Content uploaded by Anil Amichund Chuturgoon
Author content
All content in this area was uploaded by Anil Amichund Chuturgoon on Mar 05, 2014
Content may be subject to copyright.
Available via license: CC BY 2.0
Content may be subject to copyright.
Available via license: CC BY 2.0
Content may be subject to copyright.
R E S E A R C H A R T I C L E Open Access
The antiproliferative effect of Moringa oleifera
crude aqueous leaf extract on cancerous human
alveolar epithelial cells
Charlette Tiloke
2
, Alisa Phulukdaree
2
and Anil A Chuturgoon
1*
Abstract
Background: The incidence of lung cancer is expected to increase due to increases in exposure to airborne
pollutants and cigarette smoke. Moringa oleifera (MO), a medicinal plant found mainly in Asia and South Africa is
used in the traditional treatment of various ailments including cancer. This study investigated the antiproliferative
effect of MO leaf extract (MOE) in cancerous A549 lung cells.
Methods: A crude aqueous leaf extract was prepared and the cells were treated with 166.7 μg/ml MOE (IC
50
) for
24 h and assayed for oxidative stress (TBARS and Glutathione assays), DNA fragmentation (comet assay) and
caspase (3/7 and 9) activity. In addition, the expression of Nrf2, p53, Smac/DIABLO and PARP-1 was determined by
Western blotting. The mRNA expression of Nrf2 and p53 was assessed using qPCR.
Results: A significant increase in reactive oxygen species with a concomitant decrease in intracellular glutathione
levels (p< 0.001) in MOE treated A549 cells was observed. MOE showed a significant reduction in Nrf2 protein
expression (1.89-fold, p< 0.05) and mRNA expression (1.44-fold). A higher level of DNA fragmentation (p< 0.0001)
was seen in the MOE treated cells. MOE’s pro-apoptotic action was confirmed by the significant increase in p53
protein expression (1.02-fold, p< 0.05), p53 mRNA expression (1.59-fold), caspase-9 (1.28-fold, p< 0.05), caspase-3/7
(1.52-fold) activities and an enhanced expression of Smac/DIABLO. MOE also caused the cleavage and activation of
PARP-1 into 89 KDa and 24 KDa fragments (p< 0.0001).
Conclusion: MOE exerts antiproliferative effects in A549 lung cells by increasing oxidative stress, DNA
fragmentation and inducing apoptosis.
Keywords: Moringa oleifera, Drumstick tree, Lung cancer, Oxidative stress, Nrf2, Apoptosis
Background
Lung cancer is a leading cause of morbidity and mortality
in many countries [1]. Inhalation of airborne pollutants,
exposure to toxins present in grain dusts and fungal
spores and cigarette smoking causes lung damage and
increases the risk of carcinogenesis [2]. South Africa (SA)
has the highest human immunodeficiency virus (HIV)
infection burden globally and Bello et al. (2011) showed
that surviving HIV positive individuals have a high risk
of cancer such as lung cancer. Cancer deaths accounted
for 63% in developing countries across the world [3].
Cancer is characterised by uncontrolled cell growth as
cells proliferate and evade apoptosis [4]. Apoptosis is
regulated by caspases through two pathways, viz., death
receptor-mediated procaspase-activation pathway (extrinsic
pathway) and mitochondrion-mediated procaspase-activa-
tion pathway (intrinsic pathway) [4,5]. To maintain cellular
homeostasis, these cells follow a process of growth, division
and cell death. When this process is affected, it can result
in the initiation of cancer.
There are many regulators of apoptosis. The p53 tumor
suppressor protein and transcription factor is up-regulated
when DNA is damaged by causing G1 arrest and DNA
repair; if the repair is unsuccessful then it signals for
apoptosis and ultimately cell death [6,7]. During apoptosis
* Correspondence: chutur@ukzn.ac.za
1
Discipline of Medical Biochemistry, School of Laboratory Medicine and
Medical Sciences, College of Health Sciences, University of KwaZulu-Natal,
Durban, South Africa
Full list of author information is available at the end of the article
© 2013 Tiloke et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Tiloke et al. BMC Complementary and Alternative Medicine 2013, 13:226
http://www.biomedcentral.com/1472-6882/13/226
cellular proteins are proteolysed by caspases. These proteins
also include poly (ADP ribose) polymerase (PARP-1) [8].
Lung cancer still remains incurable and current drug
therapies have many side-effects and alternate therapy
is actively being sought [9]. If traditional medicine can
provide an alternate source for treatment, the number of
lung cancer deaths can be reduced. Some traditional medi-
cines possess antiproliferative effects such as Sutherlandia
frutescens, commonly referred to as cancer bush, is used
by traditional healers in SA to treat cancer [10]. Moringa
oleifera (MO), an indigenous tree to India, is found widely
in SA [11]. It belongs to the family Moringaceae and is
cultivated for medicinal and industrial purposes [12]. It
is commonly referred to as the ‘tree of life’or Drumstick
tree [12,13]. All parts of the MO plant possess medicinal
properties, but the leaves have high nutritional value
(high levels of vitamins C and A, potassium, proteins,
calcium and iron) [14,15]. In addition the leaves possess
phytochemicals like carotenoids, alkaloids and flavonoids
[11] and is rich in amino acids such as cystine, lysine,
methionine and tryptophan [16]. MO is used in traditional
treatment of diabetes mellitus, cardiovascular and liver
disease.
Phytochemical properties of MO play an important role
in its mode of action against diseases [11]. It contains a rich
source of rhamnose, glucosinolates and isothiocyanates. A
study conducted by Manguro and Lemmen (2007) into the
phenolics of MOE had characterised five flavonol glycosides
using spectroscopic methods [17]. The anticancer property
can be attributed to specific components of MOE such
as 4-(α-L-rhamnopyranosyloxy) benzyl glucosinolate,
4-(α-L-rhamnopyranosyloxy) benzyl isothiocyanate, benzyl
isothiocyanate and niazimicin. The leaves contain quer-
cetin-3-O-glucoside and kaempferol-3-O-glucoside which
plays a role in antioxidant defence as it scavengers for free
radicals thus reducing oxidative stress [12]. Thiocarbamates
such as niazimicin are found in the leaves and can be used
as a chemopreventive agent [18,19]. Studies have suggested
that the anticancer and chemopreventive property of MOE
can be attributed to niazimicin [20,21].
MO leaf extracts have been shown to disrupt prolifera-
tion of cancer cells. In a study on Swiss mice, MO leaf
extracts increased glutathione-S-transferase (GST) [12].
The MO leaf extracts induced apoptosis in KB carcinoma
cells [22]. Sreelatha and Padma (2011) had shown that the
extracts inhibited lipid peroxidation as it scavenged free
radicals and reduced oxidative stress [22]. It also protected
against oxidative DNA damage. To date there is no study
assessing the effects of MO leaf extracts on lung carcino-
genesis. The present study investigated the antiproliferative
effects of a crude aqueous extract of MO leaves in A549
(human lung carcinoma) cells. It was hypothesised that
MO leaf extracts induces cell death as a result of oxidative
stress in the cancerous cells.
Methods
Materials
MO leaves were collected from the KwaZulu-Natal region
(Durban, South Africa) and verified by the KwaZulu-Natal
herbarium (Batch no. CT/1/2012, Genus no. 3128).
A549 cells were purchased from Highveld Biologicals
(Johannesburg, South Africa). Cell culture reagents were
purchased from Whitehead Scientific (Johannesburg, South
Africa). ECL-LumiGlo® chemiluminescent substrate kit was
purchased from Gaithersburg (USA) and western blot
reagents were purchased from Bio-Rad (USA). All other
reagents were purchased from Merck (South Africa).
Cell culture
A549 lung cells were cultured (37°C, 5% CO
2
)in25cm
3
culture flasks in complete culture media (CCM) [23]
comprising of Eagle’s minimum essential medium supple-
mented with 10% foetal calf serum, 1% L-glutamine and
1% penicillin-streptomycin-fungizone until confluent [24].
Cell growth was monitored and CCM was changed as
necessary. Confluent flasks were trypsinized using 1 ml
trypsin. Cell numbers were enumerated using trypan blue.
Leaf extract
The MO leaf extract (MOE) was prepared by crushing
10 g of air-dried leaves in a pestle and mortar and the
subsequent addition of 100 ml de-ionised water [24,25].
The resultant extract was boiled with continuous stirring
for 20 min, transferred to 50 ml conical tubes and
centrifuged [720 × g, 10 min, room temperature (RT)].
The upper aqueous layer (MOE) was removed, lyophilised
and stored at 4°C. MOE stock solution was prepared by
dissolving 1 mg of MOE in 1 ml of CCM and filter
sterilised [0.22 μM filter (Millipore)].
Cell viability assay
The cytotoxicity of MOE in A549 cells was determined
using the Methyl thiazol tetrazolium (MTT) assay [26].
A549 cells (15,000 cells/well) were seeded into a 96-well
microtitre plate. The cells were incubated with varying
MOE dilutions (0, 1, 10, 50, 100, 150, 200, 250, 500 μg/ml)
in six replicates (300 μl/well) and incubated (37°C, 5%
CO
2
) for 24 h. A control of cells incubated with CCM only
was used. A CCM/MTT salt solution (5 mg/ml) was
added (120 μl/well) and the plate was incubated (37°C,
4 h). Thereafter, supernatants were removed; dimethyl
sulphoxide (DMSO) 100 μl/well was added and incubated
(1 h). The optical density of the formazan product was
measured at 570 nm and reference wavelength of 690 nm
using a spectrophotometer (Bio Tek μQuant). The per-
centage cell viability was determined and a concentration-
response curve was plotted using GraphPad Prism V5.0
software relative to the control. This experiment was
Tiloke et al. BMC Complementary and Alternative Medicine 2013, 13:226 Page 2 of 8
http://www.biomedcentral.com/1472-6882/13/226
repeated on two separate occasions before the concentra-
tion of half the maximum inhibition (IC
50
) was calculated.
For subsequent assays, A549 cells at inoculation density
of 20,000 cells per well were treated (24 h) with the IC
50
determined on viability assay.
Lipid peroxidation - quantification of malondialdehyde (MDA)
To investigate MOE generation of reactive oxygen species
(ROS), Thiobarbituric acid assay (TBARS) was used.
TBARS measures MDA which is the end product of
lipid peroxidation and an indicator of oxidative stress
[27]. Following treatment, cells lysed in 0.2% H
3
PO
4
(100 μl) by passing the cell solution through a 25 gauge
needle at least 25 times from each sample was transferred
to test tubes with the addition of 2% H
3
PO
4
(200 μl), 7%
H
3
PO
4
(400 μl) and TBA/BHT solution (400 μl). A posi-
tive control of MDA and a negative control of CCM were
prepared. All samples were adjusted to pH 1.5 and heated
(100°C, 15 min). After cooling, butanol (1.5 ml) was added
to each test tube, vortexed and allowed to separate into
distinct phases. The upper butanol phase (800 μl) was
transferred into eppendorfs and centrifuged (17,949 × g,
6 min, RT). 100 μl from each sample was aliquoted into
a 96-well microtitre plate in six replicates. The optical
density was measured on a spectrophotometer at 532 nm
with reference wavelength of 600 nm. The mean optical
density for each sample was calculated and divided by
the absorption coefficient (156 mM
-1
). The results were
expressed in μM.
Antioxidant potential - quantification of glutathione
Glutathione-Glo™Assay (Promega) was used according
to manufacturer’s guidelines to quantify glutathione
(GSH) levels. 50 μl from each sample (MOE treated
and untreated control) was added in six replicates to
the wells of an opaque polystyrene 96-well microtitre
plate. GSH standards (0-50 μM) were prepared from a
5 mM stock diluted in de-ionised water. 50 μl of each
GSH standards and 50 μloftheGSH-Glo™Reagent 2×
was added per well and incubated in the dark (30 min,
RT). Reconstituted Luciferin Detection Reagent (50 μl)
was added per well and incubated (15 min, RT). The
luminescence was measured on a Modulus™microplate
luminometer (Turner Biosystems, Sunnyvale, USA). The
data was analysed and expressed as relative light units
(RLU).
DNA damage
DNA damage was determined using the Comet assay
[28]. Following treatment of cells (20,000 cells/well) in a
6-well plate, supernatants were removed and cells were
trypsinized. Three slides per sample were prepared as
the first layer of 1% low melting point agarose (LMPA,
37°C), second layer of 25 μl of cells (20, 000) from the
samples with 175 μl of 0.5% LMPA (37°C) and third
layer of 0.5% LMPA (37°C) covered the slides. After
solidification, the slides were then submerged in cold
lysing solution [2.5 M NaCl, 100 mM EDTA, 1% Triton
X-100, 10 mM Tris (pH 10), 10% DMSO] and incubated
(4°C, 1 h). Following incubation the slides were placed in
electrophoresis buffer [300 mM NaOH, 1 mM Na
2
EDTA
(pH 13)] for 20 min and thereafter subjected to electro-
phoresis (25 V, 35 min, RT) using Bio-Rad compact power
supply. The slides were then washed 3 times with neutral-
isation buffer [0.4 M Tris (pH 7.4)] for 5 min each. The
slides were stained overnight (4°C) with 40 μlethidium
bromide (EtBr) and viewed with a fluorescent microscope
(Olympus IXSI inverted microscope with 510-560 nm
excitation and 590 nm emission filters). Images of 50
cells and comets were captured per treatment and the
comet tail lengths were measured using Soft imaging
system (Life Science -
©
Olympus Soft Imaging Solutions v5)
and expressed in μm.
Caspase-3/7 and 9 activities
Caspase-Glo® 3/7 and Caspase-Glo® 9 Assays (Promega)
were used to assess apoptosis. For each assay the same
procedure was followed: A549 cells were seeded into an
opaque polystyrene 96-well microtitre plate in six repli-
cates. Following treatment, the Caspase-Glo® 3/7 and
Caspase-Glo® 9 reagents were prepared according to
manufacturer’s guidelines. 100 μl of the reagent was
added per well and incubated in the dark (30 min, RT).
Following incubation, the luminescence was measured
on a Modulus™microplate luminometer. The data was
expressed as RLU and fold change.
Western blotting
Western Blots were performed to determine the expression
of Nrf2, p53, Smac/DIABLO and PARP-1. Briefly, total pro-
tein was isolated using Cytobuster™reagent supplemented
with protease inhibitor (Roche, cat. no. 05892791001) and
phosphatase inhibitor (Roche, cat. no. 04906837001). The
bicinchoninic acid assay (Sigma, Germany) was used to
quantify the protein and was standardised to 2.042 mg/ml
[29]. The samples were prepared in Laemmli buffer [30],
boiled (100°C, 5 min) and electrophoresed (150 V, 1 h) in
7.5% sodium dodecyl sulfate polyacrylamide gels using a
Bio-Rad compact power supply. The separated proteins
were electro-transferred to nitrocellulose membrane using
the Trans-Blot® Turbo Transfer system (Bio-Rad) (20 V,
45 min). The membranes were blocked (1 h) using 3%
BSA in Tris-buffered saline containing 0.5% Tween20
(TTBS - NaCl, KCL, Tris, Tween 20, dH
2
O, pH 7.4).
Thereafter, the membranes were immune-probed with
primary antibody [Nrf2 (ab89443), p53 (ab26), PARP-1
(ab110915), 1:1,000; Smac/DIABLO (ab68352), 1:200]
at 4°C overnight. The membranes were then washed
Tiloke et al. BMC Complementary and Alternative Medicine 2013, 13:226 Page 3 of 8
http://www.biomedcentral.com/1472-6882/13/226
4× with TTBS (10 min each) and incubated with the
secondary antibody (ab97046; 1:2,000) at RT for 1 h.
The membranes were finally washed 4× with TTBS
(10 min each). To correct for loading error and to nor-
malise the expression of the proteins, β-actin was
assessed (ab8226; 1:5,000). Horse radish peroxidase
(HRP) chemiluminescence detector and enhancer solution
was used for the antigen-antibody complex and the signal
was detected with the Alliance 2.7 image documentation
system (UViTech). The expression of the proteins were
analysed with UViBand Advanced Image Analysis soft-
ware v12.14 (UViTech). The data was expressed as relative
band density (RBD) and fold change.
Quantification of mRNA
To determine p53 and Nrf2 mRNA expression, RNA was
first isolated from control and MOE treatment by adding
500 μl Tri reagent (Am9738) as per manufacturer’s guide-
lines. Thereafter, RNA was quantified (Nanodrop 2000)
and standardised to 100 ng/μl. RNA was reverse tran-
scribed by reverse transcriptase into copy DNA (cDNA)
using the RT
2
First Strand Kit (SABiosciences, C-03) as
per manufacturer’s instructions. Briefly, a 20 μlreaction
was prepared by adding 10 μl genomic DNA elimination
mixture (Total RNA, 5× gDNA elimination buffer, H
2
O)
to 10 μl of RT cocktail (5× RT buffer 3, primer and external
control mix, RT enzyme mix, H
2
O). The reaction was then
subjected to 42°C (15 min) and 95°C (5 min) (GeneAmp®
PCR System 9700, Applied Biosystems) to obtain cDNA.
Quantitative PCR (qPCR) was used to determine mRNA
expression using RT
2
SYBR® Green qPCR Master Mix
(SABiosciences). A 25 μl reaction consisting of 12.5 μlIQ™
SYBR® green supermix (cat. no. 170–8880), 8.5 μlnuclease-
free water, 2 μlcDNA,and1μl sense and anti-sense primer
(10 mM, inqaba biotec™, Table 1) were used. The mRNA
expression was compared and normalised to a housekeep-
ing gene, GAPDH.
The reaction was subjected to an initial denaturation
(95°C, 10 min). It was followed by 40 cycles of denaturation
(95°C, 15 s), annealing (Nrf2: 57°C, 40s; p53: 56°C, 40 s)
and extension (72°C, 30 s) (Chromo 4 Real-Time PCR de-
tector, Biorad). The data was analysed using MJ opticon
monitor analysis software V3.1, Biorad. The mRNA ex-
pression was determined using the Livak method and
expressed as fold changes [31].
Statistical analysis
Statistical analyses were performed using GraphPad Prism
v5.0 software (GraphPad Software Inc., La Jolla, USA). The
results were expressed as means with standard deviation
(SD). The concentration-response-inhibition equation was
used to determine IC
50
for MTT assay. The statistical sig-
nificances were determined by unpaired t-test and a 95%
confidence interval. The data were considered statistically
significant with a value of p<0.05.
Results
Cell viability assay
The MTT assay measures cell viability based on the gener-
ation of reducing equivalents in metabolic active cells. The
A549 cell viability (%) data is presented in Table 2.
UsingGraphPadprism,anIC
50
value of 166.7 μg/ml
was calculated. This concentration of MOE was used
in all subsequent assays.
Assessment of oxidative stress
Reactive oxygen species (ROS) induce oxidative stress.
Lipid peroxidation, caused by ROS, was assayed by
quantifying MDA presented in Figure 1A.
There was a significant increase in MDA levels in
MOE treatment as compared to the untreated cells
(0.269 ± 0.013 μM vs 0.197 ± 0.016 μM, p<0.001).GSH
levels were significantly decreased in the MOE treatment
compared to the control [Figure 1B (2.507 × 10
6
±0.081×
10
6
RLU vs 3.751 × 10
6
±0.110×10
6
RLU, p<0.001):
Additional file 1].
DNA damage
The comet assay assessed DNA damage and the comet tail
lengths were measured in MOE treated and untreated
A549 cells (Figure 2).
There was a significant increase in comet tail length in
MOE treatment compared to the control (18.52 ± 4.90 μm
vs 5.15 ± 1.18 μm, p< 0.0001).
Table 1 Primer sequences used in qPCR assay
Primer sequence
Sense Primer Anti-sense Primer
Nrf2 5′AGTGGATCTGCCAACTACTC 3′5′CATCTACAAACGGGAATGTCTG 3′
p53 5′CCACCATCCACTACAACTACAT3′5′CAAACACGGACAGGACCC3′
GAPDH 5′TCCACCACCCTGTTGCTGTA3′5′ACCACAGTCCATGCCATCAC3′
Table 2 Viability of A549 cells treated with MOE for 24 h
Concentration (μg/ml) Mean OD ± SD Cell viability (%)
0 (Control) 1.469 ± 0.008 100
1 1.177 ± 0.058 80.123
10 1.120 ± 0.132 76.242
50 1.001 ± 0.118 68.108
100 1.201 ± 0.082 81.756
150 1.170 ± 0.110 79.646
200 0.966 ± 0.158 65.725
250 0.922 ± 0.177 62.730
500 0.984 ± 0.350 66.950
OD optical density, SD standard deviation.
Tiloke et al. BMC Complementary and Alternative Medicine 2013, 13:226 Page 4 of 8
http://www.biomedcentral.com/1472-6882/13/226
Assessment of caspase-3/7 and 9 activities
Intracellular activity of caspases-3/7 and caspase-9 was
measured. Table 3 presents the apoptotic induction in
A549 cells.
There was an increase (non-significant) in caspase-3/7
activity and a significant increase in caspase-9 activity in
MOE treatment compared to the control (Table 3).
Western blotting
To determine the effect of MOE on protein expression
we assessed the levels of Nrf2, p53, Smac/DIABLO and
PARP-1 using western blot (Figure 3).
MOE induced a significant 1.89-fold decrease in Nrf2
expression [Figure 3 (0.069 ± 0.007 RBD vs control:
0.129 ± 0.022 RBD, p< 0.05)]; a 1.02-fold increase in
p53 expression [Figure 3 (0.567 ± 0.002 RBD vs control:
0.558 ± 0.002 RBD, p< 0.05)] and a 1.06-fold increase in
Smac/DIABLO expression [Figure 3 (1.509 ± 0.055 RBD
vs control: 1.425 ± 0.007 RBD, p= 0.162)]. During apop-
tosis, PARP-1 is proteolysed by caspases to an 89 KDa
and 24 KDa fragment. There was a significant 1.27-fold
decrease in the expression of PARP 89 KDa fragment in
the MOE treatment compared to the control [Figure 3
(0.234 ± 0.005 RBD vs 0.297 ± 0.005 RBD, p< 0.0001)]
and a 1.46-fold increase in the level of PARP 24 KDa
fragment [Figure 3 (0.419 ± 0.014 RBD vs 0.286 ± 0.016
RBD, p< 0.0001); Additional file 1].
Quantification of mRNA
The mRNA expression of Nrf2 and p53 in A549 cells was
determined using qPCR relative to the control (Figure 4).
The Nrf2 mRNA expression was decreased 1.44 ± 0.03-
fold (p< 0.001) in MOE treatment (Figure 4). A 1.59 ± 0.41-
fold (p= 0.168) increase in p53 mRNA expression was
observed in MOE treated cells.
Discussion
MO, a widely consumed traditional plant, is used to treat
various ailments such as cancer [13]. Cancer is listed as the
fourth leading cause of death in SA [3], with lung cancer
expected to increase. This is a first study to show a possible
biochemical mechanism of action of MOE on cancerous
A549 cells.
Reactive oxygen species are known to induce many
diseases [32]. These oxidants damage membrane phos-
pholipids and results in lipid peroxidation [2,27]. This
study showed that MOE significantly increased lipid
peroxidation as measured by elevated levels of MDA.
Figure 1 Oxidative stress induced by MOE on A549 cells. An increase in MDA levels (lipid peroxidation) (A) and decreased intracellular GSH
levels (B) in MOE treated cells (**p< 0.001).
Figure 2 Comet assay images of control and MOE treatments for 24 h. DNA damage was higher in cells exposed to MOE (B) then control
cells (A) (100×, ***p< 0.0001).
Tiloke et al. BMC Complementary and Alternative Medicine 2013, 13:226 Page 5 of 8
http://www.biomedcentral.com/1472-6882/13/226
This lipid peroxidation compromises cell membranes and
their function. In addition, the mitochondrial membranes
may become dysfunctional and lead to uncoupling of
oxidative phosphorylation and increased electron leak
from the respiratory chain. These oxidants also react
with proteins and DNA in the cell [33].
Hydrogen peroxide (H
2
O
2
) oxidises cysteine in GSH to
produce glutathione disulphide (GSSG), thereby decreasing
the antioxidant capacity of GSH. GSH levels were sig-
nificantly decreased in MOE-treated A549 cells with a
corresponding significant increase in lipid peroxidation
(Figure 1).
The mRNA plays a pivotal role in protein synthesis as
it is used as a template and thus translated into protein
[34]. The transcription factor nuclear factor-erythroid 2
p45-related factor 2 (Nrf2) is important in antioxidant
defence as it protects the cell from oxidative stress. Nrf2
dissociates from Kelch-like epichlorohydrin-associated
protein 1 (Keap1) and translocates to the nucleus and
binds to the antioxidant-response elements in promoter
regions of antioxidant genes thus increasing transcription
[35,36]. Nrf2 regulates the synthesis of GSH and MOE
reduced mRNA expression by 1.44-fold (Figure 4) [34].
This resulted in a significant decrease in Nrf2 protein
expression in A549 cells, (Figure 3) which leads to de-
creased transcription of important antioxidant genes
and increased oxidative damage [37]. The suppression
of Nrf2 expression may explain the antiproliferative effect
of MOE in this cell line. A consequence is that the en-
dogenous antioxidant GSH is not replenished adequately
and will result in increased oxidants and ultimately to cell
death.
The increase in oxidative stress is genotoxic to the cell.
H
2
O
2
can react with metal ions such as iron and produce
highly reactive hydroxyl radicals that target DNA [22].
ROS-mediated DNA damage can be a therapeutic target
in cancer cells as it signals nucleases to cause DNA strand
breaks. The MOE induced significant DNA strand breaks
and fragmentation in the alveolar epithelial cells (Figure 2).
Again this finding shows that MOE possess pro-apoptotic
and antiproliferative properties.
To further confirm the pro-apoptotic action of MOE, we
investigated its effect on p53 mRNA and protein expres-
sion. MOE increased p53 mRNA expression (Figure 4) with
a significant increase in the expression of p53 protein in
A549 treated cells (Figure 3). It is known that an increase
in oxidative stress and DNA damage results in apoptosis
[38,39]. DNA damage up-regulates signals for repair and
apoptosis. The increased expression of p53 correlates well
withtheincreasedDNAdamagebyMOE.Thissignals
for apoptosis via Bax activation, a pro-apoptotic protein,
which causes mitochondrial depolarisation and cytochrome
c release from the mitochondria into the cytoplasm.
Cytochrome c, together with Apaf-1 and ATP forms an
apoptosome resulting in pro-caspase-9 cleavage and
activation of caspase-9. MOE significantly increased
(1.28-fold) caspase-9 activity, which in turn activates the
executioner caspases-3/7 (1.52-fold increase) (Table 3).
Caspase-3/7 activity can be inhibited by inhibitor of apop-
tosis (IAP) proteins [40,41]. The protein, Smac/DIABLO
is concurrently released from the mitochondria with
Figure 3 MOE regulating protein expression in A549 cells.
Differential expression of Nrf2, p53, Smac/DIABLO, PARP-89 KDa and
24 KDa fragment in A549 cells after treatment with MOE for 24 h.
-2
-1.5
-1
-0.5
0
0.5
1
1.5
2
2.5
Relative Fold-change
Nrf2 p53
Control
MOE
Figure 4 The effect of MOE on mRNA expression. MOE regulated
the Nrf2 and p53 mRNA expression in A549 cells after treatment for
24 h (**p< 0.001).
Table 3 Apoptotic markers of A549 cells following
treatment for 24 h
Mean ± SD (RLU x 10
5
) Fold
change
p-value
Control MOE
Caspase-3/7 2.097 ± 0.489 3.196 ± 0.261 1.52 0.107
Caspase-9 12.630 ± 0.020 16.160 ± 0.702 1.28 < 0.05*
*p< 0.05: statistically significant compared to the control, SD: standard
deviation, RLU relative light units.
Tiloke et al. BMC Complementary and Alternative Medicine 2013, 13:226 Page 6 of 8
http://www.biomedcentral.com/1472-6882/13/226
cytochrome c and inhibits IAP proteins thus ensuring
execution of apoptosis. MOE afforded a slight increase on
Smac/DIABLO expression (1.06-fold) [Figure 3 (1.509 ±
0.055 RBD vs control: 1.425 ± 0.007 RBD, p= 0.162)] that
could contribute to the apoptotic pathway.
In addition PARP-1 cleavage was investigated. During
apoptosis, caspases are activated resulting in the cleavage
of PARP-1 [6]. PARP-1, a nuclear enzyme, is proteolysed
to an 89 KDa C-terminal catalytic fragment and a 24 KDa
N-terminal DNA-binding domain fragment [42]. PARP-1
(important in DNA base excision repair) maintains the
integrity of the genome [43]. MOE increased caspase-3/7
activity in A549 cells which resulted in cleavage of PARP-
1 into 2 fragments [44]. There was a significant (1.46-fold)
increase in the expression of the 24 KDa fragment
(Figure 3) in MOE treated cells. This increased cleavage of
the smaller PARP-1 fragment correlates well with the
increased DNA damage by MOE (p< 0.0001).
The phytoconstituents of MOE were shown to possess
antiproliferative effects on various cell lines [20]. The
leaves contain glucosinolates, isothiocyanates, niazimicin,
niaziminin and quercetin which attributes to the anticancer
effect [11,20,21]. In addition the leaves also contain other
thiocarbamate, carbamates and nitrile glycosides [20].
A recent study showed the significance of MO phyto-
chemicals in prostate cancer therapy [21]. Niazimicin
and 4-(4’-O-acetyl-α-L-rhamnopyranosyloxy) benzyl iso-
thiocyanate were identified as natural anticancer agents
and compared favourably with the recommended chemo-
therapeutic drug, Estramustine. These phytochemicals en-
hanced the activity of cellular prostatic acid phosphatase
and possessed less toxicity, thus showing potential as a
potent and safe natural agent in prostate cancer therapy
and drug design [21]. Similarly these active compounds
in MOE can act as anticancer agents in lung cancer by
inducing cellular apoptosis and subsequent cell death.
An in vivo study on the anticancer activity of MOE
on B16 F10 melanoma tumors in mice, revealed that
treatment at 500 mg/kg-bw could delay tumor growth
and increase lifespan [20]. The anticancer activity was
attributed to the phytochemicals quercetin, niazimicin
and niaziminin. The therapeutic and nutritional use of
MOE is safe at doses below 2 g/kg-bw [45]. Similarly
the antiproliferative effect of MOE observed in the
A549 cancerous cells may be due to the phytochemicals
(e.g., isothiocyanates, niazimicin, niaziminin and quercetin)
in the plant leaves.
Conclusion
The MO leaves possess antiproliferative properties as
evidenced by an increase in oxidative stress leading to
apoptosis of lung cancer cells. The results from the study
provide a biochemical mechanism underlying the usage of
MOE as a therapeutic agent in lung cancer therapy. It
shows a promising complementary and alternative treat-
ment for lung cancer. Furthermore, phytochemical
analysis and the effect of MOE on other cancerous cell
lines need to be assessed.
Additional file
Additional file 1: S1. Table of contents. S2. Comet Assay. S3 to S9.
Western blotting.
Abbreviations
BSA: Bovine serum albumin; CCM: Complete culture media; cDNA: Copy
DNA; DMSO: Dimethyl sulphoxide; EtBr: Ethidium bromide; GST:
Glutathione-S-transferase; GSH: Glutathione; GSSG: Glutathione disulphide;
HIV: Human immunodeficiency virus; HRP: Horse radish peroxidase;
H
2
O
2
: Hydrogen peroxide; IAP: Inhibitor of apoptosis; Keap1: Kelch-like
epichlorohydrin-associated protein 1; LMPA: Low melting point agarose;
MDA: Malondialdehyde; mRNA: Messenger RNA; MO: Moringa oleifera;
MOE: MO leaf extract; MTT: Methyl thiazol tetrazolium; Nrf2: Nuclear
factor-erythroid 2 p45-related factor 2; OD: Optical density; PARP-1: Poly
(ADP ribose) polymerase; ROS: Reactive oxygen species; RT: Room
temperature; RLU: Relative light units; RBD: Relative band density; SA: South
Africa; SD: Standard deviation; TBARS: Thiobarbituric acid assay; TBA/
BHT: Thiobarbituric acid (1%)/0.1 mM butylated hydroxytoluene solution;
qPCR: Quantitative polymerase chain reaction.
Competing interests
The authors declare that they have no competing interests.
Authors’contributions
CT conceived the study, designed and conducted all laboratory experiments;
analysed and interpreted experimental results and prepared the draft
manuscript. AP participated in laboratory experiments. AP and AC
participated in the study design, data analysis and manuscript preparations.
All authors read and approved the final manuscript.
Acknowledgements
Miss C. Tiloke acknowledges the prestigious Masters scholarship from the
National Research Foundation, South Africa. The study was also supported
by the funds from College of Health Sciences (UKZN).
Author details
1
Discipline of Medical Biochemistry, School of Laboratory Medicine and
Medical Sciences, College of Health Sciences, University of KwaZulu-Natal,
Durban, South Africa.
2
Postal address: Discipline of Medical Biochemistry,
Nelson R Mandela School of Medicine, University of KwaZulu-Natal, Private
Bag 7, Congella, 4013, Durban, South Africa.
Received: 23 January 2013 Accepted: 9 September 2013
Published: 16 September 2013
References
1. GLOBOCAN 2008 estimated cancer incidence, mortality, prevalence and
disability-adjusted life years (DALYs) worldwide in 2008. http://globocan.iarc.fr/.
2. Rahman I: Oxidative stress, chromatin remodeling and gene transcription
in inflammation and chronic lung diseases. J Biochem Mol Biol 2003,
36:95–109.
3. Bello B, Fadahun O, Kielkowski D, Nelson G: Trends in lung cancer
mortality in South Africa: 1995–2006. BMC Public Health 2011, 11:1–5.
4. Sharma H, Parihar L, Parihar P: Review on cancer and anticancerous
properties of some medicinal plants. J Med Plant Res 2011,
5:1818–1835.
5. Fan TJ, Han LH, Cong RS, Liang J: Caspase family proteases and apoptosis.
Acta Biochim Biophys Sin (Shanghai) 2005, 37:719–727.
6. Radhakrishna Pillai G, Srivastava AS, Hassanein TI, Chauhan DP, Carrier E:
Induction of apoptosis in human lung cancer cells by curcumin. Cancer
Lett 2004, 208:163–170.
Tiloke et al. BMC Complementary and Alternative Medicine 2013, 13:226 Page 7 of 8
http://www.biomedcentral.com/1472-6882/13/226
7. Nithipongvanitch R, Ittarat W, Velez JM, Zhao R, St Clair DK, Oberley TD:
Evidence for p53 as guardian of the cardiomyocyte mitochondrial
genome following acute adriamycin treatment. J Histochem Cytochem
2007, 55:629–639.
8. Halappanavar SS, Le Rhun Y, Mounir S, Martins LM, Huot J, Earnshaw WC,
Shah GM: Survival and proliferation of cells expressing caspase-
uncleavable poly (ADP-ribose) polymerase in response to death-
inducing DNA damage by an alkylating agent. J Biol Chem 1999,
274:37097–37104.
9. Frunze P, Hamed D, Abdo H, Timothy S: Targeted therapy for lung cancer.
Anti-Cancer Drugs 2012, 23:1016–1021.
10. Gericke N, Albrecht CF, Van Wyke B, Mayeng B, Mutwa C, Hutchings A:
Sutherlandia frutescens. Am J Men’s Health 2001, 13:9–15.
11. Fahey JW: Moringa oleifera: a review of the medical evidence for its nutritional,
therapeutic, and prophylactic properties. Part 1. Trees Life J 2005:1–5.
12. Goyal BR, Agrawal BB, Goyal RK, Mehta AA: Phyto-pharmacology of
Moringa oleifera Lam. An overview. Nat Prod Rad 2007, 6:347–353.
13. Djakalia B, Guichard BL, Soumaila D: Effect of Moringa oleifera on growth
performance and health status of young post-weaning rabbits.
Res J Poultry Sci 2011, 4:7–13.
14. Sreelatha S, Jeyachitra A, Padma PR: Antiproliferation and induction of
apoptosis by Moringa oleifera leaf extract on human cancer cells.
Food Chem Toxicol 2011, 49:1270–1275.
15. Cajuday LA, Pocsidio GL: Effects of Moringa oleifera Lam. (Moringaceae)
on the reproduction of male mice (Mus musculus). J Med Plants Res 2010,
4:1115–1121.
16. Siddhuraju P, Becker K: Antioxidant properties of various solvent extracts
of total phenolic constituents from three different agroclimatic origins of
drumstick tree (Moringa oleifera Lam.) leaves. J Agric Food Chem 2003,
51:2144–2155.
17. Manguro LOA, Lemmen P: Phenolics of Moringa oleifera leaves. Nat Prod
Res 2007, 21:56–68.
18. Guevara AP, Vargas C, Sakurai H, Fujiwara Y, Hashimoto K, Maoka T, Kozuka
M, Ito Y, Tokuda H, Nishino H: An antitumor promoter from Moringa
oleifera Lam.Mutat Res 1999, 440:181–188.
19. Anwar F, Latif S, Ashraf M, Gilani AH: Moringa oleifera: a food plant with
multiple medicinal uses. Phytother Res 2007, 21:17–25.
20. Purwal L, Pathak AK, Jain UK: In vivo anticancer activity of the leaves and
fruits of Moringa oleifera on mouse melanoma. Pharmacologyonline 2010,
1:655–665.
21. Inbathamizh L, Padmini E: Insilico studies on the enhancing effect of anti-
cancer phytochemicals of Moringa oleifera on cellular prostatic acid
phosphatase activity. Drug Invent Today 2011, 3:186–192.
22. Sreelatha S, Padma PR: Modulatory effects of Moringa oleifera extracts
against hydrogen peroxide-induced cytotoxicity and oxidative damage.
Hum Exp Toxicol 2011, 30:1359–1368.
23. Wilson K, Walker J: Principles and techniques of biochemistry and molecular
biology. Cambridge, England: Cambridge University Press; 2005.
24. Phulukdaree A, Moodley D, Chuturgoon AA: The effects of Sutherlandia
frutescens extracts in cultured renal proximal and distal tubule epithelial
cells. S Afri J Sci 2010, 106:1–5.
25. Prasad TNVKV, Elumalai EK: Biofabrication of Ag nanoparticles using
Moringa oleifera leaf extract and their antimicrobial activity. Asian Pacific J
Trop Biomed 2011:439–442.
26. Mossman T: Rapid colorimetric assay for cellular growth and survival:
application to proliferation and cytotoxicity assay. J Immunol Methods
1983, 65:55–63.
27. Halliwell B, Chirico S: Lipid peroxidation: its mechanism, measurement
and significance. Am J Clin Nutrit 1993, 57:715S–725S.
28. Singh NP, McCoy MT, Tice RR, Schneider EL: A simple technique for
quantitation of low levels of DNA damage in individual cells. Exp Cell Res
1988, 1751:184–191.
29. Bainor A, Chang L, McQuade TJ, Webb B, Gestwicki JE: Bicinchoninic acid
(BCA) assay in low volume. Anal Biochem 2011, 410:310–312.
30. Yang Y, Ma H: Western blotting and ELISA techniques. Research 2009,
1:67–86.
31. Livak KJ, Schmittgen TD: Analysis of relative gene expression data using
real-time quantitative PCR and the 2
-ΔΔCT
method. Methods 2001, 25:402–408.
32. Ashok Kumar N, Pari L: Antioxidant action of Moringa oleifera Lam.
(drumstick) against antitubercular drugs induced lipid peroxidation in
rats. J Med Food 2003, 6:255–259.
33. Bartosz G: Reactive oxygen species: destroyers or messengers? Biochem
Pharmacol 2009, 77:1303–1315.
34. Cooper GM: The cell. A molecular approach. Boston, USA: Sunderland:
Sinauer Associates; 2000.
35. Harvey CJ, Thimmulappa RK, Singh A, Blake DJ, Ling G, Wakabayashi N, Fujii
J, Myers A, Biswal S: Nrf2-regulated glutathione recycling independent of
biosynthesis is critical for cell survival during oxidative stress. Free Radic
Biol Med 2009, 46:443–453.
36. Singh A, Misra V, Thimmulappa RK, Lee H, Ames S, Hoque MO, Herman JG,
Baylin SB, Sidransky D, Gabrielson E, Brock MV, Biswal S: Dysfunctional
KEAP1-NRF2 interaction in non-small-cell lung cancer. PLoS Med 2006,
3:1865–1876.
37. Lewis KN, Mele J, Hayes JD, Buffenstein R: Nrf2, a guardian of healthspan
and gatekeeper of species longevity. Integr Comp Biol 2010, 50:829–843.
38. Bertram JS: The molecular biology of cancer. Mol Aspects Med 2001,
21:167–223.
39. Thompson CB: Apoptosis in the pathogenesis and treatment of disease.
Science 1995, 267:1456–1462.
40. Hengartner MO: The biochemistry of apoptosis. Nature 2000, 407:770–776.
41. Wang X: The expanding role of mitochondria in apoptosis. Genes Dev
2001, 15:2922–2933.
42. D’Amours D, Sallmann FR, Dixit VM, Poirier GG: Gain-of-function of poly
(ADP-ribose) polymerase-1 upon cleavage by apoptotic proteases:
implications for apoptosis. J Cell Sci 2001, 114:3771–3778.
43. Eustermann S, Videler H, Yang J, Cole PT, Gruszka D, Veprintsev D, Neuhaus
D: The DNA-binding domain of human PARP-1 interacts with DNA
single-strand breaks as a monomer through its second zinc finger.
J Mol Biol 2011, 407:149–170.
44. Pagano A, Pitteloud C, Reverdin C, Metrailler-Ruchonnet I, Donati Y,
Argiroffo CB: Poly (ADP-ribose) polymerase activation mediates lung
epithelial cell death in vitro but is not essential in hyperoxia-induced
lung injury. Am J Respir Cell Mol Biol 2005, 33:555–564.
45. Adedapo AA, Mogbojuri OM, Emikpe BO: Safety evaluations of the
aqueous extract of the leaves of Moringa oleifera in rats. J Med Plants Res
2009, 3:585–591.
doi:10.1186/1472-6882-13-226
Cite this article as: Tiloke et al.:The antiproliferative effect of Moringa
oleifera crude aqueous leaf extract on cancerous human alveolar
epithelial cells. BMC Complementary and Alternative Medicine 2013 13:226.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Tiloke et al. BMC Complementary and Alternative Medicine 2013, 13:226 Page 8 of 8
http://www.biomedcentral.com/1472-6882/13/226
