DataPDF Available

2013 Talavera et al Lysandra SM

Authors:
  • Zoological Institute of Russian Academy of Sciences
SUPPLEMENTARY MATERIAL
In the shadow of phylogenetic uncertainty: the recent
diversification of the Lysandra butterflies through
chromosomal change
Gerard Talaveraa,b,c, Vladimir A. Lukhtanovb,d, Lukas Rieppelc,e, Naomi E. Piercec and
Roger Vilaa,*
aInstitut de Biologia Evolutiva (CSIC-UPF), Passeig Marítim de la Barceloneta, 37,
08003 Barcelona, Spain
bFaculty of Biology & Soil Science, St Petersburg State University, Universitetskaya
nab.7/9, 199034 St Petersburg, Russia
c
Department of Organismic and Evolutionary Biology and Museum of Comparative
Zoology, Harvard University, 26 Oxford Street, Cambridge, Massachusetts 02138, USA
d
Department of Karyosystematics, Zoological Institute of Russian Academy of
Science, Universitetskaya nab. 1, 199034 St Petersburg, Russia
e
Department of History, Brown University, 79 Brown Street, Providence, RI 02192,
USA
*Corresponding author: roger.vila@csic.es
!
!
2!
SUPPLEMENTARY DISCUSSION
Phylogenetic relationships
We recover three well-differentiated clades plus three species with apparently no close
relative (L. syriaca, L. dezina and L. ossmar). One of the strongly supported clades is
formed by L. punctifera and L. bellargus, a grouping that corresponds very well to
morphology. In fact L. punctifera and L. bellargus are so similar in their wing patterns
that the taxon punctifera, first described by Oberthür in 1876 was initially considered a
subspecies of L. bellargus. Much later, de Lesse (1959) assigned punctifera species
status based on differences in chromosome number. These two taxa split ca. 0.74 Mya,
possibly because of dispersal across the West Mediterranean (perhaps through the
Gibraltar Strait), since L. bellargus is widespread in the Iberian Peninsula and across
Europe into Western Asia, while L. punctifera is confined to the Southwestern
Mediterranean shore (Morocco, N. Algeria and NW. Tunisia). The removal of the
conflicting signal created by the mitochondrial sequence of L. bellargus JC96Q001
substantially increases the posterior probability of this clade (pp from 0.82 to 0.98).
This specimen was collected in Germany, where L. bellargus flies syntopically and
synchronically with L. coridon. Indeed, the introgressed mitochondrial haplotype has
already been shown to be very widespread in Romania, where nine out of ten sequenced
Romanian L. bellargus specimens carried the introgression (Dincă et al., 2011).
Another supported clade includes all Iberian taxa (L. albicans, L. coelestissima, and L.
hispana) + coridon sensu stricto group (including the taxa gennargenti, nufrellensis,
and philippi) (Figure 2A-2B). Two differentiated clades are recovered in the
mitochondrial tree (Figure 1). One, which we will call the eastern clade, is well
supported and comprises only L. coridon, mainly from central and eastern Europe. The
!
!
3!
other, which we will call the western clade, is not well supported, and contains the
remainder of the L. coridon samples from the Iberian Peninsula and Southern France,
which cluster together with the other three Iberian taxa. The internal relationships for
this group display a high degree of phylogenetic uncertainty. Notably, the four Iberian
taxa and L. coridon are not recovered as monophyletic. Introgression is likely at play
within this western clade, although JML could not differentiate it from the uncertainty
created by incomplete lineage sorting. As shown in Figure 2C, the L. coridon specimens
from the western clade were usually collected in sympatry or proximity to some of the
other three Iberian taxa.
A macropopulation structure dividing L. coridon into an eastern and a western European
form has been previously suggested (Schmitt and Seitz, 2001; Schmitt et al., 2002;
Schmitt and Zimmermann, 2011). While our results generally agree with the proposed
distribution of these two forms, remarkable additions to the known phylogeography of
the species are worth discussing. First of all, a L. coridon specimen from Monte Pollino
(Calabria, Southern Italy) displays a highly diverged haplotype with unresolved position
in the tree, and it could represent a relict lineage that has survived in this rather isolated
locality. Similarly, the Sardinian taxon gennargenti, while apparently related to the
eastern clade, is also substantially diverged, which suggests that it has remained isolated
for a substantial amount of time. Rather surprisingly, the geographically close taxon
nufrellensis from Corsica belongs instead to the eastern clade, and its mitochondrial
sequence is close to that of one French L. coridon narbonensis specimen studied,
among others. Thus, nufrellensis is apparently the outcome of a more recent
colonization of Corsica from the mainland, despite having some phenotypic
!
!
4!
differentiation that could be either the result of a founder effect, drift or adaptation to
insular conditions.
The other insular population studied is from the UK, which also belongs to the eastern
clade and is almost identical to the French L. coridon narbonensis specimen. Thus, we
can conclude that L. coridon may have colonized Great Britain quite recently from the
mainland.
Our results show that the clear-cut division proposed for the two L. coridon forms, with
a contact zone in north-eastern Germany, along the mountain ranges of the German–
Czech border and throughout the eastern Alps (Schmitt and Zimmermann, 2012), is
much more complex than originally proposed, at least for mitochondrial markers.
Indeed, at least two specimens from the eastern clade were collected in surprisingly
western locations: one was L. coridon narbonensis MAT99Q932 from Mende
(Languedoc region, France). The other specimen is L. coridon asturiensis RV07C272
collected in the extreme north-western Iberian Peninsula (Figure 2C). Worth noting, this
novel population, which represents the westernmost locality for L. coridon, occurs in an
isolated small cape situated outside the area of influence of any other Iberian Lysandra
species.
The two L. coridon clades may be the outcome of two different glacial refugia (the
western clade in the Iberian Peninsula and the eastern clade in the Italian or Balkan
Peninsulas, with postglacial dispersal creating the current distribution (Schmitt et al.,
2002). However, we propose that isolation during the last glaciation has not generated
most of the intraspecific divergence detected in L. coridon, but that the four taxa in the
!
!
5!
Iberian refugium shared mitochondrial sequences in a high degree. The hypothesis of
introgression between L. albicans, L. coelestissima, L. hispana and western L. coridon
is further supported by the species tree treating separately the L. coridon eastern and
western clades, which recovers them as paraphyletic lineages because the western clade
is sister to the other three Iberian taxa (Figure 2D). While introgression within the
Iberian Peninsula could not be unambiguously demonstrated by JML, this hypothesis is
more likely than solely incomplete lineage sorting being the cause. Indeed, the presence
of the eastern form in the extreme northwest Iberian Peninsula can hardly be explained
by recent long-range dispersal. This isolated and ecologically unique population,
located outside the area of influence of the other Iberian taxa and of other L. coridon
populations (Figure 2C), shares a chromosome number with its geographical
neighbours, and is most probably a relict of “pure” Iberian L. coridon that was not
introgressed, which would mean that most of the western clade genetic differentiation is
actually derived from events of introgression.
Within the coridon group, we consider the somewhat morphologically differentiated
taxa gennargenti and nufrellensis as L. coridon subspecies because their genetic
divergences fall within that of L. coridon sensu stricto. The taxon gennargenti is
morphologically different from other forms of the L. coridon complex and due to the
blue color of wing upperside in both males and females it was considered sometimes as
a species distinct from L. coridon (Jutzeler et al., 2003). However, recent hybridization
experiments (Schurian et al., 2011) demonstrated an absence of reproductive isolation
between the taxa gennargenti and nufrellensis, concluding conspecifity of both taxa
with L. coridon. No information is available on their chromosome numbers, and they
are allopatric. The taxon philippi, which flies in Northern Greece, is genetically
!
!
6!
identical to L. coridon graeca from Central Greece. Indeed, the taxon philippi was
described as a separate species due an erroneous chromosome number count: Brown
and Coutsis (1978) determined its chromosome number to be n=20-26, but no figures
were provided. Later on, Coutsis et al. (2001) examined the karyotype of philippi again
and found n=88-90, with one large chromosome. As its chromosome number does not
differ from nearby L. coridon, its species status no longer seems warranted.
The generally parapatric, but sometimes locally sympatric, Iberian taxa require more
complex assessment. Even if they frequently hybridize, they seem to present stable
differences in chromosome number, and we tentatively consider albicans, hispana and
coelestissima as three recent species.
Lastly, we recover the corydonius group as monophyletic. This includes four taxa from
the Caucasus (corydonius, arzanovi, melamarina and sheikh) that are often considered
subspecies of a single species, corydonius (Vodolazhsky and Stradomsky, 2008). Their
divergence is minimal and they are estimated to have diverged ca. 0.25 Mya. They all
seem to be allopatric, and differ in certain morphological characteristics and voltinism.
The taxon melamarina is bivoltine, and differs from other representatives of the coridon
subgroup by a very light, whitish color of the underside wing. The taxon sheikh,
however, is monovoltine, and close to other representatives of the coridon subgroup,
although displaying more bluish upperside wings in males and larger marginal black
spots. The taxon arzanovi was described on the basis of putative chromosomal
differences, as well as tiny differences in male genitalia (fine structure of gnathos) and
male wing color (wing underside is grey whereas it is whitish in melamarina and brown
in corydonius and sheikh).
!
!
7!
However, since the chromosomal data we provide (n=84 for L. melamarina, L. sheikh
and L. corydonius) cast doubt on previously reported chromosomal differences within
this complex, we propose provisionally treating these taxa as conspecific until further
evidence is obtained. Indeed, no predominant fixed barriers seem to exist between them,
and the fact that they appear to be isolated, parapatric populations with some degree of
phenotypic differentiation encourages us to treat them as subspecies sensu Braby et al.
(2012).
The case of L. ossmar, a taxon that is usually considered to be closely related to the
parapatric L. corydonius (Schurian, 1989; Hesselbarth et al., 1995), is especially
interesting. While Schurian (1989, p. 158) conducted a morphological and ecological
analysis that recovered L. ossmar as sister to the L. corydonius clade, in our dataset this
is shown to be an effect produced by detected cases of mitochondrial introgression
between these two taxa. Indeed, when removing the two potentially introgressed
sequences, L. ossmar is recovered as an independent lineage with no close relative and
unresolved position, similarly to the result for the middle-eastern taxa L. dezina and L.
syriaca.
References:
Braby, M.F., Eastwood, R., Murray, N., 2012. The subspecies concept in butterflies: has
its application in taxonomy and conservation biology outlived its usefulness? Biol. J.
Linn. Soc. 106, 699716.
!
!
8!
de Lesse H., 1959. Sur la valeur spécifique de deux sous-espèces d'Agrodiaetus (Lep.
Lycaenidae) récemment descrites. Bull. mens. Soc. Linn. Lyon. 28, 312315.
Jutzeler, D., Casula, P., Gascoigne-Pees, M., Grill, A., Leigheb, G. 2003. Confirmation
du statut specifique de Polyommatus gennargenti (LEIGHEB, 1987) de Sardaigne
compare a Polyommatus coridon (PODA, 1761) de la region de Schaffhouse (CH) par
elevage parallele (Lepidoptera: Lycaenidae) 1ere partie. Linneana Belgica 19(3), 109-
118.
Oberthür, C., 1876. Faunes entomologiques; descriptions d’insects nouveaux ou peu
connus. Imprimerie Oberthür. Rennes.
Schmitt, T., Seitz, A., 2001. Allozyme variation in Polyommatus coridon (Lepidoptera:
Lycaenidae): identification of ice-age refugia and reconstruction of post-glacial
expansion. J. Biogeogr. 28, 1129–1136.
Schmitt, T., Gießl, A., Seitz, A., 2002. Postglacial colonisation of western Central
Europe by Polyommatus coridon (Poda 1761) (Lepidoptera: Lycaenidae): evidence
from population genetics. Heredity 88, 26–34.
Schmitt, T., Zimmermann, M., 2012. To hybridize or not to hybridize: what separates
two genetic lineages of the Chalk-hill Blue Polyommatus coridon (Lycaenidae,
Lepidoptera) along their secondary contact zone throughout eastern Central Europe? J.
Zoo. Syst. Evol. Res. 50, 106115.
!
!
9!
Schurian, K.G., Westenberger, A., Diringer, Y., Wiemers, M. 2011. Contribution to
the biology, ecology and taxonomy of Polyommatus (Lysandra) coridon nufrellensis
(Schurian, 1977) (Lepidoptera: Lycaenidae), Part II1: an experimental hybridisation of
P. (L.) c. gennargenti x P. (L.) c. nufrellensis. Nachrichten des Entomologischen
Vereins Apollo 31(4), 177-186.
Vodolazhsky, D.I., Stradomsky, B.V., 2008. A study of blues butterflies of the group of
Lysandra corydonius (Herrich-Schäffer, 1804) (Lepidoptera: Lycaenidae) with the use
of mtDNA markers. Caucas. Entomol. Bull. 4, 353355.
SUPPLEMENTARY TABLES AND FIGURES
Table S1. Samples used in this study: taxon name, sample accession number at MCZ
and sample collection locality.
Genus
Species & ssp.
Sample
code
Locality
Lysandra
albicans albicans
RV03H582
Puebla de Don Fadrique, 1295 m, Granada, Spain
Lysandra
albicans
arragonensis
MAT99Q969
Una, Cuenca, 970m, Spain
Lysandra
arzanovi
SH02H019
Aibga-1 Pass. 1850m, Krasnaya Polyana, Aibga Mts., Sotch,
Krasnodar Region, Russia
Lysandra
arzanovi
SH02H020
Aibga-1 Pass. 1850m, Krasnaya Polyana, Aibga Mts., Sotch,
Krasnodar Region, Russia
Lysandra
bellargus
AD00P129
Aragatz Mt., Amberd Valley, 2300m, Transcaucasus, Armenia
Lysandra
bellargus
JC96Q001
Gambach, Bavaria, Germany
Lysandra
bellargus
MAT99Q882
Rúbies, Catalonia, Spain
Lysandra
bellargus
RV04G399
Saimbeyli Valley, 1445m (Adana), Turkey
Lysandra
bellargus
VL02X510
Masuleh, 1900-2100m, Gilan, Iran
Lysandra
caelestissima
MAT99Q959
Ciudad Encantada, 1440m, Uña, Cuenca, Spain
Lysandra
caelestissima
MAT99Q966
Uña, Cuenca, 970m, Spain
Lysandra
coridon apennina
MB05G416
Mt. Pollino, Calabria, Italy
Lysandra
coridon asturiensis
JR04G493
Albelda, 900m, La Rioja, Spain
Lysandra
coridon asturiensis
RV07C272
Cedeira, Capelada, Galicia, Spain
Lysandra
coridon borussia
AD00P192
Tula region, Tatinki, 120 m., W. Russia
Lysandra
coridon cataluniae
RV03H454
El Brull, Catalonia, Spain
!
!
10!
Lysandra
coridon coridon
VD02T008
Romania
Lysandra
coridon gennargenti
KS05I874
Orgosolo, 1250m, vic. Monte Novo S. Giovanni, Sardignia Is.
Lysandra
coridon gennargenti
KS05I875
Orgosolo, 1250m, vic. Monte Novo S. Giovanni, Sardignia Is.
Lysandra
coridon insulana
RE04C165
Therfield Heath, Royston, UK
Lysandra
coridon narbonensis
MAT99Q932
Mende, 780m, Languedoc region, France
Lysandra
coridon
AD00P045
Volgograd region, Kamyshinsky v., 200 m., Low Volga, South
Russia
Lysandra
coridon
RE07G279
NE Bezandun-sur-Bine, 735 m, Drome, France
Lysandra
coridon
RV06A183
Sorteny, Andorra
Lysandra
coridon
RV07E302
Baile Herculane, Pecinisca, 220-320m, Caras-Severin, Romania
Lysandra
coridon graeca
JXC02G002
Mt. Timfristos (=Mt. Veluhi), 1300-1500m, Sterea Ellas, Greece
Lysandra
corydonius
caucasica
VL01L120
Hasköy, 12 km SW Gümüshane, Gümüshane Prov., Turkey
Lysandra
corydonius
caucasica
AD00P435
Aiodzor Mts., Gnishyk 1800 m., Transcaucasus, Armenia
Lysandra
corydonius
corydonius
VL03F932
Talysh Mts, SE Azerbeijan
Lysandra
corydonius
corydonius
VL05N131
Iran Azerbaijan-e Sharqi, pass 25 km NW Varzaqan; 2050-2170 m
Lysandra
dezina
09X500
Kurdistan
Lysandra
hispana hispana
MAT99T993
Coll d’Estenalles, 870m, Parc Natural de Sant Llorenç del Munt,
Spain
Lysandra
hispana hispana
RV07F312
El Mont, Albanyà, Alt Empordà, Girona, Spain, 860m
Lysandra
hispana semperi
RV02N590
Ares del Maestre, 1150m, Castello, Spain
Lysandra
melamarina
SH02H007
Gelendjik, Betta Mts., 150m, Krasnodar Region, Russia
Lysandra
melamarina
SH02H010
Gelendjik, Betta Mts., 150m, Krasnodar Region, Russia
Lysandra
nufrellensis
KS05I821
Corsica, 1300m
Lysandra
nufrellensis
KS05I822
Corsica, 1300m
Lysandra
ossmar ankara
RV04G136
Kargasekmez Geçidi, Kizilcahamam, 1150m (Ankara) Turkey
Lysandra
ossmar ossmar
RV04G356
3Km NW Urgüp, 1140m (Kapadokya) Turkey
Lysandra
ossmar ossmar
RV07F170
Yelatan, 15 km S. of Çamardi, Nidge, Turkey, 1330m
Lysandra
philippi
SI03K025
Mt. Phalakro, 1600 m, District (Nomos) Drama, Greece
Lysandra
philippi
SI03K037
Mt. Phalakro, 600 m, District (Nomos) Drama, Greece
Lysandra
punctifera
NK02A026
Ait-b-Yahya, 1900m, Rich, Morocco
Lysandra
punctifera
NK02A027
Col Taghzoum, 1900m, High Atlas Range, Morocco
Lysandra
sheikh
VL03F998
Altyagach,1300m, Azerbeijan near the border with Dagestan,
Russia
Lysandra
sheikh
VL03H615
Altyagach,1300m, Azerbeijan near the border with Dagestan,
Russia
Lysandra
syriaca burak
RV07F139
13 km N. of Saimbeily, 1505m (Adana) Turkey
Polyommatus
amandus amurensis
AD02W109
Primorski Krai, S. Ussuri, Khanka Lake, Poganichnoye, Russia
Neolysandra
diana
AD00P081
Gegamsky Mts., 1800m, Gegadyr, Armenia
Polyommatus
myrrha cinyraea
AD00P389
Zangezur Mts., Akhtchi, Armenia
!
!
11!
Table S2. Primer sequences. mt: mitochondrial, n: nuclear. T = thymine, A = adenine,
G = guanine, C = cytosine, K = G+T, W = A+T, M = A+C, Y = C+T, R = A+G, S =
G+C, V = G+A+C, I = Inosine, N = A+C+G+T.
Primer
location
Primer name
Direction
Sequence (5' to 3')
mt COI
LCO14901
forward
GGTCAACAAATCATAAAGATATTGG
mt COI
Ron2,3
forward
GGATCACCTGATATAGCATTCCC
mt COI
Nancy3
reverse
CCCGGTAAAATTAAAATATAAACTTC
mt COI
Tonya3
forward
GAAGTTTATATTTTAATTTTACCGGG
mt COI
Hobbes3
reverse
AAATGTTGNGGRAAAAATGTTA
mt COI
TN21264
forward
TTGAYCCTGCAGGTGGWGGAG
mt COII
George3,5
forward
ATACCTCGACGTTATTCAGA
mt COII
Phyllis3,5
reverse
GTAATAGCIGGTAARATAGTTCA
mt COII
Strom3,5
forward
TAATTTGAACTATYTTACCIGC
mt COII
Eva3,5
reverse
GAGACCATTACTTGCTTTCAGTCATCT
mt COII
JL31464
forward
GAGTTTCACCTTTAATAGAACA
mt COII
B-tLys2
reverse
GTTTAAGAGACCAGTACTTG
mt COII
JL25324
forward
ACAGTAGGAGGATTAACAGGAG
n CAD
CAD787F6
forward
GGDGTNACNACNGCNTGYTTYGARCC
n CAD
CADFa7
forward
GDATGGTYGATGAAAATGTTAA
n CAD
CADRa7
reverse
CTCATRTCGTAATCYGTRCT
n H3
H3F8
forward
ATGGCTCGTACCAAGCAGACVGC
n H3
H3R8
reverse
ATATCCTTRGGCATRATRGTGAC
n ITS-2
ITS-39
forward
GCATCGATGAAGAACGCAGC
n ITS-2
ITS-49
reverse
TCCTCCGCTTATTGATATGC
n wg
LepWg110
forward
GARTGYAARTGYCAYGGYATGTCTGG
n wg
LepWg2E7
reverse
ACNACGAACATGGTCTGCGT
n wg
Wg1n11
forward
CGGAGATGCGMCAGGARTGC
n wg
Wg2n11
reverse
CTTTTTCCGTSCGACACAGYTTGC
n 28S
S366012
forward
GAGAGTTMAASAGTACGTGAAAC
n 28S
A33512
reverse
TCGGARGGAACCAGCTACTA
n Rpl5
F4413
forward
TCCGACTTTCAAACAAGGATG
n Rpl5
Lys3R14
reverse
ACAGCTCTGGCGCAGCGAAG
1 Folmer, O., Black, M., Hoeh, W., Lutz, R., & Vrijenhoek, R.C. 1994. DNA primers for amplification of mitochondrial
cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Marine Biol. Biotech. 3, 294-299.
2 Simon, C., Frati, F., Beckebach, A., Crespi, B., Liu, H. & Flook, P. 1994. Evolution, weighting, and phylogenetic utility
of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the
Entomological Society of America 87(6), 651-701.
3 Monteiro, A. & Pierce, N.E. 2001. Phylogeny of Bicyclus (Lepidoptera: Nymphalidae) inferred from COI, COII, and EF-
1alpha gene sequences. Molecular Phylogenetics and Evolution 18, 264-281.
4 Canfield M.R., Greene E., Moreau C.S., Chen N., & Pierce N.E. 2008. Exploring phenotypic plasticity and
biogeography in emerald moths: A phylogeny of the genus Nemoria (Lepidoptera: Geometridae). Molecular
Phylogenetics and Evolution 49(2), 477-87.
5 Brower, A.V.Z. 1994. Phylogeny of Heliconius butterflies inferred from mitochondrial DNA sequences (Lepidoptera:
Nymphalidae). Molecular Phylogenetics and Evolution 3(2), 159-174.
6 Moulton, J.K. & Wiegmann, B.M. 2004. Evolution and phylogenetic utility of cad (rudimentary) among Mesozoic-aged
eremoneuran Diptera (Insecta). Molecular Phylogenetics and Evolution 31, 363-378.
7 Vila, R., Bell, C.D., Macniven, R., Goldman-Huertas, B., Ree, R.H., Marshall, C.R., Bálint, Z., Johnson, K., Benyamini,
D., & Pierce, N.E. 2011. Phylogeny and palaeoecology of Polyommatus blue butterflies show Beringia was a climate-
regulated gateway to the New World. Proceedings of the Royal Society B 278(1719), 2737-2744.
8 Colgan, D.J., McLauchlan, A., Wilson, G.D.F., Livingston, S.P., Edgecombe, G.D., Macaranas, J., Cassis G., & Gray,
M.R. 1998. Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. Australian Journal of
Zoology 46, 419-437.
!
!
12!
9 White, T.J., Bruns, S., Lee, S., & Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes
for phylogenetics in PCR protocols: a guide to methods and applications, edited by M.A. Innis, Gelfandm D.H., J.J.
Snisky, & T. J. White. Academic Press, New York, pp. 315-322.
10 Brower, A.V.Z. & DeSalle, R. 1998. Patterns of mitochondrial versus nuclear DNA sequence divergence among
nymphalid butterflies: the utility of wingless as a source of characters for phylogenetic inference. Insect Molecular
Biology 7(1), 73-82.
11 Designed by Ada Kalizewska (Harvard University, Cambridge, MA, USA).
12 Sequeira, A.S., Normark, B.B., & Farrell, B. 2000. Evolutionary assembly of the conifer fauna: Distinguishing ancient
from recent associations in bark beetles. Proceedings of the Royal Entomological Society (London) B 267, 2359-
2366.
13 Mallarino R, Bermingham E, Willmott KR, Whinnett A. and CD Jiggins. 2005. Molecular systematics of the butterfly
genus Ithomia (Lepidoptera: Ithomiinae): a composite phylogenetic hypothesis based on seven genes. Molecular
Phylogenetics and Evolution 34, 625-644.
14 Designed in this study
Table S3. Genbank accession codes. GenBank codes used in this study.
Taxon
Specimen
Code
COI +
COII
Wg
CAD
ITS2
H3
28S
Rpl5
L. albicans albicans
RV03H582
X (COI)
X
X
X
X
X
X
L. albicans
arragonensis
MAT99Q969
X
X
X
X
X
L. arzanovi
SH02H019
X
X
X
X
X
X
L. arzanovi
SH02H020
X
X
X
X
X
X
X
L. bellargus
AD00P129
X
X
X
X
X
X
L. bellargus
JC96Q001
X
X
X
X
X
X
X
L. bellargus
MAT99Q882
X
X
X
X
X
X
L. bellargus
RV04G399
X
X
X
X
X
X
X
L. bellargus
VL02X510
X
X
X
X
X
X
L. caelestissima
MAT99Q959
X
X
X
X
X
X
X
L. caelestissima
MAT99Q966
X
X
X
X
X
X
X
L. coridon apennina
MB05G416
X
X
X
X
X
X
X
L. coridon
asturiensis
JR04G493
X
X
X
X
X
X
X
L. coridon
asturiensis
RV07C272
X
X
X
X
X
X
X
L. coridon borussia
AD00P192
X
X
X
X
X
L. coridon cataluniae
RV03H454
X
X
X
L. coridon coridon
VD02T008
X
X
X
X
X
X
X
L. coridon
gennargenti
KS05I874
X
X
X
X
X
X
X
L. coridon
gennargenti
KS05I875
X
X
X
X
X
X
L. coridon insulana
RE04C165
X
X
X
X
X
X
X
L. coridon
narbonensis
MAT99Q932
X
X
X
X
X
X
X
L. coridon
AD00P045
X
X
X
X
X
X
L. coridon
RE07G279
X
X
X
X
X
X
!
!
13!
L. coridon
RV06A183
X
X
X
X
X
X
L. coridon
RV07E302
X
X
X
X
X
X
L. coridon graeca
JXC02G002
X
X
X
X
X
X
X
L. corydonius
caucasica
VL01L120
X
X
X
X
X
X
X
L. corydonius
caucasica
AD00P435
X
X
X
X
X
X
X
L. corydonius
corydonius
VL03F932
X
X
X
X
X
X
X
L. corydonius
corydonius
VL05N131
X
X
X
X
X
X
X
L. dezina
08X599
X
X
L. hispana hispana
MAT99T993
X
X
X
X
X
X
X
L. hispana hispana
RV07F312
X
X
X
X
X
X
X
L. hispana semperi
RV02N590
X
X
X
X
X
X
X
L. melamarina
SH02H007
X
X
X
X
X
X
X
L. melamarina
SH02H010
X
X
X
X
X
X
L. nufrellensis
KS05I821
X
X
X
X
X
X
X
L. nufrellensis
KS05I822
X
X
X
X
X
X
X
L. ossmar ankara
RV04G136
X
X
X
X
X
X
L. ossmar ossmar
RV04G356
X
X
X
X
X
X
L. ossmar ossmar
RV07F170
X
X
X
X
X
X
L. philippi
SI03K025
X
X
X
X
X
L. philippi
SI03K037
X
X
X
X
X
X
X
L. punctifera
NK02A026
X (COI)
X
X
X
X
X
X
L. punctifera
NK02A027
X
X
X
X
X
X
X
L. sheikh
VL03F998
X
X
X
X
X
X
L. sheikh
VL03H615
X
X
X
X
X
X
X
L. syriaca burak
RV07F139
X
X
X
X
X
X
X
P. amandus
amurensis
AD02W109
X
X
X
X
X
X
X
N. diana
AD00P081
X
X
X
X
X
X
X
P. myrrha cinyraea
AD00P389
X
X
X
X
X
X
X
Table S4. Parsimony informative sites and number of positions per each loci for the
Lysandra species.
Gene
Parsimony
informative sites
Number of
positions
CO
153
2164
CAD
2
745
Wg
15
403
ITS2
10
635
28S
3
821
H3
4
329
Rpl5
21
873
!
!
14!
!
Table S5. Demographic history from *BEAST species tree inference. Values are
extracted from Biopy consensus tree summaries. The X axis represents divergence time
and Y axis represents relative population sizes width. Demographic values (dmv) for
coalescence beginnings and ending points in branches are shown according to piecewise
linear model used in *BEAST. Node ages are summarized using TreeAnnotator.
dmv_b
dmv_e
dmv95_b
dmv95_e
Node age
arz
0.78
0.22
0.19
1.95
0.07
mel
0.90
0.25
0.23
2.12
0.07
arz-mel
0.47
0.26
0.18
1.75
0.15
cory
0.90
0.19
0.22
1.86
0.15
cory-(arz-mel)
0.45
0.13
0.12
1.18
0.25
she
0.76
0.16
0.16
1.80
0.25
she-(cory-(arz-mel))
0.29
0.26
0.14
0.83
0.60
oss
0.93
0.39
0.33
1.84
0.60
oss-(she-(cory-(arz-mel)))
0.65
0.61
0.35
1.67
0.89
alb
1.07
0.33
0.31
2.40
0.12
cael
0.94
0.23
0.24
1.99
0.12
cael-alb
0.57
0.40
0.24
1.88
0.25
his
1.18
0.39
0.38
2.22
0.25
his-(cael-alb)
0.78
0.28
0.25
1.49
0.38
cor
2.43
1.18
1.24
2.82
0.38
cor-(his-(cael-alb))
1.47
0.66
0.60
2.33
0.89
(cor-(his-(cael-alb)))-(oss-(she-
(cory-(arz-mel)))
1.27
0.58
0.50
2.38
1.18
dez
1.02
0.35
0.30
2.38
1.18
syr
1.02
0.38
0.32
2.22
1.18
dez-syr
0.73
0.78
0.41
2.59
1.04
(dez-syr)-(cor-(his-(cael-alb)))-
(oss-(she-(cory-(arz-mel))))
1.36
0.71
0.52
2.14
1.04
bel
1.00
0.18
0.26
1.26
0.72
punc
0.72
0.18
0.19
1.53
0.72
bel-punc
0.36
0.50
0.23
1.47
1.40
(bel-punc)-rest
1.21
1.21
0.77
2.45
1.40
!
!
15!
Figures S1-S6. Maximum Likelihood nuclear gene trees (H3, 28S, Wg, CAD, ITS2 and
Rpl5). Highest values for bootstrap support are shown at nodes. Scale bar represents
substitutions per position.
RV04G356 Lysandra ossmar ossmar Turkey
AD00P435 Lysandra corydo nius caucasica Armenia
RV07C272 Lysandra coridon asturiensis Spain
RV07F170 Lysandra ossmar ossmar Turkey
SH02H007 Lysandra melamarina Russia
SH02H010 Lysandra melamarina Russia
SH02H019 Lysandra arzanovi Russia
SH02H020 Lysandra arzanovi Russia
SI03K025 Lysandra philippi Greece
VL01L120 Lysandra corydonius caucasica Turkey
VL02X510 Lysandra bellargus Iran
VL03F932 Lysandra corydonius corydonius Azerbaijan
VL03F998 Lysandra sheikh Russia
VL03H615 Lysandra sheikh Russia
RV07E302 Lysandra coridon Romania
VL05N131 Lysandra corydonius corydonius Iran
JC96Q001 Lysandra bellargus Germany
AD00P045 Lysandra coridon Russia
RV04G399 Lysandra bellargus Turkey
JXC02G002 Lysandra coridon graeca Greece
AD00P192 Lysandra coridon borussia Russia
RV02N590 Lysandra hispana semperi Spain
MAT99Q969 Lysandra albicans arragonensis Spain
MAT99Q959 Lysandra caelestissima Spain
RV03H582 Lysandra albicans albicans Spain
MAT99Q966 Lysandra caelestissima Spain
KS05I822 Lysandra nufrellensis Corsica
NK02A027 Lysandra punctifera
KS05I875 Lysandra coridon gennargenti Sardinia
KS05I874 Lysandra coridon gennargenti
6 5
NK02A026 Lysandra punctif era Mor occo
AD00P129 Lysandra bellargus Armenia
KS05I821 Lysandra nufrellensis Corsica
RE07G279 Lysandra coridon France
RV07F312 Lysandra hispana hispana Spain
VD02T008 Lysandra coridon coridon Romania
RV06A183 Lysandra coridon Andorra
RV04G136 Lysandra ossmar ankara Turkey
RV07F139 Lysandra syriaca burak Turkey
SI03K037 Lysandra philippi Greece
09X500 Lysandra dezina Kurdistan
MAT99Q932 Lysandra coridon narbonensis France
JR04G493 Lysandra coridon asturiensis Spain
RE04C165 Lysandra coridon insulana UK
MAT99T993 Lysandra hispana hispana Spain
MB05G416 Lysandra coridon apennina Italy
7 4
7 4
AD00P389 P. myrrha
AD02W109 P. amandus
AD00P081 N. diana
5 6
0.02
30
58
61
H3
!
!
16!
KS05I875 Lysandra coridon gennargenti Sardinia
KS05I874 Lysandra coridon gennargenti
MAT99Q959 Lysandra caelestissima Spain
MAT99Q966 Lysandra caelestissima Spain
MAT99T993 Lysandra hispana hispana Spain
MB05G416 Lysandra coridon apennina Italy
RE04C165 Lysandra coridon insulana UK
RE07G279 Lysandra coridon France
RV04G356 Lysandra ossmar ossmar Turkey
RV06A183 Lysandra coridon Andorra
RV07C272 Lysandra coridon asturiensis Spain
RV07F139 Lysandra syriaca burak Turkey
RV07F170 Lysandra ossmar ossmar Turkey
RV07F312 Lysandra hispana hispana Spain
SH02H007 Lysandra melamarina Russia
SH02H010 Lysandra melamarina Russia
SH02H019 Lysandra arzanovi Russia
SH02H020 Lysandra arzanovi Russia
SI03K025 Lysandra philippi Greece
SI03K037 Lysandra philippi Greece
VL01L120 Lysandra corydonius caucasica Turkey
VL03F932 Lysandra corydonius corydonius Azerbaijan
VL03F998 Lysandra sheikh Russia
VL03H615 Lysandra sheikh Russia
VD02T008 Lysandra coridon coridon Romania
MAT99Q969 Lysandra albicans arragonensis Spain
RV02N590 Lysandra hispana semperi Spain
RV03H582 Lysandra albicans albicans Spain
RV07E302 Lysandra coridon Romania
RV04G136 Lysandra ossmar ankara Turkey
AD00P192 Lysandra coridon borussia Russia
KS05I821 Lysandra nufrellensis Corsica
MAT99Q882 Lysandra bellargus Spain
JC96Q001 Lysandra bellargus Germany
NK02A026 Lysandra punctifera Morocco
RV04G399 Lysandra bellargus Turkey
VL02X510 Lysandra bellargus Iran
AD00P129 Lysandra bellargus Armenia
NK02A027 Lysandra punctifera
AD00P045 Lysandra coridon Russia
KS05I822 Lysandra nufrellensis Corsica
09X599 Lysandra dezina Kurdistan
JXC02G002 Lysandra coridon graeca Greece
2 3
MAT99Q932 Lysandra coridon narbonensis France
JR04G493 Lysandra coridon asturiensis Spain
4 0
VL05N131 Lysandra corydonius corydonius Iran
AD00P435 Lysandra corydonius caucasica Armenia
3 3
9 9
AD00P389 P. myrrha
AD02W109 P. amandus
AD00P081 N. diana
99
8 2
87
31
28S
0.0009
!
!
17!
KS05I874 Lysandra coridon gennargenti
KS05I875 Lysandra coridon gennargenti Sardinia
9 1
KS05I821 Lysandra nufrellensis Corsica
5 0
RV07F139 Lysandra syriaca burak Turkey
MAT99Q966 Lysandra caelestissima Spain
RV02N590 Lysandra hispana semperi Spain
MAT99T993 Lysandra hispana hispana Spain
KS05I822 Lysandra nufrellensis Corsica
JXC02G002 Lysandra coridon graeca Greece
JR04G493 Lysandra coridon asturiensis Spain
MAT99Q959 Lysandra caelestissima Spain
AD00P045 Lysandra coridon Russia
MAT99Q969 Lysandra albicans arragonensis Spain
RV03H582 Lysandra albicans albicans Spain
RV07F312 Lysandra hispana hispana Spain
JC96Q001 Lysandra bellargus Germany
AD00P129 Lysandra bellargus Armenia
MAT99Q882 Lysandra bellargus Spain
RV04G399 Lysandra bellargus Turkey
VL02X510 Lysandra bellargus Iran
RV06A183 Lysandra coridon Andorra
RV07C272 Lysandra coridon asturiensis Spain
SI03K025 Lysandra philippi Greece
RV04G136 Lysandra ossmar ankara Turkey
MAT99Q932 Lysandra coridon narbonensis France
RE04C165 Lysandra coridon insulana UK
6 6
MB05G416 Lysandra coridon apennina Italy
RE07G279 Lysandra coridon France
6 6
SH02H010 Lysandra melamarina Russia
VL05N131 Lysandra corydonius corydonius Iran
SI03K037 Lysandra philippi Greece
RV07E302 Lysandra coridon Romania
NK02A026 Lysandra punctifera Morocco
NK02A027 Lysandra punctifera
9 9
SH02H007 Lysandra melamarina Russia
SH02H019 Lysandra arzanovi Russia
SH02H020 Lysandra arzanovi Russia
9
AD00P435 Lysandra corydonius caucasica Armenia
VD02T008 Lysandra coridon coridon Romania
RV04G356 Lysandra ossmar ossmar Turkey
1 2
VL03F932 Lysandra corydonius corydonius Azerbaijan
RV07F170 Lysandra ossmar ossmar Turkey
VL01L120 Lysandra corydonius caucasica Turkey
VL03F998 Lysandra sheikh Russia
VL03H615 Lysandra sheikh Russia
AD02W109 P. amandus
AD00P389 P. myrrha
AD00P081 N. diana
9 1
9 7
90
29
97
Wg
0.02
!
!
18!
RV02N590 Lysandra hispana semperi Spain
MB05G416 Lysandra coridon apennina Italy
RV03H582 Lysandra albicans albicans Spain
RV07F139 Lysandra syriaca burak Turkey
SH02H019 Lysandra arzanovi Russia
VL01L120 Lysandra corydonius caucasica Turkey
VL03F932 Lysandra corydonius corydonius Azerbaijan
VL03H615 Lysandra sheikh Russia
VL05N131 Lysandra corydonius corydonius Iran
RE07G279 Lysandra coridon France
SH02H007 Lysandra melamarina Russia
SH02H020 Lysandra arzanovi Russia
RE04C165 Lysandra coridon insulana UK
RV04G356 Lysandra ossmar ossmar Turkey
MAT99Q959 Lysandra caelestissima Spain
AD00P435 Lysandra corydonius caucasica Armenia
MAT99Q932 Lysandra coridon narbonensis France
MAT99Q966 Lysandra caelestissima Spain
RV04G399 Lysandra bellargus Turkey
AD00P045 Lysandra coridon Russia
SI03K037 Lysandra philippi Greece
JC96Q001 Lysandra bellargus Germany
VL02X510 Lysandra bellargus Iran
AD00P129 Lysandra bellargus Armenia
VD02T008 Lysandra coridon coridon Romania
2 5
JR04G493 Lysandra coridon asturiensis Spain
MAT99T993 Lysandra hispana hispana Spain
MAT99Q969 Lysandra albicans arragonensis Spain
RV07E302 Lysandra coridon Romania
KS05I822 Lysandra nufrellensis Corsica
KS05I821 Lysandra nufrellensis Corsica
RV07F170 Lysandra ossmar ossmar Turkey
RV04G136 Lysandra ossmar ankara Turkey
RV06A183 Lysandra coridon Andorra
KS05I874 Lysandra coridon gennargenti
RV07C272 Lysandra coridon asturiensis Spain
4 6
KS05I875 Lysandra coridon gennargenti Sardinia
JXC02G002 Lysandra coridon graeca Greece
RV07F312 Lysandra hispana hispana Spain
3 1
NK02A027 Lysandra punctifera
MAT99Q882 Lysandra bellargus Spain
NK02A026 Lysandra punctifera Morocco
7 7
AD02W109 P. amandus
AD00P389 P. myrrha
AD00P081 N. diana
77
100
4 9
CAD
0.008
!
!
19!
KS05I874 Lysandra coridon gennargenti
KS05I875 Lysandra coridon gennargenti Sardinia
RV07C272 Lysandra coridon asturiensis Spain
RV07F312 Lysandra hispana hispana Spain
KS05I821 Lysandra nufrellensis Corsica
JR04G493 Lysandra coridon asturiensis Spain
RV06A183 Lysandra coridon Andorra
MAT99Q932 Lysandra coridon narbonensis France
RV03H454 Lysandra coridon cataluniae Spain
2 3
RE04C165 Lysandra coridon insulana UK
MAT99T993 Lysandra hispana hispana Spain
MAT99Q959 Lysandra caelestissima Spain
MB05G416 Lysandra coridon apennina Italy
2 1
KS05I822 Lysandra nufrellensis Corsica
RE07G279 Lysandra coridon France
RV07E302 Lysandra coridon Romania
MAT99Q966 Lysandra caelestissima Spain
VL03F932 Lysandra corydonius corydonius Azerbaijan
AD00P435 Lysandra corydonius caucasica Armenia
5 2
VL05N131 Lysandra corydonius corydonius Iran
SH02H010 Lysandra melamarina Russia
SH02H020 Lysandra arzanovi Russia
VL01L120 Lysandra corydonius caucasica Turkey
SH02H007 Lysandra melamarina Russia
RV03H582 Lysandra albicans albicans Spain
3 6
RV04G399 Lysandra bellargus Turkey
AD00P192 Lysandra coridon borussia Russia
5 3
MAT99Q882 Lysandra bellargus Spain
JC96Q001 Lysandra bellargus Germany
VL02X510 Lysandra bellargus Iran
NK02A027 Lysandra punctifera
NK02A026 Lysandra punctifera Morocco
4 0
3 1
VL03H615 Lysandra sheikh Russia
VL03F998 Lysandra sheikh Russia
5 9
RV02N590 Lysandra hispana semperi Spain
SI03K025 Lysandra philippi Greece
AD00P045 Lysandra coridon Russia
RV07F139 Lysandra syriaca burak Turkey
RV04G136 Lysandra ossmar ankara Turkey
RV04G356 Lysandra ossmar ossmar Turkey
3 5
RV07F170 Lysandra ossmar ossmar Turkey
5 7
VD02T008 Lysandra coridon coridon Romania
SI03K037 Lysandra philippi Greece
JXC02G002 Lysandra coridon graeca Greece
5 1
100
100AD00P081 N. diana
AD02W109 P. amandus
56
61
63
68
69
ITS2
0.008
!
!
20!
MB05G416 Lysandra coridon apennina Italy
SH02H007 Lysandra melamarina Russia
SH02H010 Lysandra melamarina Russia
VL03F932 Lysandra corydonius corydonius Azerbaijan
VL03F998 Lysandra sheikh Russia
AD00P435 Lysandra corydonius caucasica Armenia
VL03H615 Lysandra sheikh Russia
VL05N131 Lysandra corydonius corydonius Iran
VL01L120 Lysandra corydonius caucasica Turkey
RV03H454 Lysandra coridon cataluniae Spain
SH02H020 Lysandra arzanovi Russia
SH02H019 Lysandra arzanovi Russia
MAT99Q959 Lysandra caelestissima Spain
MAT99Q966 Lysandra caelestissima Spain
6 3
MAT99T993 Lysandra hispana hispana Spain
2 0
KS05I821 Lysandra nufrellensis Corsica
KS05I822 Lysandra nufrellensis Corsica
8 1
MAT99Q932 Lysandra coridon narbonensis France
6 6
RE04C165 Lysandra coridon insulana UK
AD00P192 Lysandra coridon borussia Russia
SI03K037 Lysandra philippi Greece
2 1
JXC02G002 Lysandra coridon graeca Greece
3 7
4 3
RV03H582 Lysandra albicans albicans Spain
RV07C272 Lysandra coridon asturiensis Spain
1 1
KS05I874 Lysandra coridon gennargenti
JR04G493 Lysandra coridon asturiensis Spain
RV07F312 Lysandra hispana hispana Spain
RV02N590 Lysandra hispana semperi Spain
VD02T008 Lysandra coridon coridon Romania
3 3
NK02A027 Lysandra punctifera
NK02A026 Lysandra punctifera Morocco
JC96Q001 Lysandra bellargus Germany
MAT99Q882 Lysandra bellargus Spain
RV04G399 Lysandra bellargus Turkey
AD00P129 Lysandra bellargus Armenia
5 9
60
RV07F139 Lysandra syriaca burak Turkey
33
9
12
Rpl5
0.02
!

File (1)

Content uploaded by Roger Vila
Author content
ResearchGate has not been able to resolve any citations for this publication.
Article
Full-text available
Transcontinental dispersals by organisms usually represent improbable events that constitute a major challenge for biogeographers. By integrating molecular phylogeny, historical biogeography and palaeoecology, we test a bold hypothesis proposed by Vladimir Nabokov regarding the origin of Neotropical Polyommatus blue butterflies, and show that Beringia has served as a biological corridor for the dispersal of these insects from Asia into the New World. We present a novel method to estimate ancestral temperature tolerances using distribution range limits of extant organisms, and find that climatic conditions in Beringia acted as a decisive filter in determining which taxa crossed into the New World during five separate invasions over the past 11 Myr. Our results reveal a marked effect of the Miocene–Pleistocene global cooling, and demonstrate that palaeoclimatic conditions left a strong signal on the ecology of present-day taxa in the New World. The phylogenetic conservatism in thermal tolerances that we have identified may permit the reconstruction of the palaeoecology of ancestral organisms, especially mobile taxa that can easily escape from hostile environments rather than adapt to them.
Article
Full-text available
Polyommatus coridon (Poda, 1761) is represented by endemic subspecies on the Mediterranean islands of Corsica (nufrellensis Schurian, 1977) and Sardinia (gennargenti Leigheb, 1987). The latter taxon is considered a separate species by some authors, but evidence for reproductive isolation is lacking. In order to check for isolating mechanisms we carried out hybridisation experiments. Source material for these experiments were ♀♀ which had been caught for oviposition in 2007. We achieved synchronous hatching and development of larvae by keeping them under long-day conditions and high temperatures. With the help of the “semi- artificial method” we obtained 6 matings between ♀♀ of P. c. nufrellensis and ♂♂ of P. c. gennargenti, whereas the reciprocal copulation was only achieved once. 4 of the ♀♀ laid 155 eggs altogether, of which 79% proved fertile. Resulting caterpillars were reared under the above-mentioned laboratory conditions using Hippocrepis comosa, and from mid-November, after about 6 weeks, developed into adults of the F1 generation (18 ♂♂, 22 ♀♀, 24 pupae died, 1 adult crippled). Almost all hybrids appear intermediate between the parents. We did not find evidence for reproductive isolation barriers because mortality rates of the hybrid breedings did not differ considerably from pure breedings.
Article
Full-text available
The range of DNA sequences used to study the interrelationships of the major arthropod groups (chelicerates, myriapods, hexapods and crustaceans) is limited. Here we investigate the value of two genes not previously employed in arthropod phylogenetics. Histone H3 data were collected for 31 species and small nuclear ribonucleic acid U2 data for 29 species. The sequences provided a total of 460 sites and 192 parsimony-informative characters. H3 analyses showed substantial codon usage bias, but had a low consistency index (0.26). Consistency indices were higher for the U2 data (0.49), suggesting that the class of snRNAs may provide several phylogenetically useful genes. The present data are not by themselves sufficient to clarify major arthropod group relationships. Partitioned data for H3 and U2 are incongruent according to Incongruence Length Difference tests. Although the most parsimonious trees, based on combined analyses of all taxa, differ substantially from morphology-based trees, anomalous groupings are weakly supported with only one exception. The trees uphold monophyly of Onychophora, Branchiopoda, and Malacostraca (rather than the rival Phyllopoda). Cladistic analyses constraining the monophyly of morphologically defined classes do not significantly distinguish between the main rival hypotheses of major clade relationships. Combined (‘spliced’) analysis of both genes improves topological congruence with morphological groupings relative to that of either partition. Character congruence between H3, U2, and morphology is increased by downweighting (but not excluding) transitions and third codons. Analyses of four-taxon statements using PHYLTEST found significant support for the basal position of the Crustacea among the euarthropods. This support may be due to the similarity of chelicerates, myriapods and hexapods in percentage GC content.
Article
Full-text available
The study of nucleotide sequence variation of the mitochondrial СОI gene has revealed a high genetic homogeneity in taxa examined. The maximum distinction between specimens of different taxa does not exceed 0.8%. At that, these minor variations of nucleotide sequences of cytochrome oxidase subunit I have a distinct stepwise character. Hence, we come to a conclusion that taxa examined are no more than subspecies of Lysandra corydonius: - L. corydonius caucasica (Lederer, 1870). - L. corydinius ciscaucasica (Jachontov, 1914). - L. corydonius melamarina Dantchenko, 2000. - L. corydonius sheikh Dantchenko, 2000. - L. corydonius arzanovi (Stradomsky et Shchurov, 2005). It seems that the peculiarities of morphology, genital structure and biology of these taxa result from particular characteristics of a population habitat.
Article
Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. C SIMON, F FRATI, A BECKENBACH, B CRESPI, H LIU, P
Article
Subspecies lie at the interface between systematics and population genetics, and represent a unit of biological organization in zoology that is widely used in the disciplines of taxonomy and conservation biology. In this review, we explore the utility of subspecies in relation to their application in systematics and biodiversity conservation, and briefly summarize species concepts and criteria for their diagnosis, particularly from an invertebrate perspective. The subspecies concept was originally conceived as a formal means of documenting geographical variation within species based on morphological characters; however, the utility of subspecies is hampered by inconsistencies by which they are defined conceptually, a lack of objective criteria or properties that serve to delimit their boundaries, and their frequent failure to reflect distinct evolutionary units according to population genetic structure. Moreover, the concept has been applied to populations largely comprising different components of genetic diversity reflecting contrasting evolutionary processes. We recommend that, under the general lineage (unified) species concept, the definition of subspecies be restricted to extant animal groups that comprise evolving populations representing partially isolated lineages of a species that are allopatric, phenotypically distinct, and have at least one fixed diagnosable character state, and that these character differences are (or are assumed to be) correlated with evolutionary independence according to population genetic structure. Phenotypic character types include colour pattern, morphology, and behaviour or ecology. Under these criteria, allopatric subspecies are a type of evolutionarily significant unit within species in that they show both neutral divergence through the effects of genetic drift and adaptive divergence under natural selection, and provide an historical context for identifying biodiversity units for conservation. Conservation of the adaptedness and adaptability of gene pools, however, may require additional approaches. Recent studies of Australian butterflies exemplify these points.
Article
The effects of glacial disjunctions on intraspecific differentiations are in the focus of phylogeographical studies. Several studies investigate the consequences of post-glacial expansions from glacial refugia on the composition within major genetic lineages. We analysed the geographical pattern of allozyme variation of twenty loci of Polyommatus coridon (Poda, 1761) (Lepidoptera: Lycaenidae) from thirty-six localities spread throughout large regions of its European range. A total of 1566 individuals were analysed. We obtained a significant genetic differentiation (FST 0.060 ± 0.007). Further analyses showed a division into two major genetic lineages with a mean genetic distance (Nei, 1978) of 0.041 (± 0.010 SD). Applying an AMOVA, more than three quarters of the variance between populations was between these lineages and less than one quarter within these lineages. Both genetic lineages showed a significant decline in the number of alleles from southern to northern populations. Furthermore, we found a contact zone of these two major genetic lineages in eastern Central Europe extending throughout north-eastern Germany, then following the mountain regions along the Czech-German border and passing through the eastern Alps in a north–south direction. We assume that this differentiation evolved during the last ice-age as a result of isolation in the Adriato- and the Ponto-Mediterranean region. The loss of genetic diversity from the south to the north within both lineages reflects the decline of diversity during the post-glacial expansion.
Article
The moth genus Nemoria (Lepidoptera: Geometridae) includes 134 described species whose larvae and adults display a considerable range of phenotypic plasticity in coloration and morphology. We reconstructed the phylogeny of 54 species of Nemoria and seven outgroups using characters from the mitochondrial genes, Cytochrome Oxidase I and II (COI and COII), and the nuclear gene, Elongation Factor-α (EF-1α). Maximum parsimony, maximum likelihood and Bayesian inference were used to infer the phylogeny. The 54 ingroup species represented 13 of the 15 recognized species groups of Nemoria [Ferguson, D.C., 1985. Fasc. 18.1, Geometroidea: Geometridae (in part). In: Dominick, R.B. (Ed.), The Moths of America North of Mexico, Fasc. 18.1. Wedge Entomological Research Foundation, Washington; Pitkin, L.M., 1993. Neotropical emerald moths of the genera Nemoria, Lissochlora and Chavarriella, with particular reference to the species of Costa Rica (Lepidoptera: Geometridae, Geometrinae). Bull. Br. Mus. Nat. Hist. 62, 39–159], and the seven outgroups came from four tribes of Geometrinae. These data support Nemoria as a monophyletic group and largely recover the species groupings proposed in previous taxonomic analyses using morphological characters. Phenotypic plasticity of larvae is not correlated with plasticity of adults among those species of Nemoria where life histories are known, and appears to be evolutionarily labile for both life history stages: Species exhibiting larval phenotypic plasticity, such as N. arizonaria and N. outina, are placed in several distinct clades, suggesting that this trait has evolved multiple times, and species displaying adult phenotypic plasticity are likewise distributed throughout the phylogeny. A comparative analysis of the biogeographic history of Nemoria supports a South American origin for the genus with multiple introductions into North America, and an application of published substitution rates to the phylogram provides an age estimate of 7.5 million years.
Article
The genus Heliconius has been revised more than a dozen times, yet relationships among many of its species groups remain obscure. A reliable phylogenetic hypothesis is desirable, because the genus has been a model system for studies of tropical community ecology, mimicry, and ecological genetics for the last 3 decades. A new cladogram for 35 species of Heliconius and the related genera Eueides, Laparus, and Neruda is presented, based on mitochondrial sequences spanning part of the COI gene and the COII gene. The data support most traditionally recognized species groups and also the monophyly of the above four genera with respect to other heliconiine outgroups. However, Heliconius is paraphyletic with respect to the other three genera. These data will allow a reinvestigation of problematical morphological, behavioral, and cytological traits in the group.