Content uploaded by Lai Ngo
Author content
All content in this area was uploaded by Lai Ngo on May 26, 2020
Content may be subject to copyright.
ORIGINAL ARTICLE
Virucidal effect of acidic electrolyzed water and neutral
electrolyzed water on avian influenza viruses
Shio Tamaki •Vuong N. Bui •Lai H. Ngo •
Haruko Ogawa •Kunitoshi Imai
Received: 18 May 2013 / Accepted: 16 July 2013 / Published online: 12 September 2013
!Springer-Verlag Wien 2013
Abstract The virucidal effects of two types of electro-
lyzed water, acidic electrolyzed water (AEW) and neutral
electrolyzed water (NEW), on avian influenza viruses were
studied. Virus titers of the highly pathogenic H5N1 virus
and the low-pathogenic H9N2 virus irreversibly decreased
by[5-log at 1 min after the viruses were mixed with NEW
containing C43 ppm free available chlorine (FAC), but not
with NEW containing \17 ppm FAC. The minimum con-
centration of FAC for a virucidal effect of NEW was
estimated at around 40 ppm. In contrast, the virus titers
decreased by [5 log at 1 min after the viruses were mixed
with AEW, in which the concentration of the FAC ranged
from 72 to 0 ppm. Thus, the virucidal effect of AEW did
not depend on the presence of FAC. Reverse transcription
polymerase chain reaction amplified fragments of the M
and NP genes, but not the complete M gene, from RNA
extracted from the AEW-inactivated virus. Moderate
morphological changes were found under the electron
microscope, although no changes were observed in the
electrophoresed proteins of the AEW-inactivated virus. No
viral genes were amplified from the RNA extracted from
the NEW-inactivated virus, regardless of the length of the
targeted genes. No viral particles were detected under the
electron microscope and no viral proteins were detected by
electrophoresis for the NEW-inactivated virus. Thus, this
study demonstrated potent virucidal effects of AEW and
NEW and differences in the virucidal mechanism of the
two types of electrolyzed water.
Introduction
The highly pathogenic avian influenza (HPAI) virus has
been causing devastating problems in the poultry industry
worldwide and further poses a big concern for public
health. Recent studies in experimental settings showed that
the HPAI H5N1 virus could acquire the capacity for air-
borne transmission between mammals [1,2]. There is
another concern over the recent human cases of H7N9 AI
virus infection, which include many fatal cases [3]. It is
important to prevent additional human cases of AI virus
infection, and further, to control AI cases in poultry. In
order to accomplish this, there is a need to develop antiviral
agents or disinfectants that can effectively prevent the
spread of viruses and eliminate viruses from the environ-
ment. Biological safety and ecological features have to be
taken into account in order to apply large amounts of those
agents to the environment.
Electrolyzed water, especially acidic electrolyzed water
(AEW), has been regarded as a useful new sanitizer in
recent years because of its antimicrobial activity, mainly
reported on bacteria, and its biological safety. Electrolyzed
water is generated by electrolysis of deionized or tap water
containing a low concentration of sodium chloride or
potassium chloride in an electrolysis chamber where anode
and cathode electrodes are separated by an ion-permeable
exchange diaphragm. From the anode side, AEW with low
pH, high oxidation-reduction potential (ORP), high con-
centrations of dissolved oxygen and free chlorine, and
other reactive oxidants is produced. From the cathode side,
alkaline electrolyzed water with high pH, high concentra-
tions of dissolved hydrogen, and low ORP is produced [4,
5]. Alkaline electrolyzed water from the cathode has the
potential to remove dirt and grease, but only limited anti-
microbial activity. In contrast, AEW shows antimicrobial
S. Tamaki !V. N. Bui !L. H. Ngo !H. Ogawa (&)!K. Imai
Research Center for Animal Hygiene and Food Safety, Obihiro
University of Agriculture and Veterinary Medicine, 2-11 Inada,
Obihiro, Hokkaido 080-8555, Japan
e-mail: hogawa@obihiro.ac.jp
123
Arch Virol (2014) 159:405–412
DOI 10.1007/s00705-013-1840-2
activity against a broad spectrum of bacteria, including
Salmonella,Campylobacter,and Escherichia coli
O157:H7 [4,5]. The antiviral effect of AEW has also been
reported on human immunodeficiency virus, hepatitis B
virus, herpes simplex viruses, and norovirus [6–9],
although the reported numbers are much lower than those
for bacteria. Neutral electrolyzed water (NEW) has also
been of interest to be used as disinfectant or sanitizer.
NEW can be obtained by redirecting the product formed in
the anode chamber to the cathode chamber of the electro-
lyzed water generator. Several studies have shown the
antibacterial activity of NEW [10,11]; however, its effect
on viruses has been rarely reported.
Additional scientific information about the efficacy of
AEW and NEW as disinfectants would advance their
application to public health and environmental sanitation.
The aim of this study is to evaluate the virucidal effects of
AEW and NEW against AI viruses and clarify their
underlying mechanisms.
Materials and methods
Electrolyzed water
AEW and NEW samples provided by GAEA Co., Ltd.
(Tokyo, Japan) (Table 1) were used in this study. The
samples were generated, filled in bottles at the company,
and then shipped to our laboratory. Throughout the
experiments performed in this study, the samples were
stored at room temperature in the dark, and the date on
which the bottles were opened for the first time was des-
ignated as day 0. The pH and FAC concentration shown in
Table 1represent the values measured at the company.
FAC concentrations of the samples were measured again
before each experiment using a Chloride Portable Pho-
tometer HI95771 (HANNA Instruments, Smithfield, RI).
Tap water or ultrapure water was used as a control for each
experiment.
Viruses
The HPAI virus A/chicken/Yamaguchi/7/04 (H5N1) and
the low-pathogenic AI virus A/chicken/Yokohama/aq55/
2001 (H9N2) were provided by the National Institute of
Animal Health, Japan. The H5N1 and H9N2 viruses were
propagated in the allantoic cavity of 10-day-old embryo-
nated chicken eggs. The allantoic fluids (AFs) collected
from the eggs were used as virus solutions for most
experiments unless otherwise stated. For some experi-
ments, the H9N2 virus was purified by ultracentrifugation
as described previously [12]. Purified H9N2 virus with a
protein concentration of 8.0 mg/ml, which was measured
using a Micro BCA Protein Assay Kit (Pierce, Rockford,
IL), was used at a final concentration of 400 lg/ml in this
study. The titer of purified viruses (400 lg/ml) determined
in MDCK cells was 10
9.5
TCID
50
/ml.
Evaluation of virucidal effect of the electrolyzed water
A volume of 10 ll of the AFs containing the viruses was
added to 990 ll of each electrolyzed water sample or tap
water and mixed well. The mixtures were kept at room
temperature for 1 min and serially diluted in phosphate-
buffered saline (1:10). Then, 100 ll of the diluted solution
and undiluted solution were inoculated into the allantoic
cavity of embryonated chicken eggs (2 eggs per dilution)
and incubated at 37 !C for 4 days. AFs collected from the
eggs were tested using a hemagglutination (HA) test, and
the 50 % egg infective dose (EID
50
) was calculated using
the Behrens-Ka
¨rber method. Preliminary experiments
confirmed no toxicity of the electrolyzed water samples in
eggs. The viruses treated with electrolyzed water were
stored for 17 days, and the virus titers were measured again
to confirm irreversible virus inactivation.
Reverse transcription-polymerase chain reaction
(RT-PCR) and real-time RT-PCR
From the H9N2 viruses treated with electrolyzed or ultra-
pure water, viral RNA was extracted using Isogen-LS
(NIPPON GENE Co., Ltd, Tokyo) and transcribed into
cDNA as described previously [13]. RT-PCRs for the M
gene and NP gene of the influenza A virus were carried out
using Takara Ex Taq (Takara, Shiga, Japan) and the primer
sets listed in Table 2. The PCR conditions used were as
Table 1 Feature of the electrolyzed water samples used in this study
Electrolyzed water samples pH Free available
chlorine concentration
(ppm)
AEW
a
AEW-1 2.5 19.0–30.4
AEW-2 2.0 35.2–52.2
AEW-3 1.5 87.6–120.4
NEW
b
NEW-1 7.4 136.0–282.0
NEW-2 7.0 205.0–340.5
NEW-3 6.4 39.0–67.5
The values of pH and free available chlorine concentration for the 2
lots of each sample used in this study are shown. NEW-3 was pre-
pared by a 5-fold dilution of NEW-2 with tap water. The values
represent those measured at the company prior the shipping to our
laboratory except the pH of NEW-3, which was measured in our
laboratory
a
Acidic electrolyzed water
b
Neutral electrolyzed water
406 S. Tamaki et al.
123
follows: 94 !C for 4 min; 35 cycles of denaturation at
94 !C for 30 s, annealing at 58 !C (full primer) or 50 !C
(partial primers) for 30 s, and extension at 72 !C for 2 min
(full primer) or 40 s (partial primers); and final extension at
72 !C for 7 min. The electrophoretic profiles of the PCR
products were analyzed by measuring the luminescence
intensity of the ethidium bromide on the gel using Science
Lab 2005 Multi Gauge Ver 3.0 (Fujifilm, Tokyo, Japan).
Real-time RT-PCR to detect the partial M gene of influenza
A virus was carried out as described previously [13].
Sodium dodecyl sulfate polyacrylamide gel
electrophoresis and western blotting analysis
Purified H9N2 virus was mixed with electrolyzed water or
ultrapure water at a final protein concentration of 400 lg/ml.
Following an 1-min incubation at room temperature, the
samples containing the treated viruses were electrophoresed
on a 10 % sodium dodecyl sulfate polyacrylamide gel, and
the separated viral proteins were stained with Coomassie
brilliant blue. For the western blotting analysis, the electro-
phoresed proteins were transferred to a polyvinylidene
difluoride membrane (Bio-Rad, Hercules, CA), incubated
with anti-H9N2 mouse serum, followed by incubation with
the peroxidase-conjugated goat antibody against mouse IgG
(MP Biomedicals, LLC, Solon, Ohio). The signal was
detected using an ECL Western Blotting Analysis System
(GE Healthcare, Buckinghamshire, UK) and analyzed using
LAS-3000 (Fujifilm).
Immunoelectron microscopic (IEM) analysis
IEM analysis was performed using the H9N2 virus as
reported previously [14]. Briefly, samples of the purified
H9N2 virus treated with electrolyzed water were attached
to a carbon-coated collodion grid (Nisshin EM Co., Ltd.,
Tokyo). The virus on the grid was incubated with a
monoclonal antibody (mAb) against the H9N2 virus hem-
agglutinin, which was biotinylated using Biotin-OSu
(Dojindo, Kumamoto, Japan). Then, the grid was incubated
with streptavidin immunogold conjugate (BBInternational,
Cardiff, UK). Finally, the grids were negatively stained and
examined using a Hitachi HT7700 electron microscope
(Hitachi, Tokyo, Japan). HA titers were determined for
each virus sample analyzed in the IEM analysis.
Results
Virucidal effects of the electrolyzed water on AI viruses
Titers of the H5N1 and H9N2 viruses were measured at
1 min after the viruses were mixed with the electrolyzed
water samples or tap water. Figure 1shows the results
obtained in two separate experiments using lot 1 and lot 2
of the samples. In both cases, the experiment with the
H5N1 virus was performed on day 0, and the experiment
with the H9N2 virus was on day 1. In all AEW samples, the
titers of the H5N1 and H9N2 viruses were decreased by[5
log compared to the titer of the viruses in the control. The
concentrations of FAC in AEWs ranged from 15.4 to
72.0 ppm on day 0 (Fig. 1a and c) and from 0.0 to
21.6 ppm on day 1 (Fig. 1b and d).
In the two lots of NEW-1 and NEW-2, the virus titers
decreased by[5 log, and the FAC concentrations in NEW-
1 and NEW-2 ranged from 132.5 to 215.0 ppm (Fig. 1). In
lot 2 of NEW-3, the virus titers similarly decreased by [5
log, and the FAC concentration of lot 2 of NEW-3 ranged
from 40.4 to 43.2 ppm (Fig. 1c and d). In lot 1 of NEW-3,
the virus titers were decreased by 3 log and 5.5 log for the
H5N1 virus and H9N2 virus, respectively. The FAC con-
centration of lot 1 of NEW-3 ranged from 41.0 to 32.4 ppm
(Fig. 1a and b).
The H9N2 viruses treated with the electrolyzed water
samples were stored for 17 days, and the virus titer was
measured again. The titers of the viruses stored in the
electrolyzed water samples for 17 days were confirmed to
be consistent with those measured on day 1 (Fig. 1b and d).
Table 2 Primer sets used for RT-PCR to amplify viral RNAs of influenza A viruses
Gene Forward primer Reverse primer
M-full Bm-M-1:
TATTCGTCTCAGGGAGCAAAAGCAGGTAG
Bm-M-1027R:
ATATCGTCTCGTATTAGTAGAAACAAGGTAGTTTTT
M-partial M 107-127 BamH:
TTGGATCCGGACCAATCCTGTCACCTC
M 356-335 BamH: CCGGATCCTCGTATATGAGGCCCCATRC
NP-partial-1 NP1-159F:
ATCCATGGGCATGGCGTCGCAAGGCACCAA
NP1-159R: GGACCATGGTCATTCCAGTACGCACGAGAG
NP-partial-2 NP162-327F:
ATCCATGGGCAGAATGTGCTCTCTGATGCA
NP162-327R: GGACCATGGTACTCTTGTGTGCTGGATTCT
NP-partial-3 NP327-498F:
ATCCATGGGCAGTCAATTGGTTTGGATGGC
NP327-498R: GGACCATGGTACTGTCATACTCCTCTGCAT
Virucidal effect of electrolyzed water 407
123
The effect of the electrolyzed water samples was also
retested on day 18. In all AEW samples, the virus titers
decreased [5 log, but the virus titers in all NEW samples
were similar to those in the control. The FAC concentra-
tions in the NEW samples ranged from 6.6 to 17.0 ppm;
however, no FAC was detected in any of the AEW samples
(Fig. 2).
Changes in viral genes of the H9N2 virus treated
with electrolyzed water
RT-PCR was applied to investigate the possible changes in
the viral RNAs of the H9N2 viruses treated with AEW-1
and NEW-2. In the RT-PCR for the full-length M gene
(1027 bp), no bands were detected from the RNA of
viruses treated with AEW-1 and NEW-2 (Fig. 3a). In the
RT-PCR for the partial M gene (250 bp), no bands were
detected for the RNA from the NEW-2-treated virus;
however, bands were detectable for the RNA from the
AEW-1-treated virus. The luminescence intensity of the
band for the AEW-1-treated virus was 2 log lower than that
for the control virus (Fig. 3b). Real-time RT-PCR ampli-
fying a short fragment of the M gene (100 bp) of influenza
A virus did not render positive results for NEW-inactivated
virus samples (data not shown).
Following RT-PCR for the partial NP genes
(159–172 bp), no bands were detected for the RNA from
the NEW-2-treated virus (data not shown), but bands were
detected for the RNA from the AEW-1-treated virus. The
luminescence intensity of the bands for the RT-PCR pro-
ducts of the RNA from the AEW-1-treated virus was lower
by 0.9–1.6 log compared to that of the control virus
(Fig. 4).
Changes in viral protein of the H9N2 virus treated
with electrolyzed water
Viral protein bands on the electrophoresed gels were
compared between the H9N2 viruses treated with AEW-1
or NEW-2 and ultrapure water. The protein bands of the
virus treated with AEW-1 and ultrapure water showed a
similar pattern on the gel. In contrast, no protein bands
were detected for the virus treated with NEW-2 (Fig. 5a).
In the western blotting analysis, the viral proteins of the
AEW-1-treated virus were detected by the antiserum
against the virus similarly to those of the control virus;
however, no viral proteins were detected for the NEW-2-
treated virus (Fig. 5b).
Morphological changes of the H9N2 virus treated
with electrolyzed water
The morphology of the H9N2 virus was compared between
the virus treated with AEW-1 or NEW-2 and that treated
Fig. 1 Virucidal effects of
AEW and NEW on H5N1 and
H9N2 viruses. Titers of H5N1
(a,c) and H9N2 viruses
(b,d) were measured using
embryonated chicken eggs at
1 min after the viruses were
mixed with the electrolyzed
water samples, AEW-1, 2, 3
(A1,A2,A3) and NEW-1, 2, 3
(N1,N2,N3) or tap water (Cn).
The results obtained with lot 1
(a,b) and lot 2 (c,d) of the
electrolyzed water samples are
shown. In both cases,
experiments for the H5N1 virus
were performed on day 0, and
those for the H9N2 virus were
performed on day 1. The tables
below the figures present the pH
value and free available chlorine
(FAC) concentration (ppm) of
each electrolyzed water sample
prior to the experiments. Broken
lines represent the level of virus
titer detectable in the assay
408 S. Tamaki et al.
123
with ultrapure water by IEM analysis. In the control,
influenza A virus particles were found to have typical
morphology, and hemagglutinin was identified on the
particle surface by the binding of immunogold particles
(Fig. 6c). In the virus treated with AEW-1, the viral par-
ticles showed some ambiguous structures in addition to
typical morphology; however, the presence of hemagglu-
tinin on the particle surface was identified by the immu-
nogold particles (Fig. 6a). In contrast, no viral particles
with typical shape were found in the virus preparations
treated with NEW-2 (Fig. 6b). The HA titer of the control
virus, AEW-1-treated virus, and NEW-2-treated virus was
1:1600, 1:800, and \1:2, respectively.
Discussion
The virucidal effect of electrolyzed water on AI viruses
was investigated for the first time in this study. Titers of the
H5N1 and H9N2 viruses decreased dramatically and irre-
versibly at 1 min after the viruses were mixed with either
AEW or NEW. The virucidal effect of NEW was solely
dependent on the FAC in the solution. The NEW samples
containing C43 ppm FAC showed consistent virucidal
effects against the H5N1 and H9N2 viruses (Fig. 1).
However, such virucidal effects were not observed in these
NEW samples after 18 days, when the concentration of
FAC was B17.0 ppm (Fig. 2). These results suggest that
the minimum concentration of FAC for a virucidal effect of
NEW is approximately 40 ppm, which is similar to the
value given in previous reports [10,11]. On the other hand,
Le
´ne
`s et al. [15] and Rice et al. [16] reported that low
concentrations of free chlorine (0.5–2 ppm), which is
typically used in drinking water treatment, were sufficient
to inactivate influenza viruses, including H5N1 HPAI
virus, in 1–5 min. Additional studies are required to
understand the differences between the results of this study
and those of previous studies.
In contrast to NEW, all AEW samples tested in this
study lowered the titers of the H5N1 and H9N2 viruses by
[5 log, irrespective of the concentration of FAC (Fig. 1).
The results obtained after 18 days (Fig. 2) further indicated
that AEW exerts its virucidal effects in a FAC-independent
manner and for a relatively long period compared to the
short-shelf life of NEW. AEW generated from the anodic
chamber of the electrolyzed water generator usually has a
low pH and high ORP. It was reported that the ORP of
Fig. 2 Evaluation of the virucidal effects of AEW and NEW
following 18 days of storage. Lot 2 of the electrolyzed water samples
was stored at room temperature for 18 days. Then, the virucidal effect
of those samples on H5N1 (a) and H9N2 (b) viruses was tested as
shown in Fig. 1. The tables below the figures present the pH value
and free available chlorine (FAC) concentration (ppm) of each
electrolyzed water sample prior to the experiments. Broken lines
represent the level of virus titer detectable in the assay
Fig. 3 Agarose gel electrophoresis of the RT-PCR products for the M
gene of the H9N2 virus The full-length (a) or partial (b) M gene was
amplified using the RNAs extracted from the H9N2 virus treated for
1 min with AEW-1 (A1), NEW-2 (N2), or ultra-pure water (Cn) The
amplified regions in the M gene are presented in the upper panel. The
graph shows the amount of luminescence for the RT-PCR products of
the partial M gene measured by Science Lab 2005 Multi Gauge Ver
3.0
Virucidal effect of electrolyzed water 409
123
AEW was inversely proportional to the pH [17], and
decreasing the pH increased the antimicrobial potential of
AEW, even if the residual chlorine levels were kept con-
stant [18]. Since low pH is known to inactivate influenza
viruses [19], the role of pH and ORP in virus inactivation
by AEW should be investigated particularly to determine
the threshold and range required for the virucidal effect of
AEW. Additional studies should also include the clarifi-
cation of the effects of oxidizing compounds on virus
inactivation.
Other studies reported that a high ORP is the deter-
mining factor for the antimicrobial activity of AEW [20,
21]. The high ORP is likely to damage membrane struc-
tures of bacteria, enabling oxidizing moieties to penetrate
into the cell cytoplasm [5]. A high ORP would cause
defects of surface proteins, destruction of the viral enve-
lope, inactivation of viral enzymes, or destruction of viral
nucleic acids [6,8]. The results in this study clearly indi-
cate that the antiviral effects of AEW do not require the
presence of free chlorine, which would imply the impor-
tance of a high ORP for the virucidal effect of AEW. It has
been reported that the pH and ORP in electrolyzed water
are relatively stable during the storage periods between 100
hours [22] and 21 days [23] compared to free chlorine.
This might explain the stable virucidal effect of AEW
demonstrated in this study.
In accordance with the difference in the virucidal
mechanism, different outcomes were observed for the
viruses inactivated with NEW and AEW. No RT-PCR
products were obtained from the RNA extracted from
NEW-inactivated viruses, regardless of the gene size
(Fig. 3). No viral proteins were detected by western blot-
ting (Fig. 5), and no viral particles were identified under
the electron microscope (Fig. 6) for the NEW-inactivated
virus. In addition, the HA titers were significantly reduced
in the NEW-inactivated viruses, confirming the lack of
receptor binding potential for the viruses.
Our study results are not consistent with those reported
by Tuladhar et al. [24], wherein only a limited decrease
was observed in the PCR units of influenza virus exposed
to 1000-ppm free-chlorine solution. In their study, the
disinfection efficacy of the free-chlorine solution was tes-
ted on artificially contaminated stainless steel surfaces,
which might simulate critical spots in healthcare settings
(doorknobs, handles, and other frequently touched sur-
faces). In the experiment performed, the virus solution
supplemented with 0.03 % bovine serum albumin was
spread onto a stainless steel surface, dried, and then wiped
with cloth pieces containing 1000-ppm free-chlorine solu-
tion. Twenty minutes after the surface was wiped, a sample
was collected from the tested surface to measure the virus
titer. The results of their study indicated that the reduction
in infectivity was greater than the reduction in PCR units of
the influenza virus sample collected from the tested sur-
face. In our study, the virus solution was added directly to
Fig. 4 Agarose gel
electrophoresis of the RT-PCR
products for the partial NP gene
of the H9N2 virus. Three
different regions of the partial
NP gene were amplified using
the RNA extracted from the
H9N2 virus samples treated for
1 min with AEW-1 (A1) or
ultra-pure water (Cn). The
amplified regions in the NP
gene (a,b,c) are presented in
the upper panel. The graph
shows the amount of
luminescence for the RT-PCR
products of the partial NP gene
measured by Science Lab 2005
Multi Gauge Ver 3.0
Fig. 5 SDS-PAGE and western blotting analysis of the H9N2 virus
treated with the two types of electrolyzed water. Purified H9N2 virus
was treated for 1 min with AEW-1 (A1), NEW-2 (N2), or ultra-pure
water (Cn). The electrophoresed proteins were visualized by
Coomassie brilliant blue staining (a) and western blotting using an
anti-H9N2 mouse polyclonal antibody (b)
410 S. Tamaki et al.
123
NEW and mixed well. Real-time PCR amplification of a
short fragment of the viral gene did not render positive
results for the NEW-inactivated virus samples. These
results indicate the destructive effect of NEW on viral
RNA, although additional studies need to be performed to
clarify the underlying mechanism. The correlation between
the decrease in infectivity and the decrease in the PCR
units of the virus treated with NEW should also be deter-
mined. In addition, it would be interesting to test the effi-
cacy of NEW on metal surfaces contaminated by influenza
viruses by using the method described by Tuladhar et al.
[24]. The results of such studies will give us the necessary
information for application of NEW to resolve public
health and environmental sanitation concerns.
In contrast, the HA titers of the AEW-inactivated viru-
ses were comparable to that of the control virus, and the
presence of the HA proteins on the viral particles was
confirmed. Moderate changes were observed in the mor-
phology of the viral particles, as well as in the viral genes
(Figs. 3,4,6). Overall, the changes in proteins, nucleic
acids, and morphology of AEW-inactivated viruses were
unexpectedly moderate. Therefore, further studies are
required to confirm whether these changes are sufficient to
hamper virus functions and further clarify determinant
factors for virus inactivation by AEW. It is also important
to investigate to what extent high ORP should affect pos-
sible factors to lead eventually to virus inactivation.
This study demonstrated the virucidal effects of AEW
and NEW on AI viruses and identified differences in the
virucidal mechanism of the two types of electrolyzed
water. The efficacy of the two types of electrolyzed water
might be regarded as short-term, because FAC in NEW can
be easily converted to the inactive form [22,23], and
highly reactive oxidative moieties in AEW would react
with any organic compound present in the environment
[25,26]. Nevertheless, electrolyzed water has several
advantages as a biocide, including low running cost, ease
of production on site, and biological safety. It should be
Fig. 6 IEM analysis of the
H9N2 virus treated with the
electrolyzed water. The purified
H9N2 virus was treated for
1 min with AEW-1 (a), NEW-2
(b), or ultra-pure water (c), and
then analyzed by IEM. The
samples were stained with
biotinylated anti-H mAb
followed by streptavidin
immunogold conjugate. The bar
represents 200 nm
Virucidal effect of electrolyzed water 411
123
noted that electrolyzed water is regarded as a non-envi-
ronmental hazard because it reverts to water or diluted salt
water [20,27]. Considering the large burden to the envi-
ronment that has been caused by the intensive use of
chemical disinfectants to control devastating infectious
diseases such as those caused by HPAI, electrolyzed water
might become an alternative disinfectant with favorable
ecological features.
Acknowledgments We would like to thank Sachiko Matsuda for
technical assistance. This work was partially supported by a Grant-in-
Aid for the Bilateral Joint Projects of The Japan Society for the
Promotion of Science, Japan.
References
1. Herfst S, Schrauwen EJ, Linster M, Chutinimitkul S, de Wit E,
Munster VJ, Sorrell EM, Bestebroer TM, Burke DF, Smith DJ,
Rimmelzwaan GF, Osterhaus AD, Fouchier RA (2012) Airborne
transmission of influenza A/H5N1 virus between ferrets. Science
336:1534–1541
2. Imai M, Watanabe T, Hatta M, Das SC, Ozawa M, Shinya K,
Zhong G, Hanson A, Katsura H, Watanabe S, Li C, Kawakami E,
Yamada S, Kiso M, Suzuki Y, Maher EA, Neumann G, Kawaoka
Y (2012) Experimental adaptation of an influenza H5 HA confers
respiratory droplet transmission to a reassortant H5 HA/H1N1
virus in ferrets. Nature 486:420–428
3. World Health Organization (2013) Human infection with influ-
enza A(H7N9) virus in China-update. http://www.who.int/csr/
don/2013_04_23/en/index.html
4. Huang Y-R, Hung Y-C, Hsu S-Y, Huang Y-W, Hwang D-F
(2008) Application of electrolyzed water in the food industry.
Food Control 19:329–345
5. Thorn RM, Lee SW, Robinson GM, Greenman J, Reynolds DM
(2012) Electrochemically activated solutions: evidence for anti-
microbial efficacy and applications in healthcare environments.
Eur J Clin Microbiol Infect Dis 31:641–653
6. Morita C, Sano K, Morimatsu S, Kiura H, Goto T, Kohno T,
Hong W, Miyoshi H, Iwasawa A, Nakamura Y, Tagawa M,
Yokosuka O, Saisho H, Maeda T, Katsuoka Y (2000) Disinfec-
tion potential of electrolyzed solutions containing sodium chlo-
ride at low concentrations. J Virol Methods 85:163–174
7. Park GW, Boston DM, Kase JA, Sampson MN, Sobsey MD
(2007) Evaluation of liquid- and fog-based application of Sterilox
hypochlorous acid solution for surface inactivation of human
norovirus. Appl Environ Microbiol 73:4463–4468
8. Tagawa M, Yamaguchi T, Yokosuka O, Matsutani S, Maeda T,
Saisho H (2000) Inactivation of a hepadnavirus by electrolysed
acid water. J Antimicrob Chemother 46:363–368
9. Tanaka N, Fujisawa T, Daimon T, Fujiwara K, Tanaka N, Ya-
mamoto M, Abe T (1999) The effect of electrolyzed strong acid
aqueous solution on hemodialysis equipment. Artif Organ
23:1055–1062
10. Abadias M, Usall J, Oliveira M, Alegre I, Vin
˜as I (2008) Efficacy
of neutral electrolyzed water (NEW) for reducing microbial
contamination on minimally-processed vegetables. Int J Food
Microbiol 123:151–158
11. Izumi H (1999) Electrolyzed water as a disinfectant for fresh-cut
vegetables. J Food Sci 64:536–539
12. Imai K, Ogawa H, Bui VN, Inoue H, Fukuda J, Ohba M, Ya-
mamoto Y, Nakamura K (2012) Inactivation of high and low
pathogenic avian influenza virus H5 subtypes by copper ions
incorporated in zeolite-textile materials. Antivir Res 93:225–233
13. Bui VN, Ogawa H, Xininigen, Karibe K, Matsuo K, Awad SSA,
Minoungou GL, Yoden S, Haneda H, Ngo LH, Tamaki S, Ya-
mamoto Y, Nakamura K, Saito K, Watanabe Y, Runstadler J,
Huettmann F, Happ GM, Imai K (2012) H4N8 subtype avian
influenza virus isolated from shorebirds contains a unique PB1
gene and causes severe respiratory disease in mice. Virology
423:77–88
14. Yamada K, Ogawa H, Hara A, Yoshida Y, Yonezawa Y, Karibe
K, Nghia VB, Yoshimura H, Yamamoto Y, Yamada M, Na-
kamura K, Imai K (2009) Mechanism of the antiviral effect of
hydroxytyrosol on influenza virus appears to involve morpho-
logical change of the virus. Antivir Res 83:35–44
15. Le
´ne
`s D, Deboosere N, Me
´nard-Szczebara F, Jossent J, Alexan-
dre V, Machinal C, Vialette M (2010) Assessment of the removal
and inactivation of influenza viruses H5N1 and H1N1 by drinking
water treatment. Water Res 44:2473–2486
16. Rice EW, Adcock NJ, Sivaganesan M, Brown JD, Stallknecht
DE, Swayne DE (2007) Chlorine inactivation of highly patho-
genic avian influenza virus (H5N1). Emerg Infect Dis
13:1568–1570
17. Al-Haq MI, Seo Y, Oshita S, Kawagoe Y (2002) Disinfection
effects of electrolyzed oxidizing water on suppressing fruit rot of
pear caused by Botryosphaeria berengeriana. Food Res Int
35:657–664
18. Park H, Hung Y-C, Chung D (2004) Effects of chlorine and pH
on efficacy of electrolyzed water for inactivating Escherichia coli
O157:H7 and Listeria monocytogenes. Int J Food Microbiol
91:13–18
19. Scholtissek C (1985) Stability of infectious influenza A viruses to
treatment at low pH and heating. Arch Virol 85:1–11
20. Al-Haq MI, Sugiyama J, Isobe S (2005) Applications of elec-
trolyzed water in agriculture & food industries. Food Sci Technol
Res 11:135–150
21. Venkitanarayanan KS, Ezeike GO, Hung Y-C, Doyle MP (1999)
Efficacy of electrolyzed oxidizing water for inactivating Esche-
richia coli O157:H7, Salmonella enteritidis, and Listeria mono-
cytogenes. Appl Environ Microbiol 65:4276–4279
22. Hsu S-Y, Kao H-Y (2004) Effects of storage conditions on
chemical and physical properties of electrolyzed oxidizing water.
J Food Eng 65:465–471
23. Len SV, Hung YC, Chung D, Anderson JL, Erickson MC, Morita
K (2002) Effects of storage conditions and pH on chlorine loss on
electrolyzed oxidizing (EO) water. J Agric Food Chem
50:209–212
24. Tuladhar E, Hazeleger WC, Koopmans M, Zwietering MH,
Beumer RR, Duizer E (2012) Residual viral and bacterial con-
tamination of surfaces after cleaning and disinfection. Appl
Environ Microbiol 78:7769–7775
25. Oomori T, Oka T, Inuta T, Arata Y (2000) The efficiency of
disinfection of acidic electrolyzed water in the presence of
organic materials. Anal Sci 16:365–369
26. Park E-J, Alexander E, Taylor GA, Costa R, Kang D-H (2009)
The decontaminative effects of acidic electrolyzed water for
Escherichia coli O157:H7, Salmonella typhimurium, and Listeria
monocytogenes on green onions and tomatoes with differing
organic demands. Food Microbiol 26:386–390
27. Bonde MR, Nester SE, Khayat A, Smilanick JL, Frederick RD,
Schaad NW (1999) Comparison of effects of acidic electrolyzed
water and NaOCl on Tilletia indica teliospore germination. Plant
Dis 83:627–632
412 S. Tamaki et al.
123
