ArticlePDF Available

Bathyraja leucomelanos, a new species of softnose skate (Chondrichthyes: Arhynchobatidae) from New Caledonia

Authors:

Abstract and Figures

A new species of softnose skate (Arhynchobatidae) is described, based on a single adult male measuring 895 mm TL that was collected at a depth of 953–1,022 m on the Coriolis Bank off western New Caledonia in the southwestern Pacific Ocean. The specimen conforms to the genus Bathyraja in having the rostral cartilage continuous with the neurocranium and very slender and uncalcified over its length. Bathyraja leucomelanos sp. nov. differs from its congeners through a combination of the following characters: distinctive coloration of the disc with white dorsal and black ventral surfaces, dorsal surface of the disc entirely covered with dermal denticles, ventral surface naked, anterior portion of the anterior margin of the disc straight, snout long and very broad with orbit about 6.0 times in preorbital length, orbit 0.73 times interorbital width, mouth 6.8% TL, tail 0.88 times precloacal length, accessory terminal 2 cartilage of the clasper having an expanded disc-shaped tip, and alar thorn tip undulating. Molecular barcoding from the COI sequence reveals that this new species is genetically close to B. spinicauda from the North Atlantic Ocean.
Content may be subject to copyright.
FULL PAPER
Bathyraja leucomelanos, a new species of softnose skate
(Chondrichthyes: Arhynchobatidae) from New Caledonia
Samuel Paco Igle
´sias Lauriana Le
´vy-Hartmann
Received: 8 July 2011 / Revised: 31 August 2011 / Accepted: 31 August 2011
ÓThe Ichthyological Society of Japan 2012
Abstract A new species of softnose skate (Arhyncho-
batidae) is described, based on a single adult male mea-
suring 895 mm TL that was collected at a depth of
953–1,022 m on the Coriolis Bank off western New Cal-
edonia in the southwestern Pacific Ocean. The specimen
conforms to the genus Bathyraja in having the rostral
cartilage continuous with the neurocranium and very
slender and uncalcified over its length. Bathyraja leuco-
melanos sp. nov. differs from its congeners through a
combination of the following characters: distinctive col-
oration of the disc with white dorsal and black ventral
surfaces, dorsal surface of the disc entirely covered with
dermal denticles, ventral surface naked, anterior portion of
the anterior margin of the disc straight, snout long and very
broad with orbit about 6.0 times in preorbital length, orbit
0.73 times interorbital width, mouth 6.8% TL, tail 0.88
times precloacal length, accessory terminal 2 cartilage of
the clasper having an expanded disc-shaped tip, and alar
thorn tip undulating. Molecular barcoding from the COI
sequence reveals that this new species is genetically close
to B. spinicauda from the North Atlantic Ocean.
Keywords Rajiformes Bathyraja New species New
Caledonia Deep waters DNA barcode
Introduction
The arhynchobatid genus Bathyraja was first defined as a
subgenus by Ishiyama (1958), and then elevated to the
genus level by Ishiyama and Hubbs (1968). With 51 spe-
cies presently known, including some unnamed species
(Stehmann 2005a,b), it is the largest batoid genus.
Bathyraja species are circumglobal and occur on conti-
nental and insular shelves and slopes down to the abyssal
plains, mainly at temperate and cold temperate latitudes,
but are most diverse at high latitudes (Stehmann 1986;
McEachran and Miyake 1990). Only three members of the
genus are known to occur in the Australasian region
(southeastern Indian Ocean and southwestern Pacific
Ocean): Bathyraja richardsoni (Garrick 1961) with type
locality off New Zealand, Bathyraja shuntovi Dolganov
1985 with type locality off New Zealand, and Bathyraja
ishiharai Stehmann 2005a with type locality off south-
western Australia. More than 100 new species of chon-
drichthyans, including many skates, have been described in
the last two decades in the Australian region, which has
tripled known fauna in this region (Last 2007; Last et al.
2008a,b; Last and Stevens 2009). As a result, some groups
such as skates (Rajidae and Arhynchobatidae) appear to be
represented by narrow-ranging endemic species, making
the discovery of numerous additional species likely in the
future with the investigation of unexplored ridges and
plateaus.
From 3 December 2001 to 18 December 2002, the
commercial trawler Ope
´ra investigated the fishery poten-
tial of the deep sea in the exclusive economic zone (EEZ)
S. P. Igle
´sias (&)L. Le
´vy-Hartmann
Department of Environment and Aquatic Populations USM
0405, Station of Marine Biology of Concarneau, National
Museum of Natural History, 29182 Concarneau Cedex, France
e-mail: iglesias@mnhn.fr
S. P. Igle
´sias
Biology of Aquatic Organisms and Ecosystems,
UMR 7208 CNRS/MNHN/IRD/UPMC, Paris, France
L. Le
´vy-Hartmann
Insular Laboratory of Living Resources and Environment,
University of New Caledonia, BP R4, 98851 Noumea Cedex,
New Caledonia
123
Ichthyol Res (2012) 59:38–48
DOI 10.1007/s10228-011-0254-y
of New Caledonia. A total of 172 stations (123 bottom
trawling and 49 pelagic trawling) were sampled during the
21 cruises, representing a total of 221 days at sea. This
survey provided 223 preserved specimens belonging to 41
chondrichthyan species (Igle
´sias et al., unpublished data),
including an unusual specimen of softnose skate from the
Coriolis Bank in the western EEZ of New Caledonia
(Fig. 1). Herein, we describe this specimen as a new
species.
Materials and methods
The single Bathyraja specimen was collected on 23 April
2002 during trawl surveys conducted in the EEZ of New
Caledonia with the commercial trawler Ope
´ra from the
ship’s manager ‘‘Armement Cale
´donien a
`la Pe
ˆche.’’ The
specimen was collected at station 030 (Fig. 1) during the
cruise ‘‘Ope
´ra-08’’ with a bottom trawl net measuring 11 m
horizontally and 3 m vertically, and with a 4 cm mesh.
Measurements. Measurements follow those of Last et al.
(2008c) and generally follow standards used for skates (e.g.,
Hubbs and Ishiyama 1968). Terminology and measurements
of the cranium follow Hubbs and Ishiyama (1968) and
McEachran and Compagno (1979,1982), terminology and
measurements of the scapulocoracoid follow McEachran
and Compagno (1979), and terminology of the pelvic girdle
and clasper follow Hulley (1972). Skeletal characters,
measurements, and meristic counts were observed on
radiographs, and these observations were combined with
dissections of the right clasper and left part of the scapu-
locoracoid. As the snout of the specimen was bent on the
radiograph, data on the cranium were obtained by combining
radiograph measurements with those made directly on the
specimen. Some measurements of the cranium that were not
visible on the radiograph are not presented here. A skin
sample was taken from the upper side near the center of the
right pectoral fin. Dermal denticles and tail thorn were
photographed by scanning electron microscope (SEM). The
voucher specimen was fixed in 4% formalin and then pre-
served in 80% ethanol and deposited in the collection of the
Muse
´um national d’Histoire naturelle of Paris (MNHN).
Actual and proportional morphometrics of the body, the
scapulocoracoid, and the cranium are given in Tables 1,2,
and 3. Total length is abbreviated to TL.
Molecular analyses. A muscle tissue sample (no. BPS-
0303) was taken from the fresh specimen and stored frozen in
80% ethanol. DNA was extracted according to the modified
CTAB method (Jones 1953). Homologous fragments of 655
base pairs (bp) of the cytochrome oxidase subunit 1 (COI)
mitochondrial gene were amplified by polymerase chain
reaction (PCR) using the TripleMaster
Ò
PCR System
(Eppendorf; http://www.eppendorfna.com) according to the
manufacturer’s instructions. The fragments were obtained
Fig. 1 Capture locality (black circle)ofBathyraja leucomelanos sp. nov. holotype in the EEZ of New Caledonia, southwestern Pacific Ocean
New Bathyraja from New Caledonia 39
123
with the PCR primer pair: S192 [50-CCT GTG GCA ATA
ATT AAT CG(CT) TGA TT-30]/R084 [50-TA(AG) ACT
TC(AT) GGG TGA CCA AAG AAT CA-30]. PCR thermal
cycling conditions were as follows: pre-denaturation 94°C
for 2 min, 45 cycles of denaturation at 94°C for 1 min,
annealing at 54°C for 1 min, and extension at 72°C for
3 min. At the end of the electrophoresis, the bands of gel
containing the PCR products were excised and purified using
the QIAquick
Ò
gel extraction kit (Qiagen; http://www.
qiagen.com). Sequencing reactions were performed using a
BigDye
Ò
Terminator v3.1 cycle sequencing kit (Applied
Table 2 Actual and proportional cranium measurements of Bathy-
raja leucomelanos sp. nov. (MNHN 2005-2740, preserved) expressed
in mm and as a percentage of nasobasal length
Cranium % Length
Nasobasal length (mm) 91
Cranial length 227.5 250.0
Rostral cartilage length 136 149.4
Rostral cartilage width 3 3.3
Prefontanelle length 119 130.8
Cranial width 94.5 103.8
Tip P1 to nasal capsule 122 134.1
Pre-P1 extent, rostrum 8 8.8
Anterior fontanelle length 37 40.7
Anterior fontanelle width 21 23.1
Rostral appendix length 31 34.1
Rostral appendix width 18 19.8
Width across otic capsules 42 46.2
Width of basal plate 23 25.3
Greatest width of nasal aperture 37 40.7
Least width of nasal aperture 16 17.6
Internasal width 16 17.6
Table 3 Actual and proportional scapulocoracoid measurements of
Bathyraja leucomelanos sp. nov. (MNHN 2005-2740, preserved)
expressed in mm and as a percentage of scapulocoracoid length
Scapulocoracoid % Length
Scapulocoracoid length (mm) 66.1
Scapulocoracoid height 41.2 62.3
Rear corner height 29.8 45.1
Premesocondyle 23 34.8
Postmesocondyle 43.1 65.2
Anterodorsal fenestra length 9.9 15.0
Anterodorsal fenestra height 8.2 12.4
Anteroventral fenestra length 10.0 15.1
Anteroventral fenestra height 7.7 11.6
Table 1 Morphometrics of Bathyraja leucomelanos sp. nov. holo-
type (MNHN 2005-2740, preserved) expressed in mm and as a per-
centage of total length
Holotype % TL
Total length (mm) 888
Disc width 608 68.5
Disc length (direct) 511 57.5
Snout to maximum width 305 34.3
Snout length (preorbital direct) 163 18.4
Snout to spiracle 200 22.5
Head (dorsal length) 216 24.3
Orbit diameter 27 3.0
Orbit and spiracle length 40 4.5
Spiracle length (main aperture) 21 2.4
Distance between orbits 37 4.2
Distance between spiracles 57 6.4
Snout to cloaca (1st hemal spine) 472 53.2
Distance from cloaca to caudal-fin tip 416 46.8
Ventral snout length (pre upper jaw) 148 16.7
Prenasal length 134 15.1
Ventral head length (to fifth gill) 239 26.9
Mouth width 60 6.8
Distance between nostrils 66 7.4
Nasal curtain length 38 4.3
Nasal curtain (total width) 79 8.9
Nasal curtain (min. width) 68 7.7
Nasal curtain (lobe width) 20 2.3
Width of first gill opening 9.8 1.1
Width of fifth gill opening 8.1 0.9
Distance between first gill openings 113 12.7
Distance between fifth gill openings 80 9.0
Clasper (post cloacal length) 245 27.6
Length of anterior pelvic lobe 62 7.0
Length of posterior pelvic lobe 128 14.4
Pelvic base width 118 13.3
Tail at axil of pelvic fins (width) 35 3.9
Tail at axil of pelvic fins (height) 26 2.9
Tail at midlength (width) 17 1.9
Tail at midlength (height) 12 1.4
Tail at D1 origin (width) 14 1.6
Tail at D1 origin (height) 8.4 0.9
D1 base length 32 3.6
D1 height 24 2.7
D1 origin to caudal-fin tip 112 12.6
D2 origin to caudal-fin tip 63 7.1
Caudal-fin length 27 3.0
Cloaca to pelvic-clasper insertion 37 4.2
Axis of greatest width 307 34.6
40 S. P. Igle
´sias, L. Le
´vy-Hartmann
123
Biosystems; http://www.appliedbiosystems.com) and the
sense primer S192. The thermocycles were: pre-denaturation
at 96°C for 2 min, 40 cycles of denaturation at 96°C for
0.5 min, annealing at 50°C for 0.5 min, and extension at
60°C for 4 min. PCR and sequencing reactions were carried
out on a TGradient thermocycler (Biometra; http://www.
biometra.com). Sequencing was performed on an ABI
PRISM
TM
310 genetic analyzer (Applied Biosystems).
Corrections to electropherograms were performed using
Sequencher v.4.2 (Gene Codes Corporation; http://www.
genecodes.com). The COI sequence is deposited in GenBank
under the accession number JN231283 and in the BOLD
systems (http://www.boldsystems.org) under the barcode ID
NCCB001-11, where it is part of the project ‘‘New Caledo-
nian Chondrichthyans Barcodes’’ (NCCB). To facilitate
comparison with other barcode sequences and the NJ trees
provided by the BOLD systems, the obtained sequence was
used to query the BOLD ‘‘identify specimen’’ tool using the
complete database of ‘‘All Barcode Records.’’ The inter-
specific distance from the closest species cluster [Bathyraja
spinicauda (Jensen 1914)] was analyzed in MEGA3.1
(Kumar et al. 2004) using the Kimura two-parameter (K2P)
distance model (Kimura 1980) and with the barcodes
obtained from seven specimens of B. spinicauda from the
eastern-north Atlantic Ocean (Igle
´sias et al., unpublished
data).
Bathyraja leucomelanos sp. nov. (Figs. 1,2,3,4,5,6,7,
8,9,10,11,12,13; Tables 1,2,3); Domino skate
Holotype. MNHN 2005-2740, tissue sample no. BPS-
0303, adult male, 895 mm TL (fresh), 888 mm TL
(preserved), 23 April 2002, 21°25.10–21°28.20S, 157°50.50
158°06.10E, 953–1,022 m, Coriolis Bank, off western New
Caledonia.
Diagnosis. A medium-sized species of Bathyraja with
the following combination of characters: snout long,
pointed and very broad, supported by a slender flexible
medial cartilage; margin of disc (anterior two-thirds)
straight. Orbit about 6.0 times in preorbital length and 0.73
times interorbital width. Mouth moderately broad, 6.8%
TL; outer margins of nasal curtain with distinct, broadly
triangular lobelet immediately posterior to each nostril;
posterior margin of nasal curtain with prominent fringes.
Tail of moderate length (about 0.9 times precloacal length),
slightly depressed and slender; lateral skin fold moderately
developed. Dorsal surface of disc and tail entirely covered
with small and fine dermal denticles; ventral surface naked;
disc entirely free of enlarged thorns; tail with single median
row of 18 large thorns laterally compressed. Dorsal fins
small, oblique, about equal in height; epichordal caudal-fin
lobe developed. Dorsal surface mostly uniformly white
except for black color along disc and tail margins, anterior
lobes of pelvic fins, claspers, and dorsal fins. Ventral
surface entirely black. Clasper glans with pseudosiphon
and component projection; ventral terminal cartilage
spoonlike; accessory terminal 2 cartilage with an expanded
disc-shaped tip. Distal section of crowns of alar thorns
undulating. Tooth rows: 30 in upper jaw, 28 in lower jaw;
trunk centra 35; predorsal caudal centra 70; diplospondy-
lous centra 109; pectoral-fin radials 88.
Description of holotype (male). Measurements are
presented in Table 1. Disc quadrangular, 1.19 times as
broad as long; angle in front of spiracles 86°; snout to axis
of greatest width 60.1% of disc length; anterior margin of
disc moderately concave with the anterior two-thirds
(except snout point) straight; pectoral fin apex weakly
angular; posterior margin convex; free rear tip broadly
rounded (Fig. 2). Head long, preorbital snout length 6.04
times orbit length, 4.41 times interorbit; pre-upper jaw
length 2.24 times internarial distance. Snout elongate, very
broad, tip pointed; no fleshy process at apex. Orbit of
moderate size, diameter 0.73 times interorbital width, 1.29
times spiracle length (Fig. 3). Spiracle opening elongate
oval. Nostril suboval; anterior nasal flap expanded, its lat-
eral margin forming a short open tube with fringe at apex;
inner margin and posterior inner margin concealed by nasal
curtain; posterior lobes well developed, produced postero-
laterally, forming nasal curtain; outer margins of nasal
curtain with distinct, broadly triangular lobelet immediately
posterior to each nostril; remainder of outer margins pos-
terior to lobelet strongly convex toward rounded apices;
posterior margin of nasal curtain with prominent fringes
(Fig. 4); internarial distance 1.71 in distance between first
gill slits, 1.21 in distance between fifth gill slits. Upper jaw
slightly arched; lower jaw weakly convex; lateral teeth of
upper jaw concealed by lobe of nasal curtain (Fig. 4). Teeth
unicuspid, with slightly elevated subcircular bases; arran-
ged in parallel longitudinal rows; cusps mostly similar
across jaws, conical, pointed, directed posteromedially to
posterolaterally in upper jaw. Pelvic fins of medium size,
deeply forked; anterior lobe long, narrowly rounded dis-
tally, lateral margin entire, inner margin incised; posterior
lobe moderately elongate (14.4% TL), lateral margin con-
vex, inner margin straight; free rear tip pointed; anterior
lobe 0.48 times posterior lobe. Tail slightly depressed,
moderately broad at base, tapering gradually posteriorly,
midlength narrow; width at insertions of pelvic fins 2.06
times width at midlength of tail and 2.5 times width at first
dorsal-fin origin; length from rear of cloaca 0.88 times
distance from tip of snout to rear of cloaca; anterior cross-
section equally convex dorsally and ventrally, becoming
much more strongly convex on dorsal surface than ventral
surface posteriorly, almost flat ventrally near tail apex;
width 1.35 times height at insertion of pelvic fin, 1.42 times
height at midlength, 1.67 times height at first dorsal-fin
origin; lateral tail fold not well developed, barely detectable
New Bathyraja from New Caledonia 41
123
forward of midtail, terminating well short of tail tip,
broadest beneath second dorsal fin (Fig. 5). Dorsal fins of
medium size, of similar shape; first dorsal-fin height 1.33 in
base length; anterior margins moderately convex, apices
broadly rounded, posterior margins moderately convex;
interdorsal distance short, 1.89 times in the length of the
first dorsal-fin base; distance from first dorsal-fin origin to
tail tip 3.5 times dorsal-fin base length, 4.15 times caudal-
fin length; first dorsal-fin base 1.19 times caudal-fin length
(Fig. 5c). Epichordal caudal-fin lobe relatively well devel-
oped, longbased, base length a little shorter than dorsal fin
base lengths, height about a third of dorsal fin heights, taller
posteriorly than anteriorly, truncate distally, its dorsal
margin convex; hypochordal caudal-fin lobe not developed.
Meristics. Tooth rows in upper jaw 30; lower jaw 28.
Pectoral-fin propterygial radials 37; mesopterygial radials
19; metapterygial radials 32; total radials 88. Pelvic-fin
radials 1 ?22. Trunk centra 35; predorsal caudal cen-
tra 70; predorsal centra 105; centra between origins of
dorsal fins 14; total diplospondylous centra 109; total
centra 144.
Squamation. Dorsal surface of disc, posterior lobe of
pelvic fins, tail, dorsal fins and base of epichordal lobe of
caudal fin uniformly and sparsely covered with small, fine
dermal denticles. Denticle cusps on disc small, erect,
slightly recurved and posteriorly directed; with stellate
bases, commonly with 5 branches (4–6), about 0.8 mm in
diameter (Fig. 6). Disc completely free of enlarged thorns
Fig. 2 Bathyraja leucomelanos
sp. nov., holotype, adult male
(MNHN 2005-2740, 895 mm
TL, fresh). aDorsal view,
bventral view. Scale bar 10 cm
42 S. P. Igle
´sias, L. Le
´vy-Hartmann
123
(rostral, malar, orbitospiracular, scapular, and nuchal
thorns absent). Tail with single, linear, median row of 18
thorns (Figs. 5a, b, 7), regularly spaced about a thorn base
length apart, originating over cloaca and extending to first
dorsal fin; thorns large in size and laterally compressed
(about 9 mm long, 6 mm high and 4 mm width), directed
posteriorly, subtriangular in lateral view. No interdorsal
thorns. Alar thorns strongly recurved and directed slightly
posteromedially, 58 (left pectoral fin) and 57 (right pectoral
fin), arranged in 22 (left pectoral fin) 21 (right pectoral fin)
rows; each row with 1–4 thorns; along dorsolateral margin
of each pectoral fin; all thorns nondepressible, not fitting
into slits in integument, tips pungent, crown of alar thorns
undulating; patch of thorns long, about four times longer
than orbit diameter (Fig. 8). Dorsal surface of anterior lobe
of pelvic fins, claspers, and entire ventral surface naked.
Clasper. Very slender and elongate, 27.6% TL, slightly
depressed, with glans slightly expanded; without dermal
denticles (Fig. 9). Large pseudosiphon present near outer
lateral edge of dorsal lobe, its length 11% of clasper
(postcloacal) length; inner surface of dorsal lobe with
pseudorhipidion extending from level of hypopyle and
Fig. 3 Dorsal view of the eyes and the spiracles of Bathyraja
leucomelanos sp. nov., holotype, adult male (MNHN 2005-2740,
preserved). Scale bar 1cm
Fig. 4 Ventral view of the oronasal region and the tooth band of
Bathyraja leucomelanos sp. nov., holotype, adult male (MNHN
2005-2740, preserved). Scale bar 1cm
Fig. 5 Details of the tail of Bathyraja leucomelanos sp. nov.,
holotype, adult male (MNHN 2005-2740, preserved). Thorns and
squamation at tail midlength: adorsal view, blateral view; clateral
view of dorsal and caudal fins. Scale bars 1cm
Fig. 6 Denticles of the disc of Bathyraja leucomelanos sp. nov.,
holotype, adult male (MNHN 2005-2740). aDenticle arrangement,
bdetail of a six-branched denticle. Scale bars 1mm
New Bathyraja from New Caledonia 43
123
medial to slit, to about distal quarter of glans; lobe with
deep cleft lateral to pseudorhipidion; slit proximal to cleft;
spur and flag absent. Ventral lobe without shield and rhi-
pidion; inner surface of ventral lobe with projection and
sentina; spike disc-shaped with sharp, naked lateral and
distal margins; ventral to projection, partly covered by
projection but distolateral margin visible. Axial cartilage
spatulate distally; extending beyond other cartilages
(Fig. 10). Dorsal marginal cartilage with distal elongation,
forming pseudorhipidion externally. Ventral marginal car-
tilage with pointed distal elongation, extending near to the
tip of the clasper and forming projection externally. Dorsal
terminal 1 cartilage shield-like, more extended on dorsal
side than on ventral side, with notch along proximal and
distal margins; curved around the dorsal marginal cartilage,
axial cartilage, and part of the ventral marginal cartilage;
connected with dorsal marginal cartilage forming pseudo-
siphon at its outer edge. Dorsal terminal 2 cartilage long,
slender and irregular, extending to tip of clasper, firmly
connected to dorsal terminal 3 cartilage, and loosely con-
nected to tip of axial by connective tissue. Dorsal terminal
3 cartilage large, near-hexagonal, shorter than dorsal ter-
minal 2 cartilage. Accessory terminal 2 cartilage medium,
curved and spatulate distally, forming component spike
with sharp lateral and distal margins (Fig. 10e); articulating
with posteromedial margin of ventral marginal cartilage,
lying beneath tip of ventral marginal cartilage and over
ventral terminal cartilage. Ventral terminal cartilage
spoonlike (Fig. 10d); lying beneath tip of ventral marginal
and accessory terminal; proximomedial condyle articulat-
ing with ventral marginal cartilage, distomedial extension
articulating with tip of axial cartilage; inner edge articu-
lated with a very small unnamed cartilage seated near
articulation of accessory terminal 2 and ventral marginal
cartilage.
Cranium. Relatively short and broad (Fig. 11; Table 2).
Rostral cartilage with slender, flexible, unsegmented shaft;
rostral appendices narrow, poorly calcified, separated from
rostrum over most of length; rostral cartilage base some-
what broad. Nasal capsules broad, bulbous. Posterior
Fig. 7 Thorn of the tail (14th) of Bathyraja leucomelanos sp. nov.,
holotype, adult male (MNHN 2005-2740). aDorsal view, blateral
view. Scale bars 1mm
Fig. 8 Patch of alar thorns of Bathyraja leucomelanos sp. nov.,
holotype, adult male (MNHN 2005-2740, preserved). Scale bar 1cm
Fig. 9 Lateral view, partially expanded, of the right clasper of
Bathyraja leucomelanos sp. nov., holotype, adult male (MNHN
2005-2740, preserved). cf Cleft, hy hypopyle, pj projection,
pr pseudorhipidion, ps pseudosiphon, se sentina, sl slit, sp spike.
Scale bar 1cm
44 S. P. Igle
´sias, L. Le
´vy-Hartmann
123
fontanelle approximately hourglass-shaped. Postorbital
region of cranium narrow.
Scapulocoracoid. Nearly rectangular in lateral view,
height greatest anteriorly and decreasing posteriorly
(Fig. 12; Table 3). Mesocondyle situated anteriorly on
lateral face, postmesocondyle distance 1.9 times premeso-
condyle distance. Anterodorsal and anteroventral fenestrae
subcircular, approximately equal in size, larger diameter
15% scapulocoracoid length, separated by a wide and
depressed anterior bridge. Postdorsal foramina 8 variable in
Fig. 10 Bathyraja
leucomelanos sp. nov.,
holotype, MNHN 2005-2740;
skeleton of glans of right clasper
in dorsal (a), lateral opened (b),
and ventral (c) views. External
cartilages removed (dashed
lines) to show underlying
structure. dVentral marginal
cartilage in dorsal view.
eAccessory terminal cartilage 2
in dorsal view. atr2 Accessory
terminal cartilage 2, ax axial
cartilage, dmg dorsal marginal
cartilage, dtr1,dtr2 and dtr3
dorsal terminal cartilages 1, 2
and 3, vmg ventral marginal
cartilage, vtr ventral marginal
cartilage, xunnamed cartilage.
Scale bar 1cm
Fig. 11 Ventral view (negative of the radiograph) of the cranium,
jaws, and snout of Bathyraja leucomelanos sp. nov., holotype, adult
male (MNHN 2005-2740, preserved). Scale bar 1cm
Fig. 12 Lateral view of the scapulocoracoid of Bathyraja leucomel-
anos sp. nov., holotype, adult male (MNHN 2005-2740). ab Anterior
bridge, ac anterior corner, adf anterodorsal fenestra, avf anteroventral
fenestra, msc mesocondyle, mtc metacondyle, pdf postdorsal foram-
ina, prc procondyle, pvf postventral foramina, rc rear corner, scp
scapular process. Scale bar 1cm
New Bathyraja from New Caledonia 45
123
size (1st and 5th larger); postventral foramina 8, very
small. Pectoral-fin radials 88 (on each side).
Pelvic girdle. With developed prepelvic processes
(Fig. 13); shape of iliac process not visible on X-ray;
ischiopubic region with straight anterior margin and
strongly concave posterior margin.
Color. (Fresh specimen) Dorsal surface: disc mainly
uniformly white except for black borders and snout tip;
pelvic fins with bases and anterior lobes black; posterior
lobes with a white center and wide black borders; claspers
entirely black; tail white with dorsal and epichordal caudal
fins black and thorns dark; nuchal and scapular areas and
border of posterior disc with small irregular black blotches;
a few irregular black blotches also dispersed on the disc
(mainly on the scapular area and on the posterior margin of
the disc); skin at base of each alar thorn forming a dark,
rounded blotch. A large irregular dark blotch lacking der-
mal denticles present on alar area of left disc, near patch of
alar thorns; possibly scarring from a flesh wound (Figs. 1,
9). Ventral surface entirely black except for white border of
mouth. (Preserved specimen) After 8 years in preservative,
the coloration mostly identical to fresh specimen, but with
black areas now dark brown.
Size. Adult males reach at least 895 mm TL (length of
the fresh specimen).
Distribution. Known only from the Coriolis Bank off
western New Caledonia in the southwestern Pacific
Ocean (21°25.10–21°28.20S, 157°50.50–158°06.10E) at 953–
1,022 m depth (Fig. 1).
Molecular barcode. Cytochrome oxidase subunit 1
sequence of Bathyraja leucomelanos (holotype: MNHN
2005-2740; GenBank accession number, JN231283; BOLD
barcode ID, NCCB001-11): CCTTTATTTAATCTTTGG
TGCCTGAGCAGGGATGGTTGGGACTGGTCTTAGTC
TTCTGATCCGAGCTGAATTAAGTCAACCTGGAACC
CTTTTAGGTGATGATCAGATTTATAATGTTATTGT
TACAGCCCATGCCTTTGTAATAATCTTCTTTATGG
TTATGCCAATCATAATCGGAGGTTTCGGTAATTGA
CTTGTCCCTTTAATAATTGGTTCTCCAGACATAGC
TTTTCCACGCATAAATAATATAAGCTTCTGACTTC
TGCCTCCATCTTTTCTTCTGCTTCTAGCCTCTGCCG
GTGTTGAAGCTGGAGCAGGGACTGGCTGAACTGT
TTATCCCCCACTAGCAGGAAATCTTGCCCATGCAG
GAGCTTCCGTTGATTTAACAATTTTTTCTCTTCAC
TTAGCCGGAATCTCATCTATCTTAGCATCAATTAA
TTTCATTACTACTATTATTAATATAAAACCACCAG
CAATTTCACAATACCAAACACCTTTATTTGTATGA
TCAGTTCTTGTCACAACTGTACTACTTCTTTTAGC
TCTCCCAGTTTTAGCAGCAGCTATCACTATACTTT
TAACAGATCGTAATCTTAACACAACTTTCTTTGAC
CCTGCAGGGGGAGGGGATCCTATTTTATATCAAC
ACTTATTC (655 bp)
Etymology. The species name leucomelanos, derived
from the Greek ketjo
´(white) and lekamo
´1(black), refers
to the coloration with white and black dorsal and ventral
surfaces, respectively. Vernacular names: English ‘‘Domino
skate’’ and French ‘‘raie domino’’ refer to the color of the
collective gaming dominoes pieces that often present black
and white faces.
Discussion
The present species was included in Arhynchobatidae due
to having the following unambiguous character state:
clasper glans with component projection (McEachran and
Dunn 1998). The basihyal cartilage with its lateral pro-
jection represents a second unambiguous character state for
the family, but was not visible on the radiograph of the
studied specimen. Moreover, the species clearly belongs to
Bathyraja in having the rostral cartilage continuous with
the neurocranium and very slender and uncalcified over its
length (Ishiyama 1958; Ishiyama and Hubbs 1968;
McEachran and Dunn 1998). Bathyraja leucomelanos fits
the combination of the character states for the genus as
defined by Ishiyama and Hubbs (1968) and McEachran and
Dunn (1998), with two exceptions. Firstly, B. leucomelanos
possesses an undulated distal section of the alar thorn
crowns, as observed for the Rajini Dipturus,Okamejei,
Raja, North Pacific assemblage, and Amphi-American
assemblage, whereas the distal section of the alar thorn
crowns of the other Bathyraja are described as being
straight (McEachran and Konstantinou 1996; McEachran
and Dunn 1998). Secondly, B. leucomelanos possesses an
accessory terminal 2 cartilage with an expanded
disc-shaped tip as observed in the Arhynchobatini:
Arhynchobatis,Irolita,Pavoraja, and Notoraja, whereas
the accessory terminal 2 cartilage of the other Bathyraja
are described as lacking a disc-shaped tip (McEachran and
Dunn 1998).
The new softnose skate is known only from the Coral
Sea off western New Caledonia, but probably displays a
Fig. 13 Ventral view of the pelvic girdle of Bathyraja leucomelanos
sp. nov., holotype, adult male (MNHN 2005-2740). il Iliac process, pp
prepelvic process. Drawn from radiograph. Scale bar 1cm
46 S. P. Igle
´sias, L. Le
´vy-Hartmann
123
much wider range of distribution, as generally observed for
deep water species. Fish faunas from New Zealand and
New Caledonia exhibit a high affinity (Zintzen et al. 2011),
and skate faunas from these regions are dominated by
arhynchobatids (Last and Yearsley 2002). Three members of
the genus Bathyraja are known to occur in the Australasian
area: B. ishiharai, off Western Australia, B. richardsoni, off
southern Tasmania and New Zealand, and B. shuntovi, off
New Zealand. These species differ from B. leucomelanos by
a combination of morphological characters.
Bathyraja ishiharai possesses dark brown upper and
lower surfaces of the disc (vs. white and black dorsal and
ventral surfaces of disc, respectively, in B. leucomelanos);
the dorsal surface of the disc is smooth-skinned except for
a patch of denticles along the anterior margin and around
the orbit (vs. the dorsal surface of the disc entirely covered
with small, fine dermal denticles). Bathyraja richardsoni
possesses a moderate snout length with an orbit about 4.7
times in the preorbital snout (vs. long snout with an orbit
about 6.0 times in the preorbital length in B. leucomel-
anos); a small orbit, about 1.6 times in the interorbital
space (vs. larger orbit, 1.4 times in the interorbital width);
very broad mouth, about 11.4% TL (vs. narrower, about
6.8% TL); short tail, about 0.67 times the precloacal length
(vs. longer tail, about 0.88 times the precloacal length);
ventral surface is covered with granular denticles (vs.
naked ventral surface). Bathyraja shuntovi possesses a very
long and narrow snout (vs. a shorter and broader snout in B.
leucomelanos); snout to axis of greatest width is 68.9% of
disc length (vs. 60.1% of disc length); the upper disc is
almost naked (vs. dorsal surface of the disc entirely cov-
ered with small, fine dermal denticles).
Most skate species have a dorsal surface that is darker
than the ventral surface. The ventral surface is white for
most species, especially in shallow waters, whereas a dark
ventral surface appears to be more frequent for deeper
species. A disc with white upper and black lower surfaces
is much less common, and has only been recorded for a few
species, e.g., the deep-sea Rajidae Amblyraja reversa
(Lloyd 1906) from the Arabian Sea in the western Indian
Ocean, as well as some from the Australasian region (e.g.,
Rajella challengeri Last and Stehmann 2008). The species
name of A. reversa was suggested by the reverse-like body
colors, as is the case for B. leucomelanos. For the dorsal
surfaces of both A. reversa and B. leucomelanos, the disc
margin, the pelvic fins, and the claspers are dark.
A high proportion of the Bathyraja species known to
date are available in BOLD (including undescribed and
undetermined species), with representatives from the
northern and southern Pacific and Atlantic Oceans, and
from the circum-Antarctic and Subantarctic regions.
Among the 40 species/305 specimens of Bathyraja for
which barcodes are currently available in BOLD (on 16
August 2011), the least divergent COI from the sequence of
B. leucomelanos is the B. spinicauda cluster.The mean
genetic distance between the new species and seven spec-
imens of B. spinicauda is 1.3% (1.1–1.5%). This relatively
low molecular divergence, where the two species are easily
distinguished by their morphology, may reflect the slow
rate of evolution for mitochondrial DNA, which is com-
monly observed in chondrichthyans (Martin et al. 1992).
Surprisingly, B. leucomelanos and B. spinicauda, the
closest relatives based on the available barcodes, have
antipodal distributions (southwestern Pacific Ocean vs.
northern Atlantic Ocean). Phylogenetic relationships based
on molecular markers support the idea that Bathyraja is
part of the tribe Arhynchobatini, family Arhynchobatidae
(Igle
´sias, unpublished data).
Acknowledgments We thank J.-F. Barazer and fishermen of the
trawler Ope
´ra for their help with specimen collection; B. Richer de
Forges for support at the IRD center of Noume
´a; The ‘‘Affaires
Maritimes, Service de la Marine Marchande et des Pe
ˆches Maritimes
de Nouvelle-Cale
´donie’’ and the ship’s manager ‘‘Armement Cal-
e
´donien a
`la Pe
ˆche’’ for allowing the authors to board the trawler
Ope
´ra; the ‘‘Centre hospitalier de Cornouaille–Concarneau’’ for
X-rays, G. Mascarell for SEM photographs, D. Sellos for molecular
analyses, J. Pogonoski for sending references, and I. Tkach for
translating the Russian reference.
References
Dolganov VN (1985) A new species of skate from the southwestern
Pacific Ocean. Biologiya Morya (Vladivostok) 5:66–68
Garrick JAF (1961) Studies on New Zealand Elasmobranchii. Part
XIII, A new species of Raja from 1,300 fathoms. Trans R Soc N
Z 88:743–748
Hubbs CL, Ishiyama R (1968) Methods for the taxonomic study and
description of skates (Rajidae). Copeia 1968:483–491
Hulley PA (1972) The origin, interrelationships and distribution of
southern African Rajidae (Chondrichthyes, Batoidei). Ann S Afr
Mus 60:1–103
Ishiyama R (1958) Studies on the rajid fishes (Rajidae) found in the
waters around Japan. J Shimonoseki Coll Fish 7:191–394
Ishiyama R, Hubbs CL (1968) Bathyraja, a genus of Pacific skates
(Rajidae) regarded as phyletically distinct from the Atlantic
genus Breviraja. Copeia 1968:407–410
Jensen AS (1914) The selachians of Greenland. København
Jones AS (1953) The isolation of bacterial nucleic acids using
cetyltrimethlyammonium bromide (cetavlon). Biochim Biophys
Acta 10:607–612
Kimura M (1980) A simple method for estimating evolutionary rate
of base substitutions through comparative studies of nucleotide
sequences. J Mol Evol 16:111–120
Kumar S, Tamura K, Nei M (2004) MEGA3: Integrated software for
Molecular Evolutionary Genetics Analysis and sequence align-
ment. Brief Bioinformatics 5:150–163
Last PR (2007) The state of chondrichthyan taxonomy and system-
atics. Mar Freshw Res 58:7–9
Last PR, Stehmann MFW (2008) Rajella challengeri sp. nov., a new
deepwater skate from southern Australia. CSIRO Marine and
Atmospheric Research Paper No 021:135–145
Last PR, Stevens JD (2009) Sharks and rays of Australia, 2nd edn.
CSIRO Publishing, Australia
New Bathyraja from New Caledonia 47
123
Last PR, Yearsley GK (2002) Zoogeography and relationships of
Australasian skates (Chondrichthyes: Rajidae). J Biogeogr
29:1627–1641
Last PR, White WT, Pogonoski JJ (2008a) Descriptions of new
autralian chondrichthyans. CSIRO Mar Atmos Res Pap 022
Last PR, White WT, Pogonoski JJ, Gledhill DC (2008b) Descriptions
of new autralian skates (Batoidea: Rajoidei). CSIRO Mar Atmos
Res Pap 021
Last PR, White WT, Pogonoski JJ, Gledhill DC (2008c) New
Australian skates (Batoidea: Rajoidei)—background and meth-
odology. In: Last PR, White WT, Pogonoski JJ, Gledhill DC
(eds) Descriptions of new Australian skates (Batoidea: Rajoidei).
CSIRO Mar Atmos Res Pap 021:1–8
Lloyd RE (1906) Notes on the skull of the genus Aulastomatomorpha,
with descriptions of some new deep-sea fish. Natural history
notes from the R.I.M.S. ship ‘‘Investigator,’’ Capt. T. H. Heming,
R.N. (retired), commanding. Series III, No. 14. Ann Mag Nat
Hist (Ser 7) v 18, 106:306–311
Martin AP, Naylor GJP, Palumbi SR (1992) Rates of mitochondrial
DNA evolution in sharks are slow compared with mammals.
Nature 357:153–155
McEachran JD, Compagno LJV (1979) A further description of
Gurgesiella furvescens with comments on the interrelationships
of Gurgesiellidae and Pseudorajidae (Pisces, Rajoidei). Bull Mar
Sci 29:530–553
McEachran JD, Compagno LJV (1982) Interrelationships of and
within Breviraja based on anatomical structures (Pisces, Rajoi-
dei). Bull Mar Sci 32:399–425
McEachran JD, Dunn KA (1998) Phylogenetic analysis of skates, a
morphologically conservative clade of elasmobranchs (Chon-
drichthyes: Rajidae). Copeia 1998:271–290
McEachran JD, Konstantinou H (1996) Survey of the variation in alar
and malar thorns in skates: phylogenetic implications (Chon-
drichthyes: Rajoidei). J Morph 228: 165–178
McEachran JD, Miyake T (1990) Zoogeography and bathymetry of
skates (Chondrichthyes, Rajoidei). In: Pratt HL Jr, Gruber SH,
Taniuchi T (eds) Elasmobranchs as living resources: advances in
the biology, ecology, systematics and the status of the fisheries.
NOAA Tech Rep 90:305–326
Stehmann MFW (1986) Notes on the systematics of the rajid genus
Bathyraja and its distribution in the world oceans. In: Uyeno T,
Arai R, Taniuchi T, Matsuura K (eds) Indo-Pacific fish biology:
proceedings of the Second International Conference on Indo-
Pacific Fishes. Ichthyological Society of Japan, Tokyo,
pp 261–268
Stehmann MFW (2005a) Bathyraja ishiharai n. sp., a new deep-water
skate from the eastern Indian Ocean on the Naturalist Plateau off
southwestern Australia (Elasmobranchii, Rajiformes, Rajidae).
J Ichthyol 45(suppl 1):39–57
Stehmann MFW (2005b) Bathyraja tunae n. sp., a new deep-water
skate from the western Indian Ocean (Chondrichthyes, Rajifor-
mes, Rajidae). J Ichthyol 45(suppl 1):23–38
Zintzen V, Roberts CD, Clark MR, Williams A, Althaus F, Last PR
(2011) Composition, distribution and regional affinities of the
deepwater ichthyofauna of the Lord Howe Rise and Norfolk
Ridge, south-west Pacific Ocean. Deep-Sea Res P II 58:933–947
48 S. P. Igle
´sias, L. Le
´vy-Hartmann
123
... They are found on continental and island shelves and slopes down to the abyssal plains, mainly in temperate and cold-temperate latitudes. The greatest species diversity among them is noted in high latitudes (Iglésias and Lévy-Hartmann 2012). Genus Bathyraja is now comprised 54 valid species ( Fishbase 2020;Iglésias and Lévy-Hartmann 2012;Last et al 2016a;Last et al 2016b). ...
... The greatest species diversity among them is noted in high latitudes (Iglésias and Lévy-Hartmann 2012). Genus Bathyraja is now comprised 54 valid species ( Fishbase 2020;Iglésias and Lévy-Hartmann 2012;Last et al 2016a;Last et al 2016b). The greatest species diversity (24 species) is noted in the North Pacific (Sea of Okhotsk, Beringov Sea, and East Sea). ...
Article
Full-text available
The offspring of skate Bathyraja sp., caught in the environs of the Simushir Island (Greater Kuril Chain), were studied for infections and stomach contentment. Three species of cestodes: Onchobothrium sp., Pseudanthobothrium purtoni, and Phyllobothrium georgiense were found. Eight taxa of invertebrates were found in the stomach: seven amphipods Acanthostepheia behringiensis, Ampelisca eschrichtii, Eusirus cuspidatus, Gammaridea fam. gen. sp., Lysianassidae gen. sp., Oedicerotidae gen. sp., Stenothoidae gen. sp., and one isopod Arcturus crenulatus. The explosive increase in the number of cestodes infecting Bathyraja sp., has been caused by a change in the food spectrum, characterized by the appearance of bony fish. It is the first time that these three species of cestodes have been recorded in the Bathyraja (inhabiting the Northwestern Pacific). The obtained data expands knowledge on the feeding of skates, the fauna of cestodes of the North Pacific Ocean, and their final hosts, as well as coastal communities of the middle Kuril Islands that are poorly studied.
... They are found on continental and island shelves and slopes down to the abyssal plains, mainly in temperate and cold-temperate latitudes. The greatest species diversity among them is noted in high latitudes (Iglésias and Lévy-Hartmann 2012). Genus Bathyraja is now comprised 54 valid species ( Fishbase 2020;Iglésias and Lévy-Hartmann 2012;Last et al 2016a;Last et al 2016b). ...
... The greatest species diversity among them is noted in high latitudes (Iglésias and Lévy-Hartmann 2012). Genus Bathyraja is now comprised 54 valid species ( Fishbase 2020;Iglésias and Lévy-Hartmann 2012;Last et al 2016a;Last et al 2016b). The greatest species diversity (24 species) is noted in the North Pacific (Sea of Okhotsk, Beringov Sea, and East Sea). ...
Article
The offspring of skate Bathyraja sp., caught in the environs of the Simushir Island (Greater Kuril Chain), were studied for infections and stomach contentment. Three species of cestodes: Onchobothrium sp., Pseudanthobothrium purtoni, and Phyllobothrium georgiense were found. Eight taxa of invertebrates were found in the stomach: seven amphipods Acanthostepheia behringiensis, Ampelisca eschrichtii, Eusirus cuspidatus, Gammaridea fam. gen. sp., Lysianassidae gen. sp., Oedicerotidae gen. sp., Stenothoidae gen. sp., and one isopod Arcturus crenulatus. The explosive increase in the number of cestodes infecting Bathyraja sp., has been caused by a change in the food spectrum, characterised by the appearance of bony fish. It is the first time that these three species of cestodes have been recorded in the Bathyraja (inhabiting the North-western Pacific). The obtained data expands knowledge on the feeding of skates, the fauna of cestodes of the North Pacific Ocean, and their final hosts, as well as coastal communities of the middle Kuril Islands that are poorly studied.
... The genus Bathyraja Ishiyama, 1958, one of the most speciose groups of softnose skates belonging to the family Arhynchobatidae (Chondrichthyes, Rajiformes), includes over 50 species, including some still undescribed. It is also one of the most diverse genera within the order Rajiformes (Ishihara & Ishiyama, 1986;Stehmann, 1986Stehmann, , 2005aEbert & Compagno, 2007;Orr et al., 2011;Iglésias & Lévy-Hartmann, 2012;Last et al., 2016;Weigmann, 2016). The genus was originally described by Ishiyama (1958) as a subgenus of Breviraja Bigelow & Schroeder, 1948, but later elevated to generic rank by . ...
Article
Full-text available
A new snailfish, Paraliparis flammeus , is described on the basis of 18 specimens collected off the Pacific coast of Tohoku District, northern Japan at depths of 422–890 m. The new species is distinguished from 28 species of Paraliparis described from the North Pacific by the following combination of characters: mouth oblique; uppermost pectoral-fin base below horizontal through posterior margin of maxillary; 60–63 vertebrae, 54–58 dorsal-fin rays, 50 or 51 anal-fin rays, six principal caudal-fin rays, and 17–20 pectoral-fin rays. A maximum likelihood tree based on 106 COI gene sequences (492 bp) of Paraliparis recovered a monophyletic group comprising P. flammeus , Paraliparis cephalus , and Paraliparis dipterus . Paraliparis cephalus is similar to P. flammeus in having an oblique mouth, but it has four caudal-fin rays (vs six rays) and the uppermost pectoral-fin base above a horizontal through the maxillary posterior margin. Paraliparis dipterus differs from P. flammeus in having a horizontal mouth, 12–14 pectoral-fin rays, and lacking pyloric caeca (present in P. flammeus ). Paraliparis flammeus is most similar to the eastern North Pacific Paraliparis mento in having an oblique mouth and the uppermost pectoral-fin base below a horizontal through the posterior margin of the maxillary. However, P. flammeus differs from P. mento in having six caudal-fin rays (vs five rays) and greater preanal length (29.9–35.3% SL vs 26.7–28.5% SL). A poorly known species, Paraliparis mandibularis , previously known from only two specimens collected from Tosa Bay, southern Japan, is redescribed based on the holotype and seven newly collected specimens. It is also similar to the new species but has 27–30 pectoral-fin rays and a shorter pectoral-fin lower lobe (13.8–15.9% SL in P. mandibularis vs 16.7–23.4% SL in P. flammeus ).
... The genus Bathyraja Ishiyama, 1958, one of the most speciose groups of softnose skates belonging to the family Arhynchobatidae (Chondrichthyes, Rajiformes), includes over 50 species, including some still undescribed. It is also one of the most diverse genera within the order Rajiformes (Ishihara & Ishiyama, 1986;Stehmann, 1986Stehmann, , 2005aEbert & Compagno, 2007;Orr et al., 2011;Iglésias & Lévy-Hartmann, 2012;Last et al., 2016;Weigmann, 2016). The genus was originally described by Ishiyama (1958) as a subgenus of Breviraja Bigelow & Schroeder, 1948, but later elevated to generic rank by . ...
Article
Full-text available
A new species of softnose skate (Arhynchobatidae), Bathyraja sexoculata Misawa, Orlov, Orlova, Gordeev and Ishihara is described on the basis of five specimens collected from off the east coast of Simushir Island, Kuril Islands, located in the western North Pacific. The specimens conformed to the genus Bathyraja by having the anteriormost pectoral-fin skeleton almost reaching the snout tip, and a slender unsegmented rostral cartilage. Within Bathyraja, the new species belongs to the subgenus Arctoraja (currently with four valid species) due to the relatively short tail (79–86% of disc width), high count of predorsal caudal vertebrae (more than 86), and large strong nuchal and scapular thorns. It is most similar to Bathyraja (Arctoraja) smirnovi, distributed in the Seas of Japan and Okhotsk, in having tail thorns not extending to the nuchal area, median thorns discontinuous from the nape to the tail, and no mid-dorsal thorns. However, B. sexoculata can be distinguished from B. smirnovi by the following characters: three pairs of white blotches on the dorsal disc surface (vs. blotches absent, or a pair of white or dark blotches in B. smirnovi), dark blotch around cloaca, dark bands along mid ventral line of tail (vs. dark blotch and band usually absent ventral disc surface in B. smirnovi), 86–93 predorsal caudal vertebrae (vs. 80–87 in B. smirnovi), and a unique mitochondrial DNA cytochrome c oxidase subunit I sequence. Proportional measurements, including disc width, disc length, head length, preoral length, prenarial length, internarial distance, eye diameter, and tail length, also differ between the two species. For the referential purpose, geographical variations of B. smirnovi distributed in the Seas of Japan and Okhotsk are analyzed and clarified based on morphological and genetic data. Significant morphological and genetic differences were found between local populations in the Seas of Japan and Okhotsk.
... A number of unique and possibly endemic deep-water skates, rays, and stingrays have been recorded from the deep slopes and plateaux (Compagno & Stevens, 1993;Iglesias & Levy-Hartmann, 2012;Séret & Last, 2003). Last and White (2011) also note the relatively high number of microendemic sharks and rays despite the paucity of surveys. ...
Article
Adult specimens, additional juvenile specimens, egg cases and embryos were used to provide a more detailed anatomical description of the Kerguelen sandpaper skate Bathyraja irrasa, a species of skate endemic to the Kerguelen Plateau and listed as Vulnerable by the IUCN Red List of Threatened Species. The morphological and meristic data reveal a relatively high level of intraspecific variation, mostly related to size. Egg cases are described for the first time and were shown to vary in colour and fouling depending on the length of time spent in the marine environment. Embryos removed from egg cases represent all stages of embryonic development in this species and include the largest embryo recorded for this species, i.e. 230 mm LT, which increases the range of size at hatching of B. irrasa to 178–230 mm LT. A number of morphometric and meristic characters varied ontogenetically in B. irrasa, in particular relatively tail length, number of tail thorns in median row and size of orbits. This study highlights the importance of describing intraspecific variation in species and the importance of egg cases to taxonomic and biological research on oviparous species. This article is protected by copyright. All rights reserved.
Article
Full-text available
Elasmobranchii are relatively well-studied. However, numerous phylogenetic uncertainties about their relationships remain. Here, we revisit the phylogenetic evidence based on a detailed morphological re-evaluation of all the major extant batomorph clades (skates and rays), including several holomorphic fossil taxa from the Palaeozoic, Mesozoic and Cenozoic, and an extensive out-group sampling, which includes sharks, chimaeras and several other fossil chondrichthyans. The parsimony and maximum-likelihood analyses found more resolved but contrasting topologies, with the Bayesian inference tree neither supporting nor disfavouring any of them. Overall, the analyses result in similar clade compositions and topologies, with the Jurassic batomorphs forming the sister clade to all the other batomorphs, whilst all the Cretaceous batomorphs are nested within the remaining main clades. The disparate arrangements recovered under the different criteria suggest that a detailed study of Jurassic taxa is of utmost importance to present a more consistent topology in the deeper nodes, as issues continue to be present when analysing those clades previously recognized only by molecular analyses (e.g., Rhinopristiformes and Torpediniformes). The consistent placement of fossil taxa within specific groups by the different phylogenetic criteria is promising and indicates that the inclusion of more fossil taxa in the present matrix will likely not cause loss of resolution, therefore suggesting that a strong phylogenetic signal can be recovered from fossil taxa.
Book
Full-text available
The table and provided download links below are intended for informational use in Chondrichthyan research. The allocation aims for faciliating to find species numbers and most recent information on taxonomic changes. We will regularly update the table and download links at lest twice annually. The updates will be announced on facebook (https://www.facebook.com/sharkreferences) and in our monthly newsletter (sign up here: https://eepurl.com/sJNGb). The Excel sheet allows for the application of individual filter- and sorting options. The list of described spsecies complements taxonomic information for the list of valid species by providing synonyms and / or new taxonomic combinations.
Article
Full-text available
The dark-mouth skate, Raja arctowskii Dollo, 1904 from Antarctic waters is an extraordinary case in skate taxonomy. For more than 100 years, this species has been known only from three empty egg capsules and the species as such has remained undescribed due to the lack of specimens that could be assigned to Dollo’s small capsules. Since trawled egg capsules and an egg capsule containing a near-term embryo became available, it finally was possible to connect specimens with the empty egg capsules and completely describe Dollo’s R. arctowskii with detailed external morphology, skeletal features, clasper morphology, and clasper skeleton and assign it to the genus Bathyraja Ishiyama, 1958a. Bathyraja arctowskii is one of the smallest known species of Bathyraja, attaining only a 61 cm total length (TL). It is characterized by an at least partly, usually completely medium to dark grayish pigmented mouth cavity, as well as the often dark underside of the nasal curtain from very small juvenile stages onwards. It further differs from most congeners in Antarctic and Subantarctic waters in the absence of thorns on the dorsal disc. It appears to be a wide-ranging, circumantarctic species found in the Atlantic, Pacific, and Indian Ocean sectors of the Southern Ocean. The species seems to be locally common at least in the Atlantic sector, with up to 94 juvenile to subadult specimens caught in one single haul.
Article
Full-text available
With its theoretical basis firmly established in molecular evolutionary and population genetics, the comparative DNA and protein sequence analysis plays a central role in reconstructing the evolutionary histories of species and multigene families, estimating rates of molecular evolution, and inferring the nature and extent of selective forces shaping the evolution of genes and genomes. The scope of these investigations has now expanded greatly owing to the development of high-throughput sequencing techniques and novel statistical and computational methods. These methods require easy-to-use computer programs. One such effort has been to produce Molecular Evolutionary Genetics Analysis (MEGA) software, with its focus on facilitating the exploration and analysis of the DNA and protein sequence variation from an evolutionary perspective. Currently in its third major release, MEGA3 contains facilities for automatic and manual sequence alignment, web-based mining of databases, inference of the phylogenetic trees, estimation of evolutionary distances and testing evolutionary hypotheses. This paper provides an overview of the statistical methods, computational tools, and visual exploration modules for data input and the results obtainable in MEGA.
Article
Recent studies show the need for defined methods of systematically studying and describing skates. Disc width is proposed as the basis for proportional measurements of various parts of the disc, tail, fins, and head; of distances between certain spines; and of dimensions of ocellus. Methods are proposed for measurements of the cranium and the egg-capsule, and for counting vertebrae, pelvic radials, tooth rows, numbers of spines, rows of alar and malar hooks, and turns in the valvular intestine. Suggestions are given for description of spines, of prickles in various specific regions, of coloration, of cranium, of clasper, and of egg-capsules.
Article
Skates (Rajidae) are unique among chondrichthyans for their high species diversity and morphological conservatism. To elucidate phylogenetic interrelationships within this taxon, we surveyed a wide range of morphological character complexes under the premise that characters within different character complexes are constrained in different ways and would thus reveal a robust phylogeny. Maximumparsimony analysis employing 31 taxa, including three outgroups, and 55 characters produced 20 equally parsimonious trees of 160 steps (consistency index = 0.681, retention index = 0.850, homoplasy index = 0.462, and rescaled consistency index = 0.579). The strict consensus tree divided rajids into two major clades. The first, Rajinae, consisted of two partially resolved clades and one fully resolved clade and was defined by three ambiguous character states: (1) scapulocoracoids that lack an anterior bridge; (2) claspers that are distally expandible; and (3) claspers that posses the component rhipidion. The taxon comprises three tribes, 15 genera (seven elevated from subgenera of Raja and Gurgesiella), and 149 species. The second major clade, Arhynchobatinae, was nearly fully resolved and was defined by two unambiguous character states: (1) basihyal cartilages that possess lateral extensions; and (2) claspers that possess the component projection. The taxon comprises two tribes, 11 genera, two genera elevated from subgenera of Raja, and 79 species. The strict consensus tree revealed considerable parallelisms in morphological evolution within rajids. Some parallelisms, such as reduction of the rostral cartilage and concomitant forward extension of pectoral radials and muscles and enlarged nasal capsules, appear to be adaptations for deep-sea benthic habitats. The closest relatives of rajids, Rhinobatos, Zapteryx, and Trygonorrhina, are limited to shallow water. Thus, it is likely that ancestral rajids had a similar habitat and that subsequently rajids made multiple radiations into the deep sea and developed flexible snouts for grubbing in soft substrates and enlarged nasal rosettes for increased chemosensistivty in regions with little light.