial means to detect potential cryptic species (Huemer and Mutanen 2012;Mutanen et al. 2012;Yang et al. 2012;Huemer et al. 2013;Landry and Hebert Fig. 9. Female genitalia. A, Anania hortulata (genitalia slide PYR1738, CNC); B, Anania sinensis (genitalia slide NWAFU00005, NWAFU). ...
Article
Anania hortulata (Linnaeus, 1758) (Lepidoptera: Crambidae: Pyraustinae) is a strikingly coloured, common, and widespread species that has long been recognised as a single species widely distributed in Asia, Europe, and North America. Using a combination of molecular and morphometric data, this study resolved that A. hortulata is actually a species complex of two superficially indistinguishable species. Phylogenetic and network analyses based on the mitochondrial COI gene discriminated lineages from all major geographical regions of China as distinct, A. sinensis Yang and Landry new species , whereas A. hortulata occurs in Central Asia, Europe, and North America. Nuclear gene (CAD) and morphological differences in the genital characters provided further evidence for the separation of A. hortulata and A. sinensis .
... In addition, the development of molecular technology has brought new ideas to the study of species. Increasing evidence demonstrates the importance of considering both morphological and genetic variation in studies of population structure and species differentiation [8][9][10][11][12][13][14]. ...
... Samples used for analyses of morphological characteristics were basically obtained from the samples used in molecular experiments. Our approach for anatomical analyses of gypsy moth genitalia was based on these previous studies [10,64,65]. Moreover, according to the characteristics of insects, some improvements have been made. ...
Full-text available
Article
The gyspy moth Lymantria dispar Linnaeus, a widely distributed leaf-eating pest, is considered geographically isolated in the world, with two Asian gypsy moth subspecies, Lymantria dispar asiatica and Lymantria dispar japonica. In China, only one subspecies, L. d. asiatica, has been observed. In this study, we characterized gypsy moth diversity and divergence using 427 samples covering a wide range of the species distribution, with a focus on sampling along a latitudinal gradient in China. We combine the quantitative analysis of male genitalia and the genetic diversity analysis of nine microsatellite loci of nuclear genes nuclear genes to study the structure of gypsy moth individuals in 23 locations in the world and the male genitalia of gypsy moths in some areas. In mixed ancestry model-based clustering analyses based on nuclear simple sequence repeats, gypsy moths were divided into three well-known subspecies, a unique North American cluster, and a southern Chinese cluster with differentiation between the Asian gypsy moth and European gypsy moth. We also found individuals identified as European gypsy moths in two distant regions in China. The results of a quantitative analysis of male genitalia characteristics were consistent with an analysis of genetic structure and revealed the differentiation of gypsy moths in southern China and of hybrids suspected to be associated with L. d. japonica in the Russian Far East. Admixture in gypsy moths can be explained by many factors such as human transport. In China, we detected European gypsy moths, and found unexpectedly high genetic diversity within populations across a wide range of latitudes.
... Images of adults and genitalia were captured with a Canon PowerShot SX60 digital camera and (ZEISS Discovery V20) stereomicroscope equipped with an AxioCam ICc5 camera, respectively. Methods for genitalia dissection and slide mounting followed Landry (2007) and Yang et al. (2012), and the genitalia terminology adopted from Munroe (1976), Kristensen (2003) and Nuss & Speidel (2005). The type specimens of the new species were deposited in the Entomological Museum, College of Plant Protection, Northwest A&F University, Yangling, Shaanxi, China (NWAFU). ...
... It is worth emphasizing that available material for systematic work has been quite limited, whether from being freshly collected or from museum specimens, which poses an obstacle to taxonomists. Our study endorses the point made by many recent studies (Yang et al. 2012;Kekkonen et al. 2015;Kergoat et al. 2015;Brunet et al. 2017) that integrative taxonomy is a reliable approach for species discrimination in routine identification of most diverse micro-moths, and will be greatly helpful for clarifying the ambiguous species status and alleviating the taxonomic impediment that hampers the rapid species discovery and biodiversity surveys due to a lack of qualified expertises and relatively slow pace of taxonomic revisions as well. ...
Full-text available
Article
Bacotoma Moore, 1885 is reviewed including the description of a new species from Hainan Island, B. hainanensissp. nov. , based on an analysis that combined morphology and mitochondrial DNA. The following taxonomic changes are proposed: Platamonina Shaffer & Munroe, 2007, syn. nov. is synonymized with Bacotoma and ten species are included: B. ampliatalis (Lederer, 1863) comb. nov. , B. binotalis (Warren, 1896) comb. nov. , B. camillusalis (Walker, 1859), B. cuprealis (Moore, 1877) comb. nov. , B. hainanensissp. nov. , B. illatalis (Walker, 1866), B. oggalis (Swinhoe, 1906) comb. nov. , B. poecilura (Hering, 1903) comb. nov. , B. ptochura (Meyrick, 1894) comb. nov., and B. violata (Fabricius, 1787). Syngamia albiceps Hampson, 1912 syn. nov. is confirmed to be a synonym of Bacotoma binotalis , and Platamonia medinalis Snellen, 1900 syn. nov. is synonymized with Bacotoma illatalis . A key to species examined is also provided based on external morphology and male genitalia.
... Morphometry of genitalia was carried out measuring eight traits for male and seven for female genitalia after mounting them on a microscope slide in Euparal. Optimally, these measurements are carried out before mounting (Yang et al., 2012), but Eupithecia genitalia are fragile and easily damaged dur- Groups. Statistical analyses were performed using PAST version 2.17c (Hammer et al., 2001). ...
Article
en The Barcode Index Numbers (BINs) are operational species units based on patterns of COI divergences that in most cases correspond to species. It has been repeatedly observed that more than one BIN can be found under the same species name particularly when large geographic scales are considered. One such case concerns Eupithecia conterminata, a species widespread in North European countries and restricted to mountainous regions in the rest of the continent, for which five BINs are found in Europe. In order to solve the question concerning the taxonomic status of these BINs and European populations, we employed an integrated approach by combining classical morphological traits (genitalia and wing markings) with those of molecular data, the latter involving both mitochondrial and nuclear genes. This approach allowed us to recognize two valid species in Europe, E. conterminata, currently known only in Fennoscandia, Baltic countries and Russia, and Eupithecia manniaria sp. rev., with distribution covering Central and South European countries. We furthermore synonymized Eupithecia pindosata syn. nov. from Greece with E. manniaria. The European range of these species and their mitochondrial diversity appear to be coherent with biogeographical histories of their foodplants Picea abies and Abies species. Astratta it I Barcode Index Number (BINs) sono unità tassonomiche operative basate sui pattern di divergenza del COI che in molti casi corrispondono ad una specie. È stato ripetutamente osservato che più di un BIN può essere trovato sotto uno stesso nome, soprattutto quando vengono considerate ampie scale geografiche. Uno di questi casi riguarda Eupithecia conterminata, diffusa nei paesi dell’Europa settentrionale e limitata alle regioni montuose nel resto del continente, per la quale in Europa sono stati trovati cinque BIN. Per chiarire lo status tassonomico di questi BIN e delle popolazioni europee, in questo lavoro abbiamo usato un approccio integrato che ha combinato caratteri morfologici classici (struttura dei genitali e pattern alare) con dati molecolari, gli ultimi riguardanti sia geni mitocondriali che nucleari. Questo approccio ci ha permesso di confermare la presenza di due specie in Europa, E. conterminata, attualmente conosciuta solo per Fennoscandia, paesi baltici e Russia, e E. manniaria sp. rev. nota per l’Europa centro-meridionale. Inoltre, abbiamo posto in sinonimia E. pindosata syn. nov. della Grecia con E. manniaria. La distribuzione europea di queste specie e la loro diversità mitocondriale sembra essere coerente con la storia biogeografica delle loro piante nutrici, Picea abies e diverse specie di Abies.
... Samples were dissected for identification based on male genital features and compared with material deposited in the Canadian National Collection of Insects, Arachnids and Nematodes (CNC), as this collection has particularly strong representation of the genus Ostrinia, including 43 types determined by specialists such as E. G. Munroe and A. Mutuura. Genitalia preparation and photography followed Landry (2007) and Yang et al. (2012), whereas genital terminology followed Kristensen (2003). Tissue samples for DNA extraction are preserved at the McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, Gainesville, Florida, U.S.A. and the Entomological Museum, Northwest A&F University, Yangling, Shaanxi, China. ...
Full-text available
Article
Reconstructing a robust phylogenetic framework is key to understanding the ecology and evolution of many economically important taxa. The crambid moth genus Ostrinia contains multiple agricultural pests, and its classification and phylogeny has remained controversial because of the paucity of characters and the lack of clear morphological boundaries for its species. To address these issues, we inferred a molecular phylogeny of Ostrinia using a phylogenomic dataset containing 498 loci and 115 197 nucleotide sites and examined whether traditional morphological characters corroborate our molecular results. Our results strongly support the monophyly of one of the Ostrinia species groups but surprisingly do not support the monophyly of the other two. Based on the extensive morphological examination and broadly representative taxon sampling of the phylogenomic analyses, we propose a revised classification of the genus, defined by three species groups (Ostrinia nubilalis species group, Ostrinia obumbratalis species group, and Ostrinia penitalis species group), which differs from the traditional classification of Mutuura & Munroe (1970). Morphological and molecular evidence reveal the presence of a new North American species, Ostrinia multispinosa Yang sp.n., closely related to O. obumbratalis. Our analyses indicate that the Ostrinia ancestral larval host preference was for dicots, and that O. nubilalis (European corn borer) and Ostrinia furnacalis (Asian corn borer) independently evolved a preference for feeding on monocots (i.e., maize). Males of a few Ostrinia species have enlarged, grooved midtibiae with brush organs that are known to attract females to increase mating success during courtship, which may represent a derived condition. Our study provides a strong evolutionary framework for this agriculturally important insect lineage.
... Similarly, the temperature-size rule states that higher temperatures result in a smaller adult size of ectotherms (Angilletta and Dunham 2003;Bowden et al. 2015). Finally, studying the effects of environmental factors on populations usually requires both morphometric and molecular analyses (Yang et al. 2012;Bereczki et al. 2017;De Moya et al. 2017;Paučulová et al. 2018). ...
Full-text available
Article
The contrasting habitats providing a heterogenous environment are considered to affect morphological traits of Lepidoptera due to their adaptability to various selection pressures under such conditions. The morphological and genetic variability of the butterfly Argynnis paphia (Nymphalidae) were studied with a focus on populations across different environments of the Western Carpathians. Male individuals were collected from five sites differing in elevation, type of bedrock, vegetation and climatic region. Morphometric analyses indicated significant variability in reproductive (genitalia width) and non-reproductive (forewing shape and size) traits. The most significant differences were recorded between the locality Bačová, representing the highest elevation, and other localities. The statistical analyses revealed the correlation of wing morphology with elevation, bedrock type and annual average temperature, while morphological differences of valvae structures were correlated with altitude. We concluded that size and shape of wings but also male genitalia vary among populations of A. paphia from different regions in response to environmental conditions.
... Consequently, we recommend ABGD as the best method to delimit species of Coccinellidae. BINs in BOLD have been yielded results largely conform with traditional taxonomy in many groups of animals 46 . However, it apparently overestimated species numbers in our study, arguably due to the low intra-specific genetic distance threshold obtained for Coccinellidae with the Refined Single Linkage (RESL) method. ...
Full-text available
Article
Even though ladybirds are well known as economically important biological control agents, an integrative framework of DNA barcoding research was not available for the family so far. We designed and present a set of efficient mini-barcoding primers to recover full DNA barcoding sequences for Coccinellidae, even for specimens collected 40 years ago. Based on these mini-barcoding primers, we obtained 104 full DNA barcode sequences for 104 species of Coccinellidae, in which 101 barcodes were newly reported for the first time. We also downloaded 870 COI barcode sequences (658 bp) from GenBank and BOLD database, belonging to 108 species within 46 genera, to assess the optimum genetic distance threshold and compare four methods of species delimitation (GMYC, bPTP, BIN and ABGD) to determine the most accurate approach for the family. The results suggested the existence of a ‘barcode gap’ and that 3% is likely an appropriate genetic distance threshold to delimit species of Coccinellidae using DNA barcodes. Species delimitation analyses confirm ABGD as an accurate and efficient approach, more suitable than the other three methods. Our research provides an integrative framework for DNA barcoding and descriptions of new taxa in Coccinellidae. Our results enrich DNA barcoding public reference libraries, including data for Chinese coccinellids. This will facilitate taxonomic identification and biodiversity monitoring of ladybirds using metabarcoding.
... Using a combination of DNA barcoding and morphology, several papers have recently reported the presence of European or Palearctic Lepidoptera from North America: Lampropteryx suffumata (Geometridae) (deWaard et al. 2008); Paraswammerdamia nebulella (as lutarea) and Argyresthia pruniella (Yponomeutidae); Prays fraxinella (Praydidae); Dichelia histrionana (Tortricidae) ); Gypsonoma aceriana (Tortricidae) ); and Eupithecia pusillata (Geometridae) ). Other studies have documented cases of misidentifications, as well as synonymous and cryptic species (Mutanen et al. 2012a;Yang et al. 2012). ...
Full-text available
Book
This study reports 30 species of Lepidoptera previously known from either the Palearctic or the Nearctic that are newly recorded as Holarctic. For 28 of these species, their intercontinental distributions were initially detected through DNA barcode analysis and subsequently confirmed by morphological examination; two Palearctic species were first detected in North America through morphology and then barcoded. When possible, the origin and status of each species (introduced, overlooked Holarctic species, or unknowingly re-described) is discussed, and its morphology is diagnosed and illustrated. The species involved include Tineidae: Scardia amurensis Zagulajev, Triaxomera parasitella (Hübner), Nemapogon cloacella (Haworth), Elatobia montelliella (Schantz), Tinea svenssoni Opheim; Gracillariidae: Caloptilia suberinella (Tengström), Parornix betulae (Stainton); Phyllonorycter maestingella (Müller); Yponomeutidae: Paraswammerdamia albicapitella (Scharfenberg), P. conspersella (Tengström); Plutellidae: Plutella hyperboreella Strand; Lyonetiidae: Lyonetia pulverulentella Zeller; Autostichidae: Oegoconia deauratella (Herrich-Schäffer), O. novimundi (Busck); Blastobasidae: Blastobasis glandulella (Riley), B. maroccanella (Amsel), B. tarda Meyrick; Depressariidae: Agonopterix conterminella (Zeller), Depressaria depressana (F.); Coleophoridae: Coleophora atriplicis Meyrick, C. glitzella Hofmann, C. granulatella Zeller, C. texanella Chambers, C. vitisella Gregson ; Scythrididae: Scythris sinensis (Felder & Rogenhofer); Gelechiidae: Altenia perspersella (Wocke), Gnorimoschema jalavai Povolný, Scrobipalpa acuminatella (Sircom), Sophronia gelidella Nordman; Choreutidae: Anthophila fabriciana (L.); and Tortricidae: Phiaris bipunctana (F.). These cases of previously unrecognized faunal overlap have led to their redescription in several instances. Five new synonyms are proposed: Blastobasis glandulella (Riley, 1871) = B. huemeri Sinev, 1993, syn. nov.; B. tarda Meyrick, 1902 =Neoblastobasis ligurica Nel & Varenne, 2004, syn. nov.; Coleophora atriplicis Meyrick, 1928 = C. cervinella McDunnough, 1946, syn. nov.; C. texanella Chambers, 1878 = C. coxi Baldizzone & van der Wolf, 2007, syn. nov., and = C. vagans Walsingham, 1907, syn. nov. Lectotypes are designated for Blastobasis tarda Meyrick and Coleophora texanella Chambers. Type specimens were examined where pertinent to establish new synonymies. We identify 12 previously overlooked cases of species introductions, highlighting the power of DNA barcoding as a tool for biosurveillance.
... This method has been widely recognized and accepted in molecular phylogenetic studies (Hebert et al. 2003). The COI-based identification system has achieved remarkable success discriminating species across numerous animal groups, including birds (Hebert et al. 2004b), fishes (Hubert et al. 2008), and the insect orders Lepidoptera (Hebert et al. 2004a;Hajibabaei et al. 2006;Yang et al. 2012;Ashfaq et al. 2013), Ephemeroptera (Ball et al. 2005), and Hymenoptera (Smith et al. 2008). But this technology has also failed to identify species accurately under certain circumstances. ...
Full-text available
Article
We investigated the feasibility of using the DNA barcode region in identifying Deltocephalus from China. Sequences of the barcode region of the mitochondrial COI gene were obtained for 98 specimens (Deltocephalus vulgaris - 88, Deltocephalus pulicaris - 5, Deltocephalus uncinatus - 5). The average genetic distances among morphological and geographical groups of D. vulgaris ranged from 0.9% to 6.3% and among the three species of Deltocephalus ranged from 16.4% to 21.9% without overlap, which effectively reveals the existence of a "DNA barcoding gap". It is important to assess the status of these morphological variants and explore the genetic variation among Chinese populations of D. vulgaris because the status of this species has led to taxonomic confusion because specimens representing two distinct morphological variants based on the form of the aedeagus are often encountered at a single locality. Forty-five haplotypes (D. vulgaris - 36, D. pulicaris - 5, D. uncinatus - 4) were defined to perform the phylogenetic analyses; they revealed no distinct lineages corresponding either to the two morphotypes of D. vulgaris or to geographical populations. Thus, there is no evidence that these variants represent genetically distinct species.
... DNA barcodes have frequently been attempted in order to get a more reliable species identification and recognition of cryptic species in other groups of aphids [25][26][27][28][29][30][31] . For a more rapid and precise species diversity estimation, this method of discovering diversity has been extensively adopted for various groups of taxa [32][33][34] . ...
Full-text available
Article
Nippolachnus is a small Palaearctic-Oriental genus of very characteristic aphids that live on the leaves of woody Rosaceae. One species, N. piri, has hitherto been regarded to be widely distributed and relatively polyphagous. Members of this genus are considered to be easy to recognize due to the absence of the ocular tubercle and triommatidia on the head. We conducted research on the morphology and generic characters of Nippolachnus piri complex using scanning electron microscopy (for the first time) and DNA barcoding. We analyzed N. piri populations on Pyrus and other plants (Eriobotrya, Rhaphiolepis and Sorbus) in Japan and the Republic of Korea. Specifically, a high genetic divergence value was found between the N. piri populations associated with different host plants. SEM investigation of the head capsule revealed that a triommatidium is present under the compound eye, despite their lack of an ocular tubercle. We propose Nippolachnus micromeli Shinji, 1924 stat. nov. as a cryptic species in the N. piri complex based on a morphological comparison, DNA barcoding and different host-plant associations. Illustrations and descriptions of studied species are given. Morphological keys to the apterae and alatae of all known species of the genus Nippolachnus are also provided.
Full-text available
Article
Extraction of DNA from Lepidoptera is a destructive procedure and curators are often reluctant to provide museum specimens for molecular investigations. On the other hand, dissection of abdomens and genitalia is a standard procedure for description and identification of species and generally accepted even for type material. We present a method that combines the investigation of morphological traits in genitalia with the analysis of DNA sequence information by modifying the dissection protocol. Maceration of abdomens in potassium hydroxide is replaced by enzymatic digestion of soft tissue followed by DNA extraction. DNA extracted from abdomens is suitable for sequencing, as shown for the mitochondrial COI gene appropriate for species identification. Enzymatically treated abdomens proved to be sufficient for preservation of morphological traits. Recommendations are given for appropriate treatment of collected specimens and for routine use of enzymatic digestion.
Full-text available
Article
Although much biological research depends upon species diagnoses, taxonomic expertise is collapsing. We are convinced that the sole prospect for a sustainable identification capability lies in the construction of systems that employ DNA sequences as taxon 'barcodes'. We establish that the mitochondrial gene cytochrome c oxidase I (COI) can serve as the core of a global bioidentification system for animals. First, we demonstrate that COI profiles, derived from the low-density sampling of higher taxonomic categories, ordinarily assign newly analysed taxa to the appropriate phylum or order. Second, we demonstrate that species-level assignments can be obtained by creating comprehensive COI profiles. A model COI profile, based upon the analysis of a single individual from each of 200 closely allied species of lepidopterans, was 100% successful in correctly identifying subsequent specimens. When fully developed, a COI identification system will provide a reliable, cost-effective and accessible solution to the current problem of species identification. Its assembly will also generate important new insights into the diversification of life and the rules of molecular evolution.
Full-text available
Article
With this contribution, we continue to investigate the generic classification of European Pyraustinae based on synapomorphic characters. Further taxa are recognized which are related to Anania Hübner, 1823. The monotypic genus Ametasia Martin, 1986 syn. n. is synonymised with Anania and two species are transferred to this genus: Anania ochrofascialis (Christoph, 1882) comb. n., the type-species of Ametasia, and Anania murcialis (Ragonot, 1895) comb. n. Both species were formerly provisionally placed in Achyra Guenée, 1849. The two species are closely related as they cannot be distinguished according to characters of copulatory organs. They are vicarious in the Mediterranean region of the western Palaearctic, with A. murcialis occurring in Spain and Morocco, and A. ochrofacialis in Ukraine, southern part of European Russia, Azerbaijan, south of Dead Sea, Egypt, and Kazakhstan.
Full-text available
Article
Currently, Pyraustinae (Lepidoptera: Pyraloidea: Crambidae) are split into many genera that often contain a small number of species only. This classifi cation is largely infl uenced by traditional and typological concepts and do not necessarily refl ect natural relationships. Thus, we encourage the idea to fuse taxa based on synapomorphies, as suggested by Leraut (2005), who argued, that an elongated, serrated sclerite of the phallus in males and a digitiform structure freely extending into the antrum in females is apomorphic for members of Anania Hübner, 1823. Screening the literature, we found four further species belonging to this monophylum: Anania hasanensis (Kirpichnikova, 1998) (Opsibotys) comb. n., Anania luteorubralis (Caradja, 1916) (Pyrausta) comb. n., Anania obtusalis (Yamanaka, 1987) (Perinephela) comb. n., and Anania shafferi (Speidel & Hanigk, 1990) (Algedonia) comb. n. Investigating Chinese Pyraustinae, we also found these characters in taxa which so far were not assigned to Anania. As a result, Pronomis Munroe & Mutuura, 1968 syn. n., Tenerobotys Munroe & Mutuura, 1971 syn. n., and Udonomeiga Mutuura, 1954 syn. n. are synonymized with Anania. The species formerly tretaed in Pronomis are transferred to Anania: Anania delicatalis (South, 1901) (Pyrausta) comb. n., Anania flavicolor Munroe & Mutuura, 1968 (Pronomis) comb. n., Anania profusalis (Warren, 1896) (Opsibotys) comb. n. The species and subspecies formerly treated in Tenerobotys are transferred to Anania: Anania subfumalis Munroe & Mutuura, 1971 (Tenerobotys) comb. n., Anania subfumalis continentalis (Munroe & Mutuura, 1971) (Tenerobotys) comb. n., Anania teneralis (Caradja, 1939) (Hapalia) comb. n., and Anania teneralis tsinlingalis (Munroe & Mutuura, 1971) (Tenerobotys) comb. n. Anania vicinalis (South, 1901) comb. n. (Pyrausta) is transferred from Udonomeiga to Anania. The apomorphic characters of Anania are also shared by the afrotropic Ethiobotys Maes, 1997, syn. n., and the species formerly treated therein are transferred to Anania: Anania amaniensis (Maes, 1997) comb. n., Anania ankolae (Maes, 1997) comb. n., Anania bryalis (Hampson, 1918) (Lamprosema) comb. n., Anania camerounensis (Maes, 1997) comb. n., Anania elutalis (Kenrick, 1917) (Pyrausta) comb. n., Anania epipaschialis (Hampson, 1912) (Nacoleia) comb. n., Anania lippensi (Maes, 1997) comb. n., and Anania ruwenzoriensis (Maes, 1997) comb. n. In contrast, Crypsiptya Meyrick, 1894 stat. rev. is reinstated as a valid taxon, based on our investigation of Crypsiptya coclesalis (Walker, 1859: 701) (Botys) comb. rev.
Article
The maternally inherited intracellular symbiont Wolbachia pipientis is well known for inducing a variety of reproductive abnormalities in the diverse arthropod hosts it infects. It has been implicated in causing cytoplasmic incompatibility, parthenogenesis, and the feminization of genetic males in different hosts. The molecular mechanisms by which this fastidious intracellular bacterium causes these reproductive and developmental abnormalities have not yet been determined. In this paper, we report on (i) the purification of one of the most abundantly expressed Wolbachia proteins from infected Drosophila eggs and (ii) the subsequent cloning and characterization of the gene ( wsp ) that encodes it. The functionality of the wsp promoter region was also successfully tested in Escherichia coli . Comparison of sequences of this gene from different strains of Wolbachia revealed a high level of variability. This sequence variation correlated with the ability of certain Wolbachia strains to induce or rescue the cytoplasmic incompatibility phenotype in infected insects. As such, this gene will be a very useful tool for Wolbachia strain typing and phylogenetic analysis, as well as understanding the molecular basis of the interaction of Wolbachia with its host.
Article
The genus Ostrinia is revised and the species limits, phylogeny, host relationships, geographical distribution, and the economic implications of species limitation are briefly discussed. Twenty species and 24 additional subspecies are recognized, of which 5 species and 19 additional subspecies are described as new. One new name is proposed for a homonym and a number of changes of synonymy and status are made.
Article
Pyraloidea, one of the largest superfamilies of Lepidoptera, comprise more than 15 684 described species worldwide, including important pests, biological control agents and experimental models. Understanding of pyraloid phylogeny, the basis for a predictive classification, is currently provisional. We present the most detailed molecular estimate of relationships to date across the subfamilies of Pyraloidea, and assess its concordance with previous morphology‐based hypotheses. We sequenced up to five nuclear genes, totalling 6633 bp, in each of 42 pyraloids spanning both families and 18 of the 21 subfamilies, plus up to 14 additional genes, for a total of 14 826 bp, in 21 of those pyraloids plus all 24 outgroups. Maximum likelihood analyses yield trees that, within Pyraloidea, differ little among datasets and character treatments and are strongly supported at all levels of divergence (83% of nodes with bootstrap ≥80%). Subfamily relationships within Pyralidae, all very strongly supported (>90% bootstrap), differ only slightly from a previous morphological analysis, and can be summarized as Galleriinae + Chrysauginae (Phycitinae (Pyralinae + Epipaschiinae)). The main remaining uncertainty involves Chrysauginae, of which the poorly studied Australian genera may constitute the basal elements of Galleriinae + Chrysauginae or even of Pyralidae. In Crambidae the molecular phylogeny is also strongly supported, but conflicts with most previous hypotheses. Among the newly proposed groupings are a ‘wet‐habitat clade’ comprising Acentropinae + Schoenobiinae + Midilinae, and a provisional ‘mustard oil clade’ containing Glaphyriinae, Evergestinae and Noordinae, in which the majority of described larvae feed on Brassicales. Within this clade a previous synonymy of Dichogaminae with the Glaphyriinae is supported. Evergestinae syn. n. and Noordinae syn. n. are here newly synonymized with Glaphyriinae, which appear to be paraphyletic with respect to both. Pyraustinae and Spilomelinae as sampled here are each monophyletic but form a sister group pair. Wurthiinae n. syn., comprising the single genus Niphopyralis Hampson, which lives in ant nests, are closely related to, apparently subordinate within, and here newly synonymized with, Spilomelinae syn. n.
Article
Several proposals have been launched under the new concept ‘integrative taxonomy’ to frame the future development of species discovery and description. We consider that some of those proposals have failed to be truly integrative, by not acknowledging the limitations of operational definitions of species, by defending some kinds of evidence as universally superior, by considering taxonomy to be irreconcilable with population genetics, or by ignoring that the heterogeneity of evolutionary processes often precludes full character congruence in species. Here we defend a taxonomy where species exist, but not in any particular way everyone might want them to exist; a taxonomy open to data and methods from population biology, phylogeography and phylogenetics, as well as any other discipline providing evidence about the origin and evolution of species. This new taxonomy embraces all the consequences of considering species as lineages of reproductive populations, encouraging the use of as many lines of evidence as possible, but without negating that a single line may also be the only one providing evidence for a particular species. Species cannot only be those reproductive populations showing broad character congruence and/or reproductive isolation, due to the different degrees of character congruence, as well as of reproductive isolation, that result from the heterogeneity of evolutionary processes causing lineage splitting and divergence. Also, any kind of character – and not only those established by tradition or fashion – is potentially relevant as evidence of lineage divergence. To conciliate the authors who only see species supported by broad character congruence as good species hypotheses, we explain how a hypothesis can gain corroboration using single or multiple lines of evidence, even in cases of discordance with other lines of evidence. Finally, we propose guidelines to identify the expected degree of stability (preliminary, unstable, and stable) of species hypotheses. © 2010 The Linnean Society of London, Biological Journal of the Linnean Society, 2010, 101, 747–756.