Content uploaded by Marcus Karlstetter
Author content
All content in this area was uploaded by Marcus Karlstetter on Mar 04, 2014
Content may be subject to copyright.
Progressive Retinal Degeneration and Glial Activation in
the CLN6
nclf
Mouse Model of Neuronal Ceroid
Lipofuscinosis: A Beneficial Effect of DHA and Curcumin
Supplementation
Myriam Mirza
1,2
, Cornelia Volz
3
, Marcus Karlstetter
2
, Monica Langiu
4
, Aleksandra Somogyi
4
,
Mika O. Ruonala
4
, Ernst R. Tamm
5
, Herbert Ja
¨gle
2.
, Thomas Langmann
3
*
.
1Institute of Human Genetics, University of Regensburg, Regensburg, Germany, 2Department of Ophthalmology, University of Cologne, Cologne, Germany,
3Department of Ophthalmology, University of Regensburg, Regensburg, Germany, 4Center for Membrane Proteomics, University of Frankfurt am Main, Frankfurt am
Main, Germany, 5Institute of Human Anatomy and Embryology, University of Regensburg, Regensburg, Germany
Abstract
Neuronal ceroid lipofuscinosis (NCL) is a group of neurodegenerative lysosomal storage disorders characterized by vision
loss, mental and motor deficits, and spontaneous seizures. Neuropathological analyses of autopsy material from NCL
patients and animal models revealed brain atrophy closely associated with glial activity. Earlier reports also noticed loss of
retinal cells and reactive gliosis in some forms of NCL. To study this phenomenon in detail, we analyzed the ocular
phenotype of CLN6
nclf
mice, an established mouse model for variant-late infantile NCL. Retinal morphometry,
immunohistochemistry, optokinetic tracking, electroretinography, and mRNA expression were used to characterize retinal
morphology and function as well as the responses of Mu
¨ller cells and microglia. Our histological data showed a severe and
progressive degeneration in the CLN6
nclf
retina co-inciding with reactive Mu
¨ller glia. Furthermore, a prominent phenotypic
transformation of ramified microglia to phagocytic, bloated, and mislocalized microglial cells was identified in CLN6
nclf
retinas. These events overlapped with a rapid loss of visual perception and retinal function. Based on the strong microglia
reactivity we hypothesized that dietary supplementation with immuno-regulatory compounds, curcumin and
docosahexaenoic acid (DHA), could ameliorate microgliosis and reduce retinal degeneration. Our analyses showed that
treatment of three-week-old CLN6
nclf
mice with either 5% DHA or 0.6% curcumin for 30 weeks resulted in a reduced number
of amoeboid reactive microglia and partially improved retinal function. DHA-treatment also improved the morphology of
CLN6
nclf
retinas with a preserved thickness of the photoreceptor layer in most regions of the retina. Our results suggest that
microglial reactivity closely accompanies disease progression in the CLN6
nclf
retina and both processes can be attenuated
with dietary supplemented immuno-modulating compounds.
Citation: Mirza M, Volz C, Karlstetter M, Langiu M, Somogyi A, et al. (2013) Progressive Retinal Degeneration and Glial Activation in the CLN6
nclf
Mouse Model of
Neuronal Ceroid Lipofuscinosis: A Beneficial Effect of DHA and Curcumin Supplementation. PLoS ONE 8(10): e75963. doi:10.1371/journal.pone.0075963
Editor: Anand Swaroop, National Eye Institute, United States of America
Received May 23, 2013; Accepted August 19, 2013; Published October 4, 2013
Copyright: ß2013 Mirza et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This study was supported by the NCL foundation, the Auerbach foundation, the NCL group Germany, the Stock foundation, and the DFG (LA1203/6-2
and 8-1). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: thomas.langmann@uk-koeln.de
.These authors contributed equally to this work.
Introduction
Neuronal ceroid lipofuscinoses (NCL) are a group of inherited
progressive neurodegenerative lysosomal storage disorders with a
frequency of 7–8 in 100,000 live births worldwide [1,2]. Mutations
in at least thirteen CLN genes give rise to different forms of NCL
with different onset and clinical course of the disease [3–5]. A
general hallmark of all NCL subtypes is the accumulation of
autofluorescent material in neurons causing progressive degener-
ation and tissue atrophy [6]. This results in clinically common
features shared by all NCL disorders, including visual impairment,
mental and motor deficits, spontaneous seizures and premature
death [7]. The ocular pathology in patients with the infantile type
of NCL showed a complete disappearance of photoreceptors,
bipolar cells and ganglion cells of the retina along with a marked
reactive gliosis also indicating severe retinal degeneration and glial
reactions in some forms of NCL [8].
The CLN6 gene encodes a transmembrane protein of unknown
function and mutations cause the variant-late infantile form of
NCL (vLINCL) as well as an adult form termed Kufs disease [9–
11]. A naturally occurring mouse model CLN6
nclf
contains a
frameshift truncation in both nclf genes [9]. Histological studies in
the brain of these mice showed progressive astrocyte activation
and microgliosis [12,13] but little is known about the ocular
phenotype and immune responses in the retina. Glial activation
has also been described in the brain of a CLN6
nclf
sheep model
[14] as well as other NCL models [15], indicating that
inflammation and glial processes are another hallmark of NCL.
However, it is currently unknown whether the modulation of
microglial response can affect disease progression.
PLOS ONE | www.plosone.org 1 October 2013 | Volume 8 | Issue 10 | e75963
There is a growing interest in the identification of natural
compounds to limit neuroinflammation and simultaneously
support neuronal survival [16]. Among the naturally occurring
immunomodulators, curcumin ((E,E)-1,7-bis(4-hydroxy-3-methox-
yphenyl)-1,6-heptadiene-3,5-dione), a major constituent of tumer-
ic, inhibits the defense program of microglia by diminishing the
production of nitric oxide and secretion of proinflammatory
cytokines [17,18]. Docosahexaenoic acid (DHA, 22:6n-3), a
polyunsaturated fatty acid enriched in fish oil also dampens
microglial nitric oxide production [19] and attenuates microglial
reactivity in a mouse model of inherited retinal degeneration [20].
For the purpose of our studies, we used the CLN6
nclf
mouse
retina as a model to study disease progression and therapeutic
effects of immunomodulatory compounds. We comprehensively
characterized the retinal degeneration of these mice using
histology, immunohistochemistry, optokinetic measurements, elec-
troretinography and glial marker expression. These analyses
identified a progressive early retinal degeneration in CLN6
nclf
mice coinciding with prominent microglial and Mu¨ller cell
response. In a therapy study, CLN6
nclf
mice supplemented with
curcumin or DHA showed improved retinal function as well as
attenuated microglial reactivity. These data suggest that immuno-
modulatory compounds may play a protective role in NCL.
Materials and Methods
Animals
Wild-type and CLN6
nclf
mice were all on a C57BL/6J
background. CLN6
nclf
mice and control mice were kindly provided
by Prof. Klaus Ru¨ther (Sankt Gertrauden-Krankenhaus Berlin).
Animals were maintained in an air-conditioned environment on a
12-hour light–dark schedule at 22uC, and had free access to food
and water. The health of the animals was regularly monitored, and
all procedures were approved by the University of Regensburg
animal rights committee and complied with the German Law on
Animal Protection and the Institute for Laboratory Animal
Research Guide for the Care and Use of Laboratory Animals,
2011. Animals were tested for the presence of the rd8/Crb1
mutation as described previously [21].
Microscopy
Before enucleation, eyes were branded on the superior limbus.
Eyes were fixed for 24h in Ito’s fixative and embedded in Epon
(Serva, Heidelberg, Germany). Sections 1 mm in thickness were
cut along the nasal-temporal plane and stained with fuchsin/
methylene blue for morphometric analyses using light microscopy.
Immunohistochemial analyses were performed on 10 mm retinal
sections embedded in optimal cutting temperature (OCT)
compound (Hartenstein, Wuerzburg, Germany) or retinal flat
mounts. Samples were fixed in 4% paraformaldehyde, rinsed and
rehydrated with PBS. Sections were blocked with a dried milk
solution followed by an overnight incubation with primary
antibodies at 4uC. Antibodies included rabbit anti-Iba1 antibody
(diluted 1:500; Wako Chemicals, Neuss, Germany) and rabbit
anti-GFAP antibody (diluted 1:600; Sigma-Aldrich). After wash-
ing, samples were labeled with a secondary antibody conjugated to
Alexa488 (Jackson Immuno-Research, West Grove, PA, USA) and
counter-stained with DAPI. Sections were mounted in DAKO
fluorescent mounting medium (Dako Cytomation GmbH, Ham-
burg, Germany) and viewed with Axioimager Z1 Apotome
Microscope (Carl Zeiss, Goettingen, Germany). Flat mounts were
mounted and viewed with Axioimager Z2 Apotome Microscope
(Carl Zeiss, Goettingen, Germany) using z-stacks of inner and
outer plexiform layers as indicated by fluorescent sidebars. The
microglial phenotype in wild-type and food supplemented
CLN6
nclf
mice was determined by quantification of ramified and
amoeboid microglial cells in nine different flat mount areas.
Behavioral Studies
Optokinetic tracking was assessed as a predictor of visual acuity
using a virtual optomotor system (Optomotry, Cerebral Mechan-
ics, Lethbridge, Alberta, Canada) as described previously [22,23].
Briefly, freely moving animals were exposed to moving sine wave
gratings of various spatial frequencies and reflexively tracked the
gratings by head movements. An automated staircase paradigm
adjusted the spatial frequency of the rotating pattern on
subsequent trials until a threshold was achieved. The OKT
threshold was defined as the highest spatial frequency obtained at
100% contrast.
Rotarod experiments assessing motor neuron and cognitive
difficulties were performed on age-matched wild-type and
CLN6
nclf
mice using an accelerating Rotarod (PanLab/Harvard
Apparatus, Holliston, MA). The rotarod started at 4 rpm and
accelerated to 40 rpm over 60 seconds. The latency time to fall off
was determined. Experiments were performed three times for each
mouse with 15 minute resting time in between. The same
experiment was carried out on two subsequent days to have a
training effect. The latency time was then normalized to day 1
wild-type animals.
Electroretinography
Mice were dark adapted for at least 12 hours before the
experiments and subsequently anesthetized by subcutaneous
injection of ketamine and xylazine. Pupils were dilated with
tropicamide eyedrops (Mydriaticum Stulln; Pharma Stulln,
Germany). Silver needle electrodes served as reference (fore-head)
and ground (tail) and gold wire ring electrodes as active electrodes.
Corneregel (Bausch & Lomb, Berlin, Germany) was applied to
keep the eye hydrated and maintain good electrical contact. ERGs
were recorded using a Ganzfeld bowl (Ganzfeld QC450 SCX,
Roland Consult, Brandenburg, Germany) and an amplifier &
recording unit (RETI-Port, Roland Consult, Brandenburg,
Germany). ERGs were recorded from both eyes simultaneously,
band-pass filtered (1 to 300 Hz) and averaged. Single flash
scotopic (dark adapted) responses to a series of ten LED-flash
intensities ranging from 23.5 to 1.0 log cd.s/m
2
with an inter
stimulus interval of 2 s up to 20 s for the highest intensity were
recorded. Response waveforms were analyzed by means of
through and peak amplitude and implicit time measurement. All
analysis and plotting was carried out with R 2.15.2 and gplot 0.9.2.
Table 1. Primer pairs and Roche library probes used for real-
time qRT-PCR.
Gene F-Primer (59-39) R-Primer (59-39) Probe
ATP5B ggcacaatgcaggaaagg Tcagcaggcacatagatagcc 77
C1Qa ggagcatccagtttgatcg Catccctgagaggtctccat 16
CD95 aaaccagacttctactgcgattct Gggttccatgttcacacga 76
EDN2 tggcttgacaaggaatgtgt Gccgtagggagctgtctgt 29
EGR1 ccttccagggtctggagaa Actgagtggcgaaggcttta 3
GFAP acagactttctccaacctccag Ccttctgacacggatttggt 64
NCLF ggcgaagaaggtgaagatga Agagccacatgccaggac 104
doi:10.1371/journal.pone.0075963.t001
Retinal Degeneration in CLN6
nclf
Mice
PLOS ONE | www.plosone.org 2 October 2013 | Volume 8 | Issue 10 | e75963
RNA Isolation and Reverse Transcription
Total RNA was extracted from total retina according to the
manufacturer’s instructions using the RNeasy Mini Kit (Qiagen,
Hilden, Germany). Purity and integrity of the RNA was assessed
on the Agilent 2100 bioanalyzer with the RNA 6000 Nano
LabChipHreagent set (Agilent Technologies, Boeblingen, Ger-
many). The RNA was quantified spectrophotometrically and then
stored at 280uC. First-strand cDNA synthesis was performed with
RevertAid
TM
H Minus First Strand cDNA Synthesis Kit
(Fermentas. St-Leon-Roth, Germany).
Quantitative Real-time RT-PCR
Amplifications of 50 ng cDNA were performed with an
ABI7900HT machine (Applied Biosystems, Darmstadt, Germany)
in 10 ml reaction mixtures containing 16TaqMan Universal PCR
Master Mix (Applied Biosystems), 200 nM of primers and 0.25 ml
of dual-labeled probe (Roche ProbeLibrary, Roche Applied
Science, Mannheim, Germany). The reaction parameters were
as follows: 2-min 50uC hold, 30-min 60uC hold, and 5-min 95uC
hold, followed by 45 cycles of 20-s 94uC melt and 1-min 60uC
anneal/extension. Measurements were performed in duplicates.
Results were analyzed with an ABI sequence detector software
version 2.3 using the DDCt method for relative quantification and
ATP5B as stable reference gene [24]. A Ct (cycle threshold) value
of 35 was used as a cutoff for estimating significantly expressed
transcripts. Primer sequences and Roche Library Probe numbers
are listed in Table 1.
Supplementation Study
Experimental mouse diets were ordered from SSNIFF Spezial-
dia¨ten GmbH (Soest, Germany) consisting of standard mouse diet
EF-M (control) without (control) or with either 0.6% Curcumin
(99% Pure, ChemHome, Shanghai Honghao Chemicals Co.,Ltd.,
Shanghai, China) or 5% DHA (DHASCO-T containing 40%
DHA, Martek Biosciences Corporation, Columbia, MD, USA).
Mice (n = 12) started receiving supplement diets immediately after
weaning (post natal day 21–23) for the next 30 weeks. Body
weights were measured on a weekly basis for the duration of the
Figure 1. CLN6
nclf
mice show progressive degeneration, lipofuscin accumulation, and microglial reactivity in the retina. A.
Histological changes in retinal sections from 8 month old wild-type mice compared to different ages of CLN6
nclf
mice using fuchsin/methylene blue
staining. B. Immunolabeling of reactive Mu
¨ller cells in wild-type and aging CLN6
nclf
retinas using anti-GFAP antibody. C. Staining of microglial cells
with anti-Iba1 antibody. D. Autofluorescent lipofuscin accumulation in wild-type and CLN6
nclf
retinas. E. Merged images of anti-Iba1 immunolabelling
with autofluorescent lipofuscin deposits. Arrow heads indicate co-localization of lipofuscin with amoeboid microglial cells. F. Anti-Iba1 labeled retinal
flat-mounts reveal different microglial morphologies in wild-type and CLN6
nclf
retinas. The thickness of the flat-mount is indicated on the sides of the
images. OS, outer segments; IS, inner segments; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer.
Scale bar, 50 mm.
doi:10.1371/journal.pone.0075963.g001
Retinal Degeneration in CLN6
nclf
Mice
PLOS ONE | www.plosone.org 3 October 2013 | Volume 8 | Issue 10 | e75963
study and found to be similar between supplementation and
control groups.
Statistical Analyses
RT-PCR data from different mouse ages, quantification of
retinal layer thickness, optokinetic tracking results and ERG
experiments were analyzed using a two-way ANOVA with
Bonferroni post-test. Rotarod experiments were analyzed using a
Kruskal-Wallis ANOVA. Microglia quantification was analyzed
with an unpaired two-tailed T-test. P#0.05 was considered as
statistically significant.
Results
Progressive Degeneration, Lipofuscin Accumulation, and
Glial Activation in the CLN6
nclf
Retina
To characterize the temporal retinal degeneration and glial
activation in CLN6
nclf
mice we studied animals at different ages
ranging from one to eight months. Histological analyses showed a
progressive degeneration of all retinal layers in CLN6
nclf
mice
compared to wild-type controls (Fig. 1A). At eight months of age,
the photoreceptor cell layer in particular was severely compro-
mised in CLN6
nclf
retinas with only a few rows of cell nuclei
remaining (Fig. 1A). We next used GFAP to assess the Mu¨ ller glial
status in the retina of control and CLN6
nclf
mice. While wild-type
eight month old mice had some filamentous but mostly end-feet
GFAP and/or astrocyte staining, CLN6
nclf
mice had a markedly
Figure 2. Age-dependent thinning of retinal and photoreceptor layers in CLN6
nclf
retinas. Anterior and posterior retinal areas were
divided into ten sections with the optic nerve head as reference. A. Quantification of whole retinal thickness of CLN6
nclf
retinas compared to wild-type
controls (mean 6SD). B. Quantification of photoreceptor layer thickness compared to wild-type controls (mean 6SD). *p,0.05; **p,0.01;
***p,0.001 CLN6
nclf
vs. age-matched wild-type mice, n = 4 animals per age group, two-way ANOVA followed by Bonferroni post-test.
doi:10.1371/journal.pone.0075963.g002
Retinal Degeneration in CLN6
nclf
Mice
PLOS ONE | www.plosone.org 4 October 2013 | Volume 8 | Issue 10 | e75963
increased GFAP expression as indicated by intensely stained
filamentous structures spanning all retinal layers starting at one
month of age (Fig. 1B). Increased GFAP expression at early ages in
CLN6
nclf
mice indicates reactive Mu¨ller cell gliosis as a prominent
early event in retinal degeneration. Retinal sections were also
stained with the microglia marker Iba1 to assess changes in
microglial morphology and migration into different layers
(Fig. 1C). Resident, non-alerted microglial cells usually reside in
a ramified form in both plexiform layers as seen in the wild-type
control (Fig. 1C). In contrast, one month old CLN6
nclf
retinas
already had amoeboid microglia cells with protrusions reaching
into the nuclear cell layers. This effect was even more prominent
in four, six, and eight month old CLN6
nclf
retinas with bloated
microglia infiltrating the nuclear layers. The lipofuscin deposits
visible in photoreceptor and inner-retinal layers of one month old
CLN6
nclf
mice constantly increased in size and number with age
(Fig. 1D). Interestingly, the colocalization of autofluorescent
lipofuscin deposits with alerted phagocytic microglial cells suggests
that these cells phagocytose significant amounts of storage material
(Fig. 1E, arrow heads). To further confirm the morphological
transition of ramified microglia cells into large phagocytes retinal
flat-mounts were stained with Iba1. While in retinas from wild-
type mice a highly ramified microglia network was evident (Fig. 1F)
those from one month old CLN6
nclf
retinas already showed a
mixed population of ramified and phagocytic microglia. As the
mice aged, the cells became rounder in shape with shorter
protrusions, indicating a loss of the ramified network structure and
an altered state (Fig. 1F).
In order to quantify the retinal degeneration observed,
morphometric analyses of the whole retina and the photoreceptor
layer were performed. Whole retinal measurements indicated that
changes occurred in the central retina already in one month old
CLN6
nclf
mice, an effect that spreads steadily with disease
progression across the whole retina (Figure 2A). Of note, a
significant decrease in thickness of the photoreceptor layer became
evident at four months and thus correlates with the changed
microglia phenotype (Figure 2B).
Progressive Visual Decline in Aging CLN6
nclf
Mice
We next studied the visual performance of CLN6
nclf
mice using
optokinetic tracking (OKT). OKT is a good predictor of visual
acuity when measuring reflexive head tracking to moving gratings
Figure 3. Aging CLN6
nclf
mice show a progressive reduction in visual function which is independent from motor deficits. A. Temporal
changes in optokinetic tracking thresholds (cycles/degree) in CLN6
nclf
and wild-type mice 6SD. ***p,0.001, n = 12 animals per age group, two-way
ANOVA followed by Bonferroni post-test. B. Rotarod performance of wild-type and CLN6
nclf
mice aged 4, 6 and 8 months. Data was normalized to the
performance of day 1 wild-type mice 6SD. ***p,0.001, n = 6–15 animals per age group, Kruskal-Wallis ANOVA. C-E. Dark adapted (scotopic) ERG
response amplitudes, implicit times and b/a-wave amplitude ratios of age-matched wild-type and CLN6
nclf
mice. Each symbol represents the mean of
three animals 6SEM. For the brightest flash intensity, mean amplitude values of CLN6
nclf
mice and age-matched controls were compared with
ANOVA. a-wave: 1 month: p= 0.0048, 2 months: p= 0.0005, 3 to 8 months: p,0.0001. b-wave: 1 month: p= 0.245, 2 months: p= 0.059, 3 to 8 months:
p,0.0001.
doi:10.1371/journal.pone.0075963.g003
Retinal Degeneration in CLN6
nclf
Mice
PLOS ONE | www.plosone.org 5 October 2013 | Volume 8 | Issue 10 | e75963
using stairway changes in spatial frequency. Wild-type mice had a
stable maximal OKT threshold at 0.3 c/d (Fig. 3A). CLN6
nclf
mice
also showed normal OKT thresholds up to four months of age.
However, starting at five months of age, CLN6
nclf
mice appeared
to have a significant and rapid decline in OKT thresholds with
0.05 c/d by eight months of age (Fig. 3A). The larger variability of
OKT thresholds in older animals most likely reflects variable
disease progression in different CLN6
nclf
mice.
To verify that the progressive decline in OKT readings and
visual acuity was indeed due to vision loss and not motor-neuron
deficits or cognitive difficulties, we performed rotarod experiments
as three repeated trials per day with each mouse for two
consecutive days (Fig. 3B). Four and six month old wild-type as
well as CLN6
nclf
mice showed approximately equal rates of
improvement in latency times, indicating that they learned equally
well to stay longer on the rotarod on the second day of analysis. At
eight months of age, wild-type animals also showed improved
latency times whereas no enhancement was observed with eight
month old CLN6
nclf
mice. This indicates a reduction in cognitive
function and/or motor impairment in CLN6
nclf
mice later than 8
months of age. Together these results support the hypothesis that
the decrease in OKT measurements from four to six months seen
in CLN6
nclf
mice results from a loss of visual acuity and is not
severely affected by motor problems.
To complement the OKT experiments, we performed dark
adapted (scotopic) ERG measurements as an independent measure
of retinal function. Rod photoreceptor function (a-wave) and inner
retinal function (b-wave) were both determined for wild-type and
CLN6
nclf
mice (Fig. 3 C–E). The a-wave amplitude significantly
decreased in CLN6
nclf
mice starting at one month of age followed
by the b-wave at three months of age (Fig. 3C). The amplitude loss
of both components in CLN6
nclf
mice was even more pronounced
at higher ages. As expected, the response amplitude of wild-type
mice showed only a mild descent until the age of eight months.
Early Stress Response and Inflammatory Marker
Transcripts in Degenerating CLN6
nclf
Retinas
We next used quantitative real-time RT-PCR to address the
question whether the progressive retinal degeneration in CLN6
nclf
mice can be associated with cell death, stress response and
inflammation. First, NCLF mRNA levels were determined to
study a potential nonsense-mediated decay of mutant mRNA.
NCLF transcript levels were significantly reduced in CLN6
nclf
retinas (Fig. 4A) starting as early as one month of age indicating
active ER-stress pathways in mutant cells. Also nonsense-mediated
decay has been described in other NCL models [25] and the high
expression of CD95 (alias Fas receptor) in our mouse model is
indicative for constant apoptosis (Fig. 4B). The mRNA levels for
GFAP in reactive Mu¨ller cells were increased five to ten fold in
CLN6
nclf
mice at all ages (Fig. 4C) and correlates with our
immunohistochemical analyses (above in Fig. 1B). Expression
levels of the photoreceptor stress marker endothelin 2 (EDN2) and
microglia markers complement C1q subunit a (C1qa) and early
growth response 1 (EGR1) were also assessed. Both EDN2 and
C1qa were strongly up-regulated in CLN6
nclf
retinas, indicating a
prominent stress response at all ages (Fig. 4D–E). EGR1 transcript
levels were also increased in CLN6
nclf
retinas but only as of four
months of age. These experiments suggest that retinal degener-
ation in CLN6
nclf
retinas follows a temporally ordered sequence of
very early cell stress and concomitant microglial response.
Figure 4. Early induction of stress response and glial marker transcripts in degenerating CLN6
nclf
retinas. A-F. Quantitative real-time RT-
PCR expression analysis of CLN6
nclf
retinas compared to age-matched wild-type controls. Relative mRNA levels were analyzed for NCLF (A), CD95 (B),
GFAP (C), EDN2 (D), C1Qa (E), and EGR1 (F). mRNA expression was normalized to the reference gene ATP5B and graphed relative to age-matched
wild-type (6SD). *p,0.05; **p,0.01; ***p,0.001, n = 7–10 animals per age, two-way ANOVA followed by Bonferroni post test.
doi:10.1371/journal.pone.0075963.g004
Retinal Degeneration in CLN6
nclf
Mice
PLOS ONE | www.plosone.org 6 October 2013 | Volume 8 | Issue 10 | e75963
Ramified Microglia and Improved Retinal Morphology in
Curcumin and DHA-supplemented CLN6
nclf
Mice
We next assessed whether a dietary supplementation of
CLN6
nclf
mice with the immunomodulatory compounds curcumin
and DHA could attenuate microglial reactivity and retinal
degeneration. Three week old CLN6
nclf
mice received either
control chow or chow supplemented with 0.6% curcumin or 5%
DHA for 30 weeks starting directly after weaning. The histological
comparison of cross sections revealed that DHA-supplemented
retinas appeared to have a preserved structure of the photorecep-
tor layer (Fig. 5A, black bars), but the extent of Mu¨ller cell
reactivity was not changed (Fig. 5B). The localization of microglia
and lipofuscin deposits was also comparable in control-fed and
supplemented mice (Fig. 5C). Exemplified flat mount analyses of
microglial morphology then indicated that the amoeboid pheno-
type observed in control CLN6
nclf
mice was reduced in curcumin
and DHA-treated animals compared to control-fed animals
(Fig. 5D). We then performed a quantitative analysis of microglial
cell numbers for the ramified and amoeboid phenotypes,
respectively. We first noticed that the normal situation of mostly
ramified cells in the retina of wild-type mice was completely
reversed in control-treated CLN6
nclf
mice (Fig. 5E). The fraction of
amoeboid cells was strongly increased in CLN6
nclf
mice and the
presence of this cell population was significantly suppressed in
curcumin and DHA-treated CLN6
nclf
retinas (Fig. 5E). Conversely,
there was a tendency that the amount of ramified microglial cells
was increased when CLN6
nclf
mice received supplementation with
curcumin or DHA (Fig. 5E).
In our preliminary analysis we noted a potentially preserved
retinal morphology in curcumin and DHA-supplemented CLN6
nclf
mice (Fig. 5A). To relate this observation with the applied
treatment we performed a detailed quantitative analyses of the
total retinal thickness, the outer nuclear layer thickness, and the
photoreceptor layer thickness in all groups. Curcumin-supple-
mented retinas had approximately the same total thickness of the
total retina, the ONL and the photoreceptor layer as control
retinas (Fig. 6). In DHA-fed CLN6
nclf
mice, the total retinal
thickness was not changed significantly (Fig. 6A), the ONL was
significantly thicker in some regions of the retina (Fig. 6B) and the
photoreceptor layer was thicker in most retinal regions analyzed
(Fig. 6C). These data indicate that both curcumin and DHA affect
the microglial network in CLN6nclf retinas but that only DHA
leads to a significant preservation of the retinal structure.
Improved Visual Function in Curcumin and DHA-
supplemented CLN6
nclf
Mice
Dietary supplementation of CLN6
nclf
mice with curcumin and
DHA resulted in significantly higher visual acuity compared to
control CLN6
nclf
mice starting at three months of age (Fig. 7A). In
addition, curcumin and DHA supplemented animals showed
significantly higher amplitudes of ERG-responses recorded at
seven months of age (Fig. 7B). This indicates a preservation of
photoreceptor (a-wave) and inner retinal function (b-wave)
(Fig. 7B). For DHA-treated animals, implicit times for a- and b-
waves were shorter for higher flash intensities being consistent with
less severe retinal degeneration (Fig. 7C).
Discussion
Decline of visual perception is an early symptom in most forms
of human NCL, indicating that the retina is highly vulnerable to
NCL pathologies [6]. In this study, we carefully characterized the
ocular phenotype in the well-established CLN6
nclf
mouse model of
variant late infantile NCL. We found a progressive retinal
degeneration along with gliosis and microglial reactivity which
may contribute to disease progression. A supplementation study
with curcumin and DHA changed the microglial phenotype to a
less amoeboid and improved retinal function in CLN6
nclf
mice.
Initial studies done by Bronson et al. identified an accumulation
of autofluorescent deposit and loss of cell layers in the ONL of the
CLN6
nclf
[12]. Our morphometric histological data showed that
the degeneration of the outer retina was preceding cell death in the
inner retina, which implicates that photoreceptor cells were very
early affected during disease progression. We also noticed early
diminished ERG responses, which could reflect the retinal
thinning and quantitative cell loss. However, whereas ERG
Figure 5. CLN6
nclf
mice supplemented with 0.6% curcumin or
5% DHA for 30 weeks after weaning display ramified retinal
microglia. A. Histological comparison of control animals and food-
supplemented retinas. B. Immunolabeling of Mu
¨ller cells with anti-GFAP
antibody C. Staining of microglial cells with anti-Iba1 antibody and
detection of autofluorescent lipofuscin accumulation in CLN6
nclf
retinas.
D. Anti-Iba1 labeled retinal flat mounts detect the morphology of
microglia in control retinas and food-supplemented retinas. The
thickness of the flat-mount is indicated on the sides of the image.
Scale bar, 50 mm. E. Quantification of ramified and amoeboid microglial
cells in nine independent image areas of three individual flat mounts
(mean 6SEM). *p,0.05; **p,0.01; ***p,0.001, n = 3 animals per
group, unpaired two-tailed T-test.
doi:10.1371/journal.pone.0075963.g005
Retinal Degeneration in CLN6
nclf
Mice
PLOS ONE | www.plosone.org 7 October 2013 | Volume 8 | Issue 10 | e75963
Figure 6. DHA-supplemented CLN6
nclf
retinas have a thicker ONL and photoreceptor layer. Anterior and posterior retinal areas were
divided into ten sections with the optic nerve as reference. A. Quantification of whole retinal thickness of curcumin and DHA-supplemented versus
control retinas (mean 6SD). B. Quantification of the ONL (mean 6SD). C. Quantification of the photoreceptor layer (mean 6SD) *p,0.05; **p,0.01;
***p,0.001 CLN6
nclf
vs. age-matched wild-type mice, n = 5 animals per age group, two-way ANOVA followed by Bonferroni post-test.
doi:10.1371/journal.pone.0075963.g006
Retinal Degeneration in CLN6
nclf
Mice
PLOS ONE | www.plosone.org 8 October 2013 | Volume 8 | Issue 10 | e75963
responses were already impaired at one month of age, OKT
threshold changes were only significant from five months of age
onwards. The phenomenon of disconcordant electrophysiological
and visual behavioral profiles has been recently described in
mutant rhodopsin transgenic rats [26]. Our rotarod experiments
showed that the locomotor function of CLN6
nclf
mice was
relatively normal at four months of age but was significantly
impaired at eight months of age. These data are in good
agreement with a recent report that showed reduced motor
function in CLN6
nclf
mice from 34 weeks of age onwards using
rotarod and grip strength tests [27].
In contrast to the rapidly declining amplitudes of a- and the b-
waves in CLN6
nclf
mice, CLN3
Dex7–8
animals, a model for juvenile
NCL, have relatively normal scotopic ERGs until nine months of
age, indicating a late onset retinal degeneration [28]. In the
PPT1
2/2
(CLN1) mouse model of infantile NCL, only moderate
changes in ERG response were identified [29]. Therefore, we
conclude that CLN6
nclf
mice show the most severe and progressive
decline in visual function among the NCL mouse models tested so
far.
Our analysis of Mu¨ller glia by GFAP staining and analysis of
mRNA expression showed early activation already present at one
month and progressively increasing with age. This is considerably
earlier than GFAP staining of astrocytes in CLN6
nclf
cerebral
cortices, which appeared between five to six months of age
[12,13]. Therefore, gliosis associated with neuronal degeneration
in the CLN6
nclf
mouse seems to occur in the eye before the brain.
Iba1 detection of microglial cells in retinal sections and flat-mounts
demonstrated a mixed population of alerted microglia at one
month of age which became a homogeneous group of amoeboid
microglia by four months. Alerted microglial cells also contained
autofluorescent granules at all ages examined, which could reflect
phagocytic processes of dying neurons affected by lysosomal
storage of ceroid lipofuscin. Studies in CLN6
nclf
and PPT1
2/2
mutant mouse brain show that reactive microglia and astrocytes
may induce localized damage in the brain [30]. Since lipofuscin
deposits are equally distributed in the retina, these results suggest
that lipofuscin is not the trigger for microglial cells. The trigger
may rather be stress signals sent from neurons to the glial cells.
Induction of the microglial markers C1Qa at all ages or EGR1
starting at four months were also accompanied by strong up-
regulation of EDN2, a secreted factor of stressed photoreceptors
[31]. We also identified increased expression of the apoptosis
transcript marker CD95. However, tunnel stains of CLN6
nclf
retinas revealed one or two cells undergoing apoptosis at any given
time further confirming the presence of low-grade progressive
degeneration (data not shown).
Another interesting aspect of the pathology is the significantly
reduced mRNA expression of CLN6 in the CLN6
nclf
retina. A
50% or more reduction of retinal CLN6 expression was noticed in
our study at all time points analyzed and we hypothesized that this
phenomenon reflects nonsense-mediated decay. Consistent with
our data, Kanninen et al. recently identified a reduced but not
absent expression of CLN6 in the CLN6
nclf
eye at 12 and 24 weeks
of age, which was linked to an accumulation of biometals in the
CNS [27]. 30–40% reduced CLN6 mRNA levels were also
identified in the developing and adult brain of CLN6
nclf
mice [32]
as well as in immortalized brain cells from young CLN6
nclf
animals
[33]. A related observation of reduced CLN6 mRNA was made in
the South Hampshire sheep model of CLN6 disease [34]. Of note,
the same frame-shift mutation (c.307insC) is found in CLN6
nclf
mice and human CLN6 patients. Cell culture expression studies
with mutant CLN6 revealed that the decrease in CLN6 transcripts
caused a corresponding decrease in protein levels [35]. Nonsense-
mediated decay has also been reported for CLN1, CLN2, and
CLN3 and a potential therapeutic option could be treatment with
read-through drugs that enhance protein function.
Studies done by Groh et al, in which lymphocytes were
inactivated in PPT1
2/2
mice, showed a substantial disease
attenuation, unequivocally defining immune cells as pathogenic
mediators in infantile NCL [15]. Moreover, pharmacological and
genetic suppression of the immune system in the CLN3
2/2
mouse
model of juvenile NCL resulted in improved motor performance
[36]. Since reactive microglia have also been previously identified
in CLN6
nclf
sheep brain [14] as well as in human cortical biopsies
from CLN3 patients [1], targeting the immune system and by
extension, inflammation, could be one option for therapeutic
intervention.
Several natural compounds exist which can target microglial
pathways whilst supporting neuronal survival. Curcumin is a
herbal medicine which has been used for centuries in India and
China [37]. Curcumin has been shown to block the production of
Figure 7. Curcumin and DHA-supplemented CLN6
nclf
mice have
better visual acuity and ERG measurements compared to
control CLN6
nclf
mice. A. Mice supplemented with curcumin and
DHA had higher optokinetic tracking thresholds starting at 3 months of
age (mean 6SD). *p,0.05; **p,0.01; ***p,0.001, n = 12 animals per
age group, two-way ANOVA followed by Bonferroni post-test. B. Dark
adapted ERG responses recorded at 7 months of age show higher a-
wave amplitudes for higher flash intensities and higher b-wave
amplitudes for almost all flash intensities for supplemented mice
(two-way ANOVA for the amplitudes of the highest flash intensity: a-
wave: p= 0.002 and p,0.0001, b-wave: p= 0.028 and p= 0.009 for
curcumin and DHA, respectively). While a-wave implicit times did not
differ for curcumin, the DHA implicit time was shorter for higher flash
intensities. B-wave implicit times of responses to higher flash intensities
were shorter for supplemented mice (a-wave: p= 0.77 and p= 0.0002, b-
wave: p= 0.0004 and p,0.0001).
doi:10.1371/journal.pone.0075963.g007
Retinal Degeneration in CLN6
nclf
Mice
PLOS ONE | www.plosone.org 9 October 2013 | Volume 8 | Issue 10 | e75963
nitric oxide [17], to reduce the secretion of proinflammatory
cytokines [18], and to protect dopaminergic neurons against
microglia-mediated neurotoxicity [38]. Curcumin supplementa-
tion also showed functional and structural protection of photore-
ceptors against acute light damage in rats along with decreased
inflammatory gene expression [39].
DHA is highly enriched in the retina and is a precursor for
neuroprotectin D1, promoting the survival of photoreceptors and
RPE cells [40]. Moreover, it has recently been shown that DHA
can inhibit the synthesis of inflammatory products in microglia
allowing better survival of neural progenitor cells [19]. Further-
more, it has been previously reported that patients with juvenile
NCL have reduced DHA levels in the plasma and cerebral cortex,
which may contribute to retinal and brain degeneration [41].
Based on these studies, CLN6
nclf
mice were supplemented with
curcumin or DHA for 30 weeks immediately after weaning in
order to reduce glial reactivity and promote neuronal survival.
With both dietary regimens, OKT measurements were signifi-
cantly higher compared to non-supplemented control mice
starting at three months. ERG analysis also showed improvements
in b-wave signals for both compounds with DHA having greater
preservation of the a-wave. The preservation of the photoreceptor
layer and particularly the outer segments in DHA-treated mice
was also highlighted in morphometric and histological analyses. A
beneficial effect on photoreceptor outer segments has also been
seen in DHA supplementation of rhodopsin mutant rats, although
no alteration in the rate of retinal degeneration was detected [42].
Iba1 staining of microglia showed significantly less amoeboid and
alerted cells in both supplemented CLN6
nclf
retinas compared to
control-fed CLN6
nclf
animals. It is important to note that microglia
morphology is not always equivalent to the inflammation state
[43]. However, the microglial phenotype identified in the
supplemented CLN6
nclf
retinas looked similar to those found in
DHA-supplemented retinoschisin-deficient mice [20]. In this
retinal degeneration model, the microglial population produced
less pro-inflammatory cytokines and the retinal morphology was
improved upon DHA-treatment [20]. Thus, we speculate that
DHA- and also curcumin-supplemented CLN6
nclf
retinas display
less microglial reactivity.
Microglial involvement in neurodegenerative diseases such as
Alzheimers disease, Multiple Sclerosis and now NCL is becoming
better understood. We conclude from our studies that targeting
reactive microglia whilst supporting neuronal survival with
derivatives of natural compounds or pharmaceuticals could have
therapeutic potential. Since the retina is often affected earlier than
the brain, analyses of the ocular phenotype in NCL is helpful to
understand molecular mechanisms and could also be useful to
develop diagnostic tools for experimental therapies.
Acknowledgments
We thank Dr. Klaus Ru¨ ther for providing CLN6
nclf
mice and Dr. Frank
Stehr for his support.
Author Contributions
Conceived and designed the experiments: MM HJ TL. Performed the
experiments: MM CV MK ML AS MR. Analyzed the data: MM MR ET
HJ TL. Contributed reagents/materials/analysis tools: ET. Wrote the
paper: MM HJ TL.
References
1. Haltia M (2003) The neuronal ceroid-lipofuscinoses. J Neuropathol Exp Neurol
62: 1–13.
2. Jalanko A, Braulke T (2009) Neuronal ceroid lipofuscinoses. Biochim Biophys
Acta 1793: 697–709.
3. Siintola E, Lehesjoki AE, Mole SE (2006) Molecular genetics of the NCLs–status
and perspectives. Biochim Biophys Acta 1762: 857–864.
4. Kousi M, Lehesjoki AE, Mole SE (2012) Update of the mutation spectrum and
clinical correlations of over 360 mutations in eight genes that underlie the
neuronal ceroid lipofuscinoses. Hum Mutat 33: 42–63.
5. Goebel HH, Schochet SS, Jaynes M, Bruck W, Kohlschutter A, et al. (1999)
Progress in neuropathology of the neuronal ceroid lipofuscinoses. Mol Genet
Metab 66: 367–372.
6. Haltia M (2006) The neuronal ceroid-lipofuscinoses: from past to present.
Biochim Biophys Acta 1762: 850–856.
7. Kohlschutter A, Gardiner RM, Goebel HH (1993) Human forms of neuronal
ceroid-lipofuscinosis (Batten disease): consensus on diagnostic criteria, Hamburg
1992. J Inherit Metab Dis 16: 241–244.
8. Tarkkanen A, Haltai M, Merenmies L (1977) Ocular pathology in infantile type
of neuronal ceroid-lipofuscinosis. J Pediatr Ophthalmol 14: 235–241.
9. Gao H, Boustany RM, Espinola JA, Cotman SL, Srinidhi L, et al. (2002)
Mutations in a novel CLN6-encoded transmembrane protein cause variant
neuronal ceroid lipofuscinosis in man and mouse. Am J Hum Genet 70: 324–
335.
10. Wheeler RB, Sharp JD, Schultz RA, Joslin JM, Williams RE, et al. (2002) The
gene mutated in variant late-infantile neuronal ceroid lipofuscinosis (CLN6) and
in nclf mutant mice encodes a novel predicted transmembrane protein.
Am J Hum Genet 70: 537–542.
11. Arsov T, Smith KR, Damiano J, Franceschetti S, Canafoglia L, et al. (201 1)
Kufs disease, the major adult form of neuronal ceroid lipofuscinosis, caused by
mutations in CLN6. Am J Hum Genet 88: 566–573.
12. Bronson RT, Donahue LR, Johnson KR, Tanner A, Lane PW, et al. (1998)
Neuronal ceroid lipofuscinosis (nclf), a new disorder of the mouse linked to
chromosome 9. Am J Med Genet 77: 289–297.
13. Thelen M, Damme M, Schweizer M, Hagel C, Wong AM, et al. (2012)
Disruption of the autophagy-lysosome pathway is involved in neuropathology of
the nclf mouse model of neuronal ceroid lipofuscinosis. PLoS One 7: e35493.
14. Oswald MJ, Palmer DN, Kay GW, Shemilt SJ, Rezaie P, et al. (2005) Glial
activation spreads from specific cerebral foci and precedes neurodegeneration in
presymptomatic ovine neuronal ceroid lipofuscinosis (CLN6). Neurobiol Dis 20:
49–63.
15. Groh J, Kuhl TG, Ip CW, Nelvagal HR, Sri S, et al. (2013) Immune cells
perturb axons and impair neuronal survival in a mouse model of infantile
neuronal ceroid lipofuscinosis. Brain 136: 1083–1101.
16. Jang S, Johnson RW (2010) Can consuming flavonoids restore old microglia to
their youthful state? Nutr Rev 68: 719–728.
17. Jung KK, Lee HS, Cho JY, Shin WC, Rhee MH, et al. (2006) Inhibitory effect
of curcumin on nitric oxide production from lipopolysaccharide-activated
primary microglia. Life Sci 79: 2022–2031.
18. Jin CY, Lee JD, Park C, Choi YH, Kim GY (2007) Curcumin attenuates the
release of pro-inflammatory cytokines in lipopolysaccharide-stimulated BV2
microglia. Acta Pharmacol Sin 28: 1645–1651.
19. Antonietta Ajmone-Cat M, Lavinia Salvatori M, De Simone R, Mancini M,
Biagioni S, et al. (2012) Docosahexaenoic acid modulates inflammatory and
antineurogenic functions of activated microglial cells. J Neurosci Res 90: 575–
587.
20. Ebert S, Weigelt K, Walczak Y, Drobnik W, Mauerer R, et al. (2009)
Docosahexaenoic acid attenuates microglial activation and delays early retinal
degeneration. J Neurochem 110: 1863–1875.
21. Mattapallil MJ, Wawrousek EF, Chan CC, Zhao H, Roychoudhury J, et al.
(2012) The Rd8 mutation of the Crb1 gene is present in vendor lines of C57BL/
6N mice and embryonic stem cells, and confounds ocular induced mutant
phenotypes. Invest Ophthalmol Vis Sci 53: 2921–2927.
22. Prusky GT, Alam NM, Beekman S, Douglas RM (2004) Rapid quantification of
adult and developing mouse spatial vision using a virtual optomotor system.
Invest Ophthalmol Vis Sci 45: 4611–4616.
23. Douglas RM, Alam NM, Silver BD, McGill TJ, Tschetter WW, et al. (2005)
Independent visual threshold measurements in the two eyes of freely moving rats
and mice using a virtual-reality optokinetic system. Vis Neurosci 22: 677–684.
24. Hlawatsch J, Karlstetter M, Aslanidis A, Luckoff A, Walczak Y, et al. (2013)
Sterile alpha motif containing 7 (samd7) is a novel crx-regulated transcriptional
repressor in the retina. PLoS One 8: e60633.
25. Miller JN, Chan CH, Pearce DA (2013) The role of nonsense-mediated decay in
neuronal ceroid lipofuscinosis. Hum Mol Genet 22: 2723–2734.
26. McGill TJ, Prusky GT, Douglas RM, Yasumura D, Matthes MT, et al. (201 2)
Discordant anatomical, electrophysiological, and visual behavioral profiles of
retinal degeneration in rat models of retinal degenerative disease. Invest
Ophthalmol Vis Sci 53: 6232–44.
27. Kanninen KM, Grubman A, Caragounis A, Duncan C, Parker SJ, et al. (2013)
Altered biometal homeostasis is associated with CLN6 mRNA loss in mouse
neuronal ceroid lipofuscinosis. Biol Open 2: 635–646.
Retinal Degeneration in CLN6
nclf
Mice
PLOS ONE | www.plosone.org 10 October 2013 | Volume 8 | Issue 10 | e75963
28. Staropoli JF, Haliw L, Biswas S, Garrett L, Holter SM, et al. (2012) Large-scale
phenotyping of an accurate genetic mouse model of JNCL identifies novel early
pathology outside the central nervous system. PLoS One 7: e38310.
29. Lei B, Tullis GE, Kirk MD, Zhang K, Katz ML (2006) Ocular phenotype in a
mouse gene knockout model for infantile neuronal ceroid lip ofuscinosis.
J Neurosci Res 84: 1139–1149.
30. Bible E, Gupta P, Hofmann SL, Cooper JD (2004) Regional and cellular
neuropathology in the palmitoyl protein thioesterase-1 null mutant mouse model
of infantile neuronal ceroid lipofuscinosis. Neurobiol Dis 16: 346–359.
31. Rattner A, Nathans J (2005) The genomic response to retinal disease and injury:
evidence for endothelin signaling from photoreceptors to glia. J Neurosci 25:
4540–4549.
32. Thelen M, Fehr S, Schweizer M, Braulke T, Galliciotti G (2012) High
expression of disease-related Cln6 in the cerebral cortex, purkinje cells, dentate
gyrus, and hippocampal ca1 neurons. J Neurosci Res 90: 568–574.
33. Cao Y, Staropoli JF, Biswas S, Espinola JA, MacDonald ME, et al. (201 1)
Distinct early molecular responses to mutations causing vLINCL and JNCL
presage ATP synthase subunit C accumulation in cerebellar cells. PLoS One 6:
e17118.
34. Tammen I, Houweling PJ, Frugier T, Mitchell NL, Kay GW, et al. (2006) A
missense mutation (c.184C.T) in ovine CLN6 causes neuronal ceroid
lipofuscinosis in Merino sheep whereas affected South Hampshire sheep have
reduced levels of CLN6 mRNA. Biochim Biophys Acta 1762: 898–905.
35. Kurze AK, Galliciotti G, Heine C, Mole SE, Quitsch A, et al. (2010) Pathogenic
mutations cause rapid degradation of lysosomal storage disease-related
membrane protein CLN6. Hum Mutat 31: E1163–1174.
36. Seehafer SS, Ramirez-Montealegre D, Wong AM, Chan CH, Castaneda J, et al.
(2011) Immunosuppression alters disease severity in juvenile Batten disease mice.
J Neuroimmunol 230: 169–172.
37. Ammon HP, Wahl MA (1991) Pharmacology of Curcuma longa. Planta Med
57: 1–7.
38. He LF, Chen HJ, Qian LH, Chen GY, Buzby JS (2010) Curcumin protects pre-
oligodendrocytes from activated microglia in vitro and in vivo. Brain Res 1339:
60–69.
39. Mandal MN, Patlolla JM, Zheng L, Agbaga MP, Tran JT, et al. (2009)
Curcumin protects retinal cells from light-and oxidant stress-induced cell death.
Free Radic Biol Med 46: 672–679.
40. Mukherjee PK, Marcheselli VL, Barreiro S, Hu J, Bok D, et al. (2007)
Neurotrophins enhance retinal pigment epithelial cell survival through
neuroprotectin D1 signaling. Proc Natl Acad Sci U S A 104: 13152–13157.
41. Kohlschutter A, Schade B, Blomer B, Hubner C (1993) Low erythrocyte
plasmalogen and plasma docosahexaenoic acid (DHA) in juvenile neuronal
ceroid-lipofuscinosis (JNCL). J Inherit Metab Dis 16: 299–304.
42. Martin RE, Ranchon-Cole I, Brush RS, Williamson CR, Hopkins SA, et al.
(2004) P23H and S334ter opsin mutations: Increasing photoreceptor outer
segment n-3 fatty acid content does not affect the course of retinal degeneration.
Mol Vis 10: 199–207.
43. Graeber MB, Li W, Rodriguez ML (2011) Role of microglia in CNS
inflammation. FEBS Lett 585: 3798–3805.
Retinal Degeneration in CLN6
nclf
Mice
PLOS ONE | www.plosone.org 11 October 2013 | Volume 8 | Issue 10 | e75963
