Content uploaded by Joy Mazurek
Author content
All content in this area was uploaded by Joy Mazurek on Nov 29, 2017
Content may be subject to copyright.
(This is a sample cover image for this issue. The actual cover is not yet available at this time.)
This article appeared in a journal published by Elsevier. The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elsevier’s archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright
Author's personal copy
Microbiological survey for analysis of the brown spots on the walls of the tomb of
King Tutankhamun
Archana Vasanthakumar
a
,
*
, Alice DeAraujo
a
, Joy Mazurek
b
, Michael Schilling
b
, Ralph Mitchell
a
a
Laboratory of Applied Microbiology, School of Engineering and Applied Sciences, Harvard University, 58 Oxford St., Cambridge, MA 02138, USA
b
Getty Conservation Institute, Getty Center Drive, Los Angeles, CA 90049, USA
article info
Article history:
Received 18 October 2012
Received in revised form
22 January 2013
Accepted 25 January 2013
Available online
Keywords:
Tutankhamun
Brown pigment
Microbial
Penicillium
Malic acid
Pyrosequencing
abstract
This paper presents the preliminary findings from our investigation into the possible microbial origin of
brown spots on the walls of Tutankhamun’s tomb. GC/MS analysis of the brown spots indicated that they
contained 16% (by weight) of malic acid, suggesting microbial involvement in their formation. However,
no microbial structures associated with the brown spots were detected using scanning electron micro-
scopy. Our observations indicate that the organism that created the spots is not active. We undertook an
investigation of the current microbial communities on the walls in Tutankhamun’s tomb and two other
nearby tombs. There were no significant differences in the numbers or types of culturable microor-
ganisms among the three tombs sampled. Using pyrosequencing, no statistically significant differences in
community composition and structure were observed. Fungal communities were composed primarily of
Penicillium whereas the abundant bacterial taxa were members of the Firmicutes, Actinobacteria and
Bacteroidetes phyla. Penicillium chrysogenum isolated in this study produced malic acid in vitro, sug-
gesting that they or other microorganisms may be responsible for the malic acid detected in the brown
spots. Findings from this study were compared to those from previous studies, and a possible scenario for
the formation of the brown spots was developed.
Ó2013 Elsevier Ltd. All rights reserved.
1. Introduction
The more than 3000 year-old tomb of King Tutankhamun,
a Pharaoh of the 18th Dynasty (c. 1323 BCE), perhaps the most
famous tomb in Egypt, is located in the Valley of the Kings on the
West Bank of the Nile, near Luxor, Egypt. As is known, the tomb was
discovered in 1922 and nearly all of its funerary contents were
found intact. In 2008, the Getty Conservation Institute entered into
afive-year partnership with Egypt’s Supreme Council of Antiquities
to collaborate on a project for the conservation and management of
the tomb. One of the project objectives was to identify the origins
and causes of extensive brown spots on the walls in the tomb. If the
spots are of microbiological origin, then it would be important to
ascertain whether the organisms are active, thereby posing a fur-
ther threat to the wall paintings and visitors.
The tomb is small and contains the main burial chamber,
a treasury, an annex and the antechamber. The brown spots were
observed when the tomb was first opened. They partially obscure
the wall paintings in the burial chamber (Fig. 1a, b). They are also
present on unpainted rock surfaces in the rest of the tomb (Wong,
2010; unpublished GCI report).
Attempts to isolate microorganisms from the spots immediately
after the discovery of the tomb were unsuccessful. The brown spots
were described as “fungoid”growths and their shape and mor-
phology supported a microbiological origin (Lucas, 1923;Lucas,
1963;Carter unpublished manuscript;Scott, 1963). In spite of
multiple investigations over the past 50 years, there is still no
consensus on the origin and nature of the brown spots (Fahd,1994;
Szczepanowska and Cavaliere, 2004,2008).
The microbiological objective of this study was two-fold: 1) to
investigate the possible microbial origin of the brown spots and 2)
to describe the microbial communities associated with samples
from the tomb and two other nearby tombs that also contain
substantial wall paintings, but do not contain brown spots. All three
tombs are open to the public. Brown spots were analyzed using
microscopy and gas chromatography/mass spectrometry. In
*Corresponding author. Laboratory of Applied Microbiology, School of Engi-
neering and Applied Sciences, Harvard University, 58 Oxford St., Room 301, Cam-
bridge, MA 02138, USA. Tel.: þ1 617 495 3307; fax: þ16174961471.
E-mail address: archanav@seas.harvard.edu (A. Vasanthakumar).
Contents lists available at SciVerse ScienceDirect
International Biodeterioration & Biodegradation
journal homepage: www.elsevier.com/locate/ibiod
0964-8305/$ esee front matter Ó2013 Elsevier Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.ibiod.2013.01.014
International Biodeterioration & Biodegradation 79 (2013) 56e63
Author's personal copy
addition, culture-based and DNA-based methods were used to
compare the microbial communities of the tombs.
2. Materials and methods
2.1. Sampling
Sampling was undertaken by GCI staff with permission of the
SCA. Samples for microbiological analysis were collected using
sterile swabs, which were moistened in sterile de-ionized water
just before sampling. Some swabs were also moistened with sterile
water amended with a surfactant (Tween 80, Sigma Aldrich, St.
Louis, MO) before sample collection. Brown spots and areas close to,
but outside, brown spots were sampled in multiple locations in the
burial chamber, treasury and antechamber of the tomb. In addition,
swab samples were collected from two nearby tombs, those of
Rameses III and Thutmes IV (Table 1). Collected samples were
maintained at 4
C and were analyzed at Harvard University within
five to seven days. In addition, minute samples of the brown spots
were taken from the burial chamber and treasury.
2.2. Microscopic analysis
2.2.1. Light microscopy
Minute samples of brown spots were placed on a drop of sterile
water on a clean microscope slide, a cover slip placed over them
and the slide viewed under bright light and phase contrast objec-
tives at magnifications ranging from 100to 1000.
2.2.2. Scanning electron microscopy
Minute samples from brown spots were mounted on stubs and
sputter-coated with a mix of gold/palladium. The coated samples
were viewed using the Zeiss EVO Environmental SEM (Zeiss Inc.,
Thornwood NY).
2.3. Growth on microbiological media
One to 1.5 ml of sterile water was placed into the swab con-
tainers and thoroughly mixed using a vortex mixer for w3 min.
Swabs used on the brown spots had clearly become discolored by
the brown pigment, which diffused into the water. A dilution series
was spread plated onto a wide range of microbiological culture
media, including tryptic soy agar, malt extract agar, corn meal agar,
potato dextrose agar, Rose Bengal agar, Sabouraud’s Dextrose Agar,
all from Difco (Difco, Sparks, MD), a halophilic medium (10% (w/v)
MgSO
4
.7H
2
O added to tryptic soy agar), a modified alkaliphilic
medium (Horikoshi, 1998) and a minimal salts medium containing
gum Arabic (an acacia gum which was identified as the paint
binding medium) as the sole carbon source. Inoculated growth
media were maintained for two to eight weeks before analysis.
2.4. Identification of cultivable isolates by ribosomal RNA gene
sequencing
Pure cultures of representative microbial isolates from various
samples were identified by ribosomal RNA gene sequencing. To
summarize, DNA was extracted from representative isolates and
regions of their ribosomal RNA genes amplified using primers
specific for bacteria or fungi (White et al., 1990;Lane, 1991). The
amplified fragment was gel purified using the Qiaquick Gel purifi-
cation kit (Qiagen Inc., Valencia, CA). Dilutions of the purified
fragments were directly sequenced using the eubacterial 16S rRNA
primer, 27F or the fungal intergenic spacer primer, ITS1. Sequences
were trimmed using FinchTV (Geospiza Inc. Seattle, WA). Phylo-
genetic placement of sequences was performed using the software
ARB (Ludwig et al., 2004) and closest matches found using RDP
Classifier (Ribosomal Database Project, Wang et al., 2007) and
UNITE databases (Abarenkov et al., 2010).
2.5. Molecular analysis of microbial communities
2.5.1. Community DNA isolation and PCR amplification
Total DNAwas extracted from pooled samples from brown spots
as well as areas outside brown spots using the UltraClean Soil DNA
kit (MoBio, Carlsbad, CA). ITS regions of the fungal ribosomal
operon were successfully amplified using a semi-nested PCR
Fig. 1. a) Brown spots on a painting on the wall of King Tutankhamun's tomb. b) Close-up of brown spots. (For interpretation of the references to colour in this figure legend, the
reader is referred to the web version of this article.)
Table 1
Description of sampling sites and analysis performed on samples from the three
tombs.
Sample
ID
Sample
source
Location/Tomb Culturing (C),
Sequencing (S)
BCA Brown spot Burial chamber/Tutankhamun C, S
BCD Non-brown spot Burial chamber/Tutankhamun C, S
ACA Brown spot Antechamber/Tutankhamun C
ACD Non-brown spot Antechamber/Tutankhamun C
TA Brown spot Treasury/Tutankhamun C, S
TD Non-brown spot Treasury/Tutankhamun C, S
Thutmes Non-brown spot Thutmes IV C
RAM Non-brown spot Rameses III C, S
A. Vasanthakumar et al. / International Biodeterioration & Biodegradation 79 (2013) 56e63 57
Author's personal copy
approach. Primers NS5 (AACTTCCCGGAATTGACGGAAG) and ITS4
(TCCTCCGCTTATTGATATGC) were used for the first PCR and ITS1
(TCCGTAGGTGAACCTGCGG) and ITS4 for the second PCR. Bacterial
16S ribosomal RNA genes were amplified using a nested PCR
approach. Primers27F/1492R were used for the first PCR and 357F/
907R for the second PCR (Lane, 1991). All amplified fragments were
gel purified using the QiaQuick Gel Extraction kit (Qiagen Inc.
Valencia, CA) before they were sent for 454 pyrosequencing.
2.5.2. 454 pyrosequencing
Bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP)
was performed as described previously for the 16S rRNA gene
(Dowd et al., 2008). The sequencing library was generated using
a one-step PCR for 30 cycles containing Hot Start high fidelity Taq
polymerases and the forward primer. Tag-encoded FLX amplicon
pyrosequencing analyses utilized a Roche 454 FLX instrument with
Titanium reagents. Sequencing procedures were performed at the
Research and Testing Laboratory (Lubbock, TX) based upon RTL
protocols (www.researchandtesting.com).
2.5.3. Sequence analysis
A 454 pipeline in the software program mothur v.1.25.0 (Schloss
et al., 2009;Schloss and Westcott, 2011) was used to extract, clean
up and trim sequences so that only high quality sequences were
obtained. A Phylip-based distance matrix was constructed and an
operational taxonomic unit (OTU)-based approach was employed
to analyze communities (Schloss et al., 2009). Bacterial 16S rRNA
sequences were aligned against a database containing 14,956 rRNA
sequences (www.mothur.org). Fungal ITS sequences were aligned
using a pairwise alignment approach incorporated in mothur.
Representative sequences from each OTU were compared against
the RDP and UNITE databases to obtain information about taxo-
nomic placement. Rarefaction analysis was performed. In addition,
commonly used richness and diversity indices such as the Chao1
index and the Simpsons inverse diversity index were computed for
each sample. Microbial community diversity was compared among
brown spots and areas outside brown spots using beta diversity
statistics. Finally, statistical tests were performed to determine the
significance of any differences among the communities.
2.6. Chemical analysis
Preliminary findings are given below. The brown spot and the
plaster from the wall were analyzed by an Agilent 6890N 5973 Gas
Chromatograph/Mass Spectrometer. Samples were subjected to
acid hydrolysis using 6N HCl. An internal standard,
L
-norleucine,
was added to the samples. The hydrolyzate was evaporated and
dissolved in 25 mM HCl, and ethyl chloroformate was added as
a derivatization reagent (Schilling et al., 1996). The derivatives were
evaporated, reconstituted in chloroform, and injected into the GC/
MS instrument. In calibration, the use of quadratic curve fits forced
through the origin gave correlation coefficients of 0.995 or better
for most analytes over the calibration range of 2e50 ppm. Fungal
cultures isolated from the tombs were also investigated for malic
acid production using the same method.
3. Results
3.1. Analysis of the brown spots
3.1.1. Microscopic analysis
Light microscopic observation of minute samples of the brown
spot revealed a homogeneous mass with no defined boundaries.
The surface of the brown spot was irregular. The color varied from
dark brown in the center to a lighter yellowish-brown on the
outside. The brown spots were easily flaked off from the rock using
a scalpel. No microbiological material efungal hyphae, spores or
bacterial cells ewas observed directly on the surface of the brown
spot or within the stratigraphy.
Scanning electron microscopy revealed that the brown spot was
free of any microorganisms. The brown spots had dust particles
associated with them but there was no evidence of hyphae, spores
or bacterial cells embedded in them (Fig. 2).
3.1.2. Chemical analysis
A significant amount of malic acid (16% by weight) was found
associated with the brown spots but not the plaster (Fig. 3a). Small
amounts of two amino acids, aspartic and glutamic acid, were also
detected in the brown spot (Fig. 3a).
3.2. Microbial community analysis in samples from three tombs
3.2.1. Identification of cultivable microorganisms
In our analysis of the modern microbial communities on the
walls of the chambers in the three tombs, bacterial and fungal
growth was detected on all media tested. Tryptic soy agar, malt
extract agar and the halophilic medium supported the highest di-
versity of microorganisms. Population sizes were low in all sam-
ples. The largest population of bacteria recovered was 600 cfu/
square cm of area sampled. This was from the antechamber in the
Tutankhamun tomb, which had maximum exposure to tourists.
A representative subset of the isolates was chosen for ribosomal
RNA gene sequencing. Gram positive bacteria, represented by
members of the Firmicutes and Actinobacteria, dominated among
bacterial isolates (Table 2). Red-pigmented isolates from the acti-
nobacterial genus Kocuria were isolated from brown spots as well
as areas outside them (from this point on called “non-brown spots/
samples”) in all the chambers in the Tutankhamun tomb as well as
the tombs of Rameses III and Thutmes IV. Bacillus and Staphylo-
coccus species were also represented in multiple samples from both
brown and non-brown samples. Penicillium was isolated from
Rameses III and Tutankhamun tombs. Other commonly occurring
fungi such as Cladosporium and Epicoccum were also isolated from
Tutankhamun’s tomb.
3.2.2. Malic acid production by Penicillium chrysogenum
Since malic acid was detected in the brown spots, the most
abundant fungal genus in the tomb, Penicillium, was tested for malic
Fig. 2. Scanning electron micrograph of a small portion of a brown spot, in which no
microbial structures are evident. Cracking of the sample was caused by the SEM
electron beam.
A. Vasanthakumar et al. / International Biodeterioration & Biodegradation 79 (2013) 56e6358
Author's personal copy
acid production using the same GC/MS method used for analysis of
the brown spots. P. chrysogenum isolates produced malic acid
in vitro (Fig. 3b).
3.2.3. Molecular analysis of microbial communities in brown spots
and areas outside brown spots
Total DNA was extracted from swab samples taken from tomb
walls in the tombs of Tutankhamun and Rameses III in order to
determine the nature of the current microbial community. DNA
from replicate samples from the same sampling area was pooled
together. Microbial communities in five pooled DNA samples iso-
lated from swab samples were analyzed by pyrosequencing. Each of
these five samples was analyzed separately for fungal and bacterial
communities. There were two brown spot samples, one each from
the burial chamber and the treasury (BCAITS/BC16S and TAITS/
TA16S) and similarly, two non-brown samples (BCDITS/BCD16S and
TDITS/TD16S), as well as a sample from the Rameses III tomb
(RamITS/Ram16S).
At 3% difference among sequences, fungal communities in the
samples BCAITS, TAITS, BCDITS and TDITS could be divided into 13,
8, 13 and 3 operational taxonomic units (OTUs) respectively while
the Rameses sample contained 4 OTUs (Table 3). When the taxo-
nomic affiliation of the representatives of each of these OTUs was
investigated, however, the same genus and species combination
could be represented in multiple OTUs. For ease of visualization,
relative abundance data were combined in order to represent only
genera. The relative abundance of Penicillium in the samples ranged
from 28% in the non-brown sample from the burial chamber to 96%
in the Rameses samples. Aspergillus was represented by 20e40% of
sequences in the burial chamber samples but was almost unde-
tectable in the treasury sample (Fig. 4a). Only one fungal OTU,
Penicillium, was shared among all four Tutankhamun samples
analyzed. In fact, this was the only OTU shared among all five
samples in this study, accounting for 70% of the total number of
sequences in all five samples. In our investigation, we detected
Aspergillus in the burial chamber samples but not in the samples
from the treasury or the other two tombs.
At 3% sequence difference, there were no fungal OTUs that were
unique to either brown or non-brown spots. However, the OTU
corresponding to the Cladosporium and Amorphotheca group was
represented only in the non-brown samples (Fig. 4a). The only OTU
that was unique to the burial chamber samples was represented by
the fungus Epicoccum (Fig. 4a).
At 3% difference among sequences, bacterial communities in
brown spot samples BCA16S and TA16S were composed of 90 and
678
Brown Spot
Aspartic Glutamic
67 8
Plaster
I.S. Nor
Malic Acid
I.S. Nor
Retention Time ->
0.E+00
2.E+05
4.E+05
6.E+05
8.E+05
1.E+06
1.E+06
Malic Acid
2.3 6.0
Retention Time
→
Fig. 3. Comparison of brown spot and plaster by GC/MS. a) A large peak corresponding
to malic acid is seen in the brown spot sample but is absent from the plaster sample. b)
Malic acid production by Penicillium chrysogenum isolated from Tutankhamun’s tomb.
The other peaks shown here could not be identified when compared against the NIST
mass spectral library.
Table 2
Phylogenetic placement of a representative subset of cultivable microbial isolates from the tombs of Tutankhamun, Rameses III and Thutmes IV.
Closest match % identity GenBank accession # Tomb Location Brown spot Non-brown spot
Bacillus aeris 99 EF451042 Tut Treasury U
Bacillus jeotgali 100 GU474983 Tut Burial chamber U
Bacillus cereus 99 HQ833025 Tut Treasury U
Kytococcus sp. 99 HM196770 Tut Burial Chamber U
Kocuria rosea 99 HQ202871 Tut Burial chamber U
Kocuria rosea 99 HQ202871 Tut Treasury U
Kocuria rosea 98 EU977667 Rameses III Chamber 8 U
Kocuria rosea 99 EU660350 Thutmes IV Burial chamber U
Kocuria turfanensis 99 HQ671070 Tut Treasury U
Kocuria turfanensis 99 DQ531634 Tut Burial chamber U
Micrococcus luteus 99 FJ999946 Tut Treasury U
Micrococcus luteus 99 FJ999946 Tut Burial chamber U
Staphylococcus epidermidis 99 AB617572 Tut Treasury U
Penicillium chrysogenum 99 JQ861220 Rameses III Chamber D1 U
Penicillium chrysogenum 100 JN986786 Tut Treasury U
Penicillium chrysogenum 99 JN986786 Tut Treasury U
Cladosporium cladosporioides 99 HQ380770 Tut Burial chamber U
A. Vasanthakumar et al. / International Biodeterioration & Biodegradation 79 (2013) 56e63 59
Author's personal copy
87 OTUs, respectively, while non brown samples BCD16S and TD16S
contained 59 and 70 OTUs respectively. The Rameses sample con-
tained 59 bacterial OTUs. No OTUs were shared among the four
Tutankhamun samples at this level of sequence difference. Samples
were also analyzed at 10% difference among sequences, which
corresponded to a taxonomic class level. Members of the class
Bacilli were detected in all samples and were the most abundant
group, represented by 33e91% (Fig. 4b). Bacteroidia was the next
abundant class in four samples, ranging from 9 to 57% of the total
number of sequences in those samples (Fig. 4b). At 10% sequence
difference, two OTUs were shared among all five samples, the
classes Bacilli and Actinobacteria. Both of these classes were also
represented in our culture-based study by Bacillus and Kocuria
species. There was only one OTU unique to the brown spot samples
(the class Clostridia) and this was represented by only 2 sequences.
Rarefaction analysis indicated that the fungal communities have
been adequately sampled at a distance of 3% (Fig. 5). All five rar-
efaction curves were already at a plateau or fast approaching one.
Fungal diversity in the burial chamber samples was higher than in
the treasury (Fig. 5a). Rarefaction curves of the bacterial commu-
nities also showed a high degree of similarity among the five
samples (Fig. 5b). In addition, the coverage of the samples was 98%
and above for all samples (Table 3).
Multiple beta diversity statistics were computed to detect sim-
ilarities among communities. Dendrograms were generated to
compare communities. Parsimony and unifrac tests revealed that
there were no significant differences in clustering within the den-
drograms (data not shown). Since limited samples were available, it
was not possible to perform AMOVA, the test for molecular var-
iance, which requires replicates from a single type of sample.
4. Discussion
Scanning electron microscopy revealed no evidence of micro-
organisms associated with the brown spots. It is therefore apparent
that the original organism(s) responsible for these spots are no
longer alive. The detection of malic acid only in the brown spots but
not in the plaster indicated microbial involvement in the formation
of the spots. Many microorganisms, including fungi such as Asper-
gillus spp. (Peleg et al., 1988) and bacteria such as Arthrobacter and
Pseudomonas (Vyas and Gulati, 2009), can produce malic acid in the
environment; therefore, these findings suggest a microbiological
cause for the brown spots. In addition, P. chrysogenum isolated in
this study produced malic acid in vitro. It is likely that other mi-
croorganisms from the tomb can also produce malic acid under
similar conditions. This finding provides further evidence that the
brown spots are microbiological in origin. It is conceivable that
malic acid detected in the brown spots was produced by
microorganisms on the tomb walls under conditions in the tomb at
the time the brown spots were produced. Malic acid has been
detected in wine residues from ca. 2000 years ago, suggesting that
it can survive for many years (Pecci et al., 2013).
GC/MS analysis of the brown spots also demonstrated the
presence of amino acids such as glutamic acid and aspartic acid,
both of which were detected in previous studies on the brown spots
(Porta, 1992,2009;Arai, 2000). These amino acids are common
microbial metabolites (Chiou, 1997;Arai, 2000).
There were no significant differences in cultivable communities
from brown spots or outside of their periphery. The occurrence of
fungi such as Penicillium and Cladosporium and Gram positive
bacteria such as Bacillus has been recorded in previous studies
(Fahd, 1994;Szczepanowska and Cavaliere, 2004). In addition,
these genera are ubiquitous and have adapted to various lifestyles.
Molecular analysis of the fungal communities on the tomb walls
indicate that they are comprised of fungi such as Penicillium,
Aspergillus and Cladosporium, with Penicillium being the most
abundant genus. Penicillium is a ubiquitous fungus and its sapro-
phytic lifestyle has been studied in a variety of environments (Pitt,
2000). Its abundance in the tombs suggests that this organism has
adapted its lifestyle to the dry conditions existing in these tombs. In
an earlier study, Arai, who has extensively studied formation of
brown spots (foxing) on many materials (Arai, 1992,2000), suc-
ceeded in isolating a xerophilic microorganism, Aspergillus pen-
icilloides from brown spot samples in Tutankhamun’s tomb by using
a low water activity medium. He suggested that this and other
xerophilic microorganisms can cause foxing to occur by a non-
enzymatic browning reaction (Arai, 2000). In our investigation,
we detected Aspergillus in the burial chamber samples but not in the
samples from the treasury or the other two tombs. The fungal
communities in the burial chamber samples were more diverse
than in the treasury. This is likely due to the presence of visitors in
the antechamber and their proximity to the burial chamber as
compared with the treasury. There were no fungal OTUs that were
unique to either brown or non-brown spots, suggesting that fungal
communities are similar across both types of samples.
Among the bacterial communities on the tomb walls, the classes
Bacilli and Actinobacteria, were shared among all five bacterial
samples at 10% sequence difference. The former contains spore-
forming bacteria, which are usually able to withstand harsh condi-
tions such as drying and heat. Both of these classes were also rep-
resented in our culture-based study by Bacillus and Kocuria species.
DNA analysis demonstrated the presence of a diverse microbial
community on the walls. It is possible that some of the DNA is
ancient; however, it is likely that ancient DNA has been degraded to
the extent of being intractable using the methods employed in the
current study (Pääbo et al., 2004).
Table 3
Microbial community richness and diversity indices at 3% difference among sequences. Fungal and bacterial communities in pooled DNA samples were analyzed by pyro-
sequencing the 16S rRNA gene or the ITS region. Samples were separated according to location/tomb from which they were collected and the type of sample (brown/non-
brown).
Sample Sample Location/Tomb Library coverage Observed OTUs Chao richness Invsimpson
diversity index
BCAITS Brown spot Burial chamber/Tut 0.9935 13 23.5 1.9565
BCDITS Non-brown spot Burial chamber/Tut 0.9972 13 13.6 3.6671
RAMITS Non-brown spot Rameses III 1 4 4 1.0746
TAITS Brown spot Treasury/Tut 0.9972 8 11 1.9770
TDITS Non-brown spot Treasury/Tut 0.9991 3 3 1.1245
BCA16S Brown spot Burial chamber/Tut 0.9832 91 230 2.6635
BCD16S Non-brown spot Burial chamber/Tut 0.9895 59 144 2.4744
RAM16S Non-brown spot Rameses III 0.9892 59 149 1.4866
TA16S Brown spot Treasury/Tut 0.9856 87 171 2.2418
TD16S Non-brown spot Treasury/Tut 0.9898 70 105 3.4291
A. Vasanthakumar et al. / International Biodeterioration & Biodegradation 79 (2013) 56e6360
Author's personal copy
No significant differences were observed in the current micro-
bial communities associated with brown spots and areas outside
brown spots. This study also revealed that microbial communities
in nearby tombs are not different from those in Tutankhamun’s
tomb. The methods described herein facilitated the isolation of
a representative community of bacteria and fungi from the tombs
in the Valley of the Kings. Cultivable populations were low in all
these samples. It is possible that the hot and dry conditions in the
Valley of the Kings contribute to low populations.
Although this investigation provided information about the
dominant members of the modern microbial community, the
ability of specific isolates to produce brown spots similar to those
found in the tomb was not analyzed. Therefore, additional research
is required, including detailed chemical and microbial analysis to
further elucidate the origin and nature of the spots.
Because Tutankhamun’s tomb is the only one known to contain
the brown spots, it is very likely that they were formed under
conditions specific to the tomb. Howard Carter, who discovered the
0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
BCAITS BCDITS RamITS TAITS TDITS
Trametes
Eucasphaeria
Epicoccum
Amorphotheca and Cladosporium
Aspergillus
Malassezia et al.
Penicillium
Oidiodendron
0%
10%
20%
30%
40%
50%
60%
70%
80%
90%
100%
BCA16S BCD16S RAM16S TA16S TD16S
Erysipelotrichia
Clostridia
Thermolithobacteria
Flavobacteria
Deinococci
Deltaproteobacteria
Actinobacteria
Gammaproteobacteria
Betaproteobacteria
Alphaproteobacteria
Bacilli
Bacteroidia
Fig. 4. a: Composition of different genera of fungi based on partial sequencing of the ITS region of the ribosomal operon. Five samples are represented: two brown spot samples in
Tutankhamun’s tomb (BCAITS, TAITS), two non-brown samples (BCDITS, TDITS) and one sample from the Rameses tomb (RAMITS). b: Composition of different classes of bacteria
based on partial sequencing of the 16S rRNA gene. Five samples are represented: two brown spot samples in Tutankhamun’s tomb (BCA16S, TA16S), two non-brown samples
(BCD16S, TD16S) and one sample from the Rameses tomb (RAM16S).
A. Vasanthakumar et al. / International Biodeterioration & Biodegradation 79 (2013) 56e63 61
Author's personal copy
tomb, reported that some of the deterioration observed is indica-
tive of the existence of high humidity in the tomb following the
burial, and suggested that infrequent flooding had occurred in the
tomb (Carter and Mace, 1963). In addition, the tomb remained
almost entirely sealed until 1922, creating conditions that were
unlike those in any of the other tombs. With further collaborative
studies, it may be possible to develop a more definitive character-
ization of the conditions within the tomb that led to development
of the brown spots.
Acknowledgments
This research was carried out as a collaborative agreement be-
tween the Getty Conservation Institute and Egypt’s Supreme
Council of Antiquities. Scanning electron microscopy was per-
formed at the Center for Nanoscale Systems (CNS), a member of the
National Nanotechnology Infrastructure Network (NNIN), which is
supported by the National Science Foundation under NSF award
number ECS-0335765. CNS is part of Harvard University. The au-
thors wish to thank Nick Konkol, Chris McNamara, Marc Mittelman
and Federica Villa for insightful discussions, Conor O’Herin and
Felix Wu for technical assistance and the anonymous reviewers for
useful suggestions.
References
Abarenkov, K., Nilsson, H.R., Larsson, K.-H., Alexander, I.J., Eberhardt, U., Erland, S.,
Høiland, K., Kjøller, R., Larsson, E., Pennanen, T., Sen, R., Taylor, A.F.S.,
Tedersoo, L., Ursing, B.M., Vrålstad, T., Liimatainen, K., Peintner, U., Kõljalg, U.,
2010. The UNITE database for molecular identification of fungi erecent updates
and future perspectives. New Phytologist 186, 281e285.
Arai, H., 1992. Relationship between fungi and brown spots found in various ma-
terials. In: Proceedings of the 2nd International Conference on Biodeterioration
of Cultural Property, 5-8 October 1992 Yokohama Japan, pp. 320e336.
Arai, H., 2000. Foxing caused by fungi: twenty-five years of study. International
Biodeterioration and Biodegradation 46, 181e188.
Carter, H. unpublished. Tomb and Tomb Plan: Notes in Preparation for the Publi-
cation of the Tomb. Unpublished Manuscript Held by the Griffith Institute.
Source: The Getty Conservation Institute Publication.
Carter, H., Mace, A.C., 1963. The Main Cause of Deterioration and Chemical Changes
Among the Objects in the Tomb (Chapter V). In: Tomb of Tutankhamen, vol. III,
pp. 151e164.
Chiou, R.Y., 1997. Estimation of fungal infection of peanut kernels by determination
of free glutamic acid content. Applied and Environmental Microbiology 63,
1083e1087.
Dowd, S.E., Callaway, T.R., Wolcott, R.D., Sun, Y., McKeehan, T., Hagevoort, R.G.,
Edrington, T.S., 2008. Evaluation of the bacterial diversity in the feces of cattle
using 16S rDNA bacterial tag-encoded FLX amplicon pyrosequencing (bTEFAP).
BMC Microbiology 8, 125. http://dx.doi.org/10.1186/1471-2180-8-125.
Fahd, M., 1994. Biodeterioration of the mural paintings of the tomb of Tutankhamun
and its conservation. Zeitschrift fur Kunsttechnologie und Konservierung,
Wernersche Verlagsgellschaft 8, 143e146.
Horikoshi, K., 1998. Alkaliphiles. In: Horikoshi, K., Grant, W.D. (Eds.), Extremophiles;
Microbial Life in Extreme Environments. Wiley-Liss, New York, pp. 155e180.
Lane, D.J., 1991. 16S/23S rRNA sequencing. In: Stackebrandt, E., Goodfellow, M.
(Eds.), Nucleic Acid Techniques in Bacterial Systematics. John Wiley and Sons,
New York, pp. 115e175.
Lucas, A., 1923. Examination of Materials: (a) Tutankhamun; (b) Various. Unpub-
lished Manuscript in Collection of Griffith Institute, Oxford.
Lucas, A., 1963. The Chemistry of the Tomb, Appendix II. In: Tomb of Tutankhamun,
vol. II, pp. 162e166.
Ludwig, W., Strunk, O., Westram, R., Richter, L., Meier, H., Yadhukumar, Buchner, A.,
Lai, T., Steppi, S., Jobb, G., Forster, W., Brettske, I., Gerber, S., Ginhart, A.W.,
Gross, O., Grumann, S., Hermann, S., Jost, R., Konig, A., Liss, T., Lüßmann, T.,
May, M., Nonhoff, B., Reichel, B., Strehlow, R., Stamatakis, A., Stuckmann, N.,
Vilbig, A., Lenke, M., Ludwig, T., Bode, A., Schleifer, K.H., 2004. ARB: a software
environment for sequence data. Nucleic Acids Research 32, 1363e1371.
Pääbo, S., Poinar, H., Serre, D., Jaenicke-Després, V., Hebler, J., Rohland, N., Kuch, M.,
Krause, J., Vigilant, L., Hofreiter, M., 2004. Genetic analyses from ancient DNA.
Annual Review of Genetics 28, 645e679.
Pecci, A., Georgi, G., Salvini, L., Ontiveros, M.A.C., 2013. Identifying wine markers in
ceramics and plasters using gas chromatography-mass spectrometry. Exper-
imental and archaeological materials. Journal of Archaeological Science 40,
109e115.
Peleg, Y., Stieglitz, B., Goldberg, I., 1988. Malic acid accumulation by Aspergillus
flavus. Applied Microbiology and Biotechnology 28, 69e75.
Pitt, J., 2000. A Laboratory Guide to Common Penicillium Species. Food Science
Australia, North Ryde, NSW, Australia.
Porta, E., 1992. Announces of the Brown Stains found on the Paint Layers of the
Tombs of Tutankhamun, Unpublished Report Translated from Spanish in
Investigation and Treatment of Brown Spots in the Tomb of Tutankhamen: A
Summary and Compilation of articles. The Getty Conservation Institute, 2010.
Porta, E. 2009. The Stains on the Tutankhamen Tomb Walls Painting. Unpublished
Report in Investigation and Treatment of Brown Spots in the Tomb of Tutank-
hamen: A Summary and Compilation of Articles. The Getty Conservation
Institute, 2010.
Schilling, M.R., Khanjian, H.P., Souza, L.A.C., 1996. Gas chromatographic analysis of
amino acids as ethyl chloroformate derivatives. Part 1. Composition of Proteins
Associated with Art Objects and Monuments. Journal of the American Institute
for Conservation 35, 45e59.
Schloss, P.D., Westcott, S.L., Ryabin, T., Hall, J.R., Hartmann, M., Hollister, E.B.,
Lesniewski, R.A., Oakley, B.B., Parks, D.H., Robinson, C.J., Sahl, J.W., Stres, B.,
Thallinger, G.G., Van Horn, D.G., Weber, C.F., 2009. Introducing mothur: open-
source, platform-independent, community-supported software for describing
and comparing microbial communities. Applied and Environmental Micro-
biology 75, 7537e7541.
Schloss, P.D., Westcott, S.L., 2011. Assessing and improving methods used in
operational taxonomic unit-based approaches for 16S rRNA gene sequence.
Analysis Applied and Environmental Microbiology 77, 3219. http://dx.doi.org/
10.1128/AEM.02810-10.
Scott, A., 1963. Notes on objects from the tomb of King Tutankhamen, brown spots
on the painted walls of burial chamber. Appendix IV. In: Carter, Mace (Eds.),
Tomb of Tutankhamen, vol. II, pp. 200e202.
Szczepanowska, H.M., Cavaliere, A.R., 2004. Tutankhamun tomb: a closer look at
biodeterioration, preliminary report. In: Schimmel: Gefahr fur Mensch und
Kulturgut duruch Mikroorganismen (Fungi, A Threat for People and Cultural
Heritage through Microorganisms), 21-23 June, vol. 1. VDR Schriftenreihe,
Munchen, pp. 42e47.
Szczepanowska, H.M., Cavaliere, A.R., 2008. New molds in old tombs: the burial
chambers of Tutankhamun and Khufu. In: Proceedings of the 14th International
Biodeterioration andBiodegradationSymposium 6e11 October2008 Messina Italy.
Vyas, P., Gulati, A., 2009. Organic acid production in vitro and plant growth pro-
motion in maize under controlled environment by phosphate-solubilizing
Number of OTUs
Number of sequences sampled
BCAITS
BCDITS
TAITS
TDITS
RamITS
Number of OTUs
Number of se
q
uences sam
p
led
BCA16S
BCD16S
TA16S
TD16S
RAM16S
b
a
Fig. 5. a: Rarefaction curves of fungal communities in five pooled samples. Rarefaction
analysis was performed in mothur v.1.25.0. b: Rarefaction curves of bacterial com-
munities in five pooled samples. Rarefaction analysis was performed in mothur
v.1.25.0.
A. Vasanthakumar et al. / International Biodeterioration & Biodegradation 79 (2013) 56e6362
Author's personal copy
fluorescent Pseudomonas. BMC Microbiology 9, 174. http://dx.doi.org/10.1186/
1471-2180-9-174 (PMID:19698133).
Wang, Q., Garrity, G.M., Tiedje, J.M., Cole, J.R., 2007. Naïve Bayesian classifier for
rapid assignment of rRNA sequences into the new bacterial taxonomy. Applied
and Environmental Microbiology 73, 5261e5267. http://dx.doi.org/10.1128/
AEM.00062-07 (PMID: 17586664).
White, T.J., Bruns, T., Lee, S., Taylor, J., 1990. Amplification and direct sequencing of
fungal ribosomal RNA genes for phylogenetics. In: Innis, M.A. (Ed.), PCR pro-
tocols: a Guide to Methods and Applications. Academic Press, New York,
pp. 315e322.
Wong, L., 2010. Summary of the Investigation and Treatment of Brown Spots in the
Tomb of Tutankhamen. Unpublished Getty Conservation Institute Report.
A. Vasanthakumar et al. / International Biodeterioration & Biodegradation 79 (2013) 56e63 63
