ArticlePDF Available

Withania somnifera Root Extract Inhibits Mammary Cancer Metastasis and Epithelial to Mesenchymal Transition

Authors:

Abstract and Figures

Though clinicians can predict which patients are at risk for developing metastases, traditional therapies often prove ineffective and metastatic disease is the primary cause of cancer patient death; therefore, there is a need to develop anti-metastatic therapies that can be administered over long durations to specifically inhibit the motility of cancer cells. Withaniasomnifera root extracts (WRE) have anti-proliferative activity and the active component, Withaferin A, inhibits the pro-metastatic protein, vimentin. Vimentin is an intermediate filament protein and is part of the epithelial to mesenchymal transition (EMT) program to promote metastasis. Here, we determined whether WRE standardized to Withaferin A (sWRE) possesses anti-metastatic activity and whether it inhibits cancer motility via inhibition of vimentin and the EMT program. Several formulations of sWRE were created to enrich for Withaferin A and a stock solution of sWRE in EtOH could recover over 90% of the Withaferin A found in the original extract powder. This sWRE formulation inhibited breast cancer cell motility and invasion at concentrations less than 1µM while having negligible cytotoxicity at this dose. sWRE treatment disrupted vimentin morphology in cell lines, confirming its vimentin inhibitory activity. To determine if sWRE inhibited EMT, TGF-β was used to induce EMT in MCF10A human mammary epithelial cells. In this case, sWRE prevented EMT induction and inhibited 3-D spheroid invasion. These studies were taken into a human xenograft and mouse mammary carcinoma model. In both models, sWRE and Withaferin A showed dose-dependent inhibition of tumor growth and metastatic lung nodule formation with minimal systemic toxicity. Taken together, these data support the hypothesis that low concentrations of sWRE inhibit cancer metastasis potentially through EMT inhibition. Moreover, these doses of sWRE have nearly no toxicity in normal mouse organs, suggesting the potential for clinical use of orally administered WRE capsules.
Content may be subject to copyright.
Withania somnifera Root Extract Inhibits Mammary
Cancer Metastasis and Epithelial to Mesenchymal
Transition
Zhen Yang1, Anapatricia Garcia2, Songli Xu1, Doris R. Powell3, Paula M. Vertino3, Shivendra Singh4, Adam
I. Marcus1*
1 Department of Hematology and Medical Oncology, Winship Cancer Institute of Emory University, Emory University School of Medicine, Atlanta, Georgia,
United States of America, 2 Yerkes National Primate Research Center, Emory University School of Medicine, Atlanta, Georgia, United States of America,
3 Department of Radiation Oncology, Winship Cancer Institute of Emory University, Emory University School of Medicine, Atlanta, Georgia, United States of
America, 4 Department of Pharmacology & Chemical Biology, and University of Pittsburgh Cancer Institute, University of Pittsburgh School of Medicine,
Pittsburgh, Pennsylvania, United States of America
Abstract
Though clinicians can predict which patients are at risk for developing metastases, traditional therapies often prove
ineffective and metastatic disease is the primary cause of cancer patient death; therefore, there is a need to develop
anti-metastatic therapies that can be administered over long durations to specifically inhibit the motility of cancer
cells. Withania somnifera root extracts (WRE) have anti-proliferative activity and the active component, Withaferin A,
inhibits the pro-metastatic protein, vimentin. Vimentin is an intermediate filament protein and is part of the epithelial to
mesenchymal transition (EMT) program to promote metastasis. Here, we determined whether WRE standardized to
Withaferin A (sWRE) possesses anti-metastatic activity and whether it inhibits cancer motility via inhibition of vimentin
and the EMT program. Several formulations of sWRE were created to enrich for Withaferin A and a stock solution of
sWRE in EtOH could recover over 90% of the Withaferin A found in the original extract powder. This sWRE
formulation inhibited breast cancer cell motility and invasion at concentrations less than 1µM while having negligible
cytotoxicity at this dose. sWRE treatment disrupted vimentin morphology in cell lines, confirming its vimentin
inhibitory activity. To determine if sWRE inhibited EMT, TGF-β was used to induce EMT in MCF10A human
mammary epithelial cells. In this case, sWRE prevented EMT induction and inhibited 3-D spheroid invasion. These
studies were taken into a human xenograft and mouse mammary carcinoma model. In both models, sWRE and
Withaferin A showed dose-dependent inhibition of tumor growth and metastatic lung nodule formation with minimal
systemic toxicity. Taken together, these data support the hypothesis that low concentrations of sWRE inhibit cancer
metastasis potentially through EMT inhibition. Moreover, these doses of sWRE have nearly no toxicity in normal
mouse organs, suggesting the potential for clinical use of orally administered WRE capsules.
Citation: Yang Z, Garcia A, Xu S, Powell DR, Vertino PM, et al. (2013) Withania somnifera Root Extract Inhibits Mammary Cancer Metastasis and
Epithelial to Mesenchymal Transition. PLoS ONE 8(9): e75069. doi:10.1371/journal.pone.0075069
Editor: Michael Klymkowsky, University of Colorado, Boulder, United States of America
Received March 1, 2013; Accepted August 9, 2013; Published September 12, 2013
Copyright: © 2013 Yang et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by an R21 from the National Center for Complementary and Alternative Medicine (1R21AT005231) awarded to AIM,
the Godfrey Charitable Trust, and Golfer's Against Cancer. This work was also supported by a P30 CCSG awarded to the Winship Cancer Institute
(3P30CA138292). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
* E-mail: aimarcu@emory.edu
Introduction
Breast cancer is one of the most common cancers among
women in the United States and the second leading cause of
female cancer death [1]. Greater than 90% of breast cancer
patient deaths are attributed to metastatic disease where the
primary tumor has invaded distant sites. Since these metastatic
cells are often highly aggressive, difficult to detect, and
chemoresistant [2], one therapeutic strategy could be to
prevent metastatic disease rather than treat it once it occurs.
The metastatic process can be categorized into three stages-
tumor cell invasion into surrounding tissue, intravasation into
blood or lymphatic vessels, and extravasation into a new host
environment [3-5]. In many cases, metastatic cells undergo
epithelial-to-mesenchymal transition (EMT), where genetic and
epigenetic events cause a polarized epithelial cell to become
migratory and invasive [6]. At the molecular level, EMT causes
a gain of vimentin and fibronectin expression, and loss of E-
cadherin at the cell membrane [7,8]. Accumulating evidence
PLOS ONE | www.plosone.org 1 September 2013 | Volume 8 | Issue 9 | e75069
shows that EMT is a major mechanism driving breast cancer
progression and metastasis [9-13].
Withania somnifera (Ashwagandha) plants are widely used in
East Indian medicine. The W. somnifera root extract (WRE) is
composed of 14 compounds known as withanolides, with
Withaferin A being the most prominent [14-16]. Withaferin A is
a steroidal lactone that induces apoptosis and inhibits tumor
growth by targeting signaling proteins such as P53, FOXO3A,
Notch-1, Hsp90 and STAT3 [17-22]. Withaferin A treatment
leads to cell cycle arrest, increased reactive oxidative stress
[23-26], inhibition of the JAK/STAT pathway [27], inhibition of
angiogenesis [28], and modified cell shape and behavior [29].
Withaferin A also possesses potent anti-invasive activity, which
could potentially be due to its interaction with the pro-migratory
protein vimentin.
Vimentin is type III intermediate filament and classical EMT
protein marker [30]. Though vimentin functions in maintaining
cell structure, it is also a highly dynamic polymer that
assembles and dissembles in a motile cell. When cells undergo
EMT, vimentin expression is increased and this is thought to
provide cells with a more mesenchymal, pro-motile phenotype
[31]. The precise role of vimentin during EMT and development
is unclear, since a vimentin mouse knockout model did not
show severe developmental defects [32]. Additional studies
however did go on to show that these mice had impaired
fibroblast wound healing, and a reduced capacity to contract a
collagen network [33].
Withaferin A is proposed to bind to vimentin through a
covalent modification of cysteine 328 [34], leading to changes
in vimentin morphology and phosphorylation [29]; however,
other data show that mutation of cysteine 328 does not impact
Withaferin A-induced vimentin inhibition [29]. When given intra-
peritoneally (IP), Withaferin A effectively inhibits breast cancer
metastasis and has nearly no observable toxicity [35].
Less is known about the anti-tumor activity of the Withaferin
A parent root extract, WRE. Similar effects are observed on
tumor growth, cell cycle, and angiogenesis with WRE treatment
[36-40] along with immunomodulatory effects in colon and lung
cancer [41,42]. Nevertheless, studies directly comparing WRE
to Withaferin A have not been performed, and its anti-
metastatic activity has not been well studied. Furthermore,
WRE possesses several advantages over Withaferin A, since it
can be given orally in a capsule and the active withanolides
could have pharmacological synergy; therefore, we wanted to
determine the anti-metastatic efficacy of WRE standardized
(sWRE) to the pure active component, Withaferin A, in breast
cancer. We showed that sWRE can inhibit human breast
cancer cell invasion in vitro and metastasis in both allograft and
xenograft breast cancer mouse models, similar to the pure
small molecule Withaferin A. sWRE induces vimentin
reorganization and morphologic cellular changes in human
breast cancer cells and, importantly, inhibits EMT induction in
normal human mammary epithelial cells. Our results shed light
on the potential of sWRE as a novel complementary alternative
medicine used as an anti-metastatic preventative therapy in
high-risk breast cancer patients.
Methods
Reagents and antibodies
WFA was purchased from Chromadex (Irvine, CA) and WRE
was provided by Verdure Sciences (Noblesville, IN) with the
certificate of analysis stating that it is free of heavy metals,
bacteria, and fungus. The antibody against vimentin was
purchased from Sigma (St. Louis, MO), E-cadherin from BD
Biosciences (Bedford, MA), fibronectin from Abcam
(Cambridge, MA), and GAPDH from Cell Signaling (Beverly,
MA).
sWRE preparation
100% ethanol was heated to 60°C and then mixed with WRE
to the concentration of 250mg/ml for 30 minutes in a glass
beaker. Distilled H2O was then slowly added to lower the
ethanol concentration to 90%, and stirring continued for
another 30 minutes. The mixture was then spun at 4000rpm in
a centrifuge for 15 minutes at room temperature and the
supernatant was collected. The supernatant was then passed a
0.22µm filter, aliquoted, and kept at -80°C for future use.
Cell lines and culture conditions
Human MDA-MB-231 (ATCC # HTB-26), MCF-7 (# HTB-22)
and T47D (# HTB-133) breast cancer cell lines were purchased
from the American Type Culture Collection (ATCC, Manassas,
VA). Hs578-T, HCC1806 and MDA-MB-468 human breast
cancer cell lines were provided by Dr. O, Regan (Emory
University [45]). Human MCF10A mammary epithelial cell line
was provided by Dr. Vertino (Emory University [45]). Murine
breast carcinoma 4T1 cells were provided by Dr. Dewhirst
(Duke University [35,45]). T47D and HCC1806 were grown in
RPMI 1640 with 10% FBS. MDA-MB-231, MCF-7, Hs578-T,
MDA-MB-468 and 4T1 were grown in DMEM 10% FBS.
MCF10A cells were grown in DMEM/F12 supplemented with
5% FBS, 20ng/ml EGF, 0.5µg/ml Hydrocortisone, 100ng/ml
cholera toxin, and 10µg/ml insulin. All cell lines were
maintained in a humidified incubator at 37°C in a 5% CO2
atmosphere.
Cytotoxicity assay
The Promega CellTiter 96® AQueous Non-Radioactive Cell
Proliferation Assay (MTS) was performed for determining the in
vitro cytotoxicity of sWRE. Briefly, cells were cultured in 96-well
plates overnight and then treated with sWRE at the indicated
concentration for 72 hours. Cell viability was assessed by
determining the absorbance at 490nm as described by the
manufacturer (Promega, Madison, WI). Cell viability was
expressed as: Aexp group /Acontrol X 100.
In vitro wound healing assay
A cell migration wounding assay was performed as
described previously [43]. Cells were cultured in 6 wells plate to
100% confluency. After wounding with a pipette tip, cells were
washed with PBS and new media with the respective
concentration of sWRE was added. Cells then were allowed to
migrate for 24 hours at 37°C. Images of cells were taken at
Root Extract Inhibits Metastasis
PLOS ONE | www.plosone.org 2 September 2013 | Volume 8 | Issue 9 | e75069
time 0 and 24 hours with an Olympus IX51 widefield
microscope (Center Valley, PA) at 5X magnification with a
Hamamatsu Orca ER CCD camera.
Matrigel invasion assay
Cell invasion was assayed using the Roche xCelligence
RTCA DP (Real-Time Cell Analyzer Dual Plate) Instrument
(Indianapolis, IN). DMEM with 10% FBS was added into the
bottom chamber of a CIM-Plate 16. 250µg/milliliter Matrigel (BD
Biosciences) was polymerized in the wells of the top chamber
for 1 hour at 37°C. Serum free media was added to the top
chamber, incubated for 30 minutes at 37°C, and a background
measurement was taken. Cells were pretreated with different
concentrations of sWRE in serum free media over night. These
cells were then added to the top chamber and the plate was
incubated in 37°C with the xCelligence plate reader.
Impedance measurements were taken in the bottom well and
the impedance increase correlates to increasing numbers of
migrated cells. Changes in impedance, which is reflected by
the cell invasion index values, were monitored for at least 24
hours.
Western blotting
Protein levels in cell lysates were measure using a standard
BCA assay. Cell lysates in sample buffer were separated on a
10% SDS-PAGE gels, and were transferred to PVDF
membranes (Bio-Rad, Hercules, CA). After blocking with 5%
fat-free milk-containing TBST, the membranes were separately
incubated with antibodies to vimentin, E-cadherin, fibronectin,
and GAPDH at room temperature for 2 hours. Membranes
were then washed and incubated with horseradish peroxidase
conjugated secondary antibodies for 1 hour. The bands were
detected using Amersham ECL Plus reagents and then
exposed to film.
Confocal imaging
Cells were cultured on glass cover slips and treated with
sWRE for 24 hours. Cells were then fixed and processed for
immunofluorescence microscopy as previously described [35].
Cells were stained using a primary anti-vimentin antibody and
secondary Alexa 488-conjugated goat anti-mouse IgG.
Coverslips were mounted onto slides and imaged using Zeiss
LSM510 META confocal microscope with a 40X Plan-
NEOFLUAR oil objective (NA 1.3).
Real-time PCR
Total RNA was isolated from cells using the RNeasy Mini kit
(Qiagen, Valencia, CA) and pretreated with DNase I. cDNA
was then synthesized using random hexamer primers and
MMLV- reverse transcriptase. Target-specific primers were
used to amplify cDNA in triplicate using a reaction mixture that
contained 1µl of the appropriately diluted cDNA sample,
0.2µmol/l primers and 12.5µl of IQ SYBR Green supermix (Bio-
Rad). 18S rRNA was amplified from the same samples as an
internal control. The reaction was subjected to a hot start for 3
min at 95°C and 40 cycles of 95°C, 10 s; 55°C (18S) or 63°C
(vimentin), 30 sec. Primers for real-time PCR analysis were for
vimentin: 5’ AATGGCTCGTCACCTTCGTGAA3’ and 5’
CAGATTAGTTTCCCTCAGGTTCAG3’ and for 18S, 5’
GAGGGAGCCTGAGAAACG G3’ and 5’
GTCGGGAGTGGGTAATTT GC3’
Three dimensional spheroid invasion assay
Agarose-coated plates were made by loading each well with
0.75% agarose in DMEM with 10% FBS. After gelation,
MCF10A cells were added into the wells and incubated at
37°C. Cell spheroids formed within 3-5 days. 5-10 spheroids
were mixed with Matrigel in DMEM or DMEM plus sWRE. The
mixture was placed in the middle of a 35 mm imaging petri dish
with a #1.5 coverslip (MatTek Corporation) and then
sandwiched on top with an additional cover slip. The dish was
then placed in a 37 °C incubator for 30 min to allow for Matrigel
polymerization, then 2ml of DMEM with 10% FBS was added.
The dish was transferred to the live cell PerkinElmer Ultraview
ERS spinning disk confocal microscope [44] and images were
acquired using 20X Zeiss objective (NA 0.75) every 20 minutes
for 24 hours with a Hamamatsu Orca ER camera.
In vivo sWRE toxicity study
Eight week old female Balb/c mice were purchased from
Harlan and housed in the Winship Cancer Animal Models
facility according to our approved IACUC protocol. Mice were
kept in groups of five per cage and fed with AIN76A control diet
and water ad libitum. The mice were randomized into 3 groups
of 3 mice per group and treated by oral gavage with either
vehicle (9% ethanol) or vehicle containing sWRE at 4, and
8mg/kg body weight, 3 times a week for 4 weeks. Mice body
weight was recorded each time after oral gavage. After 4
weeks of treatment, mice were sacrificed and organs (heart,
lung, liver, spleen and kidney) were collected and sent for
pathological analysis. Toxic effects were evaluated by a
blinded veterinarian pathologist based upon the presence of
inflammation, necrosis and fibrosis using a scale from normal
(1+) to moderate (3+).
Mammary carcinoma model
All mouse studies were performed in accordance with our
approved Emory University Institutional Animal Care and Use
Committee protocol. Eight weeks old female Balb/c mice were
divided randomly into 4 groups with 10 mice in each group. 106
4T1 cells in PBS were injected subcutaneously into the
mammary fat pad of each mouse. One week after injection,
sWRE were given by oral gavage with either vehicle or vehicle
containing sWRE at 1, 4, and 8mg/kg body weight 3 times a
week for 4 weeks. Withaferin A was intraperitoneally injected
by dissolving in 10% DMSO, 20% Cremophor-EL and 50%
PBS at 1, 4, and 8mg/kg 3 times a week for 4 weeks. The
tumor volume was recorded before gavage using calipers with
volume=(width)2 x length/2. Mice were sacrificed after 4 weeks
of treatment and metastatic lung nodules were counted under a
dissecting microscope. For H&E staining, the lung and primary
tumor from vehicle and sWRE-treated mice were fixed in 10%
neutral-buffered formalin, processed, embedded in paraffin,
and sectioned at 5µm thickness. Representative tumor sections
Root Extract Inhibits Metastasis
PLOS ONE | www.plosone.org 3 September 2013 | Volume 8 | Issue 9 | e75069
from vehicle control, sWRE-treated, and Withaferin A-treated
mice were processed for H&E staining.
Xenograft mouse breast cancer model
All mouse studies were performed in accordance with our
approved Emory University Institutional Animal Care and Use
Committee protocol. Eight week old female athymic nude
Foxn1nu mouse were purchased from Harlan and housed in
the Winship Cancer Animal Models facility. Mice were kept in
groups of five per cage and fed with AIN76A control diet and
water ad libitum. Mice were divided randomized into 7 groups
with 10 mice in each group and 106 MDA-MB-231 cells in PBS
were injected subcutaneously into the mammary fat pad of
each mouse. One week after injection, mice were treated with
vehicle (9% ethanol), vehicle containing sWRE at 1, 4, and
8mg/kg by oral gavage, or intraperitoneally injected with
Withaferin A dissolved in 10% DMSO, 20% Cremophor-EL and
50% PBS at 1, 4, and 8mg/kg 3 times a week for 4 weeks. The
tumor volume was recorded before gavage. Mice were
sacrificed after 4 weeks of treatment and metastatic lung
nodules were counted under a dissecting microscope. For H&E
staining, the lung and tumor from vehicle and sWRE-treated
mice were fixed in 10% neutral-buffered formalin, processed,
embedded in paraffin and sectioned at 5µm thickness.
Representative tumor sections from control and sWRE-treated
mice were processed for H&E staining.
Statistical Analysis
Data were analyzed statistically using GraphPad Prism for
Windows (version 5). One-way ANOVA was carried out to
compare the mean of lung nodules among the experimental
groups. Linear mixed effects model was used to compare the
mean tumor volumes among the groups. Values of p<0.05
were considered significant.
Results
WRE Standardization, Solubility, and Cytotoxicity
WRE powder was solubilized in H2O or 90% ethanol (EtOH)
at different concentrations to determine optimal conditions to
standardize WRE (sWRE) to the pure small molecule
Withaferin A. The concentration of Withaferin A in each sWRE
formulation was measured by HPLC (Figure 1A) and the
recovery rate of Withaferin A after solubulization was
calculated for each sample (Figure 1B). The content of
Withaferin A compared to other withanolides using HPLC is
shown in Table 1. When sWRE at 250mg/ml was dissolved in
water, the Withaferin A recovery rate was 4%. The largest
percent recovery of Withaferin A in water was 16%, observed
at a starting concentration of 10 mg/ml sWRE. In contrast,
when WRE powder was dissolved in 90% EtOH the Withaferin
A recovery rate ranged from 80-92%. These results show that
re-solubilization of sWRE in 90% EtOH is clearly superior to
that in H2O. To estimate the long-term stability of the WRE
stock solution in 90% EtOH, HPLC analysis was done on WRE
after 6 and 12 months of storage at -80°C. The results show
that about 90% of the initial Withaferin A can be detected after
6 months, and about 80% after 12 months (Figure 1C, D).
To assess cytotoxicity, breast cancer cell lines were treated
with increasing concentrations of Withaferin A-standardized
WRE (sWRE) for 24 and 72 hours (Figure 2A, B). Among the
six cell lines tested, four (MDA-MB-468, HCC 1806, Hs587-T,
and MDA-MB-231) are triple negative breast cancer cell lines
[45]. Since Withaferin A is a vimentin-targeting agent [30,34],
vimentin expression along with other EMT markers were
assessed in the cell lines. Two of the four triple negative cell
lines, (Hs578-T and MDA-MB-231) were vimentin-positive and
all other cell lines were vimentin-negative. These vimentin
positive cell lines also exhibited EMT induction since they
displayed E-cadherin loss and were fibronectin positive (Figure
2C). Interestingly, different sensitivity to sWRE was observed
across the six cell lines, where the two most sensitive cell lines,
Hs578-T and MDA-MB 231, were vimentin-positive with a 72
hour IC50 of 0.5µM and 0.4µM respectively (Figure 2B). The
vimentin-negative cell lines had IC50s that ranged from 1.2µM
to 4.0µM. To probe this, cytotoxicity assays were performed in
isogenic control and vimentin siRNA depleted MDA-MB 231
cells. In this case, vimentin depleted cells show a minor
Figure 1. Withaferin A recovery in sWRE. sWRE powder
was dissolved in different solvents and the concentration (A)
and recovery rate (B) of Withaferin A in sWRE was measured
by HPLC. The stability of Withaferin A in sWRE (90% EtOH
stock solution) over time is shown in a bar graph with the
absolute (C) and relative (D) Withaferin A concentration.
doi: 10.1371/journal.pone.0075069.g001
Table 1. Withanolides in WRE by HPLC.
Withanolides Concentration (mg/ml) Percentage (%)
Withaferin A 5.88 79.03
Withanoside V 0.356 4.78
12-Deoxywithastramonolide 1.06 14.25
Withanolide A 0.136 1.83
Withanolne 0.0137 0.18
Total Withanolides 7.44 100.00
doi: 10.1371/journal.pone.0075069.t001
Root Extract Inhibits Metastasis
PLOS ONE | www.plosone.org 4 September 2013 | Volume 8 | Issue 9 | e75069
decrease in sWRE cytotoxicity compared to isogenic control
cells (Figure 2D).
sWRE inhibits breast cancer cell motility and invasion,
and disrupts vimentin morphology
We have previously shown the Withaferin A inhibits breast
cancer cell motility and metastasis [35]; therefore, we sought to
determine if sWRE shows anti-invasive efficacy. The effect of
sWRE on the cell motility of triple negative breast cancer cells
(human MDA-MB-231 and mouse 4T1) was tested using a
wound healing assay. WRE inhibits cell motility in a dose-
dependent manner after 24 hours of treatment at 0.5µM in both
cell lines (Figure 3A,B). An expanded experiment at lower
doses in MDA-MB 231 cells shows inhibition of cell motility at
0.25 µM as well (Figure S1). We then wanted to determine how
sWRE impacts cell motility when vimentin protein is absent.
This experiment was first attempted in MCF7 and MDA MB 468
breast carcinoma cells, both of which do not have detectable
vimentin by western blotting; however in these cases, cells
were also not motile so the experiment could not be performed
(data not shown). Instead, we used the lung epithelial cell line,
BEAS-2B, which lacks vimentin (Figure S1-B) and shows some
motility. sWRE had a 24 hr anti-proliferative IC50 of 2.9µM and
a 48 hr IC50 of 1.9 µM (Figure S1-C). In a wounding assay,
lower doses of sWRE (0.125 to 1 µM) below the IC50 had nearly
no impact on cell motility (Figure S1-D). It was not until
treatment with 2 µM sWRE which is near the 24 hr anti-
proliferative IC50, did we observe appreciable inhibition of
motility (Figure S1-D).
The anti-invasive activity of sWRE was tested using a real
time Matrigel invasion assay in a Boyden chamber. sWRE was
again able to significantly inhibit cell invasion in both cell lines
at doses as low as 0.25µM in 4T1 and 0.5µM in MDA-MB-231
cells (Figure 3C, D). These results show that sWRE inhibits cell
motility and is anti-invasive in triple negative breast cancer
cells.
Since Withaferin A inhibits vimentin [30,34], we explored
whether sWRE has similar vimentin-disrupting ability. Vimentin
immunofluorescence in control MDA-MB-231 cells show that
vimentin is networked throughout the spindle-shaped
cytoplasm; however, upon sWRE treatment (0.5µM and 1.0µM)
for 16 hours, cells were not as elongated and the vimentin
network was abolished (Figure 3E). Instead, vimentin
accumulated as a perinuclear bundle in most cells, which is
similar to the effect of pure Withaferin A [35]. Furthermore,
sWRE did not decrease total cellular protein levels until 48 hrs
of treatment (Figure S2), suggesting that this is not due to a
defect in total protein synthesis. Therefore, based upon these
observations we conclude that sWRE also possesses vimentin
inhibitory activity at low doses.
Figure 2. sWRE cytotoxicity in breast cancer cell lines. (A and B) Line graphs showing the % survival of six breast cancer cell
lines treated with increasing concentrations of sWRE for 24 (A) and 72 (B) hours. (C) Western blot showing EMT markers in
different breast cancer lines. Triple negative breast cancer cell lines are indicated with an asterisk. (D) (left) Western blot showing
successful vimentin siRNA depletion (right) Cytotoxciity assay using sWRE in isogenic control and vimentin siRNA depleted cells.
doi: 10.1371/journal.pone.0075069.g002
Root Extract Inhibits Metastasis
PLOS ONE | www.plosone.org 5 September 2013 | Volume 8 | Issue 9 | e75069
Figure 3. sWRE inhibits migration and invasion in MDA-MB-231 and 4T1 cell lines. (A and B) Cell wounding assay in (A)
MDA-MB-231 and (B) 4T1 cells treated with increasing concentrations of sWRE for 24 hours. (C and D) Line graph showing the rate
of cellular invasion through Matrigel embedded in a Boyden chamber in (C) MDA-MB-231 and (D) 4T1 cells treated with increasing
concentrations of sWRE. (E) Confocal immunofluorescence imaging of vimentin (green), actin (red), and DAPI (blue) in MDA-
MB-231 cells treated with 9% EtOH control, 0.5µM or 1.0µM sWRE.
doi: 10.1371/journal.pone.0075069.g003
Root Extract Inhibits Metastasis
PLOS ONE | www.plosone.org 6 September 2013 | Volume 8 | Issue 9 | e75069
sWRE prevents TGFβ-induced EMT
Since vimentin plays a key role in EMT, we wanted to test if
sWRE could inhibit EMT and EMT-induced motility in breast
cancer. To test this, we used MCF10A cells, where treatment
with 4ng/ml TGFβ causes these cells to undergo EMT, as
assessed by an increase in the mesenychmal markers vimentin
and fibronectin, and loss of the epithelial marker, E-cadherin
[8,9]. These data show that sWRE inhibits MCF10A motility in a
wound healing assay with TGFβ (Figure 4C) at doses similar to
those used in 4T1 and MDA-MB-231cell lines (Figure 3). To
assess how sWRE impacts EMT, MCF10A cells were treated
with TGFβ in the presence of sWRE or Withaferin A. TGFβ
alone induced vimentin and fibronectin protein expression and
decreased E-cadherin protein levels indicating successful EMT
induction. In contrast, treatment with 500nM sWRE or 500nM
Withaferin A potently inhibited TGFβ-induced EMT by keeping
vimentin and fibronectin at pre-induction levels and increasing
E-cadherin levels (Figure 4A, B). To determine if this occurs at
the transcriptional level, real-time PCR of the vimentin
transcript was performed and these results showed that TGFβ
increased vimentin mRNA as expected, but sWRE did not
impact vimentin mRNA levels (Figure 4D), similar to that
observed using Withaferin A [30]. Therefore the results show
that sWRE does not inhibit vimentin expression at the mRNA
level but rather on the protein level.
These studies were then moved into a spheroid model of
invasion to determine if sWRE inhibits EMT-induced invasion.
In this model, TGFβ induced potent invasion into the Matrigel
extracellular matrix using live cell imaging to visualize invasion
(Figure 4E, Movie S1); however, upon treatment with doses as
low as 100nM sWRE, invasion was potently inhibited (Figure
4E, Movie S2). Taken together, these results show that sWRE
can inhibit EMT and EMT-induced motility and invasion.
sWRE in vivo toxicity
To study the anti-metastatic efficacy of sWRE in vivo, sWRE
toxicity was first assessed in normal female BALB/c mouse.
Mice were given either 4 or 8 mg/kg sWRE in 9% EtOH and the
mean body weight gain after 35 days in treated mice were not
significantly different from the control group given 9% EtOH
alone (Figure 5A). After four weeks of treatment, the histology
of the heart, lung, liver, spleen and kidney were graded for
fibrosis, necrosis and inflammation. Histological data show no
significant difference between sWRE-treated and vehicle
control groups (Figure 5B, C).
sWRE anti-metastatic efficacy
To determine the anti-metastatic efficacy of sWRE and
compare it to Withaferin A in a mouse model, the mouse
mammary carcinoma 4T1 metastatic model was used. This
model develops metastatic lesions in the lung, liver, and spleen
4-6 weeks post-injection of cells into the mammary fat pad.
Mice were divided randomly into 4 groups with 10 mice in each
group, and sWRE was given by oral gavage and Withaferin A
by i.p. injection at 1, 4, and 8 mg/kg 3 times per week for 4
weeks. The dose range was selected based on the previous
sWRE toxicity experiment in the BALB/c mouse (Figure 5). At
all doses, primary tumor volume was decreased after 36 days
of treatment with sWRE or Withaferin A (Figure 6A, B).
Representative gross specimens of primary tumors show that
both sWRE and Withaferin A treated tumors were smaller
(Figure 6C). Importantly, the number of metastatic lung nodules
significantly decreased in both 4 and 8 mg/kg groups in sWRE
and Withaferin A treated mice (Figure 6D, E, and examples in
Figure 6G). H&E staining confirmed the presence of micro-
metastatic lesions in the lung (Figure 6F).
To further test the anti-metastatic efficacy of sWRE, a similar
experiment using a xenograft model with human metastatic
breast cancer MDA-MB-231 cells was performed. Cells were
injected subcutaneously into the mammary fat pad of female
athymic nude mice. Mice were administrated sWRE by oral
gavage and Withaferin A by i.p. injection at concentration of 1,
4, and 8mg/kg 3 times a week for 4 weeks. Primary tumor
Figure 4. sWRE inhibits TGFβ1-induced EMT in MCF10A
cells. (A) Western blot of vimentin in TGFβ1-stimulated
MCF10A cells treated with increasing concentrations of sWRE.
(B) Western blot of vimentin, fibronectin, and E-cadherin in
TGFβ1 stimulated MCF10A cells treated with 500nM sWRE or
Withaferin A. (C) Cell migration in wound-healing assay with
increasing concentrations of WRE. (D) Relative vimentin
mRNA levels detected by real-time PCR in TGFβ1-stimulated
MCF10A cells treated with 500nM sWRE or WFA. (E) Live cell
time lapse images of MCF10A 3D spheroids embedded in
Matrigel and stimulated with TGFβ1. Cell were treated with 9%
EtOH control, or 100nM or 500nM sWRE.
doi: 10.1371/journal.pone.0075069.g004
Root Extract Inhibits Metastasis
PLOS ONE | www.plosone.org 7 September 2013 | Volume 8 | Issue 9 | e75069
volume was inhibited by sWRE at 4 and 8mg/kg doses.
Similarly Withaferin A treatment also resulted in a reduction in
tumor volume at 4 and 8mg/kg dose (Figure 7A, B).
Importantly, both sWRE and Withaferin A showed similar
efficacy and decreased the number of metastatic nodules in the
lung at 8 mg/kg (Figure 7C, D).
Discussion
Our data show that sWRE has similar anti-metastatic efficacy
to pure Withaferin A in two in vivo mouse models (Figures 6
and 7). Specifically, sWRE significantly decreased metastatic
lung nodule formation in the 4T1 model when given orally at 4
or 8 mg/kg and at 8 mg/kg in the MDA-MB-231 xenograft
model, where in general sWRE had a more graded, dose-
dependent effect on metastatic lung nodule formation. These
results are similar to those observed with pure Withaferin A,
which inhibited metastatic lung nodules at 4 and 8 mg/kg in
both models (Figures 6 and 7). Furthermore, sWRE had nearly
no toxicity based upon pathological analysis and monitoring of
mouse weight at 8 mg/kg (Figure 5), which is similar to the
previous observation that pure Withaferin A given i.p. also had
minimal toxicity at a similar concentration [35]. Therefore,
based upon these in vivo mouse studies we conclude that oral
Figure 5. Toxicity of sWRE in female BALB/c mice. (A) Relative body weight in mice treated with vehicle, or sWRE at 4mg/kg
and 8mg/kg. (B) Histological grading of inflammation, fibrosis, and necrosis in organs from mice treated with vehicle (9% EtOH) or
sWRE at 8mg/kg. (C) Representative images of H&E stained histological sections.
doi: 10.1371/journal.pone.0075069.g005
Root Extract Inhibits Metastasis
PLOS ONE | www.plosone.org 8 September 2013 | Volume 8 | Issue 9 | e75069
Figure 6. Anti-metastatic activity of sWRE and Withaferin A in an allograft breast cancer mouse model. (A and B) Mean
tumor volume in mice treated with 1, 4, 8mg/kg of (A) sWRE or (B) Withaferin A (WFA) (* p<0.05 compared to control). (C)
Representative images of the primary tumor in sWRE or WFA treated mice. (D and E) Bar graph showing the mean number of
metastatic lung nodules in (D) sWRE or (E) WFA-treated mice (* p<0.05 compared to control). (F) Representative H&E staining
images showing the histology of metastatic nodules in mouse lung; two examples shown. (G) Representative images of lung
metastatic nodules (black arrows) in mice treated with vehicle control (9% EtOH) or sWRE or WFA at 8mg/kg.
doi: 10.1371/journal.pone.0075069.g006
Root Extract Inhibits Metastasis
PLOS ONE | www.plosone.org 9 September 2013 | Volume 8 | Issue 9 | e75069
administration of sWRE has similar anti-metastatic efficacy as
pure Withaferin A. Furthermore, these data would suggest that
oral administration of WRE capsules that contain active
Withaferin A could retain anti-metastatic efficacy in a clinical
setting.
sWRE also inhibits cell motility and invasion in vitro at 0.5µM
(Figure 3), which is well below its cytotoxic 24hr IC50 of 8µM or
higher depending on the cell line (Figure 2). These data
suggest that its ability to inhibit cell motility is distinct from its
anti-proliferative activity, and thus may not be due to general
cytotoxicity. We propose that inhibition of motility, could occur
via vimentin inhibition, since we observed a prominent
disruption of vimentin morphology in cells treated at 0.5µM and
1µM sWRE. It was previously shown that Withaferin A can bind
directly to vimentin [28] and also disrupt vimentin morphology
[29,30,35]; therefore, these results with sWRE are consistent
with these previous studies showing vimentin inhibitory activity.
It is important to note that the role of vimentin in cell motility
has remained controversial. Numerous reports show that
vimentin is a classic EMT biomarker that is expressed in
aggressive cell lines and tumors [46-53], and correlates with
high grade cancer and metastatic disease [54-58];
Nevertheless, the precise molecular role of vimentin in cell
motility remains largely undefined and there are several reports
that induced vimentin expression in vimentin null cell lines does
not impact motility [59,60]. Thus, it is still debatable as to why
vimentin expression in certain contexts correlates with invasion
(e.g., metastatic disease) while in other systems re-expression
does not. Though Withaferin A and now sWRE are both shown
to disrupt vimentin, we cannot directly rule out the possibility
Figure 7. Anti-metastatic activity of sWRE and Withaferin
A in an MDA-MB-231 xenograft breast cancer model. (A
and B) Mean tumor volume in mice treated with 1, 4, 8mg/kg of
(A) sWRE or (B) WFA (*, p<0.05 compared to vehicle control).
Bar graph showing the mean number of metastatic lung
nodules in (C) sWRE or (D) WFA-treated mice compared to
vehicle control (9% EtOH; * indicated p<0.05 compared to
control).
doi: 10.1371/journal.pone.0075069.g007
that both treatments inhibit metastasis through a vimentin-
independent pathway.
sWRE can prevent EMT induction in the MCF10A EMT
model (Figure 4) at 0.5µM, whereby sWRE treatment reverses
vimentin and fibronectin induction and promotes E-cadherin
expression. Furthermore, sWRE also potently inhibits TGFβ
induced 3-D MCF10A spheroid invasion at both 0.1µM and
0.5µM (supplemental Movies). It remains unclear if the anti-
EMT efficacy of sWRE is tied to its ability to inhibit vimentin, but
one possibility is that vimentin inhibition by sWRE leads to its
degradation and consequently a reversal of the EMT program.
We did not observe changes in the vimentin transcript after
sWRE treatment; therefore, we do not suspect that sWRE
affects transcription of the EMT markers.
Though the major focus of these studies was on metastasis,
it is interesting to note that higher concentrations of sWRE
inhibited cell proliferation (Figure 2). Interestingly, the greatest
anti-proliferative activity was observed in cell lines that were
vimentin-positive suggesting a potential correlation between
vimentin expression and cytotoxicity. Though vimentin is
primarily linked to cell motility, there are reports that it functions
in proliferation [61-64] and perhaps that is responsible for the
observed cytotoxicity.
In triple negative breast cancers (estrogen, progesterone,
and HER-2 negative), vimentin expression is correlated with
poor prognosis as well as an aggressive and metastatic
phenotype [64-68]. We observed that two of the three triple
negative cell lines (MDA-MB-231 and Hs578-T) express
vimentin. These cell lines were also the most sensitive to
sWRE in cytotoxicity assays and sWRE inhibited metastasis in
the MDA-MB-231 xenograft model. Though this data set is
correlative and we cannot directly attribute the sensitivity to
vimentin expression, we believe that these efficacy data
suggest that sWRE has the potential to be used as an anti-
metastatic in vimentin-positive tumors. Additional
pharmacokinetic and pharmcodynamic data with sWRE will
likely prove to be useful and will be the focus of future work.
Supporting Information
Figure S1. (A) Wounding assay in MDA-MB 231 cells using
low concentrations of sWRE (B) Western blotting of vimentin in
MDA-MB 231 cells and BEAS-2B lung epithelial cells (C) MTT
anti-proliferative assay in BEAS-2B cells with sWRE(D)
Wounding assay in BEAS-2B lung epithelial cells using a range
of sWRE concentrations.
(PDF)
Figure S2. (A) BCA assay quantifying protein concentration
per cell in MDA-MB 231 cells after treatment at different
timepoints with sWRE (*p<0.05).To do this, the total protein
was divided by the number of cells in the well after treatment.
(B) BCA assay quantifying protein levels per well after
treatment at different timepoints with sWRE (*p<0.05).
(PDF)
Movie S1. Live cell imaging of MCF10A spheroids embedded
in Matrigel and treated with TGF-beta.Time is in hours.
Root Extract Inhibits Metastasis
PLOS ONE | www.plosone.org 10 September 2013 | Volume 8 | Issue 9 | e75069
(AVI)
Movie S2. Live cell imaging of MCF10A spheroids embedded
in Matrigel and treated with TGF-beta and sWRE at 100
nM.Time is in hours.
(AVI)
Acknowledgements
We would like to thank the Winship Pathology Core, Emory
Integrated Cellular Imaging Core, and the Winship Cancer
Animal Models Core for their assistance. We would also like to
thank Anthea Hammond for editorial assistance on this
manuscript.
Author Contributions
Conceived and designed the experiments: ZY AG DRP PMV
AIM. Performed the experiments: ZY AG SX DRP AIM.
Analyzed the data: ZY AG SX DRP PMV SS AIM. Contributed
reagents/materials/analysis tools: PMV SS AIM. Wrote the
manuscript: ZY SS AIM.
References
1. American Cancer Society website. Available: http://www.cancer.org/
Cancer/BreastCancer/OverviewGuide/index. Accessed 2013 August
16th.
2. Gunasinghe NP, Wells A, Thompson EW, Hugo HJ (2012)
Mesenchymal-epithelial transition (MET) as a mechanism for metastatic
colonisation in breast cancer. Cancer Metastasis Rev 31(3-4): 469-478.
doi:10.1007/s10555-012-9377-5. PubMed: 22729277.
3. Bacac M, Stamenkovic I (2008) Metastatic cancer cell. Annu Rev
Pathol 3: 221-247. doi:10.1146/annurev.pathmechdis.
3.121806.151523. PubMed: 18233952.
4. Jones SE (2008) Metastatic breast cancer: the treatment challenge.
Clin Breast Cancer 8(3): 224-233. doi:10.3816/CBC.2008.n.025.
PubMed: 18650152.
5. Chaffer CL, Weinberg RA (2011) A perspective on cancer cell
metastasis. Science 331: 1559-1564. PubMed: 21436443.
6. Thiery JP (2002) Epithelial-mesenchymal transitions in tumour
progression. Nat Rev Cancer 2(6): 442-454. doi:10.1038/nrc822.
PubMed: 12189386.
7. Kalluri R, Weinberg RA (2009) The basics of epithelial-mesenchymal
transition. J Clin Invest 119(6): 1420-1428. doi:10.1172/JCI39104.
PubMed: 19487818.
8. Tomaskovic-Crook E, Thompson EW, Thiery JP (2009) Epithelial to
mesenchymal transition and breast cancer. Breast Cancer Res 11(6):
213. doi:10.1186/bcr2416. PubMed: 19909494.
9. Sarrió D, Rodriguez-Pinilla SM, Hardisson D, Cano A, Moreno-Bueno
G et al. (2008) Epithelial-mesenchymal transition in breast cancer
relates to the basal-like phenotype. Cancer Res 68(4): 989-997. doi:
10.1158/0008-5472.CAN-07-2017. PubMed: 18281472.
10. Roxanis I (2013) Occurrence and significance of epithelial-
mesenchymal transition in breast cancer. J Clin Pathol 66(6): 517-521.
doi:10.1136/jclinpath-2012-201348. PubMed: 23322823.
11. Takebe N, Warren RQ, Ivy SP (2011) Breast cancer growth and
metastasis: interplay between cancer stem cells, embryonic signaling
pathways and epithelial-to-mesenchymal transition. Breast Cancer Res
13(3): 211. doi:10.1186/bcr2876. PubMed: 21672282.
12. Hardy KM, Booth BW, Hendrix MJ, Salomon DS, Strizzi L (2010)
ErbB/EGF signaling and EMT in mammary development and breast
cancer. J Mammary Gland Biol Neoplasia 15(2): 191-199. doi:10.1007/
s10911-010-9172-2. PubMed: 20369376.
13. Taylor MA, Parvani JG, Schiemann WP (2010) The pathophysiology of
epithelial-mesenchymal transition induced by transforming growth
factor-beta in normal and malignant mammary epithelial cells. J
Mammary Gland Biol Neoplasia 15(2): 169-190. doi:10.1007/
s10911-010-9181-1. PubMed: 20467795.
14. Ali Mohammed, Shuaib Mohammed, Ansari Shahid Husain (1997)
Withanolides from the stem bark of Withania somniferafla.
Phytochemistry 44(6): 1163-1168. doi:10.1016/
S0031-9422(96)00656-5.
15. Misra L, Mishra P, Pandey A, Sangwan RS, Sangwan NS et al. (2008)
Withanolides from Withania somnifera roots. Phytochemistry 69(4):
1000-1004. doi:10.1016/j.phytochem.2007.10.024. PubMed: 18061221.
16. Chaurasiya ND, Uniyal GC, Lal P, Misra L, Sangwan NS et al. (2008)
Analysis of withanolides in root and leaf of Withania somnifera by
HPLC with photodiode array and evaporative light scattering detection.
Phytochem Anal 19(2): 148-154. doi:10.1002/pca.1029. PubMed:
17879227.
17. Vanden Berghe W, Sabbe L, Kaileh M, Haegeman G, Heyninck K
(2012) Molecular insight in the multifunctional activities of Withaferin A.
Biochem Pharmacol 84(10): 1282-1291. doi:10.1016/j.bcp.
2012.08.027. PubMed: 22981382.
18. Srinivasan S, Ranga RS, Burikhanov R, Han SS, Chendil D (2007)
Par-4-dependent apoptosis by the dietary compound withaferin A in
prostate cancer cells. Cancer Res 67(1): 246-253. doi:
10.1158/0008-5472.CAN-06-2430. PubMed: 17185378.
19. Stan SD, Hahm ER, Warin R, Singh SV (2008) Withaferin A causes
FOXO3a- and Bim-dependent apoptosis and inhibits growth of human
breast cancer cells in vivo. Cancer Res 68(18): 7661-7669. doi:
10.1158/0008-5472.CAN-08-1510. PubMed: 18794155.
20. Koduru S, Kumar R, Srinivasan S, Evers MB, Damodaran C (2010)
Notch-1 inhibition by Withaferin-A: a therapeutic target against colon
carcinogenesis. Mol Cancer Ther 9(1): 202-210. doi:
10.1158/1535-7163.MCT-09-0771. PubMed: 20053782.
21. Lee J, Hahm ER, Singh SV (2010) Withaferin A inhibits activation of
signal transducer and activator of transcription 3 in human breast
cancer cells. Carcinogenesis 31(11): 1991-1998. doi:10.1093/carcin/
bgq175. PubMed: 20724373.
22. Munagala R, Kausar H, Munjal C, Gupta RC (2011) Withaferin A
induces p53-dependent apoptosis by repression of HPV oncogenes
and upregulation of tumor suppressor proteins in human cervical
cancer cells. Carcinogenesis 32(11): 1697-1705. doi:10.1093/carcin/
bgr192. PubMed: 21859835.
23. Stan SD, Zeng Y, Singh SV (2008) Ayurvedic medicine constituent
withaferin a causes G2 and M phase cell cycle arrest in human breast
cancer cells. Nutr Cancer 60 Suppl 1: 51-60. doi:
10.1080/01635580802381477. PubMed: 19003581.
24. Mayola E, Gallerne C, Esposti DD, Martel C, Pervaiz S et al. (2011)
Withaferin A induces apoptosis in human melanoma cells through
generation of reactive oxygen species and down-regulation of Bcl-2.
Apoptosis 16(10): 1014-1027. doi:10.1007/s10495-011-0625-x.
PubMed: 21710254.
25. Hahm ER, Moura MB, Kelley EE, Van Houten B, Shiva S et al. (2011)
Withaferin A-induced apoptosis in human breast cancer cells is
mediated by reactive oxygen species. PLOS ONE 6(8): e23354. doi:
10.1371/journal.pone.0023354. PubMed: 21853114.
26. Grogan PT, Sleder KD, Samadi AK, Zhang H, Timmermann BN et al.
(2013) Cytotoxicity of withaferin A in glioblastomas involves induction of
an oxidative stress-mediated heat shock response while altering Akt/
mTOR and MAPK signaling pathways. Invest New Drugs 31(3):
545-557. doi:10.1007/s10637-012-9888-5. PubMed: 23129310.
27. Um HJ, Min KJ, Kim DE, Kwon TK (2012) Withaferin A inhibits JAK/
STAT3 signaling and induces apoptosis of human renal carcinoma Caki
cells. Biochem Biophys Res Commun 427(1): 24-29. doi:10.1016/
j.bbrc.2012.08.133. PubMed: 22982675.
28. Mohan R, Hammers HJ, Bargagna-Mohan P, Zhan XH, Herbstritt CJ et
al. (2004) Withaferin A is a potent inhibitor of angiogenesis.
Angiogenesis 7(2): 115-122. doi:10.1007/s10456-004-1026-3. PubMed:
15516832.
29. Grin B, Mahammad S, Wedig T, Cleland MM, Tsai L et al. (2012)
Withaferin a alters intermediate filament organization, cell shape and
behavior. PLOS ONE 7(6): e39065. doi:10.1371/journal.pone.0039065.
PubMed: 22720028.
30. Lahat G, Zhu QS, Huang KL, Wang S, Bolshakov S et al. (2010)
Vimentin is a novel anti-cancer therapeutic target; insights from in vitro
and in vivo mice xenograft studies. PLOS ONE 5(4): e10105. doi:
10.1371/journal.pone.0010105. PubMed: 20419128.
31. Chung BM, Rotty JD, Coulombe PA (2013) Networking galore:
intermediate filaments and cell migration. Curr Opin Cell Biol, 25: 600–
12. doi:10.1016/j.ceb.2013.06.008. PubMed: 23886476.
32. Colucci-Guyon E, Portier MM, Dunia I, Paulin D, Pournin S et al. (1994)
Mice lacking vimentin develop and reproduce without an obvious
Root Extract Inhibits Metastasis
PLOS ONE | www.plosone.org 11 September 2013 | Volume 8 | Issue 9 | e75069
phenotype. Cell 79(4): 679-694. doi:10.1016/0092-8674(94)90553-3.
PubMed: 7954832.
33. Eckes B, Colucci-Guyon E, Smola H, Nodder S, Babinet C et al. (2000)
Impaired wound healing in embryonic and adult mice lacking vimentin.
J Cell Sci 113(13): 2455-2462. PubMed: 10852824.
34. Bargagna-Mohan P, Hamza A, Kim YE, Khuan Abby Ho Y, Mor-Vaknin
N et al. (2007) The tumor inhibitor and antiangiogenic agent withaferin
A targets the intermediate filament protein vimentin. Chem Biol 14(6):
623-634. doi:10.1016/j.chembiol.2007.04.010. PubMed: 17584610.
35. Thaiparambil JT, Bender L, Ganesh T, Kline E, Patel P et al. (2011)
Withaferin A inhibits breast cancer invasion and metastasis at sub-
cytotoxic doses by inducing vimentin disassembly and serine 56
phosphorylation. Int J Cancer 129(11): 2744-2755. doi:10.1002/ijc.
25938. PubMed: 21538350.
36. Mathur R, Gupta SK, Singh N, Mathur S, Kochupillai V et al. (2006)
Evaluation of the effect of Withania somnifera root extracts on cell cycle
and angiogenesis. J Ethnopharmacol 105(3): 336-341. doi:10.1016/
j.jep.2005.11.020. PubMed: 16412596.
37. Christina AJ, Joseph DG, Packialakshmi M, Kothai R, Robert SJ et al.
(2004) Anticarcinogenic activity of Withania somnifera Dunal against
Dalton’s ascitic lymphoma. J Ethnopharmacol 93(2-3): 359-361. doi:
10.1016/j.jep.2004.04.004. PubMed: 15234777.
38. Leyon PV, Kuttan G (2004) Effect of Withania somnifera on B16F-10
melanoma induced metastasis in mice. Phytother Res 18(2): 118-122.
doi:10.1002/ptr.1378. PubMed: 15022162.
39. Prakash J, Gupta SK, Dinda AK (2002) Withania somnifera root extract
prevents DMBA-induced squamous cell carcinoma of skin in Swiss
albino mice. Nutr Cancer 42(1): 91-97. doi:10.1207/
S15327914NC421_12. PubMed: 12235655.
40. Prakash J, Gupta SK, Kochupillai V, Singh N, Gupta YK et al. (2001)
Chemopreventive activity of Withania somnifera in experimentally
induced fibrosarcoma tumours in Swiss albino mice. Phytother Res
15(3): 240-244. doi:10.1002/ptr.779. PubMed: 11351360.
41. Senthilnathan P, Padmavathi R, Banu SM, Sakthisekaran D (2006)
Enhancement of antitumor effect of paclitaxel in combination with
immunomodulatory Withania somnifera on benzo(a)pyrene induced
experimental lung cancer. Chem Biol Interact 159(3): 180-185. doi:
10.1016/j.cbi.2005.11.003. PubMed: 16375880.
42. Muralikrishnan G, Dinda AK, Shakeel F (2010) Immunomodulatory
effects of Withania somnifera on azoxymethane induced experimental
colon cancer in mice. Immunol Investig 39(7): 688-698. doi:
10.3109/08820139.2010.487083. PubMed: 20840055.
43. Rodriguez LG, Wu X, Guan JL (2005) Wound-healing assay. Methods
Mol Biol 294: 23-29. PubMed: 15576902.
44. Thaiparambil JT, Eggers CM, Marcus AI (2012) AMPK regulates mitotic
spindle orientation through phosphorylation of myosin regulatory light
chain. Mol Cell Biol 32(16): 3203-3217. doi:10.1128/MCB.00418-12.
PubMed: 22688514.
45. Neve RM, Chin K, Fridlyand J, Yeh J, Baehner FL et al. (2006) A
collection of breast cancer cell lines for the study of functionally distinct
cancer subtypes. Cancer Cell 10(6): 515-527. doi:10.1016/j.ccr.
2006.10.008. PubMed: 17157791.
46. Liu LK, Jiang XY, Zhou XX, Wang DM, Song XL et al. (2010)
Upregulation of vimentin and aberrant expression of E-cadherin/beta-
catenin complex in oral squamous cell carcinomas: correlation with the
clinicopathological features and patient outcome. Mod Pathol 23(2):
213-224. doi:10.1038/modpathol.2009.160. PubMed: 19915524.
47. Hu L, Lau SH, Tzang CH, Wen JM, Wang W et al. (2004) Association
of Vimentin overexpression and hepatocellular carcinoma metastasis.
Oncogene 23(1): 298-302. PubMed: 14647434.
48. Wei J, Xu G, Wu M, Zhang Y, Li Q et al. (2008) Overexpression of
vimentin contributes to prostate cancer invasion and metastasis via src
regulation. Anticancer Res 28(1A): 327-334. PubMed: 18383865.
49. Wang JW, Peng SY, Li JT, Wang Y, Zhang ZP et al. (2009)
Identification of metastasis-associated proteins involved in gallbladder
carcinoma metastasis by proteomic analysis and functional exploration
of chloride intracellular channel 1. Cancer Lett 281(1): 71-81. doi:
10.1016/j.canlet.2009.02.020. PubMed: 19299076.
50. Singh S, Sadacharan S, Su S, Belldegrun A, Persad S et al. (2003)
Overexpression of vimentin: role in the invasive phenotype in an
androgen-independent model of prostate cancer. Cancer Res 63(9):
2306-2311. PubMed: 12727854.
51. Liu Z, Brattain MG, Appert H (1997) Differential display of reticulocalbin
in the highly invasive cell line, MDA-MB-435, versus the poorly invasive
cell line, MCF-7. Biochem Biophys Res Commun 231(2): 283-289. doi:
10.1006/bbrc.1997.6083. PubMed: 9070264.
52. Chang L, Goldman RD (2004) Intermediate filaments mediate
cytoskeletal crosstalk. Nature reviews Molecular cell biology. Nat Rev
Mol Cell Biol 5(8): 601-613. doi:10.1038/nrm1438. PubMed: 15366704.
53. Zeisberg M, Neilson EG (2009) Biomarkers for epithelial-mesenchymal
transitions. J Clin Invest 119(6): 1429-37 PubMed: 19487819.
54. Soltermann A, Tischler V, Arbogast S, Braun J, Probst-Hensch N et al.
(2008) Prognostic significance of epithelial-mesenchymal and
mesenchymal-epithelial transition protein expression in non-small cell
lung cancer. Clin Cancer Res 14(22): 7430-7437. doi:
10.1158/1078-0432.CCR-08-0935. PubMed: 19010860.
55. Al-Saad S, Al-Shibli K, Donnem T, Persson M, Bremnes RM et al.
(2008) The prognostic impact of NF-kappaB p105, vimentin, E-cadherin
and Par6 expression in epithelial and stromal compartment in non-
small-cell lung cancer. Br J Cancer 99(9): 1476-1483. doi:10.1038/
sj.bjc.6604713. PubMed: 18854838.
56. Dauphin M, Barbe C, Lemaire S, Nawrocki-Raby B, Lagonotte E et al.
(2013) Vimentin expression predicts the occurrence of metastases in
non small cell lung carcinomas. Lung Cancer 81(1): 117-122. doi:
10.1016/j.lungcan.2013.03.011. PubMed: 23562674.
57. Kusinska RU, Kordek R, Pluciennik E, Bednarek AK, Piekarski JH et al.
(2009) Does vimentin help to delineate the so-called 'basal type breast
cancer'? J Exp Clin Cancer Res 28: 118. doi:
10.1186/1756-9966-28-118. PubMed: 19695088.
58. Chen MH, Yip GW, Tse GM, Moriya T, Lui PC et al. (2008) Expression
of basal keratins and vimentin in breast cancers of young women
correlates with adverse pathologic parameters. Mod Pathol 21(10):
1183-1191. doi:10.1038/modpathol.2008.90. PubMed: 18536655.
59. Holwell TA, Schweitzer SC, Evans RM (1997) Tetracycline regulated
expression of vimentin in fibroblasts derived from vimentin null mice. J
Cell Sci 110(16): 1947-1956. PubMed: 9296393.
60. Sarria AJ, Nordeen SK, Evans RM (1990) Regulated expression of
vimentin cDNA in cells in the presence and absence of a preexisting
vimentin filament network. J Cell Biol 111(2): 553-565. doi:10.1083/jcb.
111.2.553. PubMed: 1696263.
61. Andreoli JM, Trevor KT (1995) Structural and biological consequences
of increased vimentin expression in simple epithelial cell types. Cell
Motil Cytoskeleton 32(1): 10-25. doi:10.1002/cm.970320103. PubMed:
8674130.
62. Fan LY, He DY, Wang Q, Zong M, Zhang H et al. (2012) Citrullinated
vimentin stimulates proliferation, pro-inflammatory cytokine secretion,
and PADI4 and RANKL expression of fibroblast-like synoviocytes in
rheumatoid arthritis. Scand J Rheumatol 41(5): 354-358. doi:
10.3109/03009742.2012.670263. PubMed: 22765310.
63. Lund N, Henrion D, Tiede P, Ziche M, Schunkert H et al. (2010)
Vimentin expression influences flow dependent VASP phosphorylation
and regulates cell migration and proliferation. Biochem Biophys Res
Commun 395(3): 401-406. doi:10.1016/j.bbrc.2010.04.033. PubMed:
20382123.
64. Domagala W, Markiewski M, Harezga B, Dukowicz A, Osborn M (1996)
Prognostic significance of tumor cell proliferation rate as determined by
the MIB-1 antibody in breast carcinoma: its relationship with vimentin
and p53 protein. Clin Cancer Res 2(1): 147-154. PubMed: 9816101.
65. Choo JR, Nielsen TO (2010) Biomarkers for Basal-like Breast Cancer.
Cancers 2(2): 1040-1065. doi:10.3390/cancers2021040.
66. Sun B, Zhang S, Zhang D, Li Y, Zhao X et al. (2008) Identification of
metastasis-related proteins and their clinical relevance to triple-
negative human breast cancer. Clin Cancer Res 14(21): 7050-7059.
doi:10.1158/1078-0432.CCR-08-0520. PubMed: 18981002.
67. Viale G, Bottiglieri L (2009) Pathological definition of triple negative
breast cancer. Eur J Cancer 45 Suppl 1: 5-10. doi:10.1016/
S0959-8049(09)70011-5. PubMed: 19775600.
68. Yamashita N, Tokunaga E, Kitao H, Hisamatsu Y, Taketani K et al.
(2013) Vimentin as a poor prognostic factor for triple-negative breast
cancer. J Cancer Res Clin Oncol 139(5): 739-746. doi:10.1007/
s00432-013-1376-6. PubMed: 23354842.
Root Extract Inhibits Metastasis
PLOS ONE | www.plosone.org 12 September 2013 | Volume 8 | Issue 9 | e75069
... Ashwagandha has also shown to reduce the size of tumours (Prakash et al.2002: Jayaprakasam et al., 2003 [33,20] . The most outstanding research was performed by checking the anti-carcinogenic effect of Ashwagandha in adult male mice, in which lung tumours were induced by urethane (Singh et al.1986) [42] . Another team, exhibited how Ashwagandha inhibited cell motility of breast tumours with very minimal side effects (Yang et al. 2013) [42] . ...
... The most outstanding research was performed by checking the anti-carcinogenic effect of Ashwagandha in adult male mice, in which lung tumours were induced by urethane (Singh et al.1986) [42] . Another team, exhibited how Ashwagandha inhibited cell motility of breast tumours with very minimal side effects (Yang et al. 2013) [42] . ...
... The most outstanding research was performed by checking the anti-carcinogenic effect of Ashwagandha in adult male mice, in which lung tumours were induced by urethane (Singh et al.1986) [42] . Another team, exhibited how Ashwagandha inhibited cell motility of breast tumours with very minimal side effects (Yang et al. 2013) [42] . ...
Article
Full-text available
Nanoparticles synthesis using biological materials is a recent trend in modern nanotechnology and nanoscience. The hairy root of Withania somnifera was used as biogenic materials and their extract was employed for synthesizing the silver nanoparticles (AgNPs). Several parts of the shrub "Ashwagandha" (Withania somnifera) of family Solanaceae, contains bioactive steroidal lactones, saponins and alkaloids. Characterization of the synthesized silver nanoparticles were done through UVS (UV-Visible spectroscopy), XRD (X-ray diffraction), SEM (Scanning electron microscope), TEM (Transmission electron microscope), DLS (Dynamic light scattering analysis), and FTIR (Fourier Transform Infrared Spectroscopy). The silver nanoparticles are created by reducing the silver metal ions in a rapid and eco-friendly way, which can be seen as the peak when the synthesized AgNPs were subjected to UV-vis spectroscopy. The synthesized silver nanoparticle's crystalline nature was further confirmed by carrying out the XRD analysis. The shape and size of the biosynthesized silver nanoparticles was investigated by TEM and SEM images. The probable functional groups that are part of the silver nanoparticle synthesis were identified through the FT-IR analysis. The solution phase technique, DLS reveals the particle size distribution of biosynthesized AgNPs. However, the synthesised silver nanoparticles using Ashwagandha hairy root extract demonstrated cytotoxic behaviour in the human bone cancer cell line using MG-63 by MTT assay. As a whole, this eco-friendly technique of biological silver nanoparticles synthesis renders the synthesis rates faster or comparable to that of the chemical methods and can be used in various biomedical applications.
... The biomedical significance of W. somnifera plant organs is attributed to the presence of phytochemicals such as lactones and alkaloids [1]. Yang et al. (2013) suggested the use of W. somnifera as an alternative therapy to prevent breast cancer metastasis if used on a long-term basis. Such advice was based on an in vivo observation in rats, where the root extract of W. somnifera was able to inhibit the metastasis with minimal adversity to the animal [4]. ...
... Yang et al. (2013) suggested the use of W. somnifera as an alternative therapy to prevent breast cancer metastasis if used on a long-term basis. Such advice was based on an in vivo observation in rats, where the root extract of W. somnifera was able to inhibit the metastasis with minimal adversity to the animal [4]. In a study conducted by Roy et al. (2013), withferin A, a steroidal lactone isolated from W. somnifera, demonstrated anti-tumorigenic potential against prostate tumors by inducing cytotoxicity via the metabolic inactivation of a Cdc2-mediated mitotic catastrophe [5]. ...
Article
Full-text available
Herein we report the synthesis of zinc oxide nanoparticles (ZnONPs) using Withania somnifera root extract (WSE) as an effective chelating agent. The microscopic techniques viz., X-ray diffraction analysis (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), high-resolution transmission electron microscopy (HRTEM), and selected area electron diffraction (SAED) were employed to analyze the as-obtained ZnONPs. The crystalline planes observed from the XRD pattern agrees with the hexagonal wurtzite structure of the as-prepared ZnONPs. The aggregations and agglomerations observed in the SEM images indicated that the size of the as-prepared ZnONPs was between 30 and 43 nm. The interplanar distance between the lattice fringes observed in the HR-TEM image was found to be 0.253 nm, which is in good agreement with the (100) plane obtained in the XRD pattern. Furthermore, the anti-breast cancer cytotoxic evaluation was carried out using the MCF-7 cell line, and the results showed significant cytotoxic effects in a dose-dependent manner.
... After treatment with the root extract of W. somnifera, TGF-β did not inhibit expression of vimentin at the mRNA level but did on the protein level by disrupting its morphology in cells, finally inhibiting EMT. 228 Marine natural products offer huge diversity but have limited explored resources. Marine products are enormous potential source reservoirs to isolate novel bioactive compounds from, and they also possess diverse chemical structures, which are potential sources for the drug discovery process. ...
Article
Full-text available
Background: Cancer is the world's second leading cause of death, but a significant advancement in cancer treatment has been achieved within the last few decades. However, major adverse effects and drug resistance associated with standard chemotherapy have led towards targeted treatment options. Objectives: Transforming growth factor-β (TGF-β) signaling plays a key role in cell proliferation, differentiation, morphogenesis, regeneration, and tissue homeostasis. The prime objective of this review is to decipher the role of TGF-β in oncogenesis and to evaluate the potential of various natural and synthetic agents to target this dysregulated pathway to confer cancer preventive and anticancer therapeutic effects. Methods: Various authentic and scholarly databases were explored to search and obtain primary literature for this study. The Preferred Reporting Items for Systematic Reviews and Meta-Analysis (PRISMA) criteria was followed for the review. Results: Here we provide a comprehensive and critical review of recent advances on our understanding of the effect of various bioactive natural molecules on the TGF-β signaling pathway to evaluate their full potential for cancer prevention and therapy. Conclusion: Based on emerging evidence as presented in this work, TGF-β-targeting bioactive compounds from natural sources can serve as potential therapeutic agents for prevention and treatment of various human malignancies.
... The steroidal alkaloid soladulcidine, isolated from Solanum dulcamara, and ten of its derivatives were shown to have significant antiproliferative effects against prostate cancer cells [216]. In addition, 35 withanolides and withaferin A from the roots and leaves of Withania somnifera have demonstrated efficacy against a wide range of cell lines [217,218]. Withawrightolide and four other withanolides derived from the aerial parts of Datura wrightii were similarly found to exhibit cytotoxic properties against glioma cells [219]. In addition, Physalis peruviana seed extract induced apoptosis in HeLa cells [220]. ...
Article
Full-text available
Many of the anticancer agents that are currently in use demonstrate severe side effects and encounter increasing resistance from the target cancer cells. Thus, despite significant advances in cancer therapy in recent decades, there is still a need to discover and develop new, alternative anticancer agents. The plant kingdom contains a range of phytochemicals that play important roles in the prevention and treatment of many diseases. The Solanaceae family is widely used in the treatment of various diseases, including cancer, due to its bioactive ingredient content. The purpose of this literature review is to highlight the antitumour activity of Solanaceae extracts—single isolated compounds and nanoparticles with extracts—and their synergistic effect with chemotherapeutic agents in various in vitro and in vivo cancer models. In addition, the biological properties of many plants of the Solanaceae family have not yet been investigated, which represents a challenge and an opportunity for future anticancer therapy.
... Withaferin A can potentially augment the distinct Cys328 vimentin residue in Human Umbilical Vein Endothelial Cells (HUVECs) covalently, resulting in vimentin denigration in in vivo and inhibition of neovascularization [116]. Furthermore, Withania root extracts have been shown to influence the EMT in breast cancer in in vitro and in xenograft mouse models supplemented with MDA-MB-231 cells [117,118]. The immunohistochemistry studies demonstrated that methylnitrosurea-induced mammary malignancies in female Sprague-Dawley rats caused a reduction in the proliferating cell nuclear antigen marker and Ki67 expression after Withaferin A root extract treatment [119]. ...
Article
Full-text available
Chemotherapy is one of the prime treatment options for cancer. However, the key issues with traditional chemotherapy are recurrence of cancer, development of resistance to chemotherapeutic agents, affordability, late-stage detection, serious health consequences, and inaccessibility. Hence, there is an urgent need to find innovative and cost-effective therapies that can target multiple gene products with minimal adverse reactions. Natural phytochemicals originating from plants constitute a significant proportion of the possible therapeutic agents. In this article, we reviewed the advances and the potential of Withania somnifera (WS) as an anticancer and immunomodulatory molecule. Several preclinical studies have shown the potential of WS to prevent or slow the progression of cancer originating from various organs such as the liver, cervix, breast, brain, colon, skin, lung, and prostate. WS extracts act via various pathways and provide optimum effectiveness against drug resistance in cancer. However, stability, bioavailability, and target specificity are major obstacles in combination therapy and have limited their application. The novel nanotechnology approaches enable solubility, stability, absorption, protection from premature degradation in the body, and increased circulation time and invariably results in a high differential uptake efficiency in the phytochemical’s target cells. The present review primarily emphasizes the insights of WS source, chemistry, and the molecular pathways involved in tumor regression, as well as developments achieved in the delivery of WS for cancer therapy using nanotechnology. This review substantiates WS as a potential immunomodulatory, anticancer, and chemopreventive agent and highlights its potential use in cancer treatment.
... The leaf extracts of Ashwagandha activates p53 in cancer cells, arresting its growth, causing apoptosis [166]. The root extracts lead to inhibition of mammary cancer metastasis and epithelial-mesenchymal transition by inhibiting vimentin [167]. WFA binds with vimentin intermediate filaments resulting in apoptosis of breast cancer cell lines [168]. ...
Article
Full-text available
As per World Health Organization cancer remains as a leading killer disease causing nearly 10 million deaths in 2020. Since the burden of cancer increases worldwide, warranting an urgent search for anti-cancer compounds from natural sources. Secondary metabolites from plants, marine organisms exhibit a novel chemical and structural diversity holding a great promise as therapeutics in cancer treatment. These natural metabolites target only the cancer cells and the normal healthy cells are left unharmed. In the emerging trends of cancer treatment, the natural bioactive compounds have long become a part of cancer chemotherapy. In this review, we have tried to compile about eight bioactive compounds from plant origin viz. com-bretastatin, ginsenoside, lycopene, quercetin, resveratrol, silymarin, sulforaphane and withaferin A, four marine-derived compounds viz. bryostatins, dolastatins, eribulin, plitidepsin and three microorganisms viz. Clostridium, Mycobacterium bovis and Streptococcus pyogenes with their well-established anticancer potential, mechanism of action and clinical establishments are presented.
... Experimental evidence for the chemotherapeutic actions of withaferin A also reveal the possibility as a promising anticancer agent that regulates multiple oncogenic signaling pathways in various forms of cancer (Chirumamilla et al. 2017;Dutta et al. 2019). In particular, the mechanism underlying the anti-metastatic effect of withaferin A is associated with disruption of the EMT program that elicits cell motility (Yang et al. 2013;Lee et al. 2015). Withaferin A has been shown to possess a stronger binding affinity to the mesenchymal marker protein Vimentin than its analog that substitutes a β-methoxy group at position 3 of the ergostane ring, which seems to reduce VEGF and its downstream effectors (Chaudhary et al. 2019). ...
Article
Full-text available
Abnormal expression of claudin-1 (CLDN1) has important roles in carcinogenesis and metastasis in various cancers. The role of CLDN1 in human oral squamous cell carcinoma (OSCC) remains unknown. Here, we report the functional role of CLDN1 in metastasis of human OSCC, as a potential target regulated by withaferin A. From gene expression profiling with microarray technology, we found that the majority of notable differentially expressed genes were classified into migration/invasion category. Withaferin A impaired the motility of human OSCC cells in vitro and suppressed metastatic nodule formation in an in vivo metastasis model, both associated with reduced CLDN1. CLDN1 overexpression enhanced metastatic nodule formation in vivo, resulting in severe metastatic lesions in lung tissue. Moreover, CLDN1 expression was positively correlated to lymphatic metastasis in OSCC patients. The impaired motility of human OSCC cells upon withaferin A treatment was restored by CLDN1 overexpression. Furthermore, upregulation of let-7a induced by withaferin A was inversely correlated to CLDN1 expression. Overall, these give us an insight into the function of CLDN1 for prognosis and treatment of human OSCC, substantiating further investigation into the use of withaferin A as good anti-metastatic drug candidate. Graphical abstract
... Congruence to the above result, a similar observation was made when sWRE and Withaferin A was dose-dependently administered to human xenograft and mouse mammary carcinoma model. In models, inhibition of tumor growth and metastatic lung nodule formation was attained [78]. In another study, Witharia somnifera root extract significantly decreased protein levels of fatty acid metabolism, enzymes include ATP citrate lyase (ACLγ), acetyl-CoA carboxylase 1(ACC1), fatty acid synthase (FASN), carnitine palmitoyl transferase 1A (CAPT 1 A) as well as down-regulated the mRNA level expressions of ACLγ, ACC1, FASN and CAPT 1 Ain prostate cancer (PC) cells. ...
Article
Medicinal plants and mushrooms have alwaysfascinated the world as an attractive source of natural compounds for cancer therapy. From ancient times, they have been valued as gourmet food and folk medicine in Oriental practice. For over 40 years, world has witnessed the overwhelming interest of western scientific fraternity in pharmaceutical potential of natural products in combating cancer. The plants and mushrooms credited with success against angiogenesis and cancer metastasis belong to certain Plants including Catharanthus roseus, Aloe Vera,Annona muricata,Curcuma longa, Withania somnifera, and Berberis and mushrooms such as Agaricus,Antrodia,Ganoderma,Grifolafrondosa,Hericiumerinaceus,Phel-linuslinteus, and Trametesversicolor /Coriolusversicolor. The anti-cancer compounds play a pivotal role as free radical scavenger and reactive oxygen species inducer, mitotic spindle kinase inhibitor, anti-mitotic, angiogenesis inhibitor, topoi-somerase inhibitor, apoptosis inducers, and eventually checking cancer invasion, migration and proliferation. The present review updates and focuses on the recent findings of the pharmacologically potential bioactive compounds, their anti-tumor potential, and underlying mechanism of preventing cancer metastasis and angiogenesisin order to raise knowledge for fur-ther investigations to develop cancer therapeutics with no adverse side effects The mounting experimental evidences at pre-clinical and clinical levels from various research groups across the globe, regarding prevention of cancer metastasis by natural products unarguably make it a fast-track research area worth mass attention.
... Withanolides, the compound isolated from W. somnifera has been highly focused for its anticancerous potential due to its highly oxygenated nature (Kumar et al., 2015). Yang et al. (2013) reported its long lasting potential in avoiding cancer cell invasion. Razdan et al. (2013) reported that WA and withanolides-D (Table 3) are mainly responsible for its anticarcinogenic potential., ...
Article
Ethnopharmacological relevance. Withania somnifera, commonly known as Ashwagandha, is an important medicinal herb belonging to family Solanaceae. It is widely used in folkloric and Ayurvedic medicines since antiquity. Traditionally, the plant is highly practiced throughout the globe as immunomodulator, anti-inflammatory, anti-stress, anti-parkinson, anti-alzheimer, cardio protective, neural and physical health enhancer, neurodefensive, anti-diabetic, aphrodisiac, memory boosting etc. The plant is also effective in combating various cancer and related problems of colon, mammary, lung, prostate, skin, blood, liver and kidney. Aim of this review. The present review represents the critical assessment of the literature available on the anticancerous role of W. somnifera. The present study throws light on its diverse chemical compounds and the possible mechanisms of action involved. This review also suggests further research strategies to harness the therapeutic potential of this plant. Materials and methods. The present review is the outcome of a systematic search of scientific literature about ‘Withania somnifera and its role in cancer prevention’. The scientific databases viz. Google Scholar, Science Direct, Pubmed and Web of Science were searched from 2001 to 2019. Textbooks, magazines and newspapers were also consulted. This review summarizes all the published literature about its therapeutic potential for the treatment of different types of cancers. Results. W. somnifera has been widely used in traditional and ayurvedic medicines for treatment of numerous problems related to health and vitality. The plant is a reservoir of diverse phytoconstituents like alkaloids, steroids, flavonoids, phenolics, nitrogen containing compounds and trace elements. Withanolides are the major alkaloids which renders its anticancer potential due to its highly oxygenated nature. The plant is highly effective in combating various types of cancers viz. colon, mammary, lung, prostate, skin, blood, liver and kidney. Previous studies depict that this plant is more effective against breast cancer followed by colon, lung, prostate and blood cancer. Furthermore, from different clinical studies it has been observed that the active constituents of the plant like withaferin-A, withanolide-D have least toxic effects. Conclusion. The present review confirms the various medicinal values of W. somnifera without any significant side effects. Withaferin-A (WA) and Withanolides are its most promising anticancer compounds that play a major role in apoptosis induction. Keeping in mind the anticancerous potential of this plant, it is suggested that this plant may further be investigated and more clinical studies can be performed.
Article
Background : Ayurveda is a highly recognized, well-documented, and well-accepted traditional medicine system. This system utilizes many natural products in various forms for therapeutic purposes. Thousands of plants mentioned in the Ayurvedic system are useful in disease mitigation and health preservation. One potential plant of the Ayurvedic system is “Ashwagandha” [Withania somnifera (L.) Dunal], commonly regarded as Indian Ginseng. It possesses various therapeutic activities, such as neuroprotective, hypoglycemic, hepatoprotective, antiarthritic, and anticancer effects. Purpose : Here we present a comprehensive insight on the anticancer effects of W. somnifera and mechanistic attributes of its bioactive phytocompounds. This review also provides an updated information on the clinical studies pertaining to cancer, safety evaluation and opportunities for chemical modifications of withanolides, a group of specialized phytochemicals of W. somnifera. Methods : The present study was performed in accordance with the guidelines of the Preferred Reporting Items for Systemic Reviews and Meta-Analysis. Various scientific databases, such as PubMed, Science Direct, Scopus, Google Scholar, were explored for related studies published up to May 2021. Results : An updated review on the anticancer potential and mechanisms of action of the major bioactive components of W. somnifera, including withanolides, withaferin A and withanone, is presented. Comprehensive information on clinical attributes of W. somnifera and its active components are presented with the structure-activity relationship (SAR) and toxicity evaluation. Conclusion : The outcome of the work clearly indicates that W. somnifera has a significant potential for cancer therapy. The SAR revealed that various withanolides in general and withaferin A in particular have binding energies against various proteins and tremendous potential to serve as the lead for new chemical entities. Nevertheless, additional studies, particularly well-designed clinical trials are required before therapeutic application of withanolides for cancer treatment.
Article
Full-text available
Vimentin is one of the cytoplasmic intermediate filament proteins which are the major component of the cytoskeleton. In our study we checked the usefulness of vimentin expression in identifying cases of breast cancer with poorer prognosis, by adding vimentin to the immunopanel consisting of basal type cytokeratins, estrogen, progesterone, and HER2 receptors. 179 tissue specimens of invasive operable ductal breast cancer were assessed by the use of immunohistochemistry. The median follow-up period for censored cases was 90 months. 38 cases (21.2%) were identified as being vimentin-positive. Vimentin-positive tumours affected younger women (p = 0.024), usually lacked estrogen and progesterone receptor (p < 0.001), more often expressed basal cytokeratins (<0.001), and were high-grade cancers (p < 0.001). Survival analysis showed that vimentin did not help to delineate basal type phenotype in a triple negative (ER, PgR, HER2-negative) group. For patients with 'vimentin or CK5/6, 14, 17-positive' tumours, 5-year estimated survival rate was 78.6%, whereas for patients with 'vimentin, or CK5/6, 14, 17-negative' tumours it was 58.3% (log-rank p = 0.227). We were not able to better delineate an immunohistochemical definition of basal type of breast cancer by adding vimentin to the immunopanel consisted of ER, PgR, HER2, CK5/6, 14 and 17 markers, when overall survival was a primary end-point.
Article
Full-text available
Initially recognized through microarray-based gene expression profiling, basal-like breast cancer, for which we lack effective targeted therapies, is an aggressive form of carcinoma with a predilection for younger women. With some success, immunohistochemical studies have attempted to reproduce the expression profile classification of breast cancer through identification of subtype-specific biomarkers. This review aims to present an in depth summary and analysis of the current status of basal-like breast cancer biomarker research. While a number of biomarkers show promise for future clinical application, the next logical step is a comprehensive investigation of all biomarkers against a gene expression profile gold standard for breast cancer subtype assignment.
Chapter
The wound-healing assay is simple, inexpensive, and one of the earliest developed methods to study directional cell migration in vitro. This method mimics cell migration during wound healing in vivo. The basic steps involve creating a “wound” in a cell monolayer, capturing the images at the beginning and at regular intervals during cell migration to close the wound, and comparing the images to quantify the migration rate of the cells. It is particularly suitable for studies on the effects of cell-matrix and cell-cell interactions on cell migration. A variation of this method that tracks the migration of individual cells in the leading edge of the wound is also described in this chapter.
Article
The origins of the mesenchymal cells participating in tissue repair and pathological processes, notably tissue fibrosis, tumor invasiveness, and metastasis, are poorly understood. However, emerging evidence suggests that epithelial-mesenchymal transitions (EMTs) represent one important source of these cells. As we discuss here, processes similar to the EMTs associated with embryo implantation, embryogenesis, and organ development are appropriated and subverted by chronically inflamed tissues and neoplasias. The identification of the signaling pathways that lead to activation of EMT programs during these disease processes is providing new insights into the plasticity of cellular phenotypes and possible therapeutic interventions.
Article
Without epithelial-mesenchymal transitions, in which polarized epithelial cells are converted into motile cells, multicellular organisms would be incapable of getting past the blastula stage of embryonic development. However, this important developmental programme has a more sinister role in tumor progression. Epithelial-mesenchymal transition provides a new basis for understanding the progression of carcinoma towards dedifferentiated and more malignant states.
Article
Human cells were transfected with a mouse vimentin cDNA expression vector containing the hormone response element of mouse mammary tumor virus. The distribution of mouse vimentin after induction with dexamethasone was examined by indirect immunofluorescence with antivimentin antibodies specific for either mouse or human vimentin. In stably transfected HeLa cells, which contain vimentin filaments, addition of dexamethasone resulted in the initial appearance of mouse vimentin in discrete areas, usually perinuclear, that always corresponded to areas of the human filament network with the most intense fluorescence. Within 20 h after addition of dexamethasone, the mouse and human vimentin immunofluorescence patterns were identical. However, in stably transfected MCF-7 cells, which lack vimentin filaments, induction of mouse vimentin synthesis resulted in assembly of vimentin filaments throughout the cytoplasm without any obvious local concentrations. Transient expression experiments with SW-13 cell subclones that either lack or contain endogenous vimentin filaments yielded similar results to those obtained with MCF-7 and HeLa transfectants, respectively. Further experiments with HeLa transfectants were conducted to follow the fate of the mouse protein after synthesis had dropped after withdrawal of dexamethasone. The mouse vimentin-specific fluorescence was initially lost from peripheral areas of the cells while the last detectable mouse vimentin always corresponded to the human filament network with the most intense fluorescence. These studies are consistent with a uniform assembly of vimentin filaments throughout the cytoplasm and suggest that previous observations of polarized or vectorial assembly from a perinuclear area to more peripheral areas in cells may be attributable to the nonuniformly distributed appearance of vimentin filaments in immunofluorescence microscopy.
Article
A reversed-phase HPLC method for the simultaneous analysis of nine structurally similar withanolides, namely, 27-hydroxy withanone, 17-hydroxy withaferin A, 17-hydroxy-27-deoxy withaferin A, withaferin A, withanolide D, 27-hydroxy withanolide B, withanolide A, withanone and 27-deoxywithaferin A, has been developed using a linear binary gradient solvent system comprising methanol and water containing 0.1% acetic acid. Both photodiode array and evaporative light scattering detection were used to profile the extract compositions and to quantify the withanolides therein. Homogeneity and purity of each peak was ascertained by comparative evaluation of the on-line UV spectra of the eluted compounds with those of the reference compounds. The method has been validated with respect to various parameters of performance quality including computation regression analysis based on calibration curves, peak resolution factor, asymmetry factor, tailing factor, RSD (%) of retention time and peak area response, limit of quantivation, limit of detection, precision and recovery. The developed method has been applied to the analysis of leaf and root tissues of Withania somnifera for withanolide content.
Article
Intermediate filaments (IFs) are assembled from a diverse group of evolutionarily conserved proteins and are specified in a tissue-dependent, cell type-dependent, and context-dependent fashion in the body. IFs are involved in multiple cellular processes that are crucial for the maintenance of cell and tissue integrity and the response and adaptation to various stresses, as conveyed by the broad array of crippling clinical disorders caused by inherited mutations in IF coding sequences. Accordingly, the expression, assembly, and organization of IFs are tightly regulated. Migration is a fitting example of a cell-based phenomenon in which IFs participate as both effectors and regulators. With a particular focus on vimentin and keratin, we here review how the contributions of IFs to the cell's mechanical properties, to cytoarchitecture and adhesion, and to regulatory pathways collectively exert a significant impact on cell migration.
Article
Phytochemical studies on the stem bark of Withania somnifera, collected from the southern region of New Delhi, resulted in the isolation of five new withanolides, namely withasomnilide, withasomniferanolide, somniferanolide, somniferawithanolide and somniwithanolide. Their structures have been established as (20R, 22R)-1-oxo-5α, 8β-dihydroxywitha-6α, 7β-epoxide-2,24-dienolide, (20R, 22R)-1-oxo-8β, 11β, 16β-trihydroxywitha-2,5,24-trienolide, (20R, 22R)-1-oxo-8β, 11β-dihydroxywitha-16α, 17α-epoxy-2,5,24-trienolide, (20R, 22R)-1-oxo-8α,18,20β-trihydroxywitha-2,5,24-trienolide and (20R, 22R)-1-oxo-7β, 18,20β,27-tetrahydroxywitha-2,4,24-trienolide, respectively, on the basis of spectroscopic techniques and chemical means.