ArticlePDF Available

Lost and found: One of the world's most elusive amphibians, Pseudophilautus stellatus (Kelaart 1853) rediscovered

Authors:
  • Herpetological Foundation of SriLanka
  • Herpetological Foundation of Sri Lanka

Abstract

Pseudophilautus stellatus (Kelaart 1853) has been rediscovered from the Peak Wilderness, Central Hills of Sri Lanka. The species, till now known only from its lost holotype, was the first shrub frog described from Sri Lanka, and had not been reported since then. It was thought to have become extinct for nearly 157 years, being the amphibian species "lost" for the longest amount of time. Here we designate a neotype from the material collected at what we consider its type locality, having considered characters of the lost holotype and provide a complete description. We have conducted a molecular phy- logenetic analysis, on which basis the species is well differentiated from all other Pseudophilautus sequenced so far, and placed in a clade together with P. femoralis, P. frankenbergi, P. mooreorum, and P. poppiae.
112 Accepted by M. Vences: 31 Dec. 2012; published: 5 Mar. 2013
ZOOTAXA
ISSN 1175-5326 (print edition)
ISSN 1175-5334 (online edition)
Copyright © 2013 Magnolia Press
Zootaxa 3620 (1): 112128
www.mapress.com
/
zootaxa
/
Article
http://dx.doi.org/10.11646/zootaxa.3620.1.5
http://zoobank.org/urn:lsid:zoobank.org:pub:C00DAF00-76D9-4555-BDDE-843877E66C4A
Lost and found: One of the world's most elusive amphibians, Pseudophilautus
stellatus (Kelaart 1853) rediscovered
L. J. MENDIS WICKRAMASINGHE1,3, DULAN RANGA VIDANAPATHIRANA1,
SAMEERA AIRYARATHNE1, GEHAN RAJEEV1, AMILA CHANAKA1, JENNIFER PASTORINI2,
GAYAN CHATHURANGA1 & NETHU WICKRAMASINGHE1
1Herpetological Foundation of Sri Lanka, 31/5, Alwis Town, Hendala, Wattala, Sri Lanka
2Centre for Conservation and Research, 35 Gunasekara Gardens, Nawala Road, Rajagiriya, Sri Lanka
3Corresponding author. E-mail:boiga2000@gmail.com
Abstract
Pseudophilautus stellatus (Kelaart 1853) has been rediscovered from the Peak Wilderness, Central Hills of Sri Lanka. The
species, till now known only from its lost holotype, was the first shrub frog described from Sri Lanka, and had not been
reported since then. It was thought to have become extinct for nearly 157 years, being the amphibian species "lost" for the
longest amount of time. Here we designate a neotype from the material collected at what we consider its type locality,
having considered characters of the lost holotype and provide a complete description. We have conducted a molecular phy-
logenetic analysis, on which basis the species is well differentiated from all other Pseudophilautus sequenced so far, and
placed in a clade together with P. femoralis, P. frankenbergi, P. mooreorum, and P. poppiae.
Key words: extinct amphibian, Peak Wilderness, Pseudophilautus, Pseudophilautus stellatus, rediscovery, Sri Lanka
Introduction
A global amphibian hotspot, the island of Sri Lanka (Meegaskumbura, et al. 2002) claims to have the highest
number of extinct amphibians, which numbers 20 species (Manamendra-Arachchi & Pethiyagoda 1998, 2005;
Manamendra-Arachchi et al. 2004; Pethiyagoda 2005; IUCN & MENR 2007; Meegaskumbura et al. 2007; Stuart
et al. 2008), after the recent rediscovery of Adenomas kandianus Günther (1872) (Wickramasinghe et al. 2012a), of
which 19 alone belong to the genus Pseudophilautus (Manamendra-Arachchi & Pethiyagoda 2005;
Meegaskumbura et al. 2007). A total of 34 species have so far been declared as extinct globally (Stuart et al. 2008).
The sudden steep rise in the number of amphibian species known from Sri Lanka, within a very short period of
time, is due to the increased amount of surveys being carried out on the island (Manamendra-Arachchi &
Pethiyagoda 2005; Meegaskumbura & Manamendra-Arachchi 2005).
Frogs of the family Rhacophoridae, consisting of 73 species belonging to three genera, Polypedates, Taruga,
and Pseudophilautus, form a large portion of Sri Lanka’s amphibian fauna (Wickramasinghe et. al. 2012b). Species
now included in the genus Pseudophilautus, were previously considered to belong to a Pan-Asian genus Philautus
but were found to constitute a separate clade based on molecular phylogenetic studies (Bossuyt & Dubois 2001;
Bossuyt et. al. 2004; Frost et. al. 2006; Yu et. al. 2009). Other studies also showed further species from Sri Lanka
and India to be separate clades, and these were therefore assigned to separate genera (Li et. al. 2009; Biju et al.
2010; Yu et al. 2010; Meegaskumbura & Manamendra-Arachchi 2011).
Pseudophilautus stellatus was the first shrub frog described from the island of Sri Lanka (Kelaart 1853). After
not having been recorded for nearly 160 years, P. stellatus, known only from its now lost holotype (Bossuyt &
Dubois 2001; Manamendra-Arachchi & Pethiyagoda 2005), was reported to have become extinct, despite
extensive field studies carried out over the past decade (Manamendra-Arachchi & Pethiyagoda 2005). The species
was first described by Kelaart in 1853, based on a single specimen and with a very vague description which
however mentioned several diagnostic features not observed in other Sri Lankan frogs. No living P. stellatus was
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
Zootaxa 3620 (1) © 2013 Magnolia Press · 113
SRI LANKAN EXTINCT AMPHIBIAN REDISCOVERED
documented by scientists from the country since then. This beautiful frog as mentioned by Kelaart, was found from
‘Newera-Ellia’ (Nuwara Eliya, Central Province).
In the original description, this species was placed by Kelaart under the genus Polypedates as Polypedates
stellata. Although Polypedates stellata was later considered to be a possible synonym of Philautus variablis
(Kirtisinghe 1957), its name was ignored by many authors in later publications, considering its unusually large size
and body colour. It was reassigned to Philautus and its specific name corrected to stellatus by Bossuyt & Dubois
(2001). These authors also mentioned that Kelaart may have placed this species under the genus Polypedates
considering the large sized disks of the species, and concluded by suggesting that a neotype for this species should
be designated from its type locality. Finally, after an extensive survey of amphibians on the island from 1994-2003,
its status was confirmed to be extinct (Manamendra-Arachchi & Pethiyagoda 2005), since not a single specimen
was recorded by them from approximately 350 locations (Manamendra-Arachchi & Pethiyagoda 2005).
Pethiyagoda and Manamendra-Arachchi further state that they were not able to record any specimen of the said
size range of 57 mm from Nuwara Eliya, and given that just 4.7 percent of former rainforests remain and a massive
extirpation of restricted-range species would likely have occurred, therefore concluding that the species although
extinct is a valid species. We here report on the rediscovery of Pseudophilautus stellatus during a survey of the
Peak Wilderness Sanctuary in the Central Province, Sri Lanka.
Materials and methods
Study area. Peak Wilderness (Figure 1) was designated a sanctuary on 25th October 1940 (Gazette Notification No.
8,675), having an area of about 55,300 acres (22,379 ha). According to the current management plan, the
geographical area of the sanctuary is about 24,000 ha, of which 21,175 ha comprises natural or semi-natural
vegetation; the rest is no longer forest and includes tea estate and village settlements (de Alwis et al. 2007). The
sanctuary lies in the centre of the western ridge of the Central Highlands, north-east of Ratnapura and straddling the
border of Central and Sabaragamuwa provinces. Its eastern boundary is contiguous with Horton Plains National
Park. Peak Wilderness occupies the escarpment that rises steeply from the lowlands to the south and west. Much of
the terrain is very rugged, with altitudes ranging from 50 m near Ratnapura to 2,238 m at Adam’s Peak (6° 48'
26.93" N, 80° 30' 03.06" E), Sri Lanka’s fourth highest peak (de Alwis et al. 2007).
A systematic survey was carried out over a two-year period, in order to document the amphibian diversity
across an elevation gradient (550 m to 2240 m), in the Sripada massif, Peak Wilderness (part of the Central Hills
World Heritage Site) of the Central province, of Sri Lanka. Surveys focused on terrain where not much light has
been shed by scientists, due to difficulty in accessing these sites owing to harsh weather conditions and tough trails.
Three frogs were collected and were stored in 70% ethanol, and tissue samples for molecular work were taken from
these specimens. Sex and maturity were determined by examining secondary sexual characters, or when absent, by
examining the gonads through a small lateral incision in the specimen.
The new material discussed in this paper is deposited in the National Museum Sri Lanka (NMSL) and at the
Giritale National Wildlife Research and Training Center, Department of Wildlife Conservation (DWC).
A Mitutoyo digital vernier caliper was used to take 39 external measurements of each specimen to the nearest
0.1 mm. Nomenclature of external anatomy abbreviated in the text and external measurements taken are listed
alphabetically herein: breadth of disk of the third finger (DB), taken from anterior to posterior edge of circum-
marginal groove; distance between back of eyes (DBE), measured between posterior edge of eyes; distance
between front of eyes (DFE), measured between anterior edges of eyes; length of disk of the third finger (DL),
taken from anterior edge of circum-marginal groove to posterior edge of disk; width of disk of the third finger
(DW), measured across the inner and outer edges of circum-marginal groove; eye diameter (ED), horizontal
diameter of eye; eye to nostril distance (EN), measured between anterior most point of eye and middle of nostril;
eye to snout distance (ES), measured between anterior most point of eye and tip of snout; thigh (femur) length
(FEL), distance between vent and knee with both thigh and shank flexed; first finger length (FL-1), measured
between posterior margin of the most proximal subarticular tubercle or crease of articulation and the tip of first
finger; second finger length (FL-2), measured between posterior margin of the most proximal subarticular tubercle
or crease of articulation and the tip of second finger; third finger length (FL-3), measured between posterior margin
of the most proximal subarticular tubercle or crease of articulation and the tip of third finger; fourth finger length
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
WICKRAMASINGHE ET AL.
114 · Zootaxa 3620 (1) © 2013 Magnolia Press
FIGURE 1. Current distribution map of Pseudophilautus stellatus (blue circle denotes the location of neotype).
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
Zootaxa 3620 (1) © 2013 Magnolia Press · 115
SRI LANKAN EXTINCT AMPHIBIAN REDISCOVERED
(FL-4), measured between posterior margin of the most proximal subarticular tubercle or crease of articulation and
the tip of fourth finger; foot length (FOL), distance between heel and tip of fourth toe with both foot and shank
flexed; groin to knee distance (GK), measured between groin and the tip of knee; head depth (HD), distance
between the apex of eye and the bottom of jaw; head length (HL), distance between angle of jaws and snout tip;
head width (HW), measured across angle of jaws; inner metatarsal tubercle length (IML), distance between the
anterior and posterior edges of the inner metatarsal tubercle; internarial distance (IN), least distance between the
inner margin of nares; interorbital width (IO), least distance between the upper margins of orbits; knee-angle length
(KT), distance from knee-angle to tibio-tarsal articulation; lower arm length (LAL), taken from elbow to posterior-
most margin of inner palmar tubercle; mandible-back of eye distance (MBE), distance between angle of jaws and
posterior-most point of eye; mandible-front of eye distance (MFE), taken as distance between angle of jaws and
anterior-most point of eye; mandible-nostril distance (MN), taken as distance between angle of jaws and middle of
nostril; hand length (HNL), taken from posterior-most margin of inner palmar tubercle to tip of disk of third finger;
snout-nostril distance (SN), taken as distances between middle of nostril and tip of snout; snout-vent length (SVL),
measured from tip of snout to vent; tarsal length (TAS), measured between the tibio-tarsal articulation and anterior
edge of inner metatarsal tubercle; tibia length (TBL), distance between knee and heel with both shank and foot
flexed; first toe length (TL-1), measured between posterior margin of the most proximal subarticular tubercle or
crease of articulation and the tip of first toe; second toe length (TL-2), measured between posterior margin of the
most proximal subarticular tubercle or crease of articulation and the tip of second toe; third toe length (TL-3),
measured between posterior margin of the most proximal subarticular tubercle or crease of articulation and the tip
of third toe; fourth toe length (TL-4), measured between posterior margin of the most proximal subarticular
tubercle or crease of articulation and the tip of fourth toe; fifth toe length (TL-5), measured between posterior
margin of the most proximal subarticular tubercle or crease of articulation and the tip of fifth toe; upper arm length
(UAW), distance between axilla and elbow; upper eyelid width (UEW), measured from bony edge of supraorbital
to outer edge of upper eyelid; vent to knee-angle length (VKL), distance measured from knee-angle to vent.
Geographical coordinates were determined from GPS readings (Garmin eTrex Gista) at the locality.
Molecular Methods. Whole cellular DNA was extracted from ethanol preserved muscle tissue of specimen
number DWC 2013.01.15 using QIAGEN DNeasy DNA extraction kit following the manufacturer’s guidelines.
Polymerase Chain Reaction (PCR) amplifications were carried out in 25 µl reactions targeting 12S and 16S
ribosomal regions using the primers 12S F- AAACTGGGATTAGATACCCCACTAT; 12S R-
CTTGGCTCGTAGTTCCCTGGCG (Goebel et al. 1999) and 16S F- CGCCTGTTTATCAAAAACAT, 16S R-
CCGGTCTGAACTCAGATCACGT (Palumbi et al. 1991) with Promega GoTaq DNA polymerase enzyme in an
BioRad 9600 thermal cycler. The standard PCR program consisted of an initial denaturing step of 3 minutes at
94˚C, 35-40 cycles of 1 minute at 94˚C, 1 minute at 45- 62˚C, and 1- 1.5 minutes at 72˚C , followed by a final
extension step of 6 minutes at 72˚C . PCR amplified products were cleaned using QIAGEN PCR product
purification kit according to the manufacturer’s guidelines. Cycle sequencing using BigDye Terminator v. 3.0
(Applied BioSystems) were ran in 8 µl reactions, followed by isopropanol – ethanol precipitation and bidirectional
sequencing on an ABI 310 automated DNA sequencer (Applied Bio Systems).
Additional sequences were obtained from GenBank (Appendix 1). Sequences were aligned by eye and using
CLUSTALX option of the software MEGA version 4 (Tamura et al. 2007). The aligned sequences were analyzed
using neighbor-joining and maximum parsimony methods with the computer program PAUP* 4.0b10 (Swofford
2002). Gaps were treated as missing data. For neighbor-joining analyses distance measures were employed using
corrections for nucleotide sequence data suggested by Kimura (1980). For parsimony and neighbor-joining
methods, bootstrap (BP) and jackknife (JK) analyses (Felsenstein 1985) of 2500 replicates were performed to
examine the relative support of each relationship in the resultant topologies.
Results
Pseudophilautus stellatus
Polypedates stellata Kelaart, 1853
Philautus variabilis (Günther 1859; Kirtisinghe 1957)
Philautus stellatus (Bossuyt & Dubois 2001; Manamendra-Arachchi & Pethiyagoda 2005, 2006)
Pseudophilautus stellatus (Yu et al. 2010)
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
WICKRAMASINGHE ET AL.
116 · Zootaxa 3620 (1) © 2013 Magnolia Press
Neotype. NMSL 2013.09.01 NH Adult male 55.3 mm SVL (Figure 2 & 3). Sripada World Heritage Site, (Peak
Wilderness), Ratnapura District, Sabaragamuwa Province, Sri Lanka (06° 48' 30.89" N 080° 29' 19.18" E). Alt.
1679 m (Figure 1). Collected by L. J. Mendis Wickramasinghe, Dulan Ranga Vidanapathirana & Sameera
Ariyarathne on November 22, 2009.
Others. DWC 2013.01.14, adult female, 48.9 mm SVL; DWC 3013.01.15, adult male, 39.6 mm SVL. Date,
locality and collectors same as neotype.
Diagnosis. Pseudophilautus stellatus is assigned to the genus Pseudophilautus as it was well nested within this
taxon in our molecular phylogenetic tree (Figure 4). Pseudophilautus stellatus can be distinguished from known
congeners by the following combination of characters: Body large size (SVL 55.3); snout rounded in lateral, dorsal
and ventral aspects; lingual papilla absent; vomerine teeth present; 3rd and 4th fingers with bifid distal subarticular
tubercles; tympanum indistinct; supratympanic fold absent.
FIGURE 2. Dorsolateral view of neotype.
Description of neotype. Body large size (SVL 55.3 mm); head large (HL/SVL 0.4), about as wide as long
(HW/HL 1.1), concave above; snout rounded in lateral, dorsal and ventral aspects (ES/DFE 0.8, SN/IN 0.7), its
length longer than horizontal diameter of eye (ES/ED 1.5); internasal space concave; canthus rostralis rounded,
loreal region concave; interorbital space concave, upper eyelid smaller than interorbital distance (IO/UEW 1.7);
internasal distance equal to upper eyelid width (IN/UEW 1.1); distance between front of eyes 2/3 the distance
between back of eyes (DBE/DFE 1.5); nostrils vertically elliptical without flap of skin laterally, closer to tip of
snout; pupil horizontally elliptical; tympanum indistinct; pineal ocellus and vomerine teeth present, small (Left=4,
Right=6), odontophores oblique and widely separated, between choanae with an angle of 500 relative to body axis;
tongue large, lanceolate, lingual papilla absent, and conical tubercles absent on tongue.
Arm short, robust and strong (LAL/FEL 0.5, UAL/FEL 0.4); forearm shorter than hand length (LAL/HNL
0.7), longer than upper arm (LAL/UAL 1.3); fore arm distinctly enlarged; fingers robust and strong, relative length
of fingers I < II < IV < III (FL-1/FL-3 0.5, FL-2/FL-3 0.6, FL-4/FL-3 0.9) (Table 1); tips of finger disks semi
circular, enlarged, discs present on all fingers, with distinct basal and circum marginal grooves; dermal fringe
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
Zootaxa 3620 (1) © 2013 Magnolia Press · 117
SRI LANKAN EXTINCT AMPHIBIAN REDISCOVERED
present on inside of all fingers, prominent dermal fringe present on exterior edge of finger IV and hand, and ulnar
fold; rudimentary webbing present on all fingers, webbing formula I22II2+3+III22IV; distal subarticular
tubercles prominent, fingers I and II with rounded distal subarticular tubercles, but III and IV fingers with bifid
distal subarticular tubercles, comparatively larger distal subarticular tubercle on finger IV; inner palmar tubercle,
large, single, oval, prominent, larger than the distal subarticular tubercles; outer palmar tubercle present, but
indistinct; supernumerary tubercles present, but indistinct and widespread on palm and on all fingers; prepollex
absent (Figure 5A).
Femur 2 1/4 times longer than fourth toe length (FEL/TL-4 2.2); foot length longer than thigh (FOL/FEL 1.4);
toes strong, relative length of toes I < II < III <V <IV (TL-1/TL-4 0.4, TL-2/TL-4 0.5, TL-3/TL-4 0.8 (0.78), TL-5/
TL-4 0.8 (0.83), tips of toes rounded, enlarged, discs present on all toes with distinct basal and circum marginal
grooves; webbing formula I2+2-II1+2-III12IV1-1+V; lateral dermal fringe on inside of all toes and prominent
undulating fringe on postaxial edge of toe V, metatarsal fold, and tarsal fold present but indistinct; tarsal fringe
present; distal subarticular tubercles prominent, rounded and single, all equal in size; penultimate subarticular
tubercles present on toes III, IV and V; supernumerary tubercles present, but indistinct, wide spread and
concentrated on foot and all toes; inner metatarsal tubercle oval prominent and large, its length 1/2 the length of toe
I (IML/TL-1 0.5); outer metatarsal tubercle absent (Figure 5B).
FIGURE 3. Front view of neotype.
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
WICKRAMASINGHE ET AL.
118 · Zootaxa 3620 (1) © 2013 Magnolia Press
FIGURE 4. Neighbor-joining tree based on sequences of part of the mitochondrial 12S and 16S ribosomal genes with
bootstrap values obtained from neighbor-joining (higher nodes) and maximum parsimony analysis (lower nodes).
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
Zootaxa 3620 (1) © 2013 Magnolia Press · 119
SRI LANKAN EXTINCT AMPHIBIAN REDISCOVERED
TABLE 1. Morphometric measurements of neotype and other specimens of Pseudophilautus stellatus.
Characters Neotype male Female Male Mean SD Range
NMSL 2013.09.01 NH DWC 2013.01.14 DWC 2013.01.15
SVL 55.3 48.9 39.6 48.0 7.9 39.6—55.3
DB 2.2 1.6 1.4 1.7 0.4 1.4—2.2
DBE 18.9 18.3 14.7 17.3 2.3 14.7—18.9
DFE 12.0 11.6 8.9 10.8 1.7 8.9—12.0
DL 2.7 2.2 1.9 2.3 0.4 1.9—2.7
DW 3.9 3.4 3.0 3.4 0.4 3.0—3.9
ED 6.1 5.9 4.8 5.6 0.7 4.8—6.1
EN 5.5 5.4 4.1 5.0 0.8 4.1—5.5
ES 9.0 8.8 6.7 8.2 1.3 6.7—9.0
FEL 27.6 27.8 21.0 25.5 3.9 21.0—27.8
FL-1 5.2 4.9 3.6 4.6 0.9 3.6—5.2
FL-2 6.2 6.1 4.2 5.5 1.1 4.2—6.2
FL-3 10.4 9.5 8.4 9.4 1.0 8.4—10.4
FL-4 9.3 8.8 7.2 8.4 1.1 7.2—9.3
FOL 38.1 38.4 29.9 35.4 4.8 29.9—38.4
GK 23.5 23.0 15.9 20.8 4.2 15.9—23.5
HD 10.2 9.8 7.4 9.2 1.5 7.4—10.2
HL 22.0 21.4 15.9 19.8 3.3 15.9—22.0
HW 24.0 23.3 13.4 20.2 6.0 13.4—24.0
IML 2.5 2.3 1.3 2.0 0.6 1.3—2.5
IN 5.1 4.3 3.9 4.4 0.6 3.9—5.1
IO 7.6 6.9 5.6 6.7 1.1 5.6—7.6
KT 23.0 24.2 18.5 21.9 3.0 18.5—24.2
LAL 12.3 12.0 9.8 11.4 1.4 9.8—12.3
MBE 9.6 8.1 6.9 8.2 1.4 6.9—9.6
MFE 15.9 14.6 11.2 13.9 2.4 11.2—15.9
MN 19.9 18.8 14.0 17.6 3.1 14.0—19.9
HNL 16.7 15.6 12.1 14.8 2.4 12.1—16.7
SN 3.5 3.2 2.9 3.2 0.3 2.9—3.5
TAS 16.9 16.0 12.3 15.1 2.5 12.3—16.9
TBL 27.2 27.4 21.1 25.2 3.6 21.1—27.4
TL-1 5.0 4.8 3.5 4.4 0.8 3.5—5.0
TL-2 5.9 6.0 4.7 5.5 0.7 4.7—6.0
TL-3 9.6 9.5 7.2 8.8 1.3 7.2—9.6
TL-4 12.4 12.9 11.7 12.3 0.6 11.7—12.9
TL-5 10.3 9.6 8.4 9.4 1.0 8.4—10.3
UAL 9.7 8.4 6.6 8.3 1.6 6.6—9.7
UEW 4.5 4.6 3.5 4.2 0.6 3.5—4.6
VKL 22.6 23.3 18.5 21.4 2.6 18.5—23.3
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
WICKRAMASINGHE ET AL.
120 · Zootaxa 3620 (1) © 2013 Magnolia Press
Skin on dorsal and lateral snout, head and entire dorsum weakly shagreened; upper flank shagreened to weakly
areolate; lower flank weakly areolate to granular; supratympanic fold absent; upper arm, forearm, and hand weakly
shagreened; inner thigh dorsally and outer thigh weakly shagreened; leg, tarsus and foot weakly shagreened; a
single prominent large blunt tubercle on heel.
Skin on ventral side of body: Throat and chest weakly granular; belly granular (Figure 6A); upper arm weakly
granular, forearm granular; thigh granular, leg smooth, tarsus weakly granular.
Colour in life. Body colour is bright green with intermittent pinkish white spots; dorsal part of head and
dorsum prominent pinkish white spots outlined in dark brown on bright green, intermittent with smaller blurred
dark brown blotches (Figure 2–3 & 6B); flank with transverse dark brown bands on white (Figure 6C); loreal and
tympanic regions and tympanum small brown blotching on bright green; forelimb prominent pinkish white spots
outlined in dark brown on bright green, as in dorsum, absent on upper arm; hind limb prominent pinkish white
spots outlined in dark brown on bright green (Figure 6D), posterior part of femur barred brown; throat, vocal sacs,
chest and belly all pinkish white.
Colour in alcohol. Colour of spots and strips faded a little from above, but the white spots remain, and the
overall green colour changes to a purplish brown.
The following combination of characters does not match any known Pseudophilautus species described from
the island to date. A fully grown female has the described size of 57 mm (=2 ¼’), but an adult male is
comparatively smaller with an SVL of 51 mm (= 2’), very broad fingers, large discs, body colours and patterns.
FIGURE 5. (A–B). Ventral side of Pseudophilautus stellatus neotype: A. left hand with large discs of a pinkish white
colouration; B. left foot with large discs.
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
Zootaxa 3620 (1) © 2013 Magnolia Press · 121
SRI LANKAN EXTINCT AMPHIBIAN REDISCOVERED
Molecular analysis. The aligned nucleotide sequences span a total of 938 base positions (bp). The analysed
dataset consists of parts of the 12S (380 bp) and 16S (558 bp) ribosomal RNA genes. Pseudophilautus stellatus
could not be sequenced for the last 32 bp of the aligned 12S fragment. The new mtDNA sequences generated for P.
stellatus have been deposited in GenBank (Accession Nos. JN862535 for 12S and JN862536 for 16S). The aligned
sequences yielded 490 constant and 379 parsimony-informative characters. The alignment included a total of 69
indels (37 for 12S and 32 for 16S). However, gaps were treated as missing data in MP and NJ analyses.
FIGURE 6. (A–D). Pseudophilautus stellatus, neotype: A. ventral side, belly area; B. dorsal skin colouration, showing bright
green with irregular white spots; C. flank, showing transverse darker bands; D. limbs, barred brown and spotted white.
The maximum parsimony (MP) heuristic search with all characters weighted equally resulted in six trees, 1784
steps in length with consistency indices of 0.373 and retention indices of 0.660. The distance matrices constructed
using Kimura 2-parameter corrections, and subsequently analysed by neighbor-joining methods, reconstructed the
tree shown in.
In maximum parsimony and neighbor-joining (NJ) analyses, phylogenetic relationships among clades and their
bootstrap (BP) supports are very similar. Arrangements among the 3 clades are strongly supported by BP analyses
(100%) using either MP or NJ searches. Clades containing individuals of one species have 93-100% BP support
(Figure 4).
In MP and NJ analyses, P. stellatus groups within the genus Pseudophilautus. The three species P. fe mora lis, P.
poppiae and P. m ooreoru m form a subclade with strong BP support (99% NJ/98% MP). Another well-supported
(98%/94%) subclade includes P. frankenbergi and an unknown species. P. stellatus is falling between those two
subclades (Figure 4). The sister-group relationship of P. stellatus with the femoralis-poppiae-mooreorum subclade
is only weakly supported with BP values of 50 and 55%. However, the grouping of all 6 Pseudophilautus species
gets 91% BP support in NJ and 68% in MP analyses. Regardless of the branching order, P. stellatus is clearly
different from the other five Pseudophilautus species in this clade, as the long branch in the phylogram nicely
illustrates (Figure 4).
Natural history. Typical habitat: These, unusually striking, nocturnal and slow moving amphibians were
observed in an area of about 2 km2 in the Peak Wilderness of the Central Highlands of Sri Lanka (Figure 1). They
were commonly found in the canopy of the cloud forest, 1-10 m above the forest floor, perched on large sized
leaves well camouflaged. The species was observed on misty/foggy days, and were found to be highly seasonal,
and very rare. On subsequent visits, 78 individuals were observed within an area which extends to the Ratnapura
District at elevations of 1540 m asl by the team within a period of four months, with no overlapping transects.
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
WICKRAMASINGHE ET AL.
122 · Zootaxa 3620 (1) © 2013 Magnolia Press
Threats. Amongst the most important threats noted in this region, is the forest dieback phenomena (Figure
7A&B), possibly due to pollution and/or climate change, which has never been documented in this region before.
With decrease in the canopy cover, alien invasive species, such as Clusia rosea, and Pteribium revolutum, are
widely distributed in lower areas and is slowly spreading to higher elevations, which can potentially become a
threat in the future. The Peak Wilderness is now under severe anthropogenic pressure, because of its religious
importance, and is visited every year by a large number of pilgrims who pollute the environment there, especially
the streams. As a result, a large amount of garbage gets collected, and the natural forest gets overexploited. Illegal
gem mining on either sides of the riverbank within the forest has become another potential threat to the amphibian
diversity. Tea plantations in the surrounding areas are slowly expanding and illegal tree felling to cultivate tea, has
become a major threat in the area.
FIGURE 7. Forest die back in the Peak Wilderness area, habitat of Pseudophilautus stellatus.
Discussion
Molecular analysis. The phylogenetic position of the species was a matter of debate, purely hypothetical till date
because of the lack of any material. In the phylogenetic analyses, P. stellatus is nested within the genus
Pseudophilautus and falls between two well supported subclades, one consisting of P. f emor alis, P. poppiae and P.
mooreorum and the other including P. frankenbergi and an unknown species. P. stellatus is clearly different from
other Pseudophilautus species. The phylogenetic arrangement of the genus Philautus sister to a clade formed by
Pseudophilautus and Raorchestes is corresponding with earlier phylogenetic studies (Meegaskumbura &
Manamendra-Arachchi 2005, 2011; Meegaskumbura et al. 2009, 2012).
The description given by Kelaart (Appendix 2) although vague contains some vital diagnostic characters
important in identifying the species. P. stellatus was confirmed by the large oval body, the dorsum colour,
importantly the change in colouration of the specimens to a purplish brown on preservation, and by the seeming
type locality in the Peak Wilderness of the Nuwara Eliya district, precisely the same as mentioned by Kelaart.
Prior to its current rediscovery, P. stellatus has said to have been witnessed only by two others (Barbara Layard
and E. F. Kelaart), and is the only known extinct amphibian of the world without any type material, photographs or
drawings, for the longest period of time thus making it among the world’s most elusive amphibians. Due to the
vague original description and the loss of the original type material we cannot fully exclude the possibility that the
specimens on which we here report might represent a new, undescribed species rather than Pseudophilautus
stellatus. However, the encountered specimens agree with Kelaart’s description of P. stellatus most closely, and it is
therefore the taxonomically most parsimonious solution to consider this amphibian as P. stellatus as recommended
by Bossuyt & Dubois (2001), thus confirming its rediscovery.
Acknowledgments
The authors wish to acknowledge the Biodiversity Secretariat of the Ministry of Environment for funding and
collaborating the project, Mr. R. H. S. S. Samarathunga (Secretary-Ministry of Environment), Mr. Gamini Gamage
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
Zootaxa 3620 (1) © 2013 Magnolia Press · 123
SRI LANKAN EXTINCT AMPHIBIAN REDISCOVERED
(Additional Secretary-Policy Planning), Mr. K. A. I. De Silva (former Director Biodiversity), Mr. N. K. G. K.
Nannawaththa (Additional Secretary-Natural Resources), Mr. R. A. R. Roopasinghe (Additional Secretary-
Administrations), Mrs. Dakshini Perera, and Mrs. Hasula Wickramasinghe for all the support rendered. To the
Department of Wildlife Conservation for permission granted (Permit no. WL/3/3/354), the Director General Mr. R.
M. Rathnayake, and the Deputy Director Mr. S. R. B. Dissanayake (Research and Training) for all the support.
Staff of the Nallathanniya and Palabaddala Wildlife beets. Mr. Saman Gamage, Mr. Chaminda Pushpakumara, Mr.
Dilshan Maduranga de Silva, Mr. E. A. Thusitha Jayanath, Mr. Lankaputhra Wimaladharma, Mr. L. P. D. Wasantha
Kumara, Mr. Kovida Herath, Mr. Jagath Krishantha, Mr. Ruwan Chinthaka are thanked for their immense help in
the field, and late Dr. Amith Munindradasa fondly remembered for his support and encouragements. The authors
wish to acknowledge the contributions of Mr. Chamara Hettiarachchi, in preparing the location illustrations, to Mr.
Mahesh Chathuranga Silva, Mr. Charith Pubudu Lakmal and Mr. Lalith Senanayake for preparing images. The
authors wish to thank the Director National Museums of Sri Lanka, Dr. Nanda Wickramasinghe and staff members
(Assistant Director Mrs. Manori Nandasena and Mrs. Manaram de Silva), are gratefully acknowledged for their
assistance in museum reference work. Mr. Uditha Hettige, Mr. Sameera Suranjan Karunarathna, Mr. Sanjiv De
Silva provided valuable literature relevant for this work. We wish to thank Dr. Ruwan Illeperuma (Genetech
Molecular Diagnostics) for the assistance in the molecular work, Mr. Bhathiya Kekulandala and Mr. Jagath
Gunawardana for their valuable comments and the Nagao Natural Environment Foundation, for partly funding this
work. The authors also like to thank their colleagues at Herpetological Foundation of Sri Lanka (HFS), for various
courtesies. Finally to Dr. Simon Stuart, James Lewis and Dr. Robin Moore whose invaluable comments
undoubtedly improved the quality of the paper.
References
Biju, S.D., Shouche, Y., Dubois, A., Dutta, S.K. & Bossuyt, F. (2010) A ground-dwelling rhacophorid frog from the highest
mountain peak of the Western Ghats of India. Current Science, 98, 1119–1125.
Bossuyt, F. & Dubois, A. (2001) A review of the frog genus Philautus Gistel, 1848 (Amphibia, Anura, Ranidae,
Rhacophorinae). Zeylanica, 6(1), 1–112.
Bossuyt, F., Meegaskumbura, M., Beenaerts, N., Gower, D.J., Pethiyagoda, R., Roelants, K., Mannaert, A., Wilkinson, M.,
Bahir, M.M., Manamendra-Arachchi, K., Ng, P.K.L., Schneider, C.J., Oommen, O.V. & Milinkovitch, M.C. (2004) Local
endemism within the Western Ghats–Sri Lanka Biodiversity Hotspot. Science, 306, 479–481. http://dx.doi.org/10.1126/
science.1100167
de Alwis, S.M.D.A.U., Dayawansa, P.N., How, R., Singhakumara, B.M.P., Weerakoon, D. & Wijesinghe, M.R. (2007)
Biodiversity Baseline Survey: Peak Wilderness Sanctuary. In: Green, M.J.B. (ed.), Consultancy Services Report ARD Inc
in association with Infotech IDEAS and GREENTECH Consultants. Sri Lanka Protected Areas Management and Wildlife
Conservation Project (PAM&WCP/CONSULT/02/BDBS), (Prepared for: Department of Wildlife Conservation, Ministry
of Environment and Natural Resources, Colombo), 44 pp.
Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the bootstrap, Evolution 39, 783–791.
http://dx.doi.org/10.2307/2408678
Frost, D.R., Grant, T., Faivovich, J.N., Bain, R.H., Haas, A., Haddad, C.L.F.B., De Sa, R.O., Channing, A., Wilkinson, M.,
Donnellan, S.C., Raxworthy, C.J., Campbell, J.A., Blotto, B.L., Moler, P., Drewes, R.C., Nussbaum, R.A., Lynch, J.D.,
Green, D.M. & Wheeler, W.C. (2006) The Amphibian Tree of Life. Bulletin of the American Museum of Natural History,
297, 1–370. http://dx.doi.org/10.1206/0003-0090(2006)297[0001:TATOL]2.0.CO;2
Goebel, A.M., Donnelly, J.M. & Atz, M.E. (1999) PCR primers and amplification methods for 12S ribosomal DNA, the control
region, cytochrome oxidase I, and cytochrome b in bufonids and other frogs, and an overview of PCRprimers which have
amplified DNA in amphibians successfully. Molecular Phylogenetics and Evolution, 11, 163–199.
http://dx.doi.org/10.1006/mpev.1998.0538
Günther, A. (1859) Catalogue of the Batrachia Salientia in the collection of the British Museum. Taylor & Francis, London,
160 pp.
Günther, A. (1872) Descriptions of some Ceylonese reptiles and batrachians. Annals and Magazine of Natural History, Series 4
(9), 85–88.
IUCN Sri Lanka & Ministry of Environment and Natural Resources Sri Lanka. (2007) The 2007 National Red List of
Threatened Fauna and Flora of Sri Lanka. IUCN Sri Lanka and Ministry of Environment and Natural Resources Sri
Lanka, 148 pp. http://dx.doi.org/10.4038/jnsfsr.v36i1.140
Kelaart, E.F. (1853) Prodromus faunae zeylanicae; being contributions to the zoology of Ceylon. Published by the author,
Colombo, 197 pp.
Kimura, M. (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
WICKRAMASINGHE ET AL.
124 · Zootaxa 3620 (1) © 2013 Magnolia Press
nucleotide sequences. Journal of Molecular Evolution, 16,111–120. http://dx.doi.org/10.1007/bf01731581
Li, J., Che, J., Murphy, R.W., Zhao, H., Zhao, E., Rao, D. & Zhang, Y. (2009) New insights to the molecular phylogenetics and
generic assessment in the Rhacophoridae (Amphibia: Anura) based on five nuclear and three mitochondrial genes, with
comments on the evolution of reproduction. Molecular Phylogenetics and Evolution, 53, 509–522.
http://dx.doi.org/10.1016/j.ympev.2009.06.023
Manamendra-Arachchi, K. & Pethiyagoda, R. (1998) A synopsis of the Sri Lankan Bufonidae (Amphibia: Anura) with
description of new species. Journal of South Asian Natural History, 3, 213–248.
Manamendra-Arachchi, K. & de Silva, A. (2004) Adenomus kandianus. In: IUCN 2011. IUCN Red List of Threatened Species.
Version 2011.2. Available from www.iucnredlist.org (accessed 28 January 2012).
Manamendra-Arachchi, K., Pethiyagoda, R., Dutta, S. & de Silva, A. (2004) Pseudophilautus stellatus. In: IUCN 2012. IUCN
Red List of Threatened Species. Version 2012.1. Available from www.iucnredlist.org (accessed 02 October 2012).
Manamendra-Arachchi, K. & Pethiyagoda, R. (2005) The Sri Lankan shrub frogs of the genus Philautus Gistel, 1848 (Ranidae:
Rhacophorinae), with description of 27 new species. The Raffles Bulletin of Zoology, 12, 163–303.
Meegaskumbura, M. & Manamendra-Arachchi, K. (2011). Two new species of shrub frogs (Rhacophoridae: Philautus) from
Sri Lanka. Zootaxa, 2747, 1–18. http://dx.doi.org/10.4038/tapro.v1i2.2766
Meegaskumbura, M., Bossuyt, F., Pethiyagoda, R., Manamendra-Ararchchi, K., Bahir, M., Milinkovitch, M.C. & Schneider,
C.J. (2002) Sri Lanka: an amphibian hotspot. Science, 298, 379.
Meegaskumbura, M., Manamendra-Arachchi, K., Schneider, C.J. & Pethiyagoda, R. (2007) New species amongst Sri Lanka’s
extinct shrub frogs. Zootaxa, 1397, 1–15.
Pethiyagoda, R. (2005) Exploring Sri Lanka’s biodiversity. The Raffles Bulletin of Zoology, 12, 1–4.
Stuart, S.N., Hoffmann, M., Chanson, J.S., Cox, N.A., Berridge, R.J., Ramani, P. & Young, B.E. (2008) Threatened Amphibians
of the World. Lynx Editions, 776 pp.
Swofford, D.L. (2002) PAUP*.Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4, Sinauer Associates,
Sunderland, Massachusetts.
Tamura, K., Dudley, J., Nei, M. & Kumar, S. (2007) Molecular Phylogenetics and Evolution, 24, 1596.
http://dx.doi.org/10.1093/molbev/msm092
Wickramasinghe, L.J.M., Vidanapathirana, D.R. & Wickramasinghe, N. (2012a) Back from the dead: The world’s rarest toad
Adenomus kandianus rediscovered in Sri Lanka. Zootaxa, 3347, 63–68.
Wickramasinghe, L.J.M., Munindradasa, D.A.I. & Fernando, P. (2012b) A new species of Polypedates Tschudi (Amphibia,
Anura, Rhacophoridae) from Sri Lanka. Zootaxa, 3498, 63–80.
Yu, G., Rao, D., Zhang, M. & Yang, J. (2009) Re-examination of the phylogeny of Rhacophoridae (Anura) based on mitochondrial
and nuclear DNA.
Molecular Phylogenetics and Evolution
, 50, 571–579. http://dx.doi.org/10.1016/j.ympev.2008.11.023
Yu, G., Zhang, M. & Yang, J. (2010) Generic allocation of Indian and Sri Lankan Philautus (Anura: Rhacophoridae) inferred from
12S and 16S rRNA genes.
Biochemical Systematics and Ecology
, 38, 402–409. http://dx.doi.org/10.1016/j.bse.2010.03.011
Material examined
Pseudophilautus abundus (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 3006; Labugama Forest Reserve,
Labugama, alt. 78 m (06º51’ N, 080º10’ E); Paratypes: WHT 2302; 2303; 3457; 3459; 3494; 3496, Dediyagala Forest
Reserve, Akuressa, alt. 150 m (06º10’ N, 080º26’ E); WHT 1711; 3455; 3456; 3495, Kanneliya (Galle), alt. 150 m (06º15’
N, 080º20’ E).
Pseudophilautus alto (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 2721; Paratypes: WHT 2723; 2718;
2719; 2720; 2722; 2724; Horton Plains National Park, alt. 2135 m (06º46’ N, 080º47’ E).
Pseudophilautus asankai (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 3507; Paratypes: WHT 3504; 3505;
3506; 5425, Agra Arboretum, Torrington Estate, near Agarapatana, alt. 1665 m (06º50’36” N, 80º40’40” E); WHT 2100,
Moray Estate, Rajamally, alt. 1370 m (06º48’ N, 80º31’ E); WHT 5472, Dayagama Estate, 3rd division, Dayagama, alt.
1830 m (06º50’ N, 80º40’ E).
Pseudophilautus auratus (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 2356; Paratypes: WHT 2357; 2375;
2433; 2782, Morningside Forest Reserve (near Rakwana), alt. 1060 m (06º24’ N, 080º38’ E); WHT 3282, Handapan Ella
Plains (near Rakwana), alt. 1270 m (06º26’ N, 080º36’ E); WHT 3298, Sinharaja World Heritage Site (near Kudawa), alt.
513 m (06º25’ N, 080º25’ E).
Pseudophilautus caeruleus (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 2514; Paratypes: WHT 2511;
2512; 2513, Bogawanthalawa–Balangoda road (near Udugama), alt. 810 m (06º44’ N, 80º41’ E); WHT 2101A; 2101B,
Moray Estate, Rajamally, alt. 1370 m (06º48’ N, 80º31’ E).
Pseudophilautus cavirostris (Günther, 1869). WHT 1294, Haycock (Hiniduma, Galle), alt. 660 m (06º20’ N, 80º18’ E); WHT
3299; 3300, Sinharaja World Heritage Site, Weddagala, alt. 513 m (06º25’ N, 80025’ E); WHT 3389, Kitulgala, alt. 200 m
(07º00’ N, 80º24’ E); WHT 2318; Kosmulla near Neluwa, alt. 450 m (06º23’ N, 80º23’ E); WHT 2046; 2425, Pathanegala
(Knuckles), alt. 1,000 m (07º33’ N, 80º44’ E); WHT 2045; Kadugannawa, alt. 450 m (07º15’ N, 80º30’ E); WHT 3483;
Pussellawe, alt. 986 m (07º00’ N, 080º54’ E).
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
Zootaxa 3620 (1) © 2013 Magnolia Press · 125
SRI LANKAN EXTINCT AMPHIBIAN REDISCOVERED
Pseudophilautus cuspis (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 1177(e); Paratypes: WHT 1177(a);
1177(b); 1177(c); 1177(d); 1177(f); 1177(g); 1177(h); 1177(i); 1177(j), Koskulana (near Panapola), alt. 460 m (06º25’ N,
080º27’ E).
Pseudophilautus decoris (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: mature female, 23.9 mm SVL, WHT 2358;
Paratypes: WHT 3194; 3257; 3258; 3265; 3266; 3267; 3268; 3269; 3271; 3270; 3272; Morningside Forest Reserve (near
Rakwana), alt. 1060 m (06º24’ N, 080º38’ E).
Pseudophilautus femoralis (Günther, 1864). WHT2701; 2702; 2703; 2704; 2705; 2706; 2707; 3540; 3537; 3538; 3539; 2478;
2479, 7 Jun. 1999, Horton Plains National Park, alt. 2135 m (06º46’ N, 80º47’ E).
Pseudophilautus fergusonianus (Ahl, 1927). WHT 731; 2233, Kumaradola, Monaragala, alt. 305m (06º53’N, 081º22’E); WHT
1012, Kitulhela (near Moragahapitiya), Monaragala, alt. 520m (07º20’ N, 81º28’ E); WHT 2400; 2401; Sera Ella (near
Pottotawela), Knuckles, alt. 460m (07º35’ N, 80º45’ E); WHT 2038; 2039; 2040, Puwakpitiya (near Laggala), Knuckles,
alt. 450m (07º34’ N, 80º45’ E); WHT 3360, Deniyaya, alt. 460m (06º21’ N, 080º34’ E); WHT 3361; 3362; 3363; 3364;
3365, Pitadeniya (near Watugala), alt. 320m (06º22’ N, 080º28’ E) WHT 3168; 3177; 3195, Gannoruwa Forest reserve,
Kandy, alt. 684m (07º17’ N, 080º35’ E); WHT 3178; 3179; 27; 3180; 3181; 3182, Puwakpitiya, Knuckles, alt. 414 m
(07º34’ N, 080º44’ E); WHT 3229, Hantana, Kandy, alt. 600 m (07º15’ N, 080º37’ E); WHT 3380; WHT 3381; NMSL
2006.64.1, Medapitiya, Wasgamuwa.
Pseudophilautus folicola (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: mature female, 29.4mm SVL, WHT 2645;
Paratypes: WHT 2646; 2647; 2649; 2650; 2651; 2652, Kottawa (Galle), alt. 60 m (06º06’ N, 080º20’ E).
Pseudophilautus frankenbergi (Meegaskumbura & Manamendra-Arachchi, 2005). Holotype: WHT 2554; Paratypes: WHT
2551; 2552; 2555; 2556, Namunukula Peak, alt. 1980 m (06º56’ N, 081º07’ E); WHT 2726; 2727; 2728; Horton Plains
National Park, alt. 2135 m (06º46’ N, 081º07’ E).
Pseudophilautus fulvus (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 2949; Paratypes: WHT 2948, Laggala
(Knuckles), alt. 1220 m (07º33’ N, 080º44’ E); WHT 3112; 3114; 3463, Moussakanda, Gammaduwa, Knuckles, alt. 915 m
(07º34’ N, 080º42’ E); WHT 3121; Puwakpitiya (near Laggala), Knuckles, alt. 450 m (07º34’ N, 080º45’ E).
Pseudophilautus hallidayi (Meegaskumbura & Manamendra-Arachchi, 2005). Holotype: WHT 3575; Paratypes; WHT 3573;
3576; 3577, Hanthana range, Kandy, alt. 510 to 800 m (07º15’ N, 080º34’ E); WHT 6072, Tonacombe Estate,
Namunukula, alt. 1320 m (06º52’ N, 081º07’ E).
Pseudophilautus hoffmanni (Meegaskumbura & Manamendra-Arachchi, 2005). Holotype: WHT 6120; Paratypes: WHT 3222;
3223; 3542, Corbett’s Gap (Knuckles Hills), alt. 1245 m (07º22’ N, 80º51’ E).
Pseudophilautus hoipolloi (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 2673; Paratypes: WHT 2674; 2675,
Haycock (Hiniduma), alt. 660 m (06º20’ N, 080º18’ E); WHT 2405; 2406; 2407; 2408; 2409, Kahaduwatta (Galle), alt. 15
m (06º04’ N, 080º12’ E); WHT 3196; 3197; 3198; 3199; 3200, Udugama (Galle), alt. 30 m (06º14’ N, 080º20’ E); WHT
3201, Kodagoda (Galle), alt. 45 m (06º02’ N, 080º23’ E).
Pseudophilautus limbus (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 2700; Haycock, alt. 560 m (06º20’ N,
080º18’ E).
Pseudophilautus lunatus (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 3283; Handapan Ella Plains, alt.
1270 m (06º26’ N, 080º36’ E).
Pseudophilautus macropus (Günther, 1869). WHT 3390; 3391; 3392; 3393; 3394; 3395; 3396; 3397; 3398; 3399; 3400; 3401;
3402; 3403; 3404; 3405; 3406, Mousakanda (Gammaduwa), Knuckles, alt. 760 m (07º34’ N, 80º42’ E); WHT 3183,
Divulgahapathana, Knuckles, alt. 603 m (07º33’ N, 80º43’ E); WHT 5900, Bambaraella, Knuckles, alt. 1260 m (07º24’ N,
80º47’ E).
Pseudophilautus microtympanum (Günther, 1859). WHT 2710; 2708; 2712; 2713; 3436; 3437; 3438; 3439; 3440; 3441; 3442;
3443; 3444; 3446, Horton Plains National Park, alt. 2135 m (06º46’ N, 80º47’ E); WHT 3260, Agra Arboretum, near
Agarapatana, alt. 1555 m (06º51’ N, 80º41’ E).
Pseudophilautus mittermeieri (Meegaskumbura & Manamendra-Arachchi, 2005). Holotype: WHT 3522; Paratypes: WHT
3523; 3524; 3525; 3526, Kottawa, Galle, alt. 60 m (06º’06’ N, 080º20’ E); WHT 2668, Beraliya forest, Elpitiya, alt. 150 m
(06º16’ N, 080º11’ E).
Pseudophilautus mooreorum (Meegaskumbura & Manamendra-Arachchi, 2005). Holotype: WHT 5862; Paratypes: WHT
5868; 5869, Hunnasgiriya (Knuckles), alt. 1100 m (07º23’ N, 080º41’ E); WHT 2477; 3209; 6124, Corbett’s Gap
(Knuckles), 1245 m (07º22’ N, 080º51’ E).
Pseudophilautus nemus (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 1319; Haycock (Hiniduma), alt. 660
m (06º20’ N, 080º18’ E).
Pseudophilautus ocularis (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 2360; Paratypes: WHT 3273; 2376;
2377; 2378, Morningside Forest Reserve (near Rakwana), alt. 1060 m (06º24’ N, 080º38’ E); WHT 3288; 3289; 3290;
3291; 3292; 3293, Handapan Ella Plains (near Suriyakanda), alt. 1270 m (06º26’ N, 080º36’ E).
Pseudophilautus papillosus (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 3284; Handapan Ella Plains (near
Rakwana), alt. 1270 m (06º26’ N, 080º36’ E).
Pseudophilautus pleurotaenia (Boulenger, 1904). WHT 3176; 5824; Gannoruwa Forest reserve, Kandy, alt. 684m (07º17’ N,
080º35’ E); WHT 5860; 5861; Nawalapitiya, alt. 700m (07º03’ N, 080º32’ E).
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
WICKRAMASINGHE ET AL.
126 · Zootaxa 3620 (1) © 2013 Magnolia Press
Pseudophilautus poppiae (Meegaskumbura & Manamendra-Arachchi, 2005). Holotype: WHT 3285; Handapan Ella Plains
(near Suriyakanda), alt. 1270 m (06º26’ N, 080º36’ E); Paratypes: WHT 2030; 2029; 2475; 2778; 2781; 3533; 3534; 3535;
; 3536, Morningside (near Rakwana), alt. 1060 m (06º24’ N, 080º38’ E).
Pseudophilautus procax (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 3279; Paratypes: WHT 2786; 2787;
3277; 3278; 3280; 3281, Morningside Forest Reserve (near Rakwana), alt. 1060 m (06º24’ N, 080º38’ E).
Pseudophilautus regius (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 3122; Paratypes: WHT 5827; 5828;
5829, Angammadilla, Polonnaruwa, alt. 90 m (07º51’ N, 080º55’ E).
Pseudophilautus reticulatus (Günther, 1864). WHT 2286; 2287; 2290; 2291, Kosmulla (near Nelluwa), alt. 320 m (06º24’ N,
80º23’ E); WHT 2288; 2289, Dediyagala Forest Reserve, Akuressa, alt. 150 m (06º10’ N, 80º26’ E); WHT 2344, Yagirala,
alt. 30 m (06º22’ N, 80º10’ E); WHT 3230, Induruwa, (Ratnapura), alt. 150 m (06º45’ N, 80º26’ E); NMSL 2006.66.1;
Gileemale forest, alt. 150 m (06º45’ N, 080º26’ E); WHT 2520; 2521, Check Poleat Gap (near Norton Bridge), alt. 800 m
(06º56’ N, 80º30’ E); WHT 3366, Haycock (Hiniduma), alt. 660 m (06º20’ N, 80º18’ E)
Pseudophilautus rus (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 3474; Paratypes: WHT 3475; 3476;
WHT 3477, Kiribatkumbura (near Peradeniya), alt. 450 m (07º16’ N, 080º34’ E); WHT 5437; 5439; 5436; WHT 5440;
5438; 5432; 5435; 5434, Pilimatalawa (near Peradeniya), alt. 658 m (07º15’ N, 080º34’ E,).
Pseudophilautus sarasinorum (Müller, 1887). WHT 2480; 2481; 2482; 2483, Bogawanthalawa-Balangoda road, alt. 1300 m
(06º45’ N, 080º42’ E); WHT 2426; 2427; 2428; 2429, Corbett’s Gap, alt. 1000 m (07º22’ N, 080º50’ E).
Pseudophilautus schmarda (Kelaart, 1854). Neotype: WHT 3353; Horton Plains National Park, alt. 2135 m (06º46’ N, 80º47’
E).
Pseudophilautus silus (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 3453; Paratypes: WHT 3451; WHT
3452; WHT 3454; WHT 3460, Agra Arboretum, near Agarapatana, alt. 1555 m (06º51’ N, 080º41’ E); WHT 3412,
Tangamalai Sanctuary, near Haputale, alt. 1600 m (06º46’ N, 080º55’ E);
Pseudophilautus silvaticus (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 3295; Paratypes: WHT 3296,
3378; 3379; 3461; 3462, Handapan Ella Plains (near Suriyakanda), alt. 1270 m (06º26’ N, 080º36’ E); WHT 3275; WHT
3276, Morningside Forest Reserve (near Rakwana), alt. 1060 m (06º24’ N, 080º38’ E); WHT 3310; 3316, Sinharaja World
Heritage Site (near Kudawa), alt. 513 m (06º25’ N, 080º25’ E).
Pseudophilautus simba (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 3464; Paratypes: WHT 3465; WHT
3466; WHT 3467, Morningside Forest Reserve (near Rakwana), alt. 1060 m (06º24’ N, 080º38’ E).
Pseudophilautus sordidus (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 2379; Paratypes: WHT 2383; 2384;
2385; 2386; 2389; 2390; 2391; 2393; 2395; 2397; 2398, Kanneliya Forest Reserve (Galle), alt. 150 m (06º15’ N, 080º20’
E); WHT 2380; WHT 2381, Haycock (Hiniduma), alt. 660 m (06º20’ N, 080º18’ E); WHT 2382, Haycock (Hiniduma),
alt. 150 m (06º18’ N, 080º19’ E); 2387; WHT 2396, Millawa Forest Reserve (near Morawaka), alt. 150 m (06º17’ N,
080º28’ E); WHT 2988, Welikanna, Waga (near Labugama), alt. 78 m (06º51’ N, 080º09’ E); WHT 2998, Labugama
Forest Reserve, alt. 78 m (06º51’ N, 080º10’ E); WHT 3303; 3304; 3306, Sinharaja Forest Reserve (Halmandiya), alt. 513
m (06º25’ N, 080º25’ E); NMSL 2006.65.1. Denenakanda, Peak Wilderness.
Pseudophilautus steineri (Meegaskumbura & Manamendra-Arachchi, 2005). Holotype: WHT 3210; Paratypes: WHT 3519;
3521; 3520, 6116; 3518, Corbett’s Gap (Knuckles Hills), alt. 1245 m (07º22’ N, 080º51’ E).
Pseudophilautus stictomerus (Günther, 1876). WHT 1173; 2402, Kottawa (Galle), alt. 60 m (06º06’ N, 080º20’ E); WHT 2403;
2404, Kanneliya (Galle), alt. 150 m (06º15’ N, 080º20’ E); WHT 3301, Sinharaja Forest (near Kudawa), alt. 513 m (06º25’
N, 080º25’ E); WHT 3355; 3356; 3357; 3358; 3359, Kosmulla (near Nelluwa), alt. 320 m (06º24’ N, 080º23’ E).
Pseudophilautus stuarti (Meegaskumbura & Manamendra-Arachchi, 2005). Holotype: WHT 3208; Paratypes: WHT 3207;
3206; 3218, 3527, 357 Corbett’s Gap (Knuckles Hills), alt. 1245 m (07º22’ N, 080º 51’ E).
Pseudophilautus viridis (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 5127; Paratypes: WHT 3488; 3489;
5104; 5105; 5106; 5099; 5100; 5103; 5126, Agra Arboretum, near Agarapatana, alt. 1555 m (06º51’ N, 080º41’ E); WHT
2763; 2764; 2765; 2766; 2767; 2768, 4999, Ambewela (near radio station), alt 1830 m (06º53’ N, 080º 48’ E).
Pseudophilautus zorro (Manamendra-Arachchi & Pethiyagoda, 2005). Holotype: WHT 3169; Paratypes: WHT 3175; 3204;
3205, Gannoruwa Forest Reserve, Kandy, alt. 684 m (07º17’ N, 080º35’ E); WHT 3508, Tiverton Estate (near Peradeniya),
alt. 450 m (07º16’ N, 080º34’ E).
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
Zootaxa 3620 (1) © 2013 Magnolia Press · 127
SRI LANKAN EXTINCT AMPHIBIAN REDISCOVERED
APPENDIX 1.
GenBank accession numbers of the 12S and 16S mtDNA fragments used for the phylogenetic analyses.
Taxon Collection # 12S 16S
P. alto WHT2723 AY141781 AY141827
P. a sa nk ai WHT5107 FJ788141 FJ788160
P. a ur at us WHT2792 AY141789 AY141835
P. caeruleus WHT2511 AY141764 AY141810
P. cavirostris WHT3299 FJ788137 FJ788156
P. d ec or is WHT3271 FJ788144 FJ788163
P. femoralis 1WHT2566 AY141771 AY141817
P. femoralis 2WHT2772 AY141785 AY141831
P. frankenbergi 1WHT2552 AY141768 AY141814
P. frankenbergi 2WHT2555 AY141769 AY141815
P. hallidayi WHT11 AY141793 AY141839
P. hankeni WHT6302 GU593346 GU593348
P. hoffmanni WHT3223 FJ788142 FJ788161
P. hoipolloi WHT2675 AY141776 AY141822
P. limbus 1WHT2690 AY141777 AY141823
P. limbus 2 WHT2700 AY141779 AY141825
P. lunatus WHT3283 FJ788150 FJ788169
P. microtympanum WHT2558 AY141770 AY141816
P. mittermeieri WHTKAN2 FJ788143 FJ788162
P. m oo reor um WHT3209 FJ788134 FJ788153
P. ocularis WHT2887 FJ788145 FJ788164
P. papillosus WHT3284 FJ788151 FJ788170
P. pleurotaenia WHT3176 FJ788146 FJ788165
P. poppiae 1WHT5026 FJ788135 FJ788154
P. poppiae 2WHT2779 FJ788136 FJ788155
P. popularis WHT3191 FJ788149 FJ788168
P. procax WHT2786 AY141788 AY141834
P. sarasinorum 1WHT2481 AY141761 AY141807
P. cf.sarasinorum 2WHT2484 AY141762 AY141808
P. cf. sarasinorum 3WHT2489 AY141763 AY141809
P. sc hma rda WHT2715 AY141780 AY141826
P. s ch ne id eri 1WHT2667 AY141774 AY141820
P. s ch ne id eri 2WHT5831 GU593345 GU593347
P. s im ba 1WHT3221 FJ788148 FJ788167
P. s im ba 2WHT6004 GQ204740 GQ204679
P. s in gu WHT2658 AY141773 AY141819
P. s ord idu s 1WHT2699 AY141778 AY141824
P. cf. sordidus 2WHT12 AY141791 AY141837
P.cf. sordidus 3WHT15 AY141792 AY141838
P. steineri WHT3210 FJ788138 FJ788157
P. stellatus HFS01002 JN862535 JN862536
......continued on the next page
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
WICKRAMASINGHE ET AL.
128 · Zootaxa 3620 (1) © 2013 Magnolia Press
APPENDIX 2
Kelaart, E.F. (1853) Prodromus faunae zeylanicae; being contributions to the zoology of Ceylon. Published by the author,
Colombo, pp. 194.
POLYPEDATES STELLATA. n s. nobis.
Above bright green, with transverse darker bands, and irregularly spotted white. Limbs barred brown and spotted white.
Beneath pinkish white. Body oval. Total length about 2 ¼ inches.
Geographical distribution. Newera-Ellia, Ceylon.
We are indebted to Miss Barbara Layard for the only specimen of this beautiful frog found at Newera-Ellia. This frog, too
changes its green colour into a purplish brown, the transverse bands become brown, but the white spots are always present.
APPENDIX 1. (Continued)
Taxon Collection # 12S 16S
P. stuarti 1 WHT3207 FJ788139 FJ788158
P. stuarti 2WHT3208 FJ788140 FJ788159
P. t an u WHT6343 FJ788152 FJ788171
P. viridis 1WHT2627 AY141772 AY141818
P. viridis 2WHT2766 AY141784 AY141830
P. wynaadensis NA AY141796 AY141842
P. zorro WHT3175 FJ788147 FJ788166
P. sp. 1WHT2774 AY141786 AY141832
P. sp. 2A WHT2729 AY141782 AY141828
P. sp. 2B WHT2731 AY141783 AY141829
P. sp. 3WHT2525 AY141766 AY141812
P. sp. 4 WHT2669 AY141775 AY141821
P. sp. 5WHT2797 AY141790 AY141836
P. sp. 6A WHT2515 AY141765 AY141811
P. sp. 6B WHT2540 AY141767 AY141813
Raorchestescharius NA AY141840 AY141794
Raorchestessignatus NA AY141795 AY141841
Philautusaurifasciatus 1ZRC.1.5266 AY141804 AY141850
Philautusaurifasciatus 2ZRC.1.5267 AY141805 AY141851
Polypedatescruciger WHT2640 AY141799 AY141845
Polypedatesleucomystax ZRC.1.5269 AY141803 AY141849
Polypedatesmegacephalus NA NC 006408 NC 006408
TERMS OF USE
This pdf is provided by Magnolia Press for private/research use.
Commercial sale or deposition in a public library or website is prohibited.
... Of this, 65% of the diversity is threatened with extinction, while approximately 34% are categorized as critically endangered and 23% categorized as endangered species (Manamendra-Arachchi and Meegaskumbura, 2012). Unfortunately, 18 of the 119 species have already become extinct (Wickramasinghe et al., 2012(Wickramasinghe et al., , 2013a(Wickramasinghe et al., , 2013b. Thus, conservation measures are urgently necessary to stem the rate of amphibian population declines of many threatened species. ...
... Most importantly, the discovery of this critically endangered restricted range species of frog outside its previously known range highlights the importance of taxon specific biodiversity surveys of vertebrate groups in Sri Lanka. Hence, future surveys may even shed light on species that are considered to be extinct such as N. guentheri similar to the other studies that have rediscovered other species of amphibians that were thought to be extinct Wickramasinghe et al., 2012;Wickramasinghe et al., 2013aWickramasinghe et al., , 2013b. ...
Article
Full-text available
Nannophrys marmorata is a critically endangered species of frog known only from a few locations in the Knuckles Conservation Forest (KCF) in the Knuckles mountain range of Sri Lanka. Here, we report new localities outside its known range in the KCF and examine the distribution of N. marmorata providing the most extensive distribution map for this species. Furthermore, using the distribution information, we model the fundamental ecological niche of this species through Ecological Niche Modeling (ENM) to predict suitable habitats and fine-scale distribution patterns. ENM predicted eastern slopes of the Knuckles mountain range in central Sri Lanka as areas with high habitat suitability (suitability >75%) for N. marmorata. Predicted Extent of Occurrence for N. marmo-rata was 831 km 2 and predicted Area of Occupancy was 275 km 2. We discuss these findings in light of conservation for this species threatened with extinction.
... The distribution of species are based on the data gathered from previously published literature: monographs (Dutta and Manamendra-Arachchi, 1996; Manamendra-Arachchi and Pethiyagoda, 2006), periodicals (Fernando et al., 2007;Wickramasinghe et al., 2012a, b;Wickramasinghe et al., 2013b;Batuwita et al., 2019b), reports, IUCN (1999;2007;, WCSG (2008;2009), together with personal observations based on field observations by the first three authors during 1997 to 2014. Elevations were classified as follows: (1) Low elevations (<800 m), (2) Mid-elevations (~800 m to ~1700 m), and (3) High elevations (1700 m to 2500 m). ...
... For higher-level taxonomy, we followed Frost et al. (2006) and in species taxonomy the following literature were used: Frost et al. (2006), Manamendra-Arachchi and Pethiyagoda (2006), Fernando et al. (2007), Joshy et al. (2009), Li et al. (2013), Biju et al. (2014), Khajeh et al. (2014), Meegaskumbura et al. (2015), Oliver et al. (2015), Peloso et al. (2016), Wijayathilaka et al. (2016), Garg et al. (2018), Sanchez et al. (2018), Batuwita et al. (2019b), and Chandramouli et al. (2019). The conservation statuses of species were taken from the following published sources: Fernando et al. (2007); IUCN (1999;2007;; Manamendra-Arachchi and Pethiyagoda (2006); Wickramasinghe et al. (2013b;; and Batuwita et al. (2019b). Recent taxonomic changes to the species were discussed after Manamendra-Arachchi and Pethiyagoda (2006). ...
Article
Full-text available
The amphibian fauna of Sri Lanka comprises 120 species, including 107 (~90.0%) endemic species. They belong to five families: Bufonidae, Dicroglossidae, Ichthyophiidae, Microhylidae, and Rhacophoridae. Based on distribution, we recognized five zoogeographic zones for them, Central Hills, Dry Zone, Knuckles Range, Lowland Wet Zone, and Rakwana Hills. Fifty three species were reported from the Central Hills (48 endemics [90.6%] and 42 [79.2%] threatened species). 47 species were recorded from the Lowland Wet Zone, including 36 (76.6%) endemics and 28 (59.6%) threatened species. The Knuckles Range had 25 species, of which, 19 (76.0%) were endemics and 15 (60.0%) are threatened species. 19 species were reported from Dry Zone including seven endemics (36.8%) and four threatened species (21.1%). Out of 29 species, which inhabited in the Rakwana Hills, 26 were endemics (~89.7%) including 24 (82.8%) threatened species. Species diversity along the elevational gradient was also observed with the highest species richness in the mid-elevational localities. Family Ichthyophiidae can be considered as the least studied family. Recent rediscoveries and studies have helped to reduce the number of extinct species from 21 to 18. It is speculated that some of the other extinct species have to be rediscovered or probably were misidentified as other species. About 90% of Sri Lankan amphibians occur in the regions with the highest human populations where there are established agricultural lands. Loss of habitats, competition due to anthropogenic species and invasive species, pollution (cause for malformations, parasites, and other diseases), and climate change appear to be major threats.
... On the other hand, a species is considered tolerant if it has the capacity to limit the consequences of the infection; in this case, although the pathogen is present, the animals do not die from chytridiomycosis [7]. Although the decline of amphibians observed in the 1980s and 1990s led to their disappearance, several species of amphibians have been rediscovered since the year 2000 [31][32][33][34][35][36][37][38][39]. It remains unclear why certain populations or species of amphibians survive whereas others are extirpated with the appearance of Bd. ...
Article
Full-text available
Amphibians have declined around the world in recent years, in parallel with the emergence of an epidermal disease called chytridiomycosis, caused by the chytrid fungus Batrachochytrium dendrobatidis ( Bd ). This disease has been associated with mass mortality in amphibians worldwide, including in Costa Rica, and Bd is considered an important contributor to the disappearance of this group of vertebrates. While many species are susceptible to the disease, others show tolerance and manage to survive infection with the pathogen. We evaluated the pathogen Bd circulating in Costa Rica and the capacity of amphibian skin bacteria to inhibit the growth of the pathogen in vitro . We isolated and characterized – genetically and morphologically – several Bd isolates from areas with declining populations of amphibians. We determined that the circulating chytrid fungus in Costa Rica belongs to the virulent strain Bd -GPL-2, which has been related to massive amphibian deaths worldwide; however, the isolates obtained showed genetic and morphological variation. Furthermore, we isolated epidermal bacteria from 12 amphibian species of surviving populations, some in danger of extinction, and evaluated their inhibitory activity against the collection of chytrid isolates. Through bioassays we confirmed the presence of chytrid-inhibitory bacterial genera in Costa Rican amphibians. However, we observed that the inhibition varied between different isolates of the same bacterial genus, and each bacterial isolation inhibited fungal isolation differently. In total, 14 bacterial isolates belonging to the genera Stenotrophomonas , Streptomyces , Enterobacter , Pseudomonas and Klebsiella showed inhibitory activity against all Bd isolates. Given the observed variation both in the pathogen and in the bacterial inhibition capacity, it is highly relevant to include local isolates and to consider the origin of the microorganisms when performing in vivo infection tests aimed at developing and implementing mitigation strategies for chytridiomycosis.
... Although the two species were described from two discrete localities (but within the same elevation zone,~1,800-2,200 m msl) of the Central Hills (Nuwaraeliya and Peak Wilderness), other reptile and amphibian species that span across both areas do not show any differentiation between the two areas (e.g., Adenomus kandianus (Günther), Ceratophora stoddartii (Gray), Taruga eques (Günther), and many Pseudophilautus spp. including P. schmarda (Kelaart) and P. stellatus (Kelaart)) Pethiyagoda, 1998, 2005;Wickramasinghe et al., 2013;Meegaskumbura et al., 2015;personal observation). Hence, my conclusion is supported on geographic grounds as well. ...
Article
Full-text available
As a part of an ongoing revision of Sri Lankan scincid lizards, I review the genus Lankascincus Greer on the basis of their morphology and morphometric data. I demonstrate that the long-disputed Sphenomorphus megalops (Annandale) is in fact a Lankascincus species, and a neotype is designated. Lankascincus deraniyagalae Greer and L. munindradasai Wickramasinghe, Rodrigo, Dayawansa, and Jayantha are shown to be junior subjective synonyms of L. fallax (Peters) and L. taprobanensis (Kelaart), respectively. Lankascincus deignani (Taylor) is confined to the forests around Kandy and does not extend to Nuwaraeliya and its environs. Previous records of L. deignani from Nuwaraeliya and surrounding localities are reidentified as L. sripadensis Wickramasinghe, Rodrigo, Dayawansa, and Jayantha. Three groups of Lankascincus species are identified on the basis of their morphology and breeding biology: the fallax, taprobanensis, and dorsicatenatus groups. Each group has a unique combination of characters. Lankascincus taprobanensis is restricted to high-elevational regions (1,500 m above mean sea level). Previous records from lower elevations (Sinharaja, Knuckles Range, and Peradeniya) are based on misidentified specimens of other Lankascincus spp. Lankascincus fallax has a wide distribution in Sri Lanka. Lankascincus deignani is restricted to Gannoruwa Forest Reserve and the Ambagamuwa area and is the most endangered skink in Sri Lanka. Ecologically, Lankascincus comprises a largely forest-dwelling species group (L. deignani, L. dorsicatenatus (Deraniyagala), L. gansi Greer, L. greeri Batuwita and Pethiyagoda, L. megalops new combination, and L. taprobanensis) and a group of species that live in altered habitats (L. sripadensis, L. fallax, and L. taylori). The present study confirms that the genus Sphenomorphus Fitzinger is not represented in Sri Lanka. Because of a lack of comprehensive genetic data to support a previously described new family, Ristellidae Hedges for Lankascincus and Ristella Gray, here I assign both genera into a new tribe, Ristellini. Phylogenetic relationships of Lankascincus and Ristella remain unresolved.
... Indian species were coded as (IND) and the remaining rhacophorids + outgroup were coded as undesignated (U), as their distributional data were not included in the analysis. Based on available data on the distribution of Sri Lankan species (AmphibiaWeb 2018; Bahir et al., 2005;Meegaskumbura andManamendra-Arachchi, 2005, 2011;Manamendra-Arachchi and Pethiyagoda, 2006;Meegaskumbura et al., 2007Meegaskumbura et al., , 2009Meegaskumbura et al., , 2012Wickramasinghe et al., 2013), the following dispersal routes were evaluated: Central-Rakwana, Central-Knuckles, Central-Lowlands wet, Central-India, Knuckles-Rakwana, Knuckles-Lowlands wet, Knuckles-India, Rakwana-Lowlands wet, Rakwana-India and India-Lowlands wet. Assuming that Pseudophilautus have poor dispersal abilities over non-adjacent areas, low probability values (0.1) were assigned to four routes: Central-India, Rakwana-India, Knuckles-India and Knuckles-Rakwana. ...
Article
Pseudophilautus comprises an endemic diversification predominantly associated with the wet tropical regions of Sri Lanka that provides an opportunity to examine the effects of geography and historical climate change on diversification. Using a time-calibrated multi-gene phylogeny, we analyze the tempo of diversification in the context of past climate and geography to identify historical drivers of current patterns of diversity and distribution. Molecular dating suggests that the diversification was seeded by migration across a land-bridge connection from India during a period of climatic cooling and drying, the Oi-1 glacial maximum around the Eocene-Oligocene boundary. Lineage-through-time plots suggest a gradual and constant rate of diversification, beginning in the Oligocene and extending through the late Miocene and early Pliocene with a slight burst in the Pleistocene. There is no indication of an early-burst phase of diversification characteristic of many adaptive radiations, nor were there bursts of diversification associated with favorable climate shifts such as the intensification of monsoons. However, a late Miocene (8.8 MYA) back-migration to India occurred following the establishment of the monsoon. The back migration did not trigger a diversification in India similar to that manifest in Sri Lanka, likely due to occupation of available habitat, and consequent lack of ecological opportunity, by the earlier radiation of a sister lineage of frogs (Raorchestes) with similar ecology. Phylogenetic area reconstructions show a pattern of sister species distributed across adjacent mountain ranges or from different parts of large montane regions, highlighting the importance of isolation and allopatric speciation. Hence, local species communities are composed of species from disparate clades that, in most cases, have been assembled through migration rather than in situ speciation. Lowland lineages are derived from montane lineages. Thus, the hills of Sri Lanka acted as species pumps as well as refuges throughout the 31 million years of evolution, highlighting the importance of tropical montane regions for both the generation and maintenance of biodiversity.
... Notably, several of these extinct frogs have been rediscovered in recent years. For example, the first frog to be rediscovered was Raorchestes travancoricus in India (Last seen (Ls): 1891 -Rediscovery (R): 2004) (Biju and Bossuyt, 2009 (Wickramasinghe et al., 2012(Wickramasinghe et al., , 2013a(Wickramasinghe et al., , 2013b. ...
Article
Full-text available
We report the rediscovery of a declared extinct frog, Craugastor escoces, at the edge of a protected forest in the Juan Castro Blanco National Park, Alajuela, Costa Rica. This species, which is endemic to Costa Rica, had not been observed since 1986. The rediscovery of this species comes after 30 years without being seen and 12 years of being declared extinct. The site where we found the species is located in the west of the central mountain region of Costa Rica, which is >15 km away from its known distribution. Our finding adds another species to the list of the few rediscovered frogs declared extinct. Knowing that C. escoces can still be found triggers the need for conservation strategies to help the species survive.
... Habitat loss, water pollution, and loss of vegetation are the most significant factors for restricted distribution of highland amphibians. Two of the very rare amphibian species were recently rediscovered from the Peak Wilderness, in Central Hills of Sri Lanka (Wickramasinghe et al. 2012(Wickramasinghe et al. , 2013. Nannophrys marmorata, an endemic and critically endangered amphibian species, is restricted to the rock strewn streams of the Knuckles Forest Reserve (200-1200 m amsl). ...
Chapter
Wetland ecosystems are among the most productive ecosystems that support many kinds of life. They are valuable in terms of hydrology, plant and animal survival, and biodiversity. National Wetland Directory of Sri Lanka describes 62 important wetlands, with their status. The central highland complex of Sri Lanka is a unique ecosystem and the most important catchment area of major rivers. Therefore, it is identified as a super biodiversity hotspot and a world heritage site. The major wetland types in the central highland ecosystem are freshwater marshes, streams, waterfalls, human-made lakes, reservoirs, and springs. In Sri Lanka, most of the threatened species, which are associated with aquatic habitats, are found in the central highlands with very restricted distribution. Habitat deterioration and degradation, encroachments, clearing of vegetation, water pollution, and spread of invasive alien species are the most significant threats to the highland wetlands. Therefore, demarcation of wetlands, protection of buffer zones, increased public awareness, and implementation of good agricultural practices would certainly bring beneficial changes to the ecosystems.
Article
We describe a new Pseudophilautus species, P. conniffae sp. nov. from southern Sri Lanka. It was previously confused with Pseudophilautus rus (Manamendra-Arachchi & Pethiyagoda). The new species differs from the latter by the combination of the following characters: fourth toe webbing to penultimate subarticular tubercle on inner and outer sides (vs. fourth toe webbing in between penultimate and anetpenultimate subarticular tubercles on inner and outer sides), presence of conical median lingual process (vs. absent), and black patches on the posterior flank, anterior and posterior edges of the thigh (vs. black patches on the anterior surface of the thigh). Pseudophilautus conniffae sp. nov. may be sympatric with P. limbus (Manamendra-Arachchi & Pethiyagoda), which shares certain characters with the new species. The new species is, however, distinguished from P. limbus by the following characters: having supernumerary tubercles on manus (vs. lacking), absence of frontoparietal ridges (vs. presence), fourth toe webbing to penultimate subarticular tubercle on both sides (vs. fourth toe webbing between penultimate and anetpenultimate subarticular tubercle on both sides), third toe webbing to distal subarticular tubercle on both sides (vs. distal subarticular tubercle on outer side and below penultimate subarticular tubercle on inner side), and having the dorsum light brown with dark brown patches (vs. black and yellow variegated pattern on dorsum). The new species may be restricted to the southwestern wet zone of Sri Lanka. It is compared with all known Pseudophilautus species and also provided with a field key to identify it from those species that are sympatric with it or inhabit the southwestern wet zone.
Article
Full-text available
We describe a new Pseudophilautus species, P. conniffae sp. nov. from southern Sri Lanka. It was previously confused with Pseudophilautus rus (Manamendra-Arachchi & Pethiyagoda). The new species differs from the latter by the combination of the following characters: fourth toe webbing to penultimate subarticular tubercle on inner and outer sides (vs. fourth toe webbing in between penultimate and anetpenultimate subarticular tubercles on inner and outer sides), presence of conical median lingual process (vs. absent), and black patches on the posterior flank, anterior and posterior edges of the thigh (vs. black patches on the anterior surface of the thigh). Pseudophilautus conniffae sp. nov. may be sympatric with P. limbus (Manamendra-Arachchi & Pethiyagoda), which shares certain characters with the new species. The new species is, however, distinguished from P. limbus by the following characters: having supernumerary tubercles on manus (vs. lacking), absence of frontoparietal ridges (vs. presence), fourth toe webbing to penultimate subarticular tubercle on both sides (vs. fourth toe webbing between penultimate and anetpenultimate subarticular tubercle on both sides), third toe webbing to distal subarticular tubercle on both sides (vs. distal subarticular tubercle on outer side and below penultimate subarticular tubercle on inner side), and having the dorsum light brown with dark brown patches (vs. black and yellow variegated pattern on dorsum). The new species may be restricted to the southwestern wet zone of Sri Lanka. It is compared with all known Pseudophilautus species and also provided with a field key to identify it from those species that are sympatric with it or inhabit the southwestern wet zone.
Article
Full-text available
Adenomus kandianus Günther (1872) was previously known only from two specimens both deposited in the British Museum, the holotype BMNH1947.2.20.63, and the syntype of A. kelaarti BMNH1947.2.20.62. The only record of A. kandianus since the initial description in 1872 was by Ferguson in 1876, who mentions two specimens resembling Bufo kandianus in his collection, making A. kandianus the world's rarest toad. The species had not been reported since, and was considered extinct. Here we report on its rediscovery.
Article
Full-text available
A new rhacophorid frog is described from Eravikulam National Park in the Western Ghats of India. The species is morphologically dissimilar from any known member of this family in having a bright orange to reddish colouration, multiple macroglands on the body and extremely short limbs. Phylogenetic analyses of mitochondrial genes indicate that this new frog is nested in a radiation of shrubfrogs that had its origin on the Indian subcontinent, and which is here recognized as a distinct genus, Raorchestes gen. nov. The new species, Raorchestes resplendens sp. nov. is likely restricted to less than 3 sq. km on the summit of Anamudi, and deserves immediate conservation priority.
Article
Full-text available
A new species of frog tentatively assigned to the genus Polypedates is described from the Gilimale forest reserve of the Sabaragamuwa province of Sri Lanka. This tree frog is characterized by unique osteological characteristics in the skull which distinguish it from all other congeners, such as the presence of a series of maxillary teeth progressively changing orientation from horizontal to vertical from posterior end to anterior; a laterally- curved spine in the quadratojugal bone; and bony co- ossification on the skull resulting in four dorsal spines which are externally seen as protrusions in the parietal area. Bioacoustic observations of Polypedates ranwellai sp. nov. revealed three distinct call types. High rates of deforestation and anthropogenic activities at the type locality threaten the survival of the species.
Article
Full-text available
This paper is devoted to a review of the specific taxonomy of the frog genus Philautus Gistel, 1848. From 1822 to 1999, 177 nominal species were either described as members of this genus, or of other genera but subsequently referred to this genus. We tried to review the available information on the taxonomic status of these 177 names and the status of their name-bearing types. As a result of this review, 143 types are known to be extant, including 19 lectotypes and 8 neotypes designated and/or described in the present paper. In conclusion of this preliminary analysis, we provisionally distribute these 177 names in 84 valid species names in the genus Philautus, 37 invalid synonyms of the latter names, and 56 nominal species now referred to other genera. These results are highly provisional, both at specific and supra- specific levels. Additional works, using various characters and methods, will be necessary to confirm or reject the validity of a number of these species, and many additional species clearly remain to be discovered and described in the whole range of this genus. At supraspecific level, the taxonomy we use (a single genus Philautus with three subgenera) is also highly provisional, as the generic taxonomy of the whole subfamily Rhacophorinae is in strong need of revision. The present work will provide clear nomenclatural bases for future works on the phylogeny and taxonomy of this difficult group.
Article
Full-text available
An extensive survey of amphibians in Sri Lanka, a 65,000 km 2 continental island, has recently served to uncover ~100 new species of amphibians, mostly Oriental shrub-frogs of the endotrophic genus Philautus. Comparison of specimens acquired in the course of this survey with type and other historical collections have previously shown that 19 species have disappeared from the island. The final two extinct species, Philautus pardus and P. maia, known only from collections made in the island prior to 1876, are described herein as new. A contemporaneous account of the latter species reported that the female carried its clutch of eggs adhered to its belly, a behaviour which, if true, is unique in Anura. The remarkable extinction of anurans in Sri Lanka appears to be largely a result of the loss of c. 95 % of the island's perhumid forests. Sri Lanka's amphibian extinctions have been detectable only because of the baseline offered by specimens collected in the period 1850–1940 and preserved in overseas natural-history museums. Historical biodiversity collections in the world's natural history museums thus offer outstanding value as baselines for contemporary biodiversity conservation assessments.
Article
Full-text available
Two new species of Sri Lankan frogs of the genus Philautus are described. Species diagnoses are based on morphology, morphometrics and mitochondrial DNA sequence data. Philautus tanu sp. nov. inhabits shrubs in open areas of the lowland wet zone, while P. singu sp. nov. is found on shrubs in the understory of lowland and mid-elevation rainforests. These descriptions bring the total number of valid Sri Lankan Philautus to 65 species, of which 46 are extant.
Book
— We studied sequence variation in 16S rDNA in 204 individuals from 37 populations of the land snail Candidula unifasciata (Poiret 1801) across the core species range in France, Switzerland, and Germany. Phylogeographic, nested clade, and coalescence analyses were used to elucidate the species evolutionary history. The study revealed the presence of two major evolutionary lineages that evolved in separate refuges in southeast France as result of previous fragmentation during the Pleistocene. Applying a recent extension of the nested clade analysis (Templeton 2001), we inferred that range expansions along river valleys in independent corridors to the north led eventually to a secondary contact zone of the major clades around the Geneva Basin. There is evidence supporting the idea that the formation of the secondary contact zone and the colonization of Germany might be postglacial events. The phylogeographic history inferred for C. unifasciata differs from general biogeographic patterns of postglacial colonization previously identified for other taxa, and it might represent a common model for species with restricted dispersal.
Article
The recently-developed statistical method known as the "bootstrap" can be used to place confidence intervals on phylogenies. It involves resampling points from one's own data, with replacement, to create a series of bootstrap samples of the same size as the original data. Each of these is analyzed, and the variation among the resulting estimates taken to indicate the size of the error involved in making estimates from the original data, In the case of phylogenies, it is argued that the proper method of resampling is to keep all of the original species while sampling characters with replacement, under the assumption that the characters have been independently drawn by the systematist and have evolved independently. Majority-rule consensus trees can be used to construct a phylogeny showing all of the inferred monophyletic groups that occurred in a majority of the bootstrap samples. If a group shows up 95% of the time or more, the evidence for it is taken to be statistically significant. Existing computer programs can be used to analyze different bootstrap samples by using weights on the characters, the weight of a character being how many times it was drawn in bootstrap sampling. When all characters are perfectly compatible, as envisioned by Hennig, bootstrap sampling becomes unnecessary; the bootstrap method would show significant evidence for a group if it is defined by three or more characters.