ArticlePDF Available

Selective Androgen Receptor Modulator, YK11, Regulates Myogenic Differentiation of C2C12 Myoblasts by Follistatin Expression

Authors:

Abstract and Figures

The myogenic differentiation of C2C12 myoblast cells is induced by the novel androgen receptor (AR) partial agonist, (17α,20E)-17,20-[(1-methoxyethylidene)bis-(oxy)]-3-oxo-19-norpregna-4,20-diene-21-carboxylic acid methyl ester (YK11), as well as by dihydrotestosterone (DHT). YK11 is a selective androgen receptor modulator (SARM), which activates AR without the N/C interaction. In this study, we further investigated the mechanism by which YK11 induces myogenic differentiation of C2C12 cells. The induction of key myogenic regulatory factors (MRFs), such as myogenic differentiation factor (MyoD), myogenic factor 5 (Myf5) and myogenin, was more significant in the presence of YK11 than in the presence of DHT. YK11 treatment of C2C12 cells, but not DHT, induced the expression of follistatin (Fst), and the YK11-mediated myogenic differentiation was reversed by anti-Fst antibody. These results suggest that the induction of Fst is important for the anabolic effect of YK11.
Content may be subject to copyright.
1460 Vol. 36, No. 9Biol. Pharm. Bull. 36(9) 1460–1465 (2013)
© 2013 The Pharmaceutical Society of Japan
Regular Article
Selective Androgen Receptor Modulator, YK11, Regulates Myogenic
Differentiation of C2C12 Myoblasts by Follistatin Expression
Yuichiro Kanno,* Rumi Ota, Kousuke Someya, Taichi Kusakabe, Keisuke Kato, and
Yosh io I nouye
Faculty of Pharmaceutical Sciences, Toho University; 2–2–1 Miyama, Funabashi, Chiba 2748510, Japan.
Received March 20, 2013; accepted June 19, 2013
The myogenic differentiation of C2C12 myoblast cells is induced by the novel androgen receptor (AR)
partial agonist, (17α,20E)-17,20-[(1-methoxyethylidene)bis-(oxy)]-3-oxo-19-norpregna-4,20-diene-21-carbox-
ylic acid methyl ester (YK11), as well as by dihydrotestosterone (DHT). YK11 is a selective androgen re-
ceptor modulator (SARM), which activates AR without the N/C interaction. In this study, we further in-
vestigated the mechanism by which YK11 induces myogenic differentiation of C2C12 cells. The induction
of key myogenic regulatory factors (MRFs), such as myogenic differentiation factor (MyoD), myogenic factor
5 (Myf5) and myogenin, was more significant in the presence of YK11 than in the presence of DHT. YK11
treatment of C2C12 cells, but not DHT, induced the expression of follistatin (Fst), and the YK11-mediated
myogenic differentiation was reversed by anti-Fst antibody. These results suggest that the induction of Fst is
important for the anabolic effect of YK11.
Key words androgen receptor; selective androgen receptor modulator; C2C12 cell; follistatin
Androgens such as testosterone and 5-α-dihydrotestosterone
(DHT) act as agonists of androgen receptor (AR), which is a
member of the nuclear receptor (NR) superfamily of ligand-
dependent transactivation factors. Because androgens show
anabolic effects on skeletal muscles, androgen declining with
age contributes to age-related bone and muscle loss and in-
crease in fat mass.
1–3)
Thus, the androgen anabolic effect is
attractive for the maintenance of health. However, besides
anabolic effects, various biological effects, such as develop-
ment of male reproductive tissues, sexual development and
spermatogenesis (androgenic effects), are mediated by AR.
4–7)
Separation of anabolic effects from androgenic effects is criti-
cal for clinical usage of selective androgen receptor modula-
tors (SARMs) in diseases such as sarcopenia, cancer cachexia
and osteoporosis.
8,9)
However, the detailed mechanism of
selective anabolic action by SARMs in skeletal muscle still
remains unclear.
Structurally characterized by an amino-terminal transac-
tivation domain [NTD/activation function 1 (AF1)], a DNA
binding domain (DBD), and a ligand binding domain (LBD)
including a carboxy-terminal transactivation domain [activa-
tion function 2 (AF2)],
10,11)
AR mediates the expression of
androgen-regulated genes, such as prostate specific antigen
(PSA)
1214)
and FK506-binding protein 51 (FKBP51).
15 17)
AR is localized in the cytoplasm, where it forms a complex
with chaperones. Upon ligand binding, AR translocates into
the nucleus. Following nuclear translocation, AR binds as a
homodimer to androgen responsive elements (ARE) in the
promoter regions of its target genes. Full activation of AR
requires physical interaction between the NTD/AF1 and LBD/
AF2 (known as the N/C interaction).
1821)
Follistatin (Fst) is essential for muscle fiber formation and
growth. It is an extracellular protein that acts as an inhibitory
binding partner of activins and selected transforming growth
factor β (TGF-β) family members. As the TGF-β signaling
cascade inhibits myogenic differentiation, inhibition of TGF-β
signaling accelerates myogenic differentiation.
Previously, we have reported the AR partial agonistic
nature of the novel steroidal compound, (17α,20E)-17,20-
[(1-methoxyethylidene) bis-(oxy)]-3-oxo-19-norpregna-4,20-
diene-21-carboxylic acid methyl ester (YK11), using the
ARE-luciferase assay.
22)
YK11 did not induce the N/C interac-
tion required for the AR full agonist function and was gene-
selective in MDA-MB 453 cells. In the present study, we show
the induction of myogenic differentiation of myoblast C2C12
cells by YK11 in comparison with DHT.
MATERIALS AND METHODS
Chemicals YK11 was prepared as previously reported.
22)
DHT and hydroxyutamide (FLU) were obtained from Wako
Pure Chemical Industries, Ltd. (Osaka, Japan) and Toronto
Research Chemicals (Toronto, Canada), respectively. Anti-
follistatin (Fst) antibody was purchased from GeneTex (San
Antonio, TX, U.S.A.).
Cell Culture Mouse myoblast C2C12 cells were cul-
tured in Dulbecco’s modified Eagle’s medium (DMEM)
supplemented with 10% fetal bovine serum (FBS) at 37°C
in a humidified atmosphere with 5% CO
2
. C2C12 cells were
* To whom correspondence should be addressed. e-mail: ykanno@phar.toho-u.ac.jp
The authors declare no conict of interest.
Table 1. Primers for the Target Genes (53)
Myogenin FW AGCTGTATGAGACATCCCCC
Rev TTCTTGAGCCTGCGCTTCTC
MyoD FW ACTACAGCGGCGACTCCGACGCGTCCAG
Rev GGTGGAGATGCGCTCCACGATGCTGGACAG
Myf5 FW AGCATTGTGGATCGGATCACGTCT
Rev CTGGAGGGTCCCGGGGTAGC
Follistatin FW AGAGGAAATGTCTGCTTCCG
Rev CACCTCTCTTCAGTCTCCTG
AR FW TACCAGCTCACCAAGCTCCT
Rev GATGGGCTTGACTTTCCCAG
β-Actin FW TCCTCCTGAGCGCAAGTACTC
Rev CTGCTTGCTGATCCACATCTG
Highlighted Paper selected by Editor-in-Chief
September 2013 1461
seeded on plates and maintained in culture medium for 24 h.
To induce myogenic differentiation, YK11 or DHT in DMEM
supplemented with 2% horse serum (differentiation medium)
was added to the cells on day 0. For the neutralization assay
of Fst (also known as activin-binding protein), C2C12 cells
were maintained in differentiation medium in the presence of
anti-Fst antibody.
Immunoblotting Cells were harvested and lysed in
sodium dodecyl sulfate (SDS) sample buffer containing
125 m
M TrisHCI, pH 6.8, 4% SDS, 10% sucrose, 10 mM di-
thiothreitol and 0.01% bromophenol blue. Whole-cell lysates
were resolved by SDS-polyachylamide gel electrophoresis
(PAGE) and immunoblotting was performed using anti-myosin
heavy chain (MyHC, eBioscience, San Diego, CA, U.S.A.),
anti-androgen receptor (Epitomics, Burlingame, CA, U.S.A.)
and anti-tubulin antibodies (MBL, Nagoya, Japan) as primary
Fig. 1. Induction of Myogenic Differentiation by YK11 and DHT
(A) C2C12 cells were treated with YK11 (500 nM), DHT (500 nM) or solvent control (EtOH) in differentiation medium for 2 d. Whole-cell lysates were resolved by SDS-
PAGE, and proteins were detected by immunoblotting using antibodies against androgen receptor and tubulin as a loading control. (B) C2C12 cells were treated with
YK11 (500 n
M), DHT (500 nM) or solvent control (EtOH) in differentiation medium for 7 d. Whole-cell lysates were resolved by SDS-PAGE, and proteins were detected by
immunoblotting using antibodies against myosin heavy chain (MyHC) and tubulin as a loading control. (C–H) C2C12 cells were treated with YK11 (C–E: 500 n
M, F–H:
1–500 n
M), DHT (C–E: 500 nM, F–H: 1–500 nM) or solvent control (EtOH) in differentiation medium for 2 or 4 d. The mRNA expression of Myf5 (C, F), MyoD (D, G) and
myogenin (E, H) was measured by qRT-PCR. The results were normalized against β-actin and are expressed as mean±S.D. (#, p<0.05 compared with DHT-treated cells;
*, p<0.05 and **, p<0.01 compared with the solvent control; n=3).
1462 Vol. 36, No. 9
antibodies. Horseradish peroxidase-conjugated anti-mouse
or rabbit immunoglobulin G (IgG) antibody (Cell Signaling
Technology, Danvers, MA, U.S.A.) was used as secondary
antibody.
Knockdown Experiments Cells were transfected with
AR small interfering RNA (SASI_Mm01_00027673; Sigma-
Aldrich, St. Louis, MO, U.S.A.) or control siRNA using Li-
pofectamine RNAiMAX reagent (Invitrogen, Carlsbad, CA,
U.S.A.) according to the manufacturer’s instructions.
Real-Time Quantitative Reverse Transcription-Poly-
merase Chain Rection (qRT-PCR) Total RNA was isolated
using ISOGEN II (Nippon Gene Co., Ltd., Toyama, Japan).
cDNA was synthesized using the ReverTra Ace
®
qPCR RT
Kit (TOYOBO, Osaka, Japan). qRT-PCR was conducted using
THUNDERBIRD SYBR qPCR Mix (TOYOBO) in a nal
volume of 25 µL according to the manufacturer’s protocol, and
analyzed with the Applied Biosystems 7500 Fast System SDS
software. The primer pairs used are described in Table 1.
Statistical Analysis Statistically significant differences
were determined using the Student’s t-test, and differences
were considered statistically significant at p<0.05.
RESULTS
YK11 and DHT Induce Myogenic Differentiation of
C2C12 Cells Firstly, we examined whether AR is expressed
in C2C12 myoblast cells. AR expression was detected in
C2C12 cells during cell differentiation by immunoblot assay
(Fig. 1A). To investigate the effect of YK11 on C2C12 cells,
the expression of the differentiation marker, myosin heavy
chain (MyHC), was examined. C2C12 cells were cultured with
YK11, DHT or solvent in differentiation medium. The MyHC
protein level on Day 7 was enhanced by both YK11 and DHT
treatments (Fig. 1B), suggesting that like DHT, YK11 can in-
duce myogenic differentiation of C2C12 cells.
YK11 and DHT Upregulate the mRNA Expression of
MRFs Next, we analyzed the mRNA expression of the
MRFs, Myf5, MyoD and myogenin. Cells were treated with
YK11, DHT or solvent, and the expression of Myf5, MyoD
and myogenin was analyzed by qRT-PCR on Day 2 and 4.
Myf5 and myogenin mRNA expression on Day 4 was more
significantly enhanced by YK11 treatment than by DHT treat-
ment (Figs. 1C, E). Interestingly, upregulation of Myf5 and
myogenin mRNA on Day 4 by YK11 treatment required high
YK11 concentrations (100 n
M or 500 nM; Figs. 1F–H), whereas
DHT increased the expression of these genes at lower concen-
trations.
Co-treatment with the AR antagonist, FLU, suppressed this
upregulation, suggesting that YK11-induced MRFs expression
may be mediated by AR (Figs. 2A–C).
YK11 Induces Myf5 mRNA Expression via Fst mRNA
Upregulation by AR It has been reported that androgen-
induced myogenic differentiation is regulated by Fst, which
stimulates Myf5 expression.
23,24)
Fst modulates the function of
a number of TGF-β family members, such as myostatin, which
is a negative regulator of myogenic differentiation, by directly
binding to them. We speculated that the AR-dependent Fst
induction may be responsible for the functional difference
between YK11 and DHT. To verify this hypothesis, Fst ex-
pression was measured on Day 2 and Day 4 after the addition
of YK11 or DHT. Fst mRNA expression was significantly
induced by YK11 treatment, whereas it was not affected by
DHT treatment (Fig. 3A). The YK11-induced upregulation of
Fst mRNA was significantly reduced by co-treatment with
FLU, supporting the AR-dependence of the YK11-mediated
upregulation of Fst expression (Fig. 3B). Furthermore, we car-
ried out an AR knockdown experiment. Similarly to the FLU
treatment, the YK11-induced upregulation of Fst mRNA was
significantly reduced by knockdown of AR (Fig. 3C).
To see whether the YK11-induced Fst upregulation is re-
sponsible for the induction of Myf5 mRNA expression, C2C12
cells were treated with YK11 in the presence of neutralizing
anti-Fst antibody for 2 d in differentiation medium. The in-
crease in Myf5 mRNA level induced by YK11 treatment was
abolished when cells were treated with the antibody against
Fst (Fig. 4).
DISCUSSION
In this study, we showed that the AR partial agonist, YK11,
Fig. 2. Effect of the AR Antagonist, FLU, on the YK11-Induced Upregulation of MRFs (A–C)
C2C12 cells were treated with YK11 (500 nM) or solvent control (EtOH) in the presence or absence of FLU (10 µM) in differentiation medium for 4 d. The mRNA ex-
pression of Myf5 (A), MyoD (B) and myogenin (C) was measured by qRT-PCR. The results were normalized against β-actin and are expressed as mean±S.D. (*, p<0.05
compared with solvent control or FLU alone; n=3).
September 2013 1463
induced myogenic differentiation of C2C12 myoblast cells.
Key MRFs such as MyoD, Myf5 and myogenin are known
to be required for myogenic differentiation. MyoD and Myf5
are important for myogenic determination, whereas myogenin
is important for terminal differentiation and lineage mainte-
nance.
25)
Here, we demonstrated that YK11 signicantly in-
creased the mRNA levels of these MRFs compared with DHT,
an AR full agonist. Based on these ndings, YK11 may be
more potent in inducing myogenic differentiation than DHT.
Recent reports have shown that testosterone treatment up-
regulates Fst expression and promotes myogenic differentia-
tion in mesenchymal multipotent C3H 10T1/2 cells
24)
and in
isolated satellite cells.
26)
We found that the Fst mRNA level
was enhanced by YK11 treatment in C2C12 cells in an AR-
dependent manner, as this effect was significantly reduced by
co-treatment with an AR antagonist. The differentiation state
may be involved in the agonist-specific Fst mRNA regula-
tion, as unlike C3H 10T1/2 and isolated satellite cells, which
are poorly differentiated compared with C2C12 cells, we did
not observe a DHT induction of Fst mRNA in C2C12 cells.
Recent reports have suggested that testosterone induces Fst
expression via the non-canonical Wnt signaling.
24,26)
Testos-
terone promotes nuclear translocation of the AR/β-catenin
complex, which interacts with the Wnt pathway downstream
factor, T-cell factor 4 (TCF-4). The Fst promoter has a TCF
binding site and Fst mRNA is induced by Wnt.
27)
These re-
ports have shown crosstalk between AR and Wnt signaling,
however the molecular mechanism is not clear. In contrast,
the Wnt3a-induced canonical Wnt signal decreases myogenic
differentiation
28)
and promotes osteoblastic differentiation
through upregulation of inhibitor of differentiation-3 (Id3)
in C2C12 cells.
29)
Using various N/C interaction deficient
mutants, it has been shown that the N/C interaction of AR
is important for AR-dependent gene regulation. The N/C in-
teraction contributes to selective gene activation by cofactor
recruitment and chromatin binding.
19,30)
Previously, we have
shown by ARE-luciferase reporter assay that YK11 acts as a
partial AR agonist without inducing N/C interaction, whereas
DHT strongly induced N/C interaction. In fact, a different
regulation of AR target genes has been observed between
YK11 and DHT treatment in MDA-MB453 cells.
22)
Further-
more, mutations of AR, which impair the N/C interaction,
were found in incompletely virilized patients with partial
androgen insensitivity.
31–33)
In Fig. 2, a slight upregulation
of MRFs mRNA was observed by treatment of FLU alone.
Since FLU inhibits N/C interaction of AR, FLU may increase
MRFs expression. A recent report has demonstrated that the
SARM, S-101479, which shows low N/C interaction, induced
recruitment of fewer cofactors than DHT.
34)
This observation
suggests that the difference in Fst mRNA regulation between
YK11 and DHT stems from cofactor recruitment differences.
In conclusion, YK11 induces myogenic differentiation via
AR-dependent induction of Fst expression. Although DHT
did not increase Fst mRNA, both YK11 and DHT elevated
the expression of MyHC protein and MRFs’ mRNA, imply-
ing that DHT enhances myogenic differentiation through an
Fig. 3. YK11-Induced Myogenic Differentiation Is Mediated by Induction of Fst Expression via AR in C2C12 Cells
(A) C2C12 cells were cultured with YK11, DHT (500 nM each) or solvent control (EtOH) in differentiation medium for 2 or 4 d. (**, p<0.01 compared with each solvent
control on Day 2. (B) C2C12 cells were cultured in differentiation medium for 24 h. After 30 min of pretreatment with FLU (10 µ
M), cells were treated with YK11, DHT
(500 n
M each) or solvent control (EtOH) for 6 h. (*, p<0.05). (C) C2C12 cells were treated with siRNA against AR or negative control siRNA. After 24 h the medium was
changed to differentiation medium. After another 24 h, cells were treated with YK11 or solvent for an additional 6 h. (**, p<0.01). The mRNA expression of Fst was mea-
sured by qRT-PCR. The results were normalized against β-actin and are expressed as mean±S.D. (n=3).
Fig. 4. Neutralization of Fst Inhibits YK11-Induced Myogenic Differen-
tiation of C2C12 Cells
C2C12 cells were treated with YK11 (500 nM) or solvent control (EtOH) in dif-
ferentiation medium for 4 d in the presence or absence of anti-Fst antibody. The
mRNA expression of Myf5 was measured by qRT-PCR. The results were normal-
ized against β-actin and are expressed as mean±S.D. (*, p<0.05; n=3).
1464 Vol. 36, No. 9
Fst-independent pathway. In addition to the Fst pathway, YK11
may share this Fst-independent pathway with DHT.
In this report, YK11 was shown to be an appropriate
anabolic SARM. However, further investigation is required to
elucidate the mechanisms of the differential activation of the
Fst pathway by YK11 and DHT.
Acknowledgments This study was partially supported by
the Ministry of Education, Culture, Sports, Science and Tech-
nology of Japan, a Grant-in-Aid for Young Scientists (B), and
the “Open Research Center” Project.
REFERENCES
1) Bhasin S, Tenover JS. Age-associated sarcopenia—issues in the use
of testosterone as an anabolic agent in older men. J. Clin. Endocri-
nol. Metab., 82, 16591660 (1997).
2) Bhasin S, Storer TW, Berman N, Yarasheski KE, Clevenger B, Phil-
lips J, Lee WP, Bunnell TJ, Casaburi R. Testosterone replacement
increases fat-free mass and muscle size in hypogonadal men. J.
Clin. Endocrinol. Metab., 82, 407–413 (1997).
3) Sattler FR, Castaneda-Sceppa C, Binder EF, Schroeder ET, Wang Y,
Bhasin S, Kawakubo M, Stewart Y, Yarasheski KE, Ulloor J, Col-
letti P, Roubenoff R, Azen SP. Testosterone and growth hormone
improve body composition and muscle performance in older men. J.
Clin. Endocrinol. Metab., 94, 1991–2001 (2009).
4) Matsumoto T, Takeyama K, Sato T, Kato S. Study of androgen
receptor functions by genetic models. J. Biochem., 138, 105110
(2005).
5) Matsumoto T, Shiina H, Kawano H, Sato T, Kato S. Androgen re-
ceptor functions in male and female physiology. J. Steroid Biochem.
Mol. Biol., 109, 236–241 (2008).
6) Matsumoto T, Takeyama K, Sato T, Kato S. Androgen receptor
functions from reverse genetic models. J. Steroid Biochem. Mol.
Biol., 85, 95–99 (2003).
7) Lee DK, Chang C. Endocrine mechanisms of disease: Expression
and degradation of androgen receptor: mechanism and clinical im-
plication. J. Clin. Endocrinol. Metab., 88, 4043–4054 (2003).
8) Narayanan R, Mohler ML, Bohl CE, Miller DD, Dalton JT. Selec-
tive androgen receptor modulators in preclinical and clinical devel-
opment. Nucl. Recept. Signal., 6, e010 (2008).
9) Bhasin S, Jasuja R. Selective androgen receptor modulators as func-
tion promoting therapies. Curr. Opin. Clin. Nutr. Metab. Care, 12,
232–240 (2009).
10) Robinson Rechavi M, Escriva Garcia H, Laudet V. The nuclear re-
ceptor superfamily. J. Cell Sci., 116, 585–586 (2003).
11) Simental JA, Sar M, Lane MV, French FS, Wilson EM. Transcrip-
tional activation and nuclear targeting signals of the human andro-
gen receptor. J. Biol. Chem., 266, 510 518 (1991).
12) Cleutjens KB, van Eekelen CC, van der Korput HA, Brinkmann
AO, Trapman J. Two androgen response regions cooperate in steroid
hormone regulated activity of the prostate-specific antigen pro-
moter. J. Biol. Chem., 271, 63796388 (1996).
13) Henttu P, Liao SS, Vihko P. Androgens up-regulate the human
prostate-specific antigen messenger ribonucleic acid (mRNA), but
down-regulate the prostatic acid phosphatase mRNA in the LNCaP
cell line. Endocrinology, 130, 766–772 (1992).
14) Wolf DA, Schulz P, Fittler F. Transcriptional regulation of prostate
kallikrein-like genes by androgen. Mol. Endocrinol., 6, 753–762
(1992).
15) Magee JA, Chang LW, Stormo GD, Milbrandt J. Direct, androgen
receptor-mediated regulation of the FKBP5 gene via a distal en-
hancer element. Endocrinology, 147, 590–598 (2006).
16) Makkonen H, Kauhanen M, Paakinaho V, Jaaskelainen T, Palvimo
JJ. Long-range activation of FKBP51 transcription by the andro-
gen receptor via distal intronic enhancers. Nucleic Acids Res., 37,
4135 4148 (2009).
17) Febbo PG, Lowenberg M, Thorner AR, Brown M, Loda M, Golub
TR. Androgen mediated regulation and functional implications
of fkbp51 expression in prostate cancer. J. Urol., 173, 1772–1777
(2005).
18) Doesburg P, Kuil CW, Berrevoets CA, Steketee K, Faber PW,
Mulder E, Brinkmann AO, Trapman J. Functional in vivo interac-
tion between the amino-terminal, transactivation domain and the
ligand binding domain of the androgen receptor. Biochemistry, 36,
10521064 (1997).
19) Li J, Fu J, Toumazou C, Yoon HG, Wong J. A role of the amino-
terminal (N) and carboxyl-terminal (C) interaction in binding of
androgen receptor to chromatin. Mol. Endocrinol., 20, 776–785
(2006).
20) Schaufele F, Carbonell X, Guerbadot M, Borngraeber S, Chap-
man MS, Ma AA, Miner JN, Diamond MI. The structural basis
of androgen receptor activation: intramolecular and intermolecular
amino-carboxy interactions. Proc. Natl. Acad. Sci. U.S.A., 102,
98029807 (2005).
21) He B, Lee LW, Minges JT, Wilson EM. Dependence of selective
gene activation on the androgen receptor NH2- and COOH-terminal
interaction. J. Biol. Chem., 277, 25631–25639 (2002).
22) Kanno Y, Hikosaka R, Zhang SY, Inoue Y, Nakahama T, Kato
K, Yamaguchi A, Tominaga N, Kohra S, Arizono K, Inouye Y.
(17alpha,20E)-17,20-[(1-Methoxyethylidene)bis(oxy)]-3-oxo-19-nor-
pregna-4,20-diene-21-carboxylic acid methyl ester (YK11) is a
partial agonist of the androgen receptor. Biol. Pharm. Bull., 34,
318 323 (2011).
23) Zhu J, Li Y, Lu A, Gharaibeh B, Ma J, Kobayashi T, Quintero AJ,
Huard J. Follistatin improves skeletal muscle healing after injury
and disease through an interaction with muscle regeneration, angio-
genesis, and fibrosis. Am. J. Pathol., 179, 915–930 (2011).
24) Singh R, Bhasin S, Braga M, Artaza JN, Pervin S, Taylor WE,
Krishnan V, Sinha SK, Rajavashisth TB, Jasuja R. Regulation of
myogenic differentiation by androgens: cross talk between androgen
receptor/beta-catenin and follistatin/transforming growth factor-
beta signaling pathways. Endocrinology, 150, 1259–1268 (2009).
25) Perry RL, Rudnick MA. Molecular mechanisms regulating myogen-
ic determination and differentiation. Front. Biosci., 5, D750D767
(2000).
26) Braga M, Bhasin S, Jasuja R, Pervin S, Singh R. Testosterone in-
hibits transforming growth factor-beta signaling during myogenic
differentiation and proliferation of mouse satellite cells: potential
role of follistatin in mediating testosterone action. Mol. Cell. Endo-
crinol., 350, 39–52 (2012).
27) Willert J, Epping M, Pollack JR, Brown PO, Nusse R. A transcrip-
tional response to Wnt protein in human embryonic carcinoma cells.
BMC Dev. Biol., 2, 8 (2002).
28) Tanaka S, Terada K, Nohno T. Canonical Wnt signaling is involved
in switching from cell proliferation to myogenic differentiation of
mouse myoblast cells. J. Mol. Signal., 6, 12 (2011).
29) Zhang L, Shi S, Zhang J, Zhou F, ten Dijke P. Wnt/beta-catenin
signaling changes C2C12 myoblast proliferation and differentiation
by inducing Id3 expression. Biochem. Biophys. Res. Commun., 419,
8388 (2012).
30) He B, Minges JT, Lee LW, Wilson EM. The FXXLF motif mediates
androgen receptor-specific interactions with coregulators. J. Biol.
Chem., 277, 10226–10235 (2002).
31) Quigley CA, Tan JA, He B, Zhou ZX, Mebarki F, Morel Y, For-
est MG, Chatelain P, Ritzen EM, French FS, Wilson EM. Partial
androgen insensitivity with phenotypic variation caused by andro-
gen receptor mutations that disrupt activation function 2 and the
NH(2)- and carboxyl-terminal interaction. Mech. Ageing Dev., 125,
683695 (2004).
32) Langley E, Kemppainen JA, Wilson EM. Intermolecular NH2-/
September 2013 1465
carboxyl-terminal interactions in androgen receptor dimerization
revealed by mutations that cause androgen insensitivity. J. Biol.
Chem., 273, 92–101 (1998).
33) Thompson J, Saatcioglu F, Janne OA, Palvimo JJ. Disrupted amino-
and carboxyl-terminal interactions of the androgen receptor are
linked to androgen insensitivity. Mol. Endocrinol., 15, 923935
(2001).
34) Furuya K, Yamamoto N, Ohyabu Y, Morikyu T, Ishige H, Albers
M, Endo Y. Mechanism of the tissue-specific action of the selec-
tive androgen receptor modulator S-101479. Biol. Pharm. Bull., 36,
442–451 (2013).
... additional key anabolic targets of the AR such as MyoG, Mfy5, and MyoD are upregulated with the administration of YK-11 83 . ...
Article
Full-text available
In the clinical setting, anabolic agents serve to ameliorate muscle- and bone-wasting diseases. However, many of these anabolic agents are also used by bodybuilders to surpass natural limits of body composition as performance-enhancing drugs (PEDs). The first generation of PEDs comprises testosterone-derived anabolic-androgenic steroids (AAS) which have demonstrated significant myotropic effects. However, AAS lack optimal tissue-selectively and thus, are prone to numerous adverse health consequences. Hence, a newer generation of PEDs, selective androgen receptor modulators (SARMs), was developed with the goal of achieving superior tissue-selectivity (i.e., exerting anabolic effects only in muscle and bone tissue, while minimally affecting other body systems). In general, AAS and SARMs enhance muscle growth primarily through androgen receptor (AR) agonism in target tissues. Despite multiple attempts, no single AAS nor SARM to date is completely risk free. As such, a significant portion of research efforts has been dedicated to manipulating anabolic pathways beyond the AR. Another class of PEDs, myostatin inhibitors, have shown to cause drastic muscle anabolism across multiple species by inhibiting myostatin, the primary deterrent to continuous muscle growth. The myostatin inhibitor, YK-11, blocks myostatin by upregulating its antagonist, follistatin. This effect appears to be mediated through the AR, suggesting a novel and promising gene-selective approach to engineering AR ligands that isolate benefits from risks. At any rate, the exact mechanisms by which these PEDs function is not well understood. Further pioneering regarding these topics is encouraged as it appears that the innovation of a truly tissue-selective anabolic agent is within reach.
... DHT demonstrated the same effect, but YK11 more effectively induced the key myogenic regulatory factors (myogenic differentiation factor, myogenic factor 5, and myogenin). YK11 also stimulated the expression of follistatin, which plays a major role in the realization of YK11-mediated myogenic differentiation (Kanno et al. 2013). The JNJ28330835 modulator, alternately, reduced by half the loss of lean body mass caused by orchidectomy in rats. ...
Article
Full-text available
The current issue is the third of the eighth volume of the Athens Journal of Sports, published by the Sport, Exercise, & Kinesiology Unit of the ATINER under the aegis of the Panhellenic Association of Sports Economists and Managers (PASEM).
... DHT demonstrated the same effect, but YK11 more effectively induced the key myogenic regulatory factors (myogenic differentiation factor, myogenic factor 5, and myogenin). YK11 also stimulated the expression of follistatin, which plays a major role in the realization of YK11-mediated myogenic differentiation (Kanno et al. 2013). The JNJ28330835 modulator, alternately, reduced by half the loss of lean body mass caused by orchidectomy in rats. ...
Article
Full-text available
Selective androgen receptor modulators (SARMs) are an exciting group of molecules with pronounced anabolic effects and very weak to missing androgenic ones. This is due to the tissue selectivity they possess and is their big advantage over anabolic androgenic steroids (AAS). As a result of this SARMs tend to be a big promise for improving the treatment process in different socially significant diseases such as osteoporosis, muscle wasting, benign prostatic hyperplasia, hypogonadism, sexual dysfunction, neurodegenerative diseases etc. SARMs are included in the prohibited list of World Anti-Doping agency (WADA) as they are a temptation for a lot of athletes regarding the exerted strong anabolic effect. However, as SARMs are freely available on the internet there are some reports for positive doping tests in professional sports connected with them. Still further research is needed to examine all the side effects of SARMs. Some of them may be harmful so both professional and amateur sportsmen, their coaches and doctors should be informed about this interesting topic. Keywords: SARM(s), anabolic effect, sports, doping, side effects
... DHT demonstrates the same effect, but YK11 more effectively induces the key myogenic regulatory factors (myogenic differentiation factor, myogenic factor 5, and myogenin). YK11 also stimulates the expression of Follistatin, which plays a major role in the realization of YK11-mediated myogenic differentiation (42). ...
... (17a,20E)-17,20-[(1-Methoxyethylidene)bis(oxy)]-3-oxo-19norpregna-4,20-diene-21-carboxylic Acid Methyl Ester (YK11), labeled as the most potent myostatin inhibitor on the market [12], was first studied in 2011 by the Japanese researcher Yuihi Kanno. YK11 attaches to the androgen receptor to help inhibit the production of myostatin in the muscle, easing the muscle to create more FST, thus, increasing muscle growth [13]. Notably, YK11 is considered a selective androgen receptor modulator (SARM) because it acts as a partial agonist of the androgen receptor (AR) with gene-selective properties [14]. ...
Article
Full-text available
Muscle wasting caused by catabolic reactions in skeletal muscle is commonly observed in patients with sepsis. Myostatin, a negative regulator of muscle mass, has been reported to be upregulated in diseases associated with muscle atrophy. However, the behavior of myostatin during sepsis is not well understood. Herein, we sought to investigate the expression and regulation of myostatin in skeletal muscle in mice inoculated with gram-negative bacteria. Interestingly, the protein level of myostatin was found to increase in the muscle of septic mice simultaneously with an increase in the levels of follistatin, NF-κΒ, myogenin, MyoD, p- FOXO3a, and p-Smad2. Furthermore, the inhibition of myostatin by YK11 repressed the levels of pro-inflammatory cytokines and organ damage markers in the bloodstream and in the major organs of mice, which originally increased in sepsis; thus, myostatin inhibition by YK11 decreased the mortality rate due to sepsis. The results of this study suggest that YK11 may help revert muscle wasting during sepsis and subdue the inflammatory environment, thereby highlighting its potential as a preventive agent for sepsis-related muscle wasting.
... The expression of neither IGF-1 isoform, however, was significantly impacted by tumor or treatment (Supplemental Figure 5). Myostatin signaling also governs skeletal muscle mass and is another target of androgens as myostatin, its receptor ACVRIIB, and the negative regulator of myostatin, follistatin, have all been shown to be androgen-regulated [35,53,54]. ACVRIIB was induced by the presence of C-26 tumors and was significantly suppressed only by AR-42 treatment, alone or in combination with GTx-024 ( Figure 4D). ...
Preprint
Full-text available
Purpose The common colon-26 mouse (C-26) model of experimental cachexia mimics recent late stage clinical failures of anabolic anti-cachexia therapy, and does not respond to the anabolic selective androgen receptor modulator (SARM) GTx-024. Based on the demonstrated anti-cachectic efficacy of the histone deacetylase inhibitor (HDACi) AR-42 in this model, we hypothesized that combined SARM/AR-42 would provide improved anti-cachectic efficacy. Design In the C-26 model, we determined a reduced efficacious dose of AR-42 which was combined with anabolic SARM therapy and evaluated for anti-cachectic efficacy. The effects of treatment and tumor burden on anabolic and catabolic signaling occurring in skeletal muscle were characterized using muscle performance parameters and RNA-seq. Results Anabolic anti-cachexia therapy with diverse androgens had no impact on cachectic outcomes in the C-26 model. A reduced dose of the HDACi AR-42 alone provided limited anti-cachectic benefits, but when combined with the SARM GTx-024, significantly improved bodyweight (p<0.0001), hind limb muscle mass (p<0.05), and voluntary grip strength (p<0.0001) versus tumor-bearing controls. Reduced-dose AR-42 treatment suppressed the IL-6/GP130/STAT3 signaling axis without significantly impacting circulating cytokine levels. GTx-024-mediated β-catenin target gene regulation was apparent in cachectic mice only when combined with AR-42. Conclusions Cachectic signaling in the C-26 model is comprised of catabolic signaling insensitive to anabolic GTx-024 therapy and a blockade of GTx-024-mediated anabolic signaling. AR-42 treatment mitigates catabolic gene activation and restores anabolic responsiveness to GTx-024. Combining GTx-024, a clinically established anabolic therapy, with a low dose of AR-42, a clinically evaluated HDACi, represents a promising approach to improve anabolic response in cachectic patient populations.
Article
Recently, selective androgen receptor modulators (SARMs), which bind to AR and act in a tissue/effect-specific manner, have been developed, but the selective mechanism is not well understood. In this study, we investigated the selective mechanism using the synthetic steroid YK11, which showed AR-mediated gene-selective transactivation. In the AR-positive human breast cancer MDA-MB-453 cells, different patterns of AR-mediated target gene expression and AR recruitment to their enhancer regions were observed between DHT and YK11. A docking study suggested the helices 11 and 12 was moved by the sterically hindered C17-group of YK11. Furthermore, the mutational studies of AR Gln902 and mammalian two-hybrid assays suggested different cofactor recruitment between DHT and YK11. The results of this study suggest that gene selective regulation by SARMs results from differential DNA-binding and/or cofactor recruitment by ligands. These results provide novel insights into the mechanism of action of SARMs.
Article
The androgen receptor (AR) plays a key role in the maintenance of muscle and bone and the support of male sexual-related functions, as well as in the progression of prostate cancer. Accordingly, AR-targeted therapies have been developed for the treatment of related human diseases and conditions. AR agonists are an important class of drugs in the treatment of bone loss and muscle atrophy. AR antagonists have also been developed for the treatment of prostate cancer, including metastatic castration-resistant prostate cancer (mCRPC). Additionally, selective AR degraders (SARDs) have been reported. More recently, heterobifunctional degrader molecules of AR have been developed, and four such compounds are now in clinical development for the treatment of human prostate cancer. This review attempts to summarize the different types of compounds designed to target AR and the current frontiers of research on this important therapeutic target.
Article
Performance- and image-enhancing drugs (PIEDs) misuse is a significant public health issue. Currently, seizure data, surveys, anti-doping testing, and needle service provider data are used to estimate PIED use in populations. These methods are time consuming, single point-in-time measurements that often consist of small sample sizes and do not truly capture PIED prevalence. Wastewater-based epidemiology (WBE) has been used globally to assess and monitor licit and illicit drug consumption within the general community. This method can objectively cover large populations as well as specific subpopulations (gyms, music festivals, prisons), and has potential as a complementary monitoring method for PIED use. Information obtained through WBE could be used to aid public health authorities in developing targeted prevention and education programmes. Research on PIED analysis in wastewater is limited and presents a significant gap in the literature. The focus is on anabolic steroids, and one steroid alternative currently growing in popularity; selective androgenic receptor modulators. This encompasses medical uses, addiction, prevalence, user typology and associated public health implications. An overview of wastewater-based epidemiology is described including its benefits, limitations and potential as a monitoring method for PIED use. A summary of previous work in this field is presented. Finally, we summarise gaps in the literature, future perspectives and recommendations for monitoring PIEDs in wastewater.
Article
Anabolic androgenic steroids (AAS) are testosterone and testosterone-derivative compounds sporadically employed by athletes and increasingly used recreationally to acquire a competitive edge or improve body composition. Nevertheless, users are subject to undesired side effects majorly associated with tissue-specific androgen receptor (AR) binding-mediated actions. More recently, selective AR modulators (SARMs) have gained popularity towards delivering androgen-associated anabolic actions with hopes of minimal androgenic effects. While several SARMs are in preclinical and clinical phases intended for demographics subject to hypo-gonadism, muscle wasting, and osteoporosis, several athletic organizations and drug testing affiliates have realized the increasingly widespread use of SARMs amongst competitors and have subsequently banned their use. Furthermore, recreational users are haphazardly acquiring these compounds from the internet and consuming doses several times greater than empirically reported. Unfortunately, online sources are rife with potential contamination, despite a prevailing public opinion suggesting SARMs are innocuous AAS alternatives. Considering each agent has a broad range of supporting evidence in both human and non-human models, it is important to comprehensively evaluate the current literature on commercially available SARMs to gain better understanding of their efficacy and if they can truly be considered a safer AAS alternative. Therefore, the purpose of this review is to discuss the current evidence regarding AAS and SARM mechanisms of action, demonstrate the efficacy of several prominent SARMs in a variety of scientific trials, and theorize on the wide-ranging contra-indications and potential deleterious effects, as well as potential future directions regarding acute and chronic SARM use across a broad range of demographics.
Article
Full-text available
Testosterone (T) administration is associated with increased satellite cell number and skeletal muscle hypertrophy, although there is considerable heterogeneity in the response of different skeletal muscle groups to T in vivo. We investigated the effects of T on the growth and differentiation of satellite cells isolated from levator ani (LA) and gastrocnemius (gastroc) muscles. T up regulated follistatin (Fst) expression, but down regulated the mRNA and protein expression of a number of genes in the transforming growth factor-beta (TGF-β)-signaling pathway. Inhibition of Fst expression by small interfering RNA (siRNA) inhibited myogenic differentiation and blocked the pro-myogenic effects of T. Treatment of satellite cells with T or Fst up regulated the expression of Pax7 and PCNA, and increased their proliferation. T and Fst blocked TGF-β induced inhibition of growth and myogenic differentiation and down regulated TGF-β-dependent transcriptome in both LA and gastroc cells. We conclude that T stimulation of satellite cell proliferation and myogenic differentiation are associated with up regulation of Fst and inhibition of TGF-β-signaling.
Article
Full-text available
ABSTRACT: Wnt/β-catenin signaling is involved in various aspects of skeletal muscle development and regeneration. In addition, Wnt3a and β-catenin are required for muscle-specific gene transcription in embryonic carcinoma cells and satellite-cell proliferation during adult skeletal muscle regeneration. Downstream targets of canonical Wnt signaling are cyclin D1 and c-myc. However both target genes are suppressed during differentiation of mouse myoblast cells, C2C12. Underlying molecular mechanisms of β-catenin signaling during myogenic differentiation remain unknown. Using C2C12 cells, we examined intracellular signaling and gene transcription during myoblast proliferation and differentiation. We confirmed that several Wnt signaling components, including Wnt9a, Sfrp2 and porcupine, were consistently upregulated in differentiating C2C12 cells. Troponin T-positive myotubes were decreased by Wnt3a overexpression, but not Wnt4. TOP/FOP reporter assays revealed that co-expression with Wnt4 reduced Wnt3a-induced luciferase activity, suggesting that Wnt4 signaling counteracted Wnt3a signaling in myoblasts. FH535, a small-molecule inhibitor of β-catenin/Tcf complex formation, reduced basal β-catenin in the cytoplasm and decreased myoblast proliferation. K252a, a protein kinase inhibitor, increased both cytosolic and membrane-bound β-catenin and enhanced myoblast fusion. Treatments with K252a or Wnt4 resulted in increased cytoplasmic vesicles containing phosphorylated β-catenin (Tyr654) during myogenic differentiation. These results suggest that various Wnt ligands control subcellular β-catenin localization, which regulate myoblast proliferation and myotube formation. Wnt signaling via β-catenin likely acts as a molecular switch that regulates the transition from cell proliferation to myogenic differentiation.
Article
Despite empiric evidence that androgens promote muscle growth, concerns remain about their safety, particularly their association with prostate hypertrophy, the development of male secondary sex characteristics in women, and their potential to accelerate the development of prostate cancer. These concerns led to the development of selective androgen receptor modulators (SARMs), a class of androgen receptor ligands that bind to androgen receptors in a tissue-selective manner to activate of androgenic signaling. SARMs are used for many indications including osteoporosis, anemia, male contraception, male hypogonadism, and wound healing. SARMs may be either steroidal or non-steroidal.
Article
Transcription of the prostate-specific antigen (PSA) gene is androgen regulated, The PSA promoter contains at position -170 the sequence AGAACAgcaAGTGCT, which is closely related to the ARE (androgen response element) consensus sequence GGTACAnnnTGTTCT. This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells. A 35-base pair segment starting at -400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC (2S), Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR art: involved in dexamethasone regulation of the PSA promoter, Both the AR and glucocorticoid receptor were 20-100 fold more active on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D cells), indicating (prostate) cell specificity.
Article
Selective androgen receptor modulators (SARMs) comprise a new class of molecules that induce anabolic effects with fewer side effects than those of other anabolic agents. We previously reported that the novel SARM S-101479 had a tissue-selective bone anabolic effect with diminished side effects in female animals. However, the mechanism of its tissue selectivity is not well known. In this report, we show that S-101479 increased alkaline phosphatase activity and androgen receptor (AR) transcriptional activity in osteoblastic cell lines in the same manner as the natural androgen ligand dihydrotestosterone (DHT); conversely, stimulation of AR dimerization was very low compared with that of DHT (34.4%). S-101479 increased bone mineral content in ovariectomized rats without promoting endometrial proliferation. Yeast two-hybrid interaction assays revealed that DHT promoted recruitment of numerous cofactors to AR such as TIF2, SRC1, β-catenin, NCoA3, gelsolin and PROX1 in a dose-dependent manner. SARMs induced recruitment of fewer cofactors than DHT; in particular, S-101479 failed to induce recruitment of canonical p160 coactivators such as SRC1, TIF2 and notably NCoA3 but only stimulated binding of AR to gelsolin and PROX1. The results suggest that a full capability of the AR to dimerize and to effectively and unselectively recruit all canonical cofactors is not a prerequisite for transcriptional activity in osteoblastic cells and resulting anabolic effects in bone tissues. Instead, few relevant cofactors might be sufficient to promote AR activity in these tissues.
Article
The androgen receptor (AR) is a ligand-dependent transcription factor involved in the regulation of many different physiological processes. Dysfunction of AR causes diverse clinical conditions, such as testicular feminization mutation (Tfm) syndrome and prostate cancer. However, the molecular basis of the AR in these disorders largely remains unknown, as a result of a lack of genetic models. Using conditional targeting technique with Cre-loxP system, we successfully generated null AR mutant (ARKO) mice. The ARKO males grew healthily, but they showed typical Tfm abnormalities. The ARKO males exhibited late onset of obesity with impaired bone metabolism and sexual behaviors. No overt abnormality was found in female ARKO mice, but a premature ovarian failure-like phenotype was found with impaired folliculogenesis. Thus, andorogen/AR system supports normal reproduction as well as normal female reproduction. (Reprod Med Biol 2007; 6: 11–17)
Article
Canonical Wnt signaling plays important roles in regulating cell proliferation and differentiation. In this study, we report that inhibitor of differentiation (Id)3 is a Wnt-inducible gene in mouse C2C12 myoblasts. Wnt3a induced Id3 expression in a β-catenin-dependent manner. Bone morphogenetic protein (BMP) also potently induced Id3 expression. However, Wnt-induced Id3 expression occurred independent of the BMP/Smad pathway. Functional studies showed that Id3 depletion in C2C12 cells impaired Wnt3a-induced cell proliferation and alkaline phosphatase activity, an early marker of osteoblast cells. Id3 depletion elevated myogenin induction during myogenic differentiation and partially impaired Wnt3a suppressed myogenin expression in C2C12 cells. These results suggest that Id3 is an important Wnt/β-catenin induced gene in myoblast cell fate determination.