ArticlePDF Available

The generic position of Stachys tibetica Vatke and amalgamation of the genera Eriophyton and Stachyopsis (Lamiaceae subfam. Lamioideae)

Authors:
  • Natural History Museum of Denmark

Abstract and Figures

We have investigated the phylogenetic position of Stachys tibetica by use of both plastid (rps16 intron, trnL-F region and matK) and nuclear ribosomal (ITS) DNA sequence data and both parsimony and Bayesian phylogenetic methods. All data corroborate that S. tibetica is extraneous in Stachys (tribe Stachydeae) and suggest a phylogenetic affiliation in a different lamioid tribe, Lamieae. The molecular data suggest that the species is most closely related to the genus Stachyopsis, while most of the morphological data suggest an intermediate position between Stachyopsis and Eriophyton. Due to difficulties in distinguishing Stachyopsis and Eriophyton, and the possible embedding of the former in the latter genus, we prefer to amalgamate the two closely related genera and refer S. tibetica to the expanded Eriophyton. As a consequence, five new combinations are made: Eriophyton lamiflorum (Rupr.) Brauchler, Eriophyton maleolens (Rech.f.) Salmaki, Eriophyton marrubioides (Regel) Ryding, Eriophyton oblongatum (Schrenk) Bendiksby and Eriophyton tibeticum (Vatke) Ryding.
Content may be subject to copyright.
ORIGINAL ARTICLE
The generic position of Stachys tibetica Vatke and amalgamation
of the genera Eriophyton and Stachyopsis (Lamiaceae subfam.
Lamioideae)
Mika Bendiksby Yasaman Salmaki
Christian Bra
¨uchler Olof Ryding
Received: 2 March 2013 / Accepted: 12 October 2013 / Published online: 14 November 2013
ÓSpringer-Verlag Wien 2013
Abstract We have investigated the phylogenetic position
of Stachys tibetica by use of both plastid (rps16 intron,
trnL-F region and matK) and nuclear ribosomal (ITS) DNA
sequence data and both parsimony and Bayesian phyloge-
netic methods. All data corroborate that S. tibetica is
extraneous in Stachys (tribe Stachydeae) and suggest a
phylogenetic affiliation in a different lamioid tribe, Lami-
eae. The molecular data suggest that the species is most
closely related to the genus Stachyopsis, while most of the
morphological data suggest an intermediate position
between Stachyopsis and Eriophyton. Due to difficulties in
distinguishing Stachyopsis and Eriophyton, and the possi-
ble embedding of the former in the latter genus, we prefer
to amalgamate the two closely related genera and refer S.
tibetica to the expanded Eriophyton. As a consequence,
five new combinations are made: Eriophyton lamiflorum
(Rupr.) Bra
¨uchler, Eriophyton maleolens (Rech.f.) Sal-
maki, Eriophyton marrubioides (Regel) Ryding, Eriophy-
ton oblongatum (Schrenk) Bendiksby and Eriophyton
tibeticum (Vatke) Ryding.
Keywords W Himalaya Molecular phylogenetics
Stachyopsis Eriophyton Stachys tibetica
Taxonomy
Introduction
Scheen et al. (2010) and Bendiksby et al. (2011a) studied
the phylogeny of the whole subfamily Lamioideae (Lami-
aceae) and discerned altogether ten tribes, among them
Stachydeae and Lamieae. The largest genus of the sub-
family, the subcosmopolitan Stachys L. alone comprises
about 300 species (Harley et al. 2004), of which one, S.
tibetica Vatke (from the highlands of northern Pakistan and
northern India; Dickore
´2013), is the main focus of the
present study. Kumar et al. (2012) mentions the species as
an important medicinal plant in traditional medicine.
Originally (Vatke 1875), Stachys tibetica was placed in
the predominantly American section Calostachys Benth.,
with similarities to the large section Lamiotypus Benth.
Hooker (1885) considered the Iranian to Caucasian S.
macrocheilos Boiss. (now treated as synonym under S.
fruticulosa M. Bieb.) as closely related, while a more
recent treatment (Hedge 1990) regarded it as very distinct
with respect to some unusual characteristics such as spiny
bracteoles and triquetrous, apically truncate nutlets. Con-
sequently, Krestovskaya (2003) placed the species in the
new monotypic subgenus Menitskia, raising it to generic
M. Bendiksby (&)
NTNU University Museum, Norwegian University of Science
and Technology, 7491 Trondheim, Norway
e-mail: mika.bendiksby@ntnu.no
Y. Salmaki
Center of Excellence in Phylogeny of Living Organisms,
Department of Plant Science, School of Biology, College of
Science, University of Tehran, PO Box 14155-6455,
Tehran, Iran
C. Bra
¨uchler
Department of Biology I, Biodiversity Research-Systematic
Botany, Ludwig-Maximilians Universita
¨tMu
¨nchen,
Menzinger Str. 67, 80638 Munich, Germany
C. Bra
¨uchler
Botanische Staatssammlung Mu
¨nchen, Menzinger Str. 67,
80638 Munich, Germany
O. Ryding
Botanical Garden, Natural History Museum of Denmark,
University of Copenhagen, Sølvgade 83, opg. S,
1353 Copenhagen, Denmark
123
Plant Syst Evol (2014) 300:961–971
DOI 10.1007/s00606-013-0935-2
rank only 3 years later (Krestovskaya 2006). Diagnostic
features provided for Menitskia are: bracteoles subulate
instead of herbaceous or absent; flowers sessile; corolla lips
equally long, instead of the lower longer; mid-lobe of
lower lip of corolla bent down at a right angle at the base,
equal to lateral lobes and boat-shaped; all stamens long,
curved and projecting forward instead of having the ante-
rior pair bending outward after pollination; anthers slightly
hairy; nutlets triquetrous and apically truncate instead of
rounded; leaves indistinctly three to five lobed. Govaerts
et al. (2013), nonetheless, reduce Menitskia to synonymy
and retain the species in Stachys.
Embedded in ongoing research on the phylogeny and
classification of Stachys (Salmaki et al. 2008,2009,2011,
2012a,b,2013), this paper aims at establishing the phy-
logenetic position of S. tibetica using molecular and mor-
phological analyses, and to help review this part of the
World Checklist of Seed Plants (Govaerts et al. 2013)by
improving the classification.
Materials and methods
The names used for taxa in the present study follow
Govaerts et al. (2013), with Betonica L. recognized as the
distinct genus (see e.g., Scheen et al. 2010).
Taxon sampling
We have generated altogether 19 DNA sequences for the
present study, of which 16 are the nuclear ribosomal
internal transcribed spacer (nrITS) and three are plastid
DNA (pDNA) regions of S. tibetica (trnL intron, trnL-F
spacer and rps16 intron). We aligned the plastid sequences
of S. tibetica into a trimmed version (82 accessions) of the
dataset used by Bendiksby et al. (2011a) that includes all
currently recognized lamioid genera except three (i.e.,
Metastachydium Airy Shaw ex C.Y. Wu & H.W. Li,
Paralamium Dunn. and Pseudomarrubium Popov), from
which no DNA sequences are available. We established the
nrITS dataset (59 accessions) by sequencing a subset of the
accessions included in the plastid data and also included a
few lamioid nrITS sequences from GenBank. All tribes
except for Gomphostemmatae, Synandreae and Leucadeae
are represented in the nrITS dataset. We have deposited all
sequences new to the present study in GenBank. Voucher
information and GenBank accession numbers to all inclu-
ded specimens are provided (see Table 2in Appendix).
The molecular work
We performed the molecular work (PCR-amplification,
PCR purification, cycle sequencing, sequence editing and
aligning) in different laboratories (Munich and Oslo) as
described in previous studies (Scheen et al. 2010; Bend-
iksby et al. 2011a; Salmaki et al. 2012a,b).
To test for potential errors in the process from tissue to
phylogenetic position in a gene tree, we compared separate
gene tree results prior to final analyses on concatenated
congruent datasets. It is well known that the risk of PCR
contamination increases with decreasing DNA quality as
well as with the use of universal primers. We included
some poor-quality DNA templates and used several uni-
versal primer combinations. Despite this, we detected only
a single contaminated sequence: the nrITS of Eriophyton
rhomboideum (Benth.) Ryding, which we excluded from
further analysis.
We analyzed both datasets using maximum parsimony
and Bayesian phylogenetic methods. We performed the
parsimony analyses using NONA (Goloboff 1999)in
combination with WinClada v. 1.0 (Nixon 1999) applying
the heuristic search option with 2,000 replicates and
maxtrees set to 10,000 and otherwise default settings. We
performed parsimony jackknifing with 2,000 replicates and
otherwise default setting. For the Bayesian phylogenetic
analyses, we used Mr Bayes 3.1.2 (Huelsenbeck and
Ronquist 2001; Ronquist and Huelsenbeck 2003) with prior
models of nucleotide substitution set according to the
output of TreeFinder (Jobb et al. 2004). We determined
posterior probabilities by running one cold and three heated
chains for five million generations in parallel mode, saving
trees every 1,000th generation. We performed the analyses
twice to check their convergence for the same topology. To
test whether the Markov chain converged, we monitored
the average standard deviation of split frequencies
(ASDSF), which should fall below 0.01 when comparing
two independent runs.
Morphology
We re-examined morphology in light of the molecular
phylogenetic results presented herein based on herbarium
material in C, GB, M, MSB and UPS, images in the JSTOR
plant science (2013) database and the illustrations in Hedge
(1990).
Results
Alignments and analyses
The lengths in aligned characters of the various DNA
regions were: 1,031 for the trnL-F region (intron and
spacer), 1,058 for the rps16 intron, 1,155 for the matK gene
and 702 for the nrITS. The estimated best-fit model of
nucleotide substitution for the trnL-F region, rps16 intron,
962 M. Bendiksby et al.
123
and nrITS was GTR ?G?I, whereas GTR ?G was
selected for matK. Preliminary parsimony analyses of each
plastid region resulted in congruent topologies that were
resolved to different extents. Therefore, we concatenated
all plastid regions prior to the final analyses. This concat-
enated pDNA matrix of 3,244 aligned characters contained
604 parsimony informative characters. The nrITS con-
tained 278 parsimony informative characters.
The parsimony analysis of the pDNA and nrITS datasets
produced 2,688 and 162 most parsimonious trees of lengths
1,749 and 1,304 steps, and the rescaled consistency and
homoplasy indices were 0.6/0.30 and 0.33/0.52,
0.0080
Eurysolen gracilis
Paraphlomis javanica 1
Stachyopsis oblongata 3
Stachyopsis oblongata 2
Stachys sylvatica
Phyllostostegia velutina
Anisomeles indica
Ajugoides humilis
Lagochilus cabulicus 1
Stachys tibetica
Chaiturus marrubiastrum
Sideritis hyssopifolia
Galeopsis pubescense
Phlomoides rotata 3
Chamaesphacos illicifolius
Cymaria dicotoma
Moluccella laevis
Eriophyton rhomboideum 1
Rydingia integrifolia
Warnockia scutellarioides
Synandra hispidula
Achyrospermum fruticosum
Leucosceptrum canum
Phlomoides tuberosa
Lamium purpureum 1
Roylea cinerea 1
Phlomis fruticosa 1
Matsumurella tuberifera
Betonica alupecuros
Macbridea alba
Hypogomphia turkestana
Galeopsis angustifolia
Marrubium supinum
Craniotome furcata
Acanthoprasium integrifolium
Leucas inflata
Suzukia shikikunensis
Brazoria truncata
Thuspeinanta persica
Chelonopsis longipes
Betonica officinalis
Melittis melissophyllum 2
Stachys alpigena
Lamium amplexicaule 1
Prasium majus
Loxocalyx ambiguus
Leonotis leonurus
Acrotome hispida
Lagopsis marrubiastrum
Leonurus sibiricus 2
Marrubium vulgare
Stachys debilis
Pogostemon heyneanus
Lamium galeobdolon subsp. galeobdolon 1
Eriophyton wallichii 1
Eriophyton rhomboideum 2
Haplostachys haplostachya
Colquhounia elegans
Stachys hyssopoides
Stenogyne sessilis
Stachys spinosa
Melittis melissophyllum 1
Leucas spiculifolia
Comanthosphace japonica
Lamium multifidum
Leonurus glaucescens
Lamium album
Leucas lavandulifolia
Leonurus turkestanicus 1
Panzerina lanata
Gomphostemma parviflorum
Colebrookea oppositifolia
Isoleucas arabica
Microtoena patchoulii
Physostegia virginiana
Phlomidoschema parviflorum
Rostrinucula dependens
Eremostachys laevigata 1
Leonurus chaituroides
Otostegia modesta
Stachys byzantina
Ballota nigra subsp. ruderalis
Bostrychanthera deflexa
.99
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
.99
1
1
1
1
1
1
1
1
1
1
1
1
1
1
1
.99
1
1
1
1
1
1
1
.99
1
1
1
1
1
1
1
1
1
1
1
97
100
94 99
91 89 100
100
87 100
90
62
100
99
100
100
100
100
87
98
99 94
65
100
86
77
86 100 100
98
97
80
100 71 82
60
99
65
99 99
98
86
83
95 63
99
99
84
97
98 92 7959 100 99
STACHYDEAE
LAMIEAE
POGOSTEMONEAE
GOMPHOSTEMMATEAE
SYNANDREAE
PARAPHLOMIDEAE
PHLOMIDEAE
LEONUREAE
MARRUBIEAE
LEUCADEAE
Fig. 1 The 50 % majority rule consensus phylogram from a Bayesian
analysis of a concatenated matrix with 83 accessions and 3,244
aligned base pairs from four pDNA regions (trnL intron, trnL-F
spacer, rps16 intron and matK). The Bayesian posterior probability
values of at least 0.95 are reported above branches and parsimony
jackknifing of at least 50 % in italics below branches. Multiple
accessions of the same species are numbered according to Table 2in
Appendix. Lamioid tribes are indicated. Inset picture of Stachys
tibetica (with permission from the photographer: Dr. Ori Fragman-
Sapir, Jerusalem Botanical Gardens, www.en.botanic.co.il)
The generic position of Stachys tibetica Vatke 963
123
respectively. In the Bayesian analyses of the pDNA and the
nrITS datasets, the ASDSF had fallen to 0.003165 and
0.005567, respectively, at termination (5th million gener-
ation). We discarded 1,250 generations (25 %) as burn-in
and summarized the remaining trees as Bayesian 50 %
majority rule consensus trees (Figs. 1,2) with Bayesian
posterior probabilities above branches and parsimony
jackknife support in italics below branches.
Phylogenies
Both gene trees (pDNA and nrITS) are generally well
resolved with well-supported clades that are largely con-
gruent at the tribal level (Figs. 1,2). Stachys tibetica
attains a phylogenetic position in tribe Lamieae and groups
with Stachyopsis oblongata (Schrenk) Popov & Vved.
(accession 2) in both the pDNA and nrITS trees (Figs. 1,
2). Note that the second accession of S. oblongata in the
two gene trees are represented by different specimens (1 vs.
3; see Table 2in Appendix), which attain somewhat dif-
ferent positions in the plastid versus nuclear trees.
Stachyopsis oblongata is paraphyletic in the plastid topol-
ogy (Fig. 1) and monophyletic in the nuclear topology
(Fig. 2), although neither are strongly supported.
The topology of the Lamioideae pDNA phylogeny
published by Bendiksby et al. (2011a) is retained herein
(Fig. 1) despite a strongly reduced number of accessions
(280 vs 83), the only difference being lower branch support
for some clades (e.g., Pogostemoneae and Eriophyton
Benth.) and higher for others (e.g., Leonureae and a few of
0.07
Craniotome furcata
Phlomidoschema parviflorum
Colebookea oppositifolia
Ballota hirsuta
Leonurus sibiricus 1
Thuspeinantha persica
Eremostachys laevigata 1
Lamium album
Leonurus glaucescens
Colquhounia elegans
Roylea cinerea 2
Phlomis fruticosa 1
Anisomeles indica
Stachyopsis oblongata 2
Stachys debilis
Stachys sylvatica
Phlomoides tuberosa
Prasium majus
Chamaesphacos illicifolius
Leonurus turkestanicus 2
Galeopsis angustifolia
Paraphlomis hispida
Paraphlomis javanica 3
Hypogomphia turkestana
Suzukia shikikuensis
Phlomis fruticosa 2
Haplostachys haplostachya
Roylea cinerea 1
Phlomoides rotata 1
Betonica alopecuros
Stachys spinosa
Marrubium supinum
Lamium purpureum 2
Lamium galeobdolon subsp. galeobdolon
Sideritis hyssopifolia
Eriophyton wallichii 1
Stachys byzantina
Lamium multifidum
Lamium amplexicaule 2
Pogostemon heyneanus
Phlomoides rotata 2
Melittis melissophyllum 1
Eremostachys laevigata 2
Betonica officinalis 2
Paraphlomis javanica 2
Lagochilus cabulicus 2
Stachys tibetica
Phyllostegia velutina
Stachys alpigena
Stenogyne bifida
Stachys hyssopoides
Ballota hispanica
Stachyopsis oblongata 1
Marrubium vulgare
Pogostemon cablin
Leonurus chaituroides
Eriophyton wallichii 2
Galeopsis pubescens
Melittis melissophyllum 2
1
1
1
1
1
1
1
1
1
1
1
1
1
.99
.98
.95
1
1
1
1
1
.99
.98
1
1
.97
1
1
1
.98
1
.96
1
1
STACHYDEAE
LAMIEAE
POGOSTEMONEAE
LEONUREAE
MARRUBIEAE
PHLOMIDEAE
99 100
79
97
81
100
100
100
100
99
99
91
99
79
50
100
84 100
99
89
99
7964
95
98
79
57
100
98
60
81
81
100
95
93
76
59
90
Fig. 2 The 50 % majority rule consensus phylogram from a Bayesian
analysis of 59 accessions and 702 aligned base pairs from the nuclear
ribosomal ITS region. The Bayesian posterior probability values of at
least 0.95 are reported above branches and parsimony jackknifing of
at least 50 % italics below branches. Multiple accessions of the same
species are numbered according to Table 2in Appendix. Lamioid
tribes are indicated. Inset picture of Stachys tibetica (with permission
from the photographer: Dr. Ori Fragman-Sapir, Jerusalem Botanical
Gardens, www.en.botanic.co.il)
964 M. Bendiksby et al.
123
the backbone branches). Most major, supported clades in
the pDNA tree (Fig. 1) are corroborated by the nrITS tree
(Fig. 2), except for a few nuclear–plastid incongruent
patterns within some genera [e.g., Lamium L. and Stachys;
investigated in more detail by Bendiksby et al. (2011b) and
Salmaki et al. (2013), respectively]. Monophyly of tribe
Lamieae, to which S. tibetica belongs, is inferred by both
plastid and nuclear data, but receives less than 50 % sup-
port by parsimony jackknifing.
Re-examination of morphology supports a closer rela-
tionship to genera of tribe Lamieae than the genus Stachys.
Morphologically, S. tibetica attains an intermediate posi-
tion between the genera Eriophyton and Stachyopsis
(Table 1).
Discussion
Our molecular phylogenetic results, based on both plastid
(Fig. 1) and nuclear (Fig. 2) genetic data, suggest a phy-
logenetic position of S. tibetica in the lamioid tribe Lam-
ieae, sister to the genus Stachyopsis, supporting
Krestovskaya’s (2006) view that this morphologically
distinct species is extraneous in Stachys. As argued in the
following paragraph, the suggestion that S. tibetica belong
to Lamieae close to Stachyopsis is also supported by
morphological data.
Lamieae sensu Bendiksby et al. (2011a) contains the
three genera Lamium,Eriophyton s.lat. (sensu Bendiksby
et al. 2011a) and Stachyopsis. The tribe is best character-
ized by having the anthers usually hairy and also differs
from Stachydeae in having the nutlets apically truncate or
subtruncate. Lamium clearly differs from the latter two
genera in having the lateral lobes of the lower lip of the
corolla acute, reduced or replaced by narrow teeth. There
seems to be no consistent differences between Eriophyton
and Stachyopsis, but the two genera can be distinguished
by a combination of differences in the following four
characters: number of flowers per cyme, flower length,
relation between corolla length and calyx length, and the
presence or absence of an annulus in the corolla tube
(Table 1). The only species of Eriophyton that resembles
Stachyopsis in having an annulate corolla tube, E. nepa-
lense (Hedge) Ryding, strongly differs from the latter
genus in having the corolla c. 30 mm long and c. three
times longer than the calyx.
Judging from our herbarium studies, we agree with
Krestovskaya (2006) that the following characteristics of S.
tibetica are rare or unique within Stachys: subsessile
flowers, near equally long corolla lips, anterior stamens
that do not curve sideward after pollination, hairy anthers
and triquetrous and apically truncate nutlets. While most of
these features are common in many other lamioid genera,
only Stachyopsis and Eriophyton (emend. Bendiksby et al.
2011a) combine all of them. Hairy anthers are compara-
tively uncommon in Lamioideae and are only known in
Galeopsis L. and the three genera of the tribe Lamieae.
Stachys tibetica clearly differs from Galeopsis in having
triquetrous, apically truncate nutlets and clearly differs
from Lamium in having the lateral lobes of the lower lip of
the corolla prominent and rounded. Stachys tibetica is
almost equally similar to the remaining two genera of
Lamieae, Stachyopsis and Eriophyton. In the five charac-
ters mentioned in Table 1, the species agrees better with
Stachyopsis in having the corollas short and annulate in the
tube. On the other hand, the species agrees better with
Eriophyton in having the corolla much longer than the
calyx, the hairs on the upper corolla lip short and only few
flowers in the cymes (Table 1).
Stachys tibetica should obviously be excluded from
Stachys as proposed by Krestovskaya (2006). We see three
alternatives of classifying the species. The first alternative
is to resurrect Krestovskaya (2006) genus Menitskia that
accommodates S. tibetica as the single species. Adopting
her classification will not require new nomenclatorial
combinations. The genus can be distinguished from both
Eriophyton and Stachyopsis in having a narrower posterior
corolla lip, stiffer bracteoles and often deeply crenate to
lobed leaves (Table 1). However, we do not find it infor-
mative to place the species in a monotypic genus. Mono-
typic taxa are redundant in classification as they do not
communicate information on the relationship.
Table 1 Comparison of morphological charactersistics between
Stachys tibetica and the genera Eriophyton and Stachyopsis
Eriophyton
s.lat.
Stachyopsis Stachys tibetica
Number of
species
641
Number of
flowers per
cyme
1–4 3–10 1–3
Flower length 20–40 15–23 15–24
Quotient: corolla
length/calyx
length
1.8–4 1.4–2.1 2–3.5
Annulus in
corolla tube
Absent or
sometimes
present
Present Present
Length of the
hairs of the
upper lip of the
corolla
Mostly
[0.5mm or
sometimes all
\0.5 mm
Mostly
[0.5 mm
All \0.5 mm
Leaf shape Serrate, crenate
or subentire
Serrate,
crenate or
subentire
Pinnately lobed,
crenate,
serrate or
subentire
The generic position of Stachys tibetica Vatke 965
123
The second alternative is to include S. tibetica in
Stachyopsis, the most closely related genus according to
our molecular phylogenetic results (Figs. 1,2). Stachyopsis
has a western to central Asian distribution, adjacent to, but
not overlapping with the more eastern distribution of S.
tibetica.Eriophyton has a wider distribution that overlaps
entirely with the distributions of S. tibetica and most of the
distribution of Stachyopsis (Govaerts et al. 2013). Intro-
gression seems to be common among co-occurring out-
crossing species of the same or closely related genera in the
Lamiaceae and is often detected by incompatible plastid
versus nuclear DNA-based tree topologies (see Bra
¨uchler
et al. 2010 for an overview). In such cases, nuclear data
often correlate better with morphology, while plastid data
contain a strong geographical signal (Albaladejo et al.
2005). Our nuclear data support a phylogenetic sister
relationship between S. tibetica and Stachyopsis. The
morphological data suggest that S. tibetica is about as
closely related to Eriophyton as to Stachyopsis. The four
species of Stachyopsis (S. lamiiflora [Rupr.] Popov &
Vved., S. maleolens [Rech.f.] Hedge, S. marrubioides
[Regel] Ikonn.-Gal. and S. oblongata) are more similar to
each other than to S. tibetica. Hence, inclusion of S. tibe-
tica would render the genus more variable and increase the
distribution area to a moderate extent. It is more prob-
lematic as the distinction between Stachyopsis and Erio-
phyton is rather weak and would be further diminished by
inclusion of S. tibetica which is intermediate in several
differential characters (Table 1). This problem with dis-
tinguishing and defining the two genera provides reasons to
question their status as separate genera.
The third alternative, to include both Stachyopsis and S.
tibetica in Eriophyton, is the least problematic. The group
is supported as monophyletic in both the plastid tree
(Fig. 1) and the nuclear tree (Fig. 2). An expanded genus
Eriophyton will contain 11 species and can be defined by
having the following combination of characters: usually
hairy anthers, prominent and apically rounded to slightly
emarginate lateral lobes of the lower lip of the corolla and
apically truncate or subtruncate nutlets. For the above
given reasons, favoring the latter option, we propose the
corresponding five nomenclatural changes.
Taxonomic conclusions
Eriophyton Benth. in N. Wallich, Pl. Asiat. Rar. 1:63.
1830. –Type: E. wallichii Benth.
=Erianthera Benth., Hooker’s J. Bot. Kew Gard. Misc.
3:880. 1833, nom illeg., non Nees 1832 :Alajja Ikonn.,
Novosti Sist. Vyssh. Rast. 8:274. 1971 :Susilkumara
Bennet, Indian Forester 107:432. 1981. –Type: E. rhom-
boidea Benth.
=Stachyopsis Popov & Vved., Trudy Turkestansk.
Nauchn. Obshch. 1:120 (1923), syn. nov. –Type: S.
oblongata (Schrenk) Popov & Vved., designated here.
=Menitskia (Krestovsk.) Krestovsk., Bot. Zhurn.
(Moscow & Leningrad) 91:1893 (2006), syn. nov. –Type:
M. tibetica (Vatke) Krestovsk.
Bendiksby et al. (2011a) presented a revised version of
the genus description in Harley et al. (2004). After the
inclusion of S. tibetica and the genus Stachyopsis, this
description has to be modified again:
Perennial herbs with a woody root and unbranched hairs.
Leaves crenate or sometimes shallowly pinnately lobed.
Calyx actinomorphic or slightly zymomorphic, subequally
5-lobed. Corolla 15–40 mm long, tube longer or shorter than
the calyx, exannulate or annulate, upper lip hairy above, not
bearded along the margin, lower lip 3-lobed, mid-lobe
slightly to much larger than the lateral lobes, emarginate to
almost entire and lateral lobes prominent, rounded or
sometimes emarginate. Anthers usually hairy. Nutlets api-
cally truncate or subtruncate. Eleven species growing in
alpine area at 2,000–5,000 m in Kazakhstan, Uzbekistan,
Kyrgyzstan, Tadzhikistan, Afghanistan, N Pakistan, N
India, China (Xinjiang, Tibet, Yunnan) and Nepal.
Eriophyton lamiflorum (Rupr.) Bra
¨uchler, comb. nov.
:Stachys lamiiflora Rupr. in F.von der Osten-Saken &
F.J.Ruprecht, Sert. Tianschan.: 67 (1869) :Stachyopsis
lamiiflora (Rupr.) Popov & Vved., Trudy Turkestansk.
Nauchn. Obshch. 1:122 (1923). –Type: Kyrgyzstan, Tien
Shan, ‘‘Kastek-schlucht’’, ‘‘Sary-dschasyk’’ 6 July 1867
(18 July 1867), Osten-Saken s.n. (holotype in LE?).
Eriophyton maleolens (Rech.f.) Salmaki, comb. nov.
:Stachys maleolens Rech.f., Biol. Skr. 8(1): 60 (1955);
Stachyopsis maleolens (Rech.f.) Hedge, Notes Roy. Bot.
Gard. Edinburgh 28:142 (1968). –Type: Afghanistan, Ba-
dakhshan Province, Khash District, 9 Aug. 1937, Koelz
13014 (holotype in W; isotype in US).
Eriophyton marrubioides (Regel) Ryding, comb. nov.
:Phlomis marrubioides Regel, Trudy Imp. S.-Peter-
burgsk. Bot. Sada 6:375 (1879) :Stachyopsis marrubio-
ides (Regel) Ikonn.-Gal., Izv. Glavn. Bot. Sada S.S.S.R.
26:72 (1927). –Type: China, Xinjiang Uyghur A.R. (Sin-
kiang), ‘‘in Turkestaniae orientalis trajectu Tschubaty
9-100000alt.’’, Regel s.n. (syntype in LE?, isotype in P?);
‘ad lacum Sairam’’, Fetissof s.n. (syntype in LE?).
=Phlomis oblongata var. canescens Regel, Trudy Imp. S.-
Peterburgsk. Bot. Sada 9:593 (1886) :Stachyopsis
oblongata var. canescens (Regel) Popov & Vved., Trudy
Turkestansk. Nauchn. Obshch. 1:122 (1923) :Stachyop-
sis canescens (Regel) Adylov & Tulyag., Opred. Rast.
Sred. Azii 9:114 (1987). –Type: China, Xinjiang Uyghur
A.R. (Sinkiang), ‘‘in alpium Dschungariae iliensis
966 M. Bendiksby et al.
123
orientalis trajectu montium Tschubaty a lacu Sairam ad fl.
Borotalam ducente ad alt. 9-100000’, Aug 1878, Regel s.n.
(holotype in LE?).
Eriophyton oblongatum (Schrenk) Bendiksby, comb. nov.
:Phlomis oblongata Schrenk in F.E.L.von Fischer &
C.A.von Meyer, Enum. Pl. Nov. 1:29 (1841) :Stachy-
opsis oblongata (Schrenk) Popov & Vved., Trudy Turke-
stansk. Nauchn. Obshch. 1:121 (1923). –Type: Tajikistan,
‘in vallibus graminosis montim Dschillkaragai (Dzhilka-
ragai)’’, Schenk s.n. (holotype in LE).
=Leonurus dschungaricus Regel, Trudy Imp. S.-Peter-
burgsk. Bot. Sada 6:367 (1879). –Types: China, Xinjiang
Uyghur A.R (Sinkiang), ‘‘in alpium lacum Sairam cin-
gentium valle fluvii Chorgos, 5-60000alt.’’, Regel s.n.
(syntype in LE?); China, Xinjiang Uyghur A.R. (Sinkiang),
‘in angustis fluvii Talki’’, Regel s.n. (syntype in LE?);
China, Xinjiang Uyghur A.R. (Sinkiang), ‘‘in alpibus dsc-
hungaricus lacum Sairam adjacentibus’’, Regel s.n. (syn-
type in LE?); Kazakhstan, ‘‘ad fluvium Almatinka majore
prope Wernoje’’, Regel s.n. (syntype in LE?).
=Stachyopsis ovata Diugaeva, Novosti Sist. Vyssh. Rast.
1968:180 (1968). –Type: Asia Media, Pamiro-Alaj, jugum
Hissaricum, declive austro-orientale, in loco Darja-Sary,
pratum subalpinum, 2,500 m s. m., 25 VII 1965, fl., n°44,
A. Aschirmuchamedov et R. Saprunova (LE).
Eriophyton tibeticum (Vatke) Ryding, comb. nov.
:S. tibetica Vatke, Bot. Zeitung (Berlin) 33:447
(1875) :Menitskia tibetica (Vatke) Krestovsk., Bot.
Zhurn. (Moscow & Leningrad) 91:1894 (2006). –Type:
India?, Kashmir?, ‘‘in Tibetiae occidentalis alt.
10-140000’’ , T. Thomson s.n. (types in E, K, C, PH?).
Acknowledgments We thank the NRC (Norwegian Research
Council: grant no 154145) and the Natural History Museum (Uni-
versity of Oslo, Norway) for financial support to M.B., the DAAD
(Deutscher Akademischer Austausch Dienst) for a grant to Y.S. and
the EU for a SYNTHESYS-II grant to C.B. (DK-TAF-2392). We also
appreciate the help and support of Prof. Dr. Gu
¨nther Heubl and kind
assistance from Tanja Ernst (Munich) in Heubl’s laboratory of plant
molecular systematics, Prof. Shahin Zarre (Tehran, Iran) and Char-
lotte Lindqvist (Buffalo, USA).
Appendix
See Table 2.
Table 2 Alphabetical list of specimens used in the present study including voucher information, country of origin and GenBank accession
numbers
Taxon Voucher information Origin nrITS GenBank accession no.
trnL intron trnL-F
spacer
rps16
intron
matK
Acanthoprasium integrifolium
(Benth.) Ryding
H. Lindberg s.n.
11.06.1939 (sS)
Cyprus N/A FJ854263 FJ854150 FJ854016 HQ911486
Achyrospermum fruticosum
Benth.
P. Phillipson 2082 (S) Madagascar N/A FJ854250 FJ854137 FJ854003 HQ911420
Acrotome hispida Benth. P. Herman 1990 (C) South
Africa
N/A EU138376 EU138299 EU138224 HQ911530
Ajugoides humilis (Miq.)
Makino
J. Ohwi & K. Okamoto
1401 (UPS)
Japan N/A HQ911678 HQ911746 HQ911609 HQ911452
Anisomeles indica (L.) Kuntze E. Emanuelsson 2027
(S)
Pakistan KF769017* FJ854259 FJ854146 FJ854012 HQ911395
Ballota hirsuta Benth. Podlech 53328 (M) Morokko JN680359 N/A N/A N/A N/A
B. hispanica (L.) Benth. ASG s.n. (ORT) N/A AF335641 N/A N/A N/A N/A
B. nigra L. subsp. ruderalis
(Sw.) Briq.
M. Bendiksby & A.-C.
Scheen 0431 (O)
Greece N/A FJ854264 FJ854151 FJ854017 HQ911497
Betonica alopecuros L. S. Vautier 2661390
(US)
Italy KF769018* FJ854308 FJ854203 FJ854088 HQ911446
B. officinalis L. 1. C. Lindqvist & V.A.
Albert 357 (UNA)
Cultivated N/A AF502056 FJ854224 FJ854109 N/A
2. Schuhwerk 09-150 N/A JN680360 N/A N/A N/A N/A
Bostrychanthera deflexa Benth. Sino-American Guizhou
Bot. Exped. 1923 (A)
China N/A FJ854267 FJ854154 FJ854020 HQ911423
Brazoria truncata (Benth.)
Engelm. & A.Gray
D. S. Corell 16051 (DH,
TEX)
Texas N/A EF546969 EF546892 HQ911601 HQ911433
Chaiturus marrubiastrum (L.)
Ehrh. ex Rchb.
A. Pedersen 14 (C) Germany N/A FJ854268 FJ854155 FJ854022 HQ911464
The generic position of Stachys tibetica Vatke 967
123
Table 2 continued
Taxon Voucher information Origin nrITS GenBank accession no.
trnL intron trnL-F
spacer
rps16
intron
matK
Chamaesphacos ilicifolius
Schrenk
K. H. Rechinger 50961 (C) Iran KF529540* FJ854269 FJ854156 FJ854023 HQ911549
Chelonopsis longipes
Makino
S. Okuyama & N. Maruyama
s.n. Nov. 1951 (UPS)
Japan N/A EF546938 EF546861 FJ854024 HQ911424
Colebrookea oppositifolia
Sm.
B. Hansen & T. Smitinand
12747 (C)
Thailand KF769019* HQ911655 HQ911723 HQ911585 HQ911389
Colquhounia elegans Wall. C. F. van Beusekom & C.
Phengklai 3008 (C)
Thailand KF769020* EF546937 EF546859 FJ854027 HQ911422
Comanthosphace japonica
(Miq.) S.Moore
M. Ono & S. Kobayashi 45908
(S)
Japan N/A FJ854272 FJ854159 FJ854029 HQ911407
Craniotome furcata (Link)
Kuntze
O. Polunin & al. 5638 (UPS) Nepal KF769021* FJ854275 FJ854162 FJ854032 HQ911392
Cymaria dichotoma Benth. C. Wang 33150 (US) China N/A FJ854245 FJ854132 FJ853998 HQ911388
Eremostachys laevigata
Bunge
1. J. Fro
¨din 202 (UPS) Kurdistan KF769022* GU993260 GU993069 GU993165 HQ911484
2. Salmaki & Siadati 39152
(TUH)
Iran JN680397 N/A N/A N/A N/A
Eriophyton rhomboideum
(Benth.) Ikonn.
1. Dr. J.E.T. Aitchison 831 (C) Afghanistan N/A HQ911683 HQ911753 HQ911614 HQ911460
2. T. Thomson (C) Typus Tibet N/A HQ911684 HQ911754 HQ911615 HQ911461
E. wallichii Benth. 1. Stainton & al. 7748 (UPS) Nepal KF769023* FJ854277 FJ854164 FJ854034 HQ911462
2. D990 China JF976304 N/A N/A N/A N/A
Eurysolen gracilis Prain. E. Hennipman 3215 (C) Thailand N/A HQ911664 HQ911732 HQ911593 HQ911402
Galeopsis angustifolia
Hoffm.
E. Dahl s.n. 26.08.1979 (O) France KF529535* EF546939 EF546862 FJ854035 HQ911441
Galeopsis pubescens Besser T. Tacik & M. Sychowa 366
(O)
Poland KF529536* EF546940 EF546863 FJ854036 HQ911444
Gomphostemma javanicum
(Blume) Benth.
G.E. Juan s.n. 17.08.1945 (US) Myanmar N/A HQ911667 HQ911735 HQ911595 N/A
Haplostachys haplostachya
(A.Gray) H.St.John
S. Perlman 14328 (NY) Hawaii KF529541* AF502029 FJ854166 FJ854039 HQ911565
Hypogomphia turkestana
Bunge
O. Paulsen 275 (C) C Asia KF529543* HQ911703 HQ911774 HQ911634 HQ911551
Isoleucas arabica O.
Schwartz
M. Thulin & al. 8402 (UPS) Yemen N/A EU138380 EU138303 EU138227 HQ911508
Lagochilus cabulicus
Benth.
1. E. Emanuelsson 2456 (S) Pakistan N/A FJ854279 FJ854167 FJ854040 HQ911468
2. Rechinger 56201 (M) Iran JN680362 N/A N/A N/A N/A
Lagopsis marrubiastrum
(Stephan) Ikonn.-Gal.
T. Thomson s.n. no date (C) Tibet N/A HQ911690 HQ911761 HQ911619 HQ911472
Lamium album L. M. Bendiksby 05-014 (O) Norway KF529537* JF779961 JF779961 JF780035 JF779864
L. amplexicaule L. 1. J. I. Ba
˚tvik 102 (O) Norway N/A JF779969 JF779969 JF780043 N/A
2. Jap 06/79 (BO) Japan AB266245 N/A N/A N/A N/A
L. galeobdolon (L.) L.
subsp. galeobdolon
M. Bendiksby 05-016 (O) Norway KF529538* JF779994 JF779994 JF780068 JF779869
L. multifidum L. J. & F. Bornmu
¨ller 14536 (S) Turkey KF769024* FJ854335 FJ854241 FJ854128 HQ911457
L. purpureum L. 1. N. Orderud s.n. 18.7.1999
(O)
Russia N/A JF780027 JF780027 JF780100 N/A
2. Jap 06/78 (BO) Japan AB266244 N/A N/A N/A N/A
968 M. Bendiksby et al.
123
Table 2 continued
Taxon Voucher information Origin nrITS GenBank accession no.
trnL intron trnL-F
spacer
rps16
intron
matK
Leonotis leonurus (L.) R. Br. F. Venter & P. Vorster 171
(US)
S Africa N/A EU138382 EU138305 EU138229 HQ911521
Leonurus chaituroides C.Y. Wu &
H.W. Li
Z. Chao 030730001 (SHMU) N/A DQ903316 N/A N/A N/A EF395813
L. glaucescens Bunge Z. Chao 060728002 (SHMU) N/A EF395808 N/A N/A N/A EF395811
L. sibiricus L. 1. H. Xie 050619003
(SHMU)
N/A EF395806 N/A N/A N/A N/A
2. T. M. Pedersen 16317
(UPS)
Argentina N/A EF546930 EF546852 FJ854045 HQ911471
L. turkestanicus V.I. Krecz. &
Kuprian.
1. I. Roldugin & V. Fissjun
5393 (S)
Kazakhstan N/A EF546931 EF546853 FJ854046 HQ911466
2. Z. Chao 060728003
(SHMU)
N/A EF395809 N/A N/A N/A N/A
Leucas inflata Benth. M. Thulin & al. 3869 (UPS) Ethiopia N/A EU138410 EU138333 EU138257 HQ911518
L. lavandulifolia Sm. C.A. Salsedo 164 (US) Palau, N/A EU138414 EU138337 EU138261 HQ911505
L. spiculifolia (Balf.f.) Gu
¨rke M. Thulin & A.N. Gifri 8688
(UPS)
Yemen,
Socotra
N/A EU138425 EU138348 EU138272 HQ911517
Leucosceptrum canum Sm. C.T. Mason Jr. & P.B. Mason
3963 (US)
Nepal N/A FJ854283 FJ854171 FJ854047 HQ911404
Loxocalyx ambiguus (Makino)
Makino
G. Murata & T. Shimizu
1233 (S)
Japan N/A HQ911680 HQ911750 HQ911611 N/A
Macbridea alba Chapm. E. S. Ford & E. West s.n.
14.06.1955 (GH)
USA N/A EF546962 EF546885 HQ911598 HQ911428
Marrubium supinum L. J. Barber 203 (TEX) Spain AF335642 AF335681 N/A N/A N/A
M. vulgare L. I. & O. Hedberg 92075
(UPS)
Saudi
Arabia
d* EU138443 EU138366 EU138294 HQ911499
Matsumurella tuberifera (Makino)
Makino
C-C. Liao 1125 (GH) Taiwan N/A HQ911679 HQ911747 HQ911610 HQ911453
Melittis melissophyllum L. 1. M. Bendiksby 09-010 (O) Cultivated KF529544* HQ911702 HQ911773 HQ911633 HQ911534
2. M. E. Steiner & al. 1127
(UPS)
Hungary KF529545* EF546929 EF54849 FJ854051 HQ911535
Microtoena patchoulii (Hook.f.) C.Y.
Wu & S.J. Hsuan
H. Y. Liang 66028 (US) China N/A FJ854287 FJ854174 FJ854052 HQ911393
Moluccella laevis L. W. C. Brumbach 7249 (S) USA N/A EU138444 EU138367 FJ854055 N/A
Otostegia modesta S. Moore M. G. Gilbert & D. Sebsebe
8631 (UPS)
Ethiopia N/A EU138437 EU138360 EU138283 XXXX
Panzerina lanata (L.) Soja
´k T. Norlindh & T. Ahti 10044
(S)
Mongolia N/A FJ854290 FJ854177 FJ854059 XXXX
Paraphlomis javanica (Blume) Prain 1. J. F. Rock 1097 (US) Thailand N/A FJ854292 FJ854178 FJ854061 XXXX
2. Fang 091066 (KUN) N/A EU827095 N/A N/A N/A N/A
3. Liu & Chen 67 (E) Taiwan JN680357 N/A N/A N/A N/A
P. hispida C. Y. Wu Fang 091058 (KUN) N/A EU827112 N/A N/A N/A N/A
Phlomidoschema parviflorum
(Benth.) Vved.
J. S. Andersen & I.C.
Petersen 394 (C)
Afghanistan KF529546* FJ854293 FJ854179 FJ854062 HQ911546
Phlomis fruticosa L. 1. E. Julin s.n. 19.04.1985
(UPS)
Greece KF529539* FJ854294 FJ854180 FJ854063 HQ911475
2. Roessler 6880 (MSB) Montenegro JN680364 N/A N/A N/A N/A
Phlomoides rotata (Benth. ex
Hook.f.) Mathiesen
1. Dikore 3537 (MSB) China JN680371 N/A N/A N/A N/A
2. Fang 091022 (KUN) N/A EU827099 N/A N/A N/A N/A
3. Ludlow & al. 15600 (US) Tibet N/A GU993241 GU993050 HQ911620 HQ911479
The generic position of Stachys tibetica Vatke 969
123
Table 2 continued
Taxon Voucher information Origin nrITS GenBank accession no.
trnL intron trnL-F
spacer
rps16
intron
matK
P. tuberosa (L.) Moench M. Bendiksby 09-001 (O) Cult. KF769025* HQ911691 HQ911762 HQ911621 HQ911481
Phyllostegia velutina (Sherff)
H.St.John
V. A. Albert & al. HI03-061
(O)
Hawaii KF529547* HQ911704 HQ911775 HQ911635 HQ911566
Physostegia virginiana (L.)
Benth.
M. Bendiksby 09-011 (O) Cult. N/A HQ911671 HQ911738 HQ911602 HQ911437
Pogostemon cablin (Blanco)
Benth.
PS0119MT02 N/A FJ980282 N/A N/A N/A N/A
P. heyneanus Benth. J. Klackenberg 100 (S) Sri Lanka KF769026* FJ854297 FJ854184 FJ854069 HQ911401
Prasium majus L. M. Thulin 5752 (UPS) Spain KF529550* FJ854300 FJ854187 FJ854072 HQ911541
Rostrinucula dependens (Rehder)
Kudo
ˆ
D.E. Boufford & al. 24415
(A)
China N/A FJ854302 FJ854189 FJ854074 HQ911405
Roylea cinerea (D.Don) Baill. 1. O. Polunin & al. 837
(UPS)
Nepal KF769027* EU138450 EU138373 EU138290 HQ911454
2. W. Koeltz 4651 (US) India KF769028* HQ911682 HQ911752 HQ911613 HQ911455
Rydingia integrifolia (Benth.)
Scheen & V.A. Albert
M. Thulin & al. 8161 (UPS) Yemen N/A EU138435 EU138358 EU138282 HQ911502
Sideritis hyssopifolia L. J. Barber 202 (TEX) Spain AF335633 AF502037 FJ854193 FJ854078 N/A
Stachyopsis oblongata (Schrenk)
Popov & Vved.
1. I. Roldugin & V. Fissjun
3006795 (US)
Kazachstan KF769029* N/A N/A N/A N/A
2. I. Roldugin & V. Fissjun
5394 (C)
Kazachstan KF769030* HQ911686 HQ911757 HQ911616 HQ911463
3. M. Popov & A. Vvedensky
s.n. (H)
Uzbekistan N/A HQ911687 HQ911758 N/A N/A
Stachys alpigena T.C.E.Fr. O. Ryding 2133 (UPS) Ethiopia KF529561* FJ854309 FJ854204 FJ854089 HQ911555
S. byzantina K.Koch C. Lindqvist and V.A. Albert
356 (UNA)
Cult. KF529577* AF502046 FJ854211 FJ854096 N/A
S. debilis Kunth C. Jativa and C. Epling 242
(US)
Ecuador KF529584* FJ854317 FJ854216 FJ854101 HQ911563
S. hyssopoides Burch. ex Benth. E. Retief 1080 (US) South Africa KF529600* FJ854319 FJ854218 FJ854103 HQ911544
S. spinosa L. M. Bendiksby & A.-C.
Scheen 04-022 (O)
Greece KF529639* FJ854329 FJ854232 FJ854117 HQ911537
S. sylvatica L. M. Bendiksby & A. Tribsch
06-011 (O)
Italy KF529643* AF502063 FJ854235 FJ854120 N/A
S. tibetica Vatke. Dikore 13712 (MSB) Pakistan KF769031* KF769032* KF769033* KF769034* N/A
Stenogyne sessilis Benth. V. A. Albert & al. HI03-067
(O)
Hawaii N/A HQ911705 HQ911776 HQ911636 HQ911567
S. bifida Hillebr. V. A. Albert & al. HI03–032
(O)
Hawaii KF529652* N/A N/A N/A N/A
Suzukia shikikunensis Kudo
ˆC–C. Liao & al. 564 (A) Taiwan KF529655* FJ854332 FJ854238 FJ854123 HQ911562
Synandra hispidula (Michx.)
Baill.
V. E. McNeilus 97-143 (GH) USA N/A EF546970 EF546893 FJ854124 HQ911427
Thuspeinanta persica (Boiss.)
Briq.
K. H. Rechinger 9604 (S) Iraq KF529657* FJ854334 FJ854240 FJ854126 HQ911550
Warnockia scutellarioides
(Engelm. & A. Gray) M.W.
Turner
M. H. Mayfield & G. Nesom
1970 (US)
USA N/A EF546971 EF546894 FJ854127 HQ911430
Multiple accessions from the same species are numbered. Missing data are indicated with N/A
* Sequence data generated for this study are indicated with an asterisk behind the accession number
dSequence shorter than 200 bp: L. multifidum L, Turkey,. J. & F. Bornmu
¨ller 14536 (S), ITS2, partial CACCTCCGCGCGCGGCCGGCC-
CAAATGCCAATCCGCCGTCGACTCACGTCGCGACCAGTGGTGGTTGAACTATCAACTCGCGTGCTGTCGCGCTC-
CACGGCGTCGTCGGTCCGGAAACAK
CAACGCAACCCAACGGCGCGAGCACGCATCGTGCCCACGACCGCGACCCC
970 M. Bendiksby et al.
123
References
Albaladejo RG, Fuertes Aguilar J, Aparicio A, Nieto Feliner G (2005)
Contrasting nuclear–plastidial phylogenetic patterns in the
recently diverged Iberian Phlomis crinita and P.lychnitis
lineages (Lamiaceae). Taxon 54:987–998
Bendiksby M, Thorbek L, Scheen A-C, Lindqvist C, Ryding O
(2011a) An updated phylogeny and classification of Lamiaceae
subfamily Lamioideae. Taxon 60:471–484
Bendiksby M, Brysting AK, Thorbek L, Gussarova G, Ryding O
(2011b) Molecular phylogeny and taxonomy of the genus
Lamium L. (Lamiaceae), Disentangling origins of presumed
allotetraploids. Taxon 60:986–1000
Bra
¨uchler C, Meimberg H, Heubl G (2010) Molecular phylogeny of
Menthinae (Lamiaceae, Nepetoideae, Mentheae)—Taxonomy,
biogeography and conflicts. Mol Phylogenet Evol 55:501–523
Dickore
´WB (2013) The Himalayan Uplands Plant database (HUP
Version 1). Global Mountain Biodiversity Assessment GMBA.
http://data.gbif.org/datasets/resource/14158. Accessed 26 Feb
2013
Goloboff P (1999) NONA (ver. 1.9). Software published by the
author, San Miguel de Tucuma
´n, Argentina. Available at http://
www.cladistics.com
Govaerts R, Paton AJ, Harvey Y, Navarro T (2013) World checklist
of lamiaceae & verbenaceae. The Board of Trustees of the Royal
Botanic Gardens, Kew, Richmond. http://www.kew.org/wcsp/
lamiaceae. Accessed 25 May 2013
Harley RM, Atkins S, Budantsev AL, Cantino PD, Conn BJ, Grayer
R, Harley MM, de Kok R, Krestovskaya T, Morales R, Paton AJ,
Ryding O, Upson T (2004) Labiatae. In: Kubitzki K, Kadereit
JW (eds) The Families and genera of vascular plants 7. Springer,
Berlin & Heidelberg, pp 167–275
Hedge IC (1990) Labiatae. In: Ali SI, Nasir YJ (eds) Flora of Pakistan
192. Royal Botanic Gardens, Edinburgh
Hooker JD (1885) Labiatae. In: Hooker JD (ed) Flora of British India
4.L. Reeve & CO., London, pp 604–705
Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference
of phylogenetic trees. Bioinformatics 17:754–755
Jobb G, von Haeseler A, Strimmer K (2004) TREEFINDER: a
powerful graphical analysis environment for molecular phylog-
enetics. BMC Evol Biol 4:9
JSTOR plant science (2013) Herbarium sheets published on the
internet at http://www.plants.jstor.org. Accessed 20 Oct 2013
Krestovskaya TV (2003) New subgenus of the genus Stachys
(Lamiaceae). Bot Zhurn (Moscow & Leningrad) 88:94–97
Krestovskaya TV (2006) Menitskia, a new genus of the Labiatae
family. Bot Zhurn (Moscow & Leningrad) 91:1892–1894
Kumar D, Bhat ZA, Kumar V, Khan NA, Chashoo IA, Zargar MI,
Shah MY (2012) Effects of Stachys tibetica essential oil in
anxiety. Eur J Integr Med 4:169–176
Nixon KC (1999) WINCLADA (Beta), v. 0.9.9. Software published
by the author, Ithaca, NY. Available at http://www.cladistics.
com
Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phyloge-
netic inference under mixed models. Bioinformatics
19:1572–1574
Salmaki Y, Jamzad Z, Zarre S, Bra
¨uchler C (2008) Pollen morphol-
ogy of Stachys (Lamiaceae) in Iran and its systematic implica-
tion. Flora 203:617–626
Salmaki Y, Zarre S, Jamzad Z, Bra
¨uchler C (2009) Trichome
micromorphology of Iranian Stachys (Lamiaceae) with emphasis
on its systematic implication. Flora 204:371–381
Salmaki Y, Zarre S, Lindqvist C, Heubl G, Bra
¨uchler C (2011)
Comparative leaf anatomy of Stachys (Lamiaceae: Lamioideae)
in Iran with a discussion on its subgeneric classification. Plant
Syst Evol 294:109–125
Salmaki Y, Zarre S, Ryding O, Lindqvist C, Scheunert A, Bra
¨uchler
C, Heubl G (2012a) Phylogeny of the tribe Phlomideae
(Lamioideae: Lamiaceae) with special focus on Eremostachys
and Phlomoides: New insights from nuclear and chloroplast
sequences. Taxon 61:161–179
Salmaki Y, Zarre
´S, Govaerts R, Bra
¨uchler C (2012b) A taxonomic
revision of the genus Stachys (Lamiaceae: Lamioideae) in Iran.
Bot J Linn Soc 170:573–617
Salmaki Y, Zarre S, Ryding O, Lindqvist C, Bra
¨uchler C, Heubl G,
Barber J, Bendiksby M (2013) Molecular phylogeny of the tribe
Stachydeae (Lamiaceae subfamily Lamioideae). Mol Phylogenet
Evol 69:535–551
Scheen A-C, Bendiksby M, Ryding O, Mathiesen C, Albert VA,
Lindqvist C (2010) Molecular phylogenetics, character evolution
and suprageneric classification of Lamioideae (Lamiaceae). Ann
Missouri Bot Gard 97:191–219
Vatke W (1875) Notulae criticae in Stachydis generis species, quae
adsunt in herbario regio berolinensi. Bot Zeit (Berlin)
33:446–450
The generic position of Stachys tibetica Vatke 971
123
... [43]; Stachyopsis Popov & Vved. [143]), and Holocheila, which was formerly treated as incertae sedis [1], has been shown to belong in Lamioideae [44]. Molecular phylogenies have also established that subfamily Cymarioideae is sister to Lamioideae [19]. ...
... A tribal classification of Lamioideae was the result of a molecular phylogeny based on cpDNA [52,53]. The ten tribes have been corroborated as monophyletic groups using nuclear [143] and low-copy nuclear markers [67]. Four genera remained unplaced in the tribal classification because they formed monogeneric clades [53,67]; however, two new tribes, i.e., Colquhounieae and Betoniceae, are proposed here to accommodate the genera Colquhounia and Betonica, respectively. ...
... The monotypic Roylea has still not been attributed to a tribe. Roylea groups within tribe Marrubieae in some nuclear-based phylogenies, but not in all and not in phylogenies based on cpDNA data [33,53,67,143]. To date, only two genera, Metastachydium and Paralamium, have still not been included in molecular phylogenetic studies of Lamioideae, and their relationship with the other genera remains enigmatic. ...
Article
Full-text available
Background: A robust molecular phylogeny is fundamental for developing a stable classification and providing a solid framework to understand patterns of diversification, historical biogeography, and character evolution. As the sixth largest angiosperm family, Lamiaceae, or the mint family, consitutes a major source of aromatic oil, wood, ornamentals, and culinary and medicinal herbs, making it an exceptionally important group ecologically, ethnobotanically, and floristically. The lack of a reliable phylogenetic framework for this family has thus far hindered broad-scale biogeographic studies and our comprehension of diversification. Although significant progress has been made towards clarifying Lamiaceae relationships during the past three decades, the resolution of a phylogenetic backbone at the tribal level has remained one of the greatest challenges due to limited availability of genetic data. Results: We performed phylogenetic analyses of Lamiaceae to infer relationships at the tribal level using 79 protein-coding plastid genes from 175 accessions representing 170 taxa, 79 genera, and all 12 subfamilies. Both maximum likelihood and Bayesian analyses yielded a more robust phylogenetic hypothesis relative to previous studies and supported the monophyly of all 12 subfamilies, and a classification for 22 tribes, three of which are newly recognized in this study. As a consequence, we propose an updated phylogenetically informed tribal classification for Lamiaceae that is supplemented with a detailed summary of taxonomic history, generic and species diversity, morphology, synapomorphies, and distribution for each subfamily and tribe. Conclusions: Increased taxon sampling conjoined with phylogenetic analyses based on plastome sequences has provided robust support at both deep and shallow nodes and offers new insights into the phylogenetic relationships among tribes and subfamilies of Lamiaceae. This robust phylogenetic backbone of Lamiaceae will serve as a framework for future studies on mint classification, biogeography, character evolution, and diversification.
... The expanded Stachyopsis and Eriophyton are sister groups in the phylogeny (Bendiksby et al. 2014). For this reason, and with certain differences in morphology, these groups can retain a generic status. ...
... According to the phylogenetic data, the closest relative of Stachyopsis is Eriophyton Benth. (Bendiksby et al. 2014). In spite of the incomplete sampling, Bendiksby et al. (2014) went further to merge Stachyopsis with Eriophyton "due to difficulties in distinguishing" and "the possible embedding of the former in the latter genus", mostly because of the morphologically intermediate position of the monotypic genus Menitskia (Krestovsk.) ...
... (Bendiksby et al. 2014). In spite of the incomplete sampling, Bendiksby et al. (2014) went further to merge Stachyopsis with Eriophyton "due to difficulties in distinguishing" and "the possible embedding of the former in the latter genus", mostly because of the morphologically intermediate position of the monotypic genus Menitskia (Krestovsk.) Krestovsk. ...
Article
Full-text available
A new series of notes on distribution, taxonomy, morphology and nomenclature of some vascular plants in Kyrgyzstan is presented. Carex subphysodes Popov ex V.Krecz., Astragalus sogdianus Bunge, Oxytropis ferganensis Vass. and Iris maracandica (Vved.) Wendelbo (all native), and also Delphinium orientalis J.Gay (alien) are reported as new to Kyrgyzstan. Sedum tetramerum Trautv. is new to Northern Tian-Shan, and Scirpoides holoschoenus (L.) Soják is new to Chatkal Range and Western Tian-Shan within Kyrgyzstan. The distribution area of Torilis arvensis (Huds.) Link is revised and expanded, and the distribution of Eremurus zoae Vved. (endemic to Kyrgyzstan) is verified and mapped. New names and combinations, Betonica sect. Foliosae (Krestovsk. & Lazkov) Lazkov, Eriophyton anomalum (Juz.) Lazkov & Sennikov, Kudrjaschevia sect. Jacubianae Lazkov, Lagochilus sect. Chlainanthus (Briq.) Lazkov, Leonurus sect. Panzerioidei (Krestovsk.) Lazkov, Phlomoides sect. Pseuderemostachys (Popov) Lazkov, and Scutellaria sect. Ramosissimae Lazkov, are provided as a result of the forthcoming monographic revision of Lamiaceae. Two hybrids are described in Eremurus, E. fuscus × E. cristatus = E. nikitinae Lazkov and E. cristatus × E. zoae = E. gypsaceus Lazkov. Places of valid publication and the authorship of Iris svetlanae (Vved.) T.Hall & Seisums and Erianthera anomala Juz. are corrected. Iris svetlanae is synonymized with I. maracandica. A new colour form (with pinkish flowers) of Betonica betoniciflora (Rupr. ex O.Fedtsch. & B.Fedtsch.) Sennikov is described. English-language designations are provided for the map of biogeographic provinces of Kyrgyzstan.
... The sampling strategy was to include the representatives (where available) of all generic entities allied to the 10 recognized tribes of the Lamioideae. The outgroup was selected based on results from previous phylogenetic studies of subfamily Lamioideae (Scheen et al. 2010;Bendiksby et al. 2013) and included Cymaria dichotoma Bentham. The Appendix lists all taxa included in this study and summarizes sources, voucher specimen data, and GenBank accession numbers. ...
... 1-2). The aligned data matrices were the same as those originally generated by Bendiksby et al. (2013) except for the addition of the 12 newly generated sequences. Lengths of aligned characters of the various DNA-regions were: 1031 for the trnL-F region (intron and spacer), 1058 for the rps16 intron, 1155 for the matK gene, and 702 for the nrITS. ...
Article
Full-text available
The main purpose of this study was to test the hypothesis that Stachys persepolitana is extraneous in Stachys (tribe Stachydeae, subfam. Lamioideae, Lamiaceae) and instead belongs to the genus Lamium (Lamieae, Lamioideae). We investigated the phylogenetic position of S. persepolitana using plastid (rps16 intron, trnL-F and matK regions) and nuclear (nrITS) DNA sequence data with both parsimony and Bayesian phylogenetic approaches. Plastid and nuclear data strongly support that S. persepolitana is extraneous in Stachys and belongs in fact to the genus Lamium. Morphological characters also corroborate its placement in Lamium. Most of the morphological features used to distinguish S. persepolitana from the rest of Stachys fit with Lamium. Anterior pair of stamens bending outward after pollination, anthers hairy and mericarps triquetrous are the most important characters correlating S. persepolitana to Lamium.
... Although the subfamily has a subcosmopolitan distribution, it is most common in southwest Asia and the Mediterranean region, China, and sub-Saharan Africa. During the past two decades, relationships and circumscription of constituent genera of Lamioideae have largely been clarified through both morphological (Abu-Asab and Cantino, , 1994Cantino, 1992a,b;Cantino et al., 1992;Ryding, 1994aRyding, ,b,c, 1995Ryding, , 1998Ryding, , 2003Ryding, , 2008Salmaki et al., 2008;Xiang et al., 2013a;Seyedi and Salmaki, 2015) and molecular phylogenetic studies at various taxonomic levels (Wink and Kaufmann, 1996;Lindqvist and Albert, 2002;Albert, 2007, 2009;Scheen et al., 2008Scheen et al., , 2010Bendiksby et al., 2011Bendiksby et al., , 2014Salmaki et al., 2012Salmaki et al., , 2013Xiang et al., 2013b;Chen et al., 2014;Roy and Lindqvist, 2015;Li et al., 2016;Yao et al., 2016;Siadati et al., 2018). In particular, the molecular phylogenetics analyses of Scheen et al. (2010), Bendiksby et al. (2011), and Zhao et al. (2021) have dramatically improved our understanding of both tribal classification and character evolution within Lamioideae. ...
Article
Full-text available
Paralamium (Lamiaceae) is a monotypic genus within the subfamily Lamioideae with a sporadic distribution in subtropical mountains of southeast Asia. Although recent studies have greatly improved our understanding of generic relationships within Lamioideae, the second most species-rich subfamily of Lamiaceae, the systematic position of Paralamium within the subfamily remains unclear. In this study, we investigate the phylogenetic placement of the genus using three datasets: (1) a 69,276 bp plastome alignment of Lamiaceae; (2) a five chloroplast DNA region dataset focusing on tribe Pogostemoneae, and (3) a nuclear ribosomal internal transcribed spacer region dataset of Pogostemoneae. These analyses demonstrate that Paralamium is a member of Pogostemoneae and sister to the monotypic genus Craniotome. In addition, generic-level phylogenetic relationships within Pogostemoneae are also discussed, and a dichotomous key for genera within Pogostemoneae is provided.
... The outgroup was selected based on the results from previous phylogenetic studies of subfamily Lamioideae (Scheen et al. 2010;Bendiksby et al. 2013). Their accession numbers are provided in Table 3. ...
Article
Full-text available
Azimishad F, Sheidai M, Talebi SM, Noormohammadi Z. 2019. Species relationship and genetic diversity in some Iranian Lamium L. species using ISSR markers. Biodiversitas 20: 1963-1972. Lamium is a widespread and taxonomically complex genus of Lamiaceae which comprises of 16-38 species. This genus is represented in Iran by nine species. In the present study, we used morphological and molecular (ISSR, Cp DNA, and nrITS) data to evaluate species relationships, genetic diversity and population genetic structure of the genus. 27 morphological characteristics, including 13 qualitative and 14 quantitative, and ten ISSR markers were used for morphological and genetical evaluation of 73 accessions from eight taxa. In general, species relationships obtained from morphological and molecular data were largely congruent. In the morphological study, characteristics like the life form, leaf shape, absence/existence of bracts and shape of corolla, were distinctive traits and we did not encounter intermediate forms. Our findings indicated a very high efficiency of the ISSR markers in the identification and delimitation of Lamium species. These results confirmed the placement of L. galeobdolon in the genus Lamium and segregation of L. purpureum and L. garganicum in section Lamium. AMOVA analysis revealed that the species of this genus are genetically differentiated. Nm analysis showed very low value of gene fl ow among the studied species and mantel test indicated isolation by distance occurred among them.
... Although the species belonging to this genus show great morphological and cytological diversity, they are often distinguished by their tubular to urceolate or turbinate calyx ending in equal or subequal mucronate teeth, and by the presence of an annulus or ring of hairs inside the corolla tube (Mulligan and Munro 1989;Ramamoorthy and Elliot 1993;García Zúñiga 2001;Lindqvist and Albert 2002). According to some authors (Ramamoorthy and Elliott 1993;Harley et al. 2004), the genus comprises about 300 species, but recent molecular phylogenetic studies have demonstrated striking polyphyly with at least ten Old World and Hawaiian genera intercalated among Stachys species (Lindqvist and Albert 2002;Scheen et al. 2010;Bendiksby et al. 2011), increasing the greater Stachys lineage, Stachydeae, to more than 500 species, as well as assigning previous members of Stachys to groups distantly related to this lineage (Scheen et al. 2010;Bendiksby et al. 2014). Hence, Stachys can be considered an unnatural group in extreme need of revision (García Zúñiga 2001;Lindqvist and Albert 2002;Scheen et al. 2010;Salmaki et al. 2013). ...
Article
One of the largest genera within the Lamiaceae, Stachys, is in extreme need of taxonomic revision due to its demonstrated phylogenetic polyphyly. Among the New World Stachys, a group of seven species belonging to the Stachys coccinea complex is widely distributed in Mexico, where four of the species in this complex are considered endemic. The members of this complex are characterized by having large and red, orange, or purple corollas. The observed morphological variation, however, may insufficiently circumscribe this number of species, and an assessment combining the use of morphological and molecular data is needed. Here, we evaluated the circumscription of the Stachys coccinea complex and relationships among its members using phylogenetic analyses of chloroplast (cp) DNA sequence data and numerical analysis applied to morphological data. We found that morphological variation in this complex insufficiently circumscribed members of the complex, possibly caused by plasticity of diagnostic morphological characters. In addition, the utilized cpDNA regions, which are commonly used in plant phylogenetic reconstruction (trnL intron, trnL-F spacer, and rps16 intron sequences), render relationships among most of the species in the complex unresolved.We propose that the Stachys coccinea complex be recircumscribed, reducing the number of members to three species: Stachys coccinea, S. lindenii, and S. albotomentosa, keeping the original circumscription of these species and including S. pacifica, S. manantlanensis, S. torresii, and S. jaimehintonii as varieties of S. coccinea.
... Spenn. 23 104 . As a result of these changes, Lamioideae is now considered to have 62 genera (versus 63 recognized by Harley et al. 16 ). ...
Article
Lamiaceae, the sixth largest angiosperm family, contains more than 7000 species distributed all over the world. However, although considerable progress has been made in the last two decades, its phylogenetic backbone has never been well resolved. In the present study, a large-scale phylogenetic reconstruction of Lamiaceae using chloroplast sequences was carried out with the most comprehensive sampling of the family to date (288 species in 191 genera, representing approximately 78% of the genera of Lamiaceae). Twelve strongly supported primary clades were inferred, which form the phylogenetic backbone of Lamiaceae. Six of the primary clades correspond to the current recognized subfamilies Ajugoideae, Lamioideae, Nepetoideae, Prostantheroideae, Scutellarioideae, and Symphorematoideae, and one corresponds to a portion of Viticoideae. The other five clades comprise: 1) Acrymia and Cymaria; 2) Hymenopyramis, Petraeovitex, Peronema, and Garrettia; 3) Premna, Gmelina, and Cornutia; 4) Callicarpa; and 5) Tectona. Based on these results, three new subfamilies—Cymarioideae, Peronematoideae, and Premnoideae—are described, and the compositions of other subfamilies are updated based on new findings from the last decade. Furthermore, our analyses revealed five strongly supported, more inclusive clades that contain subfamilies, and we give them phylogenetically defined, unranked names: Cymalamiina, Scutelamiina, Perolamiina, Viticisymphorina, and Calliprostantherina.
Article
In this paper, twenty-two compounds including twenty-one flavonoids (1-21) and one alkaloid (22) were isolated from Panzeria alaschanica, in which seventeen flavonoids (1-2, 5-11, 13-20) were isolated from P. alaschanica and four flavonoid p-coumaroylglucosides (15-18) from the genus Panzeria for the first time. The occurrence of flavonoid p-coumaroylglucosides and alkaloids might be employed as the common characteristic constituents of the genera Panzeria, Leonurus, Lagochilus, Lagopsis and Marrubium.
Article
Full-text available
• Premise of the study: Lamioideae, one of the most species-rich subfamilies within Lamiaceae, exhibits a remarkable diversity in morphology and habit and is found in mostly temperate to subtropical regions across the globe. Previous studies based on chloroplast DNA (cpDNA) sequence data produced a tribal classification of Lamioideae, but so far this has not been confirmed with nuclear DNA loci. • Methods: We investigated sequence variation in a low-copy nuclear pentatricopeptide repeat (PPR) region, and compared the phylogenetic results with previously published sequence data from a concatenated dataset comprising four cpDNA loci. We incorporated representatives of all ten lamioid tribes and some unclassified taxa, analyzed the data using phylogenetic inference, and estimated divergence times and ancestral areas for major nodes. • Key results: Our results show overall topological similarities between the cpDNA and PPR phylogenies with strong support for most tribes. However, we also observe incongruence in the circumscription of some tribes, including Gomphostemmateae and Pogostemoneae and in the relationship among tribes. Our results suggest an Oligocene-Miocene origin of the Lamioideae crown group. Asia and the Mediterranean region appear to have been centers of diversity and place of origin for many lamioid tribes. • Conclusions: This study represents the first phylogeny of subfamily Lamioideae inferred from low-copy nuclear DNA data. We show that most lamioid tribes are corroborated, although the exact circumscription of two tribes is questioned. We have shed further light on the evolutionary relationships within Lamioideae, and this study demonstrates the utility of the PPR region for such subfamilial-level phylogenetic studies.
Article
Full-text available
This is the first comprehensive molecular investigation of the genus Lamium L. We have addressed phylogenetic relationships and presumed allopolyploid speciation by use of nuclear (NRPA2, 5S-NTS) and chloroplast (matK, psbA-trnH, rps16, trnL, trnL-F, trnS-G) DNA sequence data. Nuclear and chloroplast data were incongruent, and nuclear data showed better correlation with morphology. Bayesian and parsimony phylogenetic results show that (1) Lamium galeobdolon is sister to all remaining Lamium species; (2) Wiedemannia is nested within Lamium; (3) L. amplexicaule is polyphyletic; (4) most tetraploids are of hybrid origin; (5) L. amplexicaule var. orientale is allotetraploid; and (6) Mennema’s (1989) infrageneric classification is not corroborated by molecular data. Based on the molecular results, and taking morphology into account, we suggest resurrection of two species: L. aleppicum and L. paczoskianum.
Article
Full-text available
Stachys is a large and taxonomically complex genus of Lamiaceae (Lamioideae: Stachydeae). On the basis of morphological examination and field investigation, we revised the genus Stachys in Iran. We examined about 3500 specimens from various herbaria and produced a key for identification of all taxa found in Iran. The following are provided for each taxon: a description along with the complete synonymy, notes on nomenclature and relationships within the genus, geographical distribution, habitat, IUCN conservation status assessment and selected materials examined. The following taxa are reported here as new for Iran: S. atherocalyx, S. kotschyi, S. melampyroides and S. recta subsp. subcrenata. Several taxa are placed in synonymy for the first time here: S. persica is a synonym of S. alpina, S. koelzii is a synonym of S. aucheri, S. ballotiformis is a synonym of S. kurdica subsp. kurdica, and S. setifera subsp. daenensis and S. setifera subsp. iranica are synonyms of S. setifera. Two taxa are reduced to the rank of subspecies: S. kurdica subsp. asterocalyx and S. pilifera subsp. ixodes. According to the present revision, the genus contains 32 species, nine subspecies and two hybrids in Iran with 17 endemic taxa.
Article
Full-text available
The tribe Phlomideae (Lamiaceae: Lamioideae) is divided into the three genera Phlomis, Phlomoides (incl. Pseud- eremostachys, Lamiophlomis and Notochaete), and Eremostachys (incl. Paraeremostachys), contains about 278 species and has a distribution range extending from Europe to Mongolia, China, and India. Here, we present a phylogenetic analysis based on nuclear ribosomal (ITS) and cpDNA (partial trnK, rpl32-trnL, and trnT-A) sequence data of 56 accessions representing all genera and major subgeneric taxa of Phlomideae. Taxon sampling covered the genera Phlomoides and Eremostachys more intensively than previous phylogenetic investigations of the tribe. Parsimony and Bayesian analyses of each marker, as well as the combined plastid datasets, produced nearly congruent trees. Monophyly of Phlomis s.str. is confirmed here, although only few representatives of this genus were included. In all obtained trees a core group of Phlomoides and Eremostachys is strongly supported. In accordance with morphological evidence, molecular data confirm the inclusion of Eremostachys, Notochaete, and Paraeremostachys in Phlomoides. In conclusion, the number of recognized genera in Phlomideae is reduced to two: Phlomis and Phlomoides. The necessary new combinations are proposed.
Article
Full-text available
Systematic and evolutionary relationships within the diploid Western Mediterranean Phlomis crinita/lychnitis complex remain controversial apparently due to hybridization and introgression. This study examines patterns of sequence variation in the nuclear ribosomal DNA (ITS region) and three non-coding plastid DNA regions (trnH-psbA, trnT-trnL and atpB-rbcL) in this complex in an aim to clarify whether hybridization, introgression or lineage sorting resulting from recent diversification is mainly responsible for poorly understood relationships. Information recovered from nuclear and chloroplast markers was found to be strongly incongruent. Phylogenetic analysis of inferred nuclear ITS ribotypes is consistent with previous morphometric and taxonomic results in distinguishing two sister lineages, P. crinita s.l. and P. lychnitis. In addition, the high number of additive polymorphisms detected in ITS sequences suggests the sharing of ancestral variability and local patterns of gene flow within the complex. In contrast, the pattern of chloroplast haplotype variation is geographic rather than taxonomic, which might be caused by low mutation rates combined with frequent instances of interspecific hybridization. To integrate the apparently discordant plastid and nuclear evidence, we suggest that both lineage sorting and horizontal transfer have been involved. Even though pinpointing cases due to either phenomenon is difficult, the available data provide evidence of two sister lineages where hybridization events can be identified despite the inheritance of ancestral polymorphisms.
Article
Full-text available
Lamioideae comprise the second-largest subfamily in Lamiaceae. Although considerable progress has recently been made in Lamioideae phylogenetics, the subfamily remains one of the most poorly investigated subfamilies in Lamiaceae. Here we present a taxonomic update of the subfamily based on earlier published data as well as 71 new DNA extracts from relevant in- and outgroup taxa, and DNA sequence data from four chloroplast regions (matK, rps16, trnL intron and trnL-F spacer). The phylogenetic positions of 10 out of 13 previously unplaced small or monotypic Asian lamioid genera and 37 additional lamioid species have been identified, and the classification is updated accordingly. Results from parsimony and Bayesian phylogenetic methods corroborate earlier results, but phylogenetic resolution as well as overall branch support are improved. All newly added genera are assigned to earlier established tribes or the new tribe Paraphlomideae Bendiksby, which includes Ajugoides, Matsumurella and Paraphlomis. Acanthoprasium is resurrected as a genus. Transfer of species is proposed to ac - commodate the monophyly of two genera (Lamium,Otostegia), whereas ten genera remain non-monophyletic (Ballota s. str., Lagopsis, Leonotis, Leonurus, Leucas, Microtoena, Phlomoides, Sideritis, Stachys, Thuspeinanta). Eriophyton and Stachyopsis have been included in Lamieae, Hypogomphia in Stachydeae, and Loxocalyx in Leonureae. Betonica, Colquhounia, Galeopsis, and Roylea remain unclassified at the tribal level. Lamium chinense and three East Asian Galeobdolon species are transferred to Matsumurella. Sulaimania and four Otostegia species are transferred to Moluccella . Alajja and three Lamium species are transferred to Eriophyton. In total, 14 new combinations are made, one at the rank of subgenus and 13 at the rank of species.
Article
Full-text available
Trichomes of 37 taxa of the genus Stachys and one species of Sideritis (S. montana) were examined using light and scanning electron microscopy. The indumentum shows considerable variability among different species, but is constant among different populations of one species, and therefore, affords valuable characters in delimitation of sections and species. The characters of taxonomic interest were presence of glandular and non-glandular trichomes, thickness of the cell walls, number of cells (unicellular or multi-cellular), presence of branched (dendroid) trichomes, presence of vermiform trichomes, orientation of trichomes in relation to the epidermal surface, curviness of trichomes, and presence of papillae on trichome surface. Two basic types of trichomes can be distinguished: glandular and non-glandular trichomes. The glandular trichomes can in turn be subdivided into subtypes: stalked, subsessile, or sessile. The stalks of the glandular trichomes can be uni-or multi-cellular. Simple unbranched and branched trichomes constitute two subtypes of non-glandular trichomes. Our data do not provide any support for separation of Sideritis from Stachys. The following evolutionary trends are suggested here for Stachys: vermiform trichomes with stellate base are primitive against vermiform trichomes with tuberculate base, long vermiform trichomes are primitive against the short simple trichomes, appressed trichomes are advanced against spreading ones, and loss of glandular trichomes is advanced against their presence. Overall, trichome micromorphology is more useful in separation of species within sections rather than characterizing large natural groups known as sections, except for few cases.
Article
Full-text available
Pollen grains of 30 taxa of the genus Stachys (29 spp. and one subsp.), representing 9 of the currently recognized sections and 1 species of the closely related genus Sideritis (Si. montana) distributed in Iran were examined by light and scanning electron microscopy. Twenty-eight taxa are studied for the first time under aspects of pollen morphology. The basic shape of the pollen grains in most taxa studied is prolate-spheroidal, but subprolate, spheroidal and oblate-spheroidal pollen grains can also be found in few species. The grains are usually tricolpate (the amb triangular), but also tetracolpate (the amb circular to more or less square) in some species (S. iberica, S. atherocalyx and Si. montana). The surface is microreticulate (the frequent type), reticulate, perforate, foveolate-psilate or foveolate. The lumina are separated by smooth or sinuate muri which make them polygonal, more or less rounded and elongate. Major pollen morphological features of the taxa studied are compared and discussed on the basis of taxonomical concepts. In some cases, these characters are useful in delimitation of formerly introduced sections while they mostly provide further characters in separating related species from each other. For example, all members of S. sect. Aucheriana are characterized by elongated lumina. Based on the oblate-spheroidal shape of its pollen as well as tetracolpate aperture type, the results of the present study confirm sect. Pontostachys as including S. angustifolia, S. iberica, S. sparsipilosa as well as S. atherocalyx. Our results also suggest that although some species like S. fruticolosa and S. lavandulifolia are morphologically well characterized, they cannot be separated from other species of Stachys based on pollen morphology.
Article
Although tribe Stachydeae (Lamiaceae) is considered monophyletic, relationships within the tribe are still poorly understood. The complexity of Stachydeae includes paraphyletic genera, considerable morphological plasticity, a range of ploidy levels, and presumably frequent natural hybridization. We performed parsimony and Bayesian phylogenetic analyses of nuclear (ribosomal ITS) and plastid (trnL intron, trnL– trnF spacer, rps16 intron) DNA sequence data from a taxonomically and geographically broad sampling of the tribe to identify major evolutionary lineages and to test taxonomic hypotheses within this largest of all lamioid tribes. We included 143 accessions corresponding to 121 species, representing both Old and New World species, and all 12 recognized genera of tribe Stachydeae. Both nuclear and plastid data corroborate monophyly of the tribe, with Melittis as sister to all remaining Stachydeae. For the latter well-supported clade, we suggest the phylogenetic name Eurystachys. Within Eurystachys, although monophyly is supported by both nuclear and plastid data for several named and unnamed groups, the majority of recognized taxa appear to be para-or polyphyletic. The taxon compositions of most subclades are congruent between the plastid and nuclear tree topologies, whereas their relative phylogenetic placements are often not. This level of plastid–nuclear incongruence suggests considerable impact of hybridization in the evolution of Stachydeae.
Article
Stachys (Lamiaceae: Lamioideae) is a species-rich, widespread, and taxonomically complex genus. A comparative anatomical study of the petioles and leaf lamina of 34 Stachys taxa representing 12 sections of the genus distributed in Iran was carried out to evaluate interspecific relationships and anatomical features that may be useful in species identification and subgeneric classification. The general leaf anatomy of Stachys species presented here corroborates earlier studies in Lamiaceae and on a few studied species in the genus. Leaf anatomy provides valuable characters that are useful in subgeneric classification as well as species discrimination in Stachys. The most important diagnostic characters are as follows: the shape of transverse section, length of ventral and dor-siventral axis, number of median bundles in the petiole, number of cell layers of palisade and spongy parenchyma, type and thickness of collenchyma as well as trichome type. Based on the present study and in accordance with previous works, some large sections such as Ambleia, Aucheriana, and Fragilicaulis appear to be natural and need minor or no changes in delimitation, while circum-scription of sect. Olisia should be revised. Isolated positions of some monotypic or oligotypic sections, such as Pontostachys, Thamnostachys, and Trinerves, as well as Zietenia, are supported by unique leaf anatomical features.