Content uploaded by Mohamed Alkafafy
Author content
All content in this area was uploaded by Mohamed Alkafafy
Content may be subject to copyright.
http://www.lifesciencesite.com) 22013;10(Life Science Journal,
Effects of Synthetic Food Color (Carmoisine) on Expression of Some Fuel Metabolism Genes in Liver of Male
Albino Rats
Metwally M. Montaser
1,2
, Mohamed E. Alkafafy
1,3
1
Biotechnology Department, Faculty of Science, Taif University, P.O. Box 888, Taif 21974, KSA.
2
Zoology Department, Faculty of Science, Al-Azhar University, 11884 Nasr City, Cairo, Egypt.
3
Histology Department, Faculty of Veterinary Medicine, University of Sadat City, Egypt.
montaser1968@yahoo.com
Abstract: Food additives were known since the old man from the ancient civilizations to introduce special color or
taste in his food. Nowadays, there are over-use of synthetic chemicals as food additives to preserve foods, to
improve characters and attract consumers especially children. Previous studies had reported many effects of
overdoses from food additives, however, further scientific studies are needed in the molecular levels. The current
work studied the effects of doses equivalent to the acceptable daily intake (ADI), 5 and 10 ADI folds of the synthetic
food color (Carmoisine) on the experimental animals (male albino rats) for different periods. Gene expression of
some fuel metabolism genes e.g. PPAR-alfa, ACo-A and CPT-1 were studied and supported by histological studies
on rat liver. There were down-regulations of the studied genes which may leads to the conclusion that, carmoisine
may decrease the fuel metabolism. The histological studies indicate also that high doses of carmoisine may affect
the liver.
[Metwally M. Montaser
, Mohamed E. Alkafafy. Effects of Synthetic Food Color (Carmoisine) on Expression of
Some Fuel Metabolism Genes in Liver of Male Albino Rats. Life Sci J 2013;10(2):2191-2198] (ISSN:1097-8135).
http://www.lifesciencesite.com. 306
Keywords: Carmoisine, rat liver, Fuel metabolism, PPAR-alfa, ACo-A, CPT-1.
1. Introduction:
The addition of colorants to make food more
attractive is not a recent invention. Extracts from spices
and vegetables were used as early as 1500 BC, in India
and China for coloring skin. Wine was colored as early
as 400 BC, and spices and condiments were being
colored by AD 1400. Colorants derived from naturally
occurring minerals, plants, and animals were prepared
along with the spices that played such a prominent part
in the development of early civilizations Tannahill,
1973)
The advent of the use of food colorants in the late
1800S and early 1900S was unfortunately accompanied
by their misuse in food adulteration. Before the
development of synthetic colorants, dangerous mineral
extracts were often used to color foods, frequently to
disguise food of poor quality. Some of these deceptive
practices included coloring of pickles with copper
sulfate, cheese with vermilion and red lead, tea with
copper arsenate, lead chromate, and Indigo, and Candy
with lead chromate, red and white lead, and vermilion
(NAS/NRC 1971.
In 1956, the discovery of the first synthetic dye,
mauve, by Sir William Henry Perkins prompted a
search for other dyes. Further development of synthetic
colorants then became attractive to the food industry
because these colorants were superior to natural
extracts in tinctorial strength, hue, and stability and was
readily available in many hues. The addition of
synthetic colorants to food in the United States was
first legalized for butter in 1885, followed by the
authorization to add colorants to cheese in 1896
(Newsome, 1986 .
Historically, synthetic colorants, also known as
aniline dyes, were manufactured from coal tar
derivatives. Although the colorants were highly
purified before they were added to foods, the negative
connotation of their association with coal tar resulted in
much unfavorable publicity. As a result, synthetic
colorants are no longer manufactured from coal tar
derivatives but instead are developed form highly
purified petrochemicals. The U.S. Department of
Agriculture began to investigate the use of colorants in
foods to establish principles for their regulation in the
early 1900s. The first comprehensive regulation
regarding food colorants was the Federal Food and
Drug Act of 1906. Previously, 80 different colorants
had been used in foods. Following establishment of the
Federal food and Drugs Acts, the U.S. Department of
agriculture eliminated all but seven of these colorants,
on the basis of known composition and purity. This act
and a series of food inspection decisions lead to
establish of a voluntary certification program for food
colorants with the food inspection decision of 1907.
Subsequently, seven more colorants were added to the
approved list. In 1938, The Federal Food, Drug, and
Cosmetic Act established mandatory certification (21
CFR parts 73-74, 81-820) requiring submission of
samples from each batch of colorant for evaluation of
purity. Synthetic colorants that had previously been
http://www.lifesciencesite.com) 22013;10(Life Science Journal,
known by common names were there given specific
names to ensure distinction of those for use in foods
from those for use in drugs or cosmetics. Three
categories for designating colorant names. FD & C
(Suitable for use in foods, drugs and cosmetics), D & C
(suitable for use in drugs and cosmetics), and external
D & C (Suitable for use in externally applied drugs and
cosmetics) were defined (Branen et al., 1990).
In 1960, the color additive amendments to the FD
& C act were established, defining the term “color
additive” as any dye, pigment or other substances made
or obtained form a vegetable, animal or mineral or
other source capable of coloring a food, drug or
cosmetic or any part of the human body. Included in
the two part amendments was a Delaney-type clause.
Part (1) of the clause prohibited addition to food of any
colorant found to induce cancer in human or animals.
Part (2) of the clause permitted the use of current color
additives under a provisional list in pending the
completion of scientific investigations needed to
determine their safety for permanence listing.
Synthetic colorants were thus required to undergo
premarketing safety clearance, and previously
authorized colorants were reevaluated (Newsome,
1986.
The development and use of food colors in
countries other than United States has been extremely
varied. Havel and Smith (1980) reviewed development
of regulations for use of food colorants in other
countries. Legalization for food colorants in the United
Kingdom was not established until the mid-1950s.
Some countries do not regulate the use of food
colorant, thus permitting the use of any colorants, while
others prohibit the use of all synthetic colorants. The
regulatory status of colorants in use outside as well as
within the U.S. is reported in the International Life
Science Institute Nutrition Foundations Catalog of
Food Colors (ILSI/NF 1981) and updated periodically
as new information becomes available
Specific food products are expected to appear in
certain color shades, and when deviations from these
expectations occur, flavor perception is attended. The
importance of color to the perception of the quality,
odor, flavor, and texture of food is well documented. In
studying how individuals react to sherbets of
mismatched flavor and color, Hall (1958) found that
white sherbets made with one of six test flavors
(Lemon, Lime, Orange, Grape, Pine apple, and
Almond) were confused, and flavor was difficult to
identifyAlso, when the sherbets were deceptively
colored, most individuals mistakenly identified flavors.
Color far outweighs flavor in the impression it makes
on the consumer, even when the flavors are pleasant
and the food is a popular one. It powerfully influences
not only the consumer’s ability to identify the flavor
but also her or his estimation of its strength and quality
The use of food colorants aids in the production of food
of preferred color values and provides significant
functional advantages in a variety of situations
colorants. It corrects for variation and irregularities
resulting from storage, processing packaging, and
distribution, assuming greater uniformity in appearance
and hence acceptability Color also, help preserve the
identity or character by which foods are recognized
(Hall, 1958)
The Certified Color manufacturer’s Association
(CCMA) has petitioned the FDA for approval of
Carmoisine, a colorant similar in shade to FD and C
Red No. 2. Carmoisine is widely used in food in
Central and South America and Europe. However,
colorants considered safe in one country may not be
considered safe in other parts of the world. In the U.S.
the toxicity of a colorant is tested under conditions
similar to those under which it will be used. Therefore,
since it is important that food colors be safe when
ingested, animal feeding studies play a key role in their
evaluation (Marmion, 1984). Present day toxicological
testing, as suggested by the FDA, is listed in the RDA
“Red Book” (FDA, 1982). Scientists in many other
parts of the world, however, place emphasis on the
effects of subcutaneous injection of the colorant.
Because of the different mechanisms involved, the
results of the studies conducted under these different
test conditions vary and have resulted in much
scientific and political debate
Gerd and Lennart (1973) reported that
“recurrences of urticaria could be prevented through
the avoidance of food and drugs containing azo dyes
and preservatives
Feingold (1979) had two case reports illustrate the
therapeutic response of congenital nystagmus to a diet
eliminating synthetic food colors. A brief discussion of
the hyperkinetic syndrome was offered with the
proposal that a variety of neurologic and
neuromuscular disturbances (grand mal, petit mal,
psychomotor seizures, la tourette syndrome, autism,
retardation, the behavioral component of Down’s
syndrome, and oculomotor disturbances) may be
induced by identical chemicals, depending upon the
individual’s genetic profile and the interaction with
other environmental factors. Juhlin (1981) and Twaroj
(1983) reported that artificial food additives
particularly, azo dyes and benzoate preservatives are a
common cause of chronic urticaria and angioedema in
both adult and children. Brozelleca et al. (1989)
reported a reduction in body weight in female rats by
high-dose of (FD and C red No, 40). Hong et al. (1989)
reported that aspirin and food additives are known to
induce bronchoconstriction, angioedema or urticaria in
susceptible patients
Van Bever et al.(1989) reported that children feed
on food colors shown to have an adverse effect on a
http://www.lifesciencesite.com) 22013;10(Life Science Journal,
daily Conner’s rating of behavior. Osman et al. (1995)
reported that synthetic food colorants administration
increased the body weight gain until the fourth month
but after that forth month a decrease in body weight as
observed either in female or male mice, there were also
an increase in organ/body weight. Gaunt et al. (1967)
carried acute toxicity studies in rats and mice and a
short term feeding study in rat. They reported an
elevation in the relative kidney weight at the 1% level
in females. Gaunt et al. (1969) reported that pig is less
sensitive to Carmoisine than rat
Rowe (1988) reported that subjects (children)
were maintained on a diet free from synthetic additives
and were challenged daily for 18 weeks with placebo
(during lead-in and washout periods) or tartrazine or
Carmoisine 50), each for 2 separate weeks. Two
significant reactors were identified whose behavioral
pattern featured extreme irritability, restlessness and
sleep disturbance. One of the reactors did not have
inattention as a feature. The findings raise the issue of
whether the strict criteria for inclusion in studies
concerned with hyperactivity” based on “attention
deficit disorder” may miss children who indicate
behavioral changes associated with ingestion of food
colorings. Moreover, for further studies, the need to
construct a behavioral rating instrument specifically
validated for dye challenge is suggested. Booth
(1993) illustrated the effectiveness of dietary advice in
a young body with chronic idiopathic urticaria. An azo
dye and preservative-free diet was initially advised,
resulting in a total improvement in urticarial symptoms.
Double-blind challenges confirmed the boy was
intolerant to E127 (Erythrosine), E122 (Carmoisine),
E128 (red 2G), and E102 (tartrazine) but not to E211
(sodium benzoate)
Murdoch et al. (1987) reported that ten healthy
adults with a negative history of adverse reactions to
foods and food additives were asked to exclude foods
known to be high in histamine and food containing azo
dyes and other coloring agents. He found that 200 mg
tartrazine caused a significant increase in plasma and
urinary histamine concentrations 30 min to 3 hrs after
ingestion with a mean time of 100 min. Abdel-Rahim
(1988) and Ibrahim et al.[38] reported pronounced
increase in serum and liver transaminases activity of
rats by ingestion of synthetic colorants. The load and
species of food colorants ingested into animals for
assimilation at any time may alter the activity of GOT
and GPT followed by changes of overall protein
metabolism
Abou El-Zahab et al. (1997) found that
administration of the synthetic colorants (Carmoisine,
sunset yellow, indigocarmine, brilliant blue and brown
chocolate HT) after 60 days induced damage to liver
tissue as evidenced by a significant increase in AST,
ALT and ALP in serum of rat groups. But, some
researchers, (Ford et al. 1987 and Brozelleca and
Hallagan 1988a, b) stated that Carmoisine and
tartrazine caused insignificant changes in rat serum
AST, ALT and ALP. Yet these contradictory results
were recorded after long term toxicity studies which
may indicate an adaptation mechanism on part of the
liver. He, also stated that serum total protein exhibited
significant increase in rats fed on colors containing
Carmoisine after 30 and 60 days of diet
supplementation, while albumin revealed significant
increase in rats fed with color B (sunset yellow,
tartrazine, Carmoisine and brilliant blue) after 60 days.
In agreement with these findings, El-Sadany whose rats
ingested the food colors indigocarmine and Carmoisine
as well as Lord who administered tartrazine dye to
the experimental rats. The accumulation of serum
protein can be attributed to the stimulation of protein
biosynthesis to produce the specific enzymes required
for all processes Amin et al. (2010) reported that
Tartrazine and Carmoisine in low and high doses affect
adversely and alter biochemical markers in vital
organs
El-Saadany (1991) pointed out that the ingestion
of synthetic chocolate colorants (indigocarmine and
Carmoisine) specifically increased RNA (not DNA) in
rat liver cell homogenates. In connection with this, it is
noted that their hydrolytic enzymes (DNase) in
cytoplasmic as well as mitochondrial fractions were
also stimulated to provide the necessary enzymatic
machinery to cope with increased flow of
ribnucleotides. Abou El-Zahab et al. (1997) stated that,
the concentrations of ribonucleic acid (RNA) in liver
cell homogenates exhibited a highly significant
increase (P < 0.01) only on rats fed on diet
supplemented with color C (brown chocolate HT and
indigo carmine in addition to small fractions of
Carmoisine, tartrazine, sunset yellow and brilliant blue)
for 60 days, whereas DNA remained unchanged. Ali et
al. (1988) also reported expected mutagenic effects of
high doses from carmoisine and fast green
Gaunt et al. (1988b) reported that the types and
incidence of histological changes were comparable in
control and test groups. A no-effect level of 0.5%
Carmoisine was established in the diet of rats for 90
days, a level equivalent to 250 mg/kg/day. Shaker et al.
(1989) noted an increase in hemoglobin content of rat
administered chocolate brown color (0.1% w/w)
consisting of tartrazine, noval coccine, Carmoisine and
indigocarmine
Abou El-Zahab et al. (1997) stated that, the
marked discrepancies observed between the various
research studies may be attributed to dose variations as
well as the duration of colorant intake, where small
doses for longer periods induced positive stimulatory
effect on erythropoiesis, moderate duration and dose
revealed inhibition and long term high dose
http://www.lifesciencesite.com) 22013;10(Life Science Journal,
administrations produced no alterations. The total
count in his study remained unchanged in all his
experimental groups
Tartrazine and carmoisine are an organic azo dyes
widely used in food products, drugs and cosmetics.
Therefore, Amin and his coworkers (Amin et al., 2010)
evaluated the toxic effect of carmoisine on hepatic
function, lipid profile, blood glucose, body-weight gain
and biomarkers of oxidative stress in tissue. They
administered carmoisine orally in two doses, one low
(8 mg/kg bw) and the other high dose (100 mg/kg bw)
for 30 days and concluded that carmoisine affects
adversely and alter biochemical markers in liver at both
doses.
In the liver, PPARα is a critical transcription
factor for lipid metabolism, because several genes
coding for enzymes involved with oxidation (either in
peroxisomes or mitochondria) contain a functional
peroxisome proliferator–responsive element in their
enhancer regions (e.g., acyl-CoA oxidase, liver fatty
acid–binding protein, cytochrome p 450A, hepatic
lipoprotein lipase, and others) (Schoonjans et al.,
1996).
The current study focus on the action of
carmoisine (synthetic food color) in different doses for
different periods on gene expression of the common
genes controlling for fuel metabolism. It also supports
the molecular studies with histological studies for the
liver.
2. Material and Methods:
Chemicals: carmoisine (C
20
H
12
N
2
O
7
S
2
Na
2
) was
ordered from Lobachemie PVL Ltd company
(Mumbai, India).
Animals: A total of 30 Male Sprague-Dawley rats, 160
+ 10 g body weight (B Wt) were used in this study.
Rats were kept on standard diet (Degrace et al., 2003)
and randomly divided in to 4 groups according to
treatment. Control negative group (G0), group 1(ADI
or acceptable daily intake) was treated with a dose
equivalent to ADI (50mg/kg B Wt), group 2 (5xADI)
was treated with 5 folds of ADI, group 3(10xADI) was
treated with 10 folds of ADI. Three rats were taken
from each group every 15 days for a period of 45 days.
Histological analysis: Animals were sacrificed.
Removed liver slices were fixed in 10%
neutral-buffered formalin and embedded in paraffin.
Five μm thick sections were stained with
hematoxylin-eosin, Alcian blue or Crossmon’s
trichrome stain for histological examination.
Semi-quantitive PCR: Total RNA from about 40mg
liver was extracted using Biozol (Biolabs, USA) . The
final amount of RNA was estimated by determining the
optical density at 260 nm. First strand cDNA synthesis
with total RNA was performed using reverse
transcriptase (Jones et al., 1999). Subsequently,
PCR-amplification was performed using specific
primers and conditions (Table 1) for 30 of 1 min at
94 °C, 1 min at the annealing temperature indicated in
Table 1, and 1 min at 72 °C. The final extension step
was 5 min at 72 °C, PCR products were separated on
1.5% agarose gels visualized under UV light and
analyzed using Alfa Ease FC software.
Statistical analysis: Data were expressed as mean ±
standard deviation. Student’s t-test was used to
compare means. A level of p<0.05 was considered as
statistically significant.
3. Results and Discussion:
Histological effects: In the control group there were
normal hepatocytes with normal un-engorged hepatic
sinusoids or any blood vessels, normal portal tracts
(Figure 4), no alcianophilic hepatocytes (Figure
3A). The ADI treated groups didn't show deleterious
effects especially for short period of treatment.
However, the longer time of treating with ADI (for 30
and 45 days) resulted in swollen hepatocytes with fatty
changes and some with congested hepatic blood
sinusoids (Figure 6C). There were also, ballooned
swollen hepatocytes that stores fat droplets as also
was present mucoid degeneration of the hepatocytes
with alcianophilia (5C).
Increasing the doses of carmoisine more than ADI
(5xADI and 10xADI) for 15 days did not vary (Figure
6C) from those of 60 and 90 days fed of light doses.
There were more degenerative changes of hepatocytes
that revealed hepatic cells mucoid degeneration as
shown in figure 6C.
Gene expression effects:
The levels of PPAR alfa gene expression
fluctuated around that of the control group, because of
the different doses along the various periods of
treatments. After 15 days The expression levels were
elevated more than that of the control group. The ADI
at 15 days elevated the level of PPAR from 0.770
(control) into 0.910, the medium (5xADI) dose resulted
in elevation into 0.913, and the high (10xADI) dose
elevated the level from 0.770 (control) into 0.900.
However, all the increments were non-significant.
At the 30 day group, only the ADI and medium
doses were non-significantly increased from 0.772
(control) into 0.860 and 0.84 respectively. While, the
high dose resulted in significant decrease in the
expression level from 0.770 (control) into 0.670.
At the 45 day group, the ADI dose produced
non-significant increase in level of expression from
0.780 (control) into 0.810. The medium and high doses
resulted in significant decreases from 0.772 (control)
into 0.770 and 0.690 respectively.
http://www.lifesciencesite.com) 22013;10(Life Science Journal,
The expression pattern of ACO-A gene was
similar to that of PPAR- alfa. After 15 days, there were
non-significant increases in expression level due to
treatments with ADI, medium and high doses from
0.630 (control) into 0.645, 0.640 and 0.637
respectively. However, at 30 day group there were
non-significant increases when treated with ADI and
medium from 0.670 (control) into 0.677 and 0.675
respectively. The high dose of carmoisine after 45 days
resulted in significant decrease into 0.660.
Carnetine palmetoyl transferase-1 was expressed
in heterogeneous pattern among the different periods of
treatment. At the 15 day period, there were
non-significant increases due to ADI, medium and high
doses from 0.392 (control) into 0.410, 0.451 and 0.444
respectively. After 30 days, there were non-significant
increases in response to ADI and high doses from
0.395 (control) into 0.511 and 0.472 respectively.
Meanwhile, the increase in CPT-1 gene expression due
to the medium dose at 30 day period was significant
into 0.470.
After 45 days of treatment, CPT-1 gene was
significantly decreased from 0.430 (control) into 0.400,
0.410 and 0.400 due to ADI, medium and high doses
respectively.
The down regulation of PPAR-α due to the high
doses of carmoisine may lead to disturbance of fuel
metabolism, which is manifested by the disturbance in
some fuel metabolism genes e.g. ACo-A oxidase and
CPT-1. The interpretation of our results could be
supported by an explanation according to Videla and
Pettinelli (2012), who summarized the expected
consequences of disturbance in PPAR.
Videla and Pettinelli (2012) stated that, Liver
PPAR-α downregulation and substantial enhancement
in the hepatic sterol regulatory element binding
protein-1c (SREBP-1c)/PPAR-α mRNA content ratio
represent major metabolic disturbances between de
novo lipogenesis and FA oxidation favouring the
former, as a central issue triggering liver steatosis in
obesity-induced oxidative stress and insulin resistance.
The prosteatotic action of PPAR-α downregulation
may be reinforced by PPAR- γ upregulation favouring
hepatic FA uptake, binding, and transport, representing
a complementary lipogenic mechanism to SREBP-1c
induction leading to de novo FA synthesis and TAG
accumulation. In addition, PPAR-α downregulation
may play a significant role in enhancing the DNA
binding capacity of proinflammatory factors NF-κB
and AP- 1 in the liver of obese patients, thus
constituting one of the major mechanisms for the
progression of simple steatosis to steatohepatitis. In the
past, PPARs have been studied as drug targets for the
management of Nonalcoholic fatty liver disease
NAFLD in obesity and the broader metabolic
syndrome (MetS) (George and Liddle 2008).
However, PPAR-α agonists such as fibrates used to
diminish steatosis and inflammatory scores in human
steatohepatitis revealed poor effectiveness,
thiazolidinediones have weight gain limitations,
whereas that of dual PPAR-αγ agonists has safety
concerns. Hepatic lipid metabolism was regulated via
ligands of PPAR-α promoted the expression of genes
encoding for proteins involved in FA oxidation at
mitochondrial, peroxisomal, and microsomal levels, FA
binding in cells, and lipoprotein assembly and transport
and reduction in PPAR-α controlling FA oxidation
(carnetine palmitoyltransferase-1a; CPT-1a), with the
consequent enhancement in the hepatic
SREBP-1c/PPAR-α ratios denoting a prolipogenic
status. This condition may also involve diminution in
TAG export from the liver via very-low density
lipoprotein (VLDL) due to decreased production of
apolipoprotein B-100, which is upregulated by
LCPUFA n-3 and PPAR-α activation (Videla and
Pettinelli 2012).
Table (1): The primer sequences and PCR conditions.
Gene name
5
\
primer
3
\
primer
T
an
°C
Product
size (bp)
PPARα
GGTCCGATTCTTCCACTGC
TCCCCTCCTGCAACTTCTC
62
404
CPT1
GAGACACCAACCCCAACATC
GTCTCTGTCCTCCCTTCTCG
55
295
ACO oxidase
AGCTTCACGCCCTCACTG
ACCACCCACCAACTTCCC
60
245
PPARα (Peroxisome proliferator-activated receptor alfa); CPT1 (carnetine palmetoyl transferase 1); ACo oxidase
(Acyl Co-A oxidase).
http://www.lifesciencesite.com) 22013;10(Life Science Journal,
Figure 1: Histogram showing changes in expression level of mRNA for PPAR-α gene in relation to
GAPDH due to treatment with carmoisine. Relative mRNA levels expressed in relative IDV (integrated
density value) of PPAR-α/ GAPDH as measured by AlfaEaseFC software.
Figure 2: Histogram showing changes in expression level of mRNA for Acyl-COA gene in relation to
GAPDH due to treatment with carmoisine. Relative mRNA levels expressed in relative IDV (integrated
density value) of ACO A/ GAPDH as measured by AlfaEaseFC software.
Figure 3: Histogram showing changes in expression level of mRNA for CPT1 (carnetine palmetoyl
transferase 1) gene in relation to GAPDH due to treatment with carmoisine. Relative mRNA levels expressed
in relative IDV (integrated density value) of CPT1/ GAPDH as measured by AlfaEaseFC software.
http://www.lifesciencesite.com) 22013;10(Life Science Journal,
Figure 4: Liver section stained with routine stain, showing normal histology of liver in the control rat liver. (Hx& E.
st., X 100 ).
A B C
Figure 5: Liver sections stained with Alcian blue stain X 400, showing: A) alcianophilia ; B) mucoid degeneration
of the hepatocytes; C) ballooned swollen hepatocytes that stores fat droplets as also was present mucoid
degeneration of the hepatocytes due to the effect of carmoisine on histology of liver.
A B C
Figure 6: Liver sections stained with Crossmon’ s trichrome stain showing: A) fibrinoid deposition around some
central veins and in the portal areas-X 100 ; B) swollen with fatty changes and some congestion of the hepatic blood
vessels -X 400; C) congested hepatic blood sinusoids-X 400, due to the effect of carmoisine on histology of liver.
4. Conclusion:
From our studies we can conclude that, the
expression levels of fuel metabolism proteins and
enzymes e.g. PPAR-alfa, Acyl Co-A and Carnetine
palmetoyl transferase-1 could be affected by the use of
carmoisine especially the high doses for long time.
The high doses of carmoisine could be harmful to
liver and lowers the expression level of some metabolic
enzymes in it.
References:
1. Abdel-Rahim, G.A. (1988): Effect of some natural and
synthetic food colorants on protein nucleic acids and
nucleases in albino rats organs. Minia J. Agric. Res.
and Dev., 10(4)112-117.
2. Abou El-Zahab, H.S.H.; El-Khyat, Z.A.; Awadallah,
R. and Mahdy, K.A. (1997): Physiological effects of
some synthetic food coloring additives on rats. Boll.
Chim. Farm.,136(10):615-627.
3. Ali, M. O.; Al-Ghor, A.; Sharaf, A. K.; Mekkawy,
H.; Montaser, M. M.(1988) Genotoxic effects of food
color (Carmoisine) on the chromosome of bone marrow
cells of rat. Toxicology Letters, 95(1):44.
4. Amin, K.A.,; Abdel-Hameid, H.; Abd Elsattar, A. H.
(2010):Effect of food azo dyes tartrazine and
carmoisine on biochemical parameters related to renal,
hepatic function and oxidative stress biomarkers in
young male rats. Food and Chemical Toxicology,
48:2994-2999.
5. Beverley, S.M., (2001). Current Protocols in Molecular
Biology 15.5.1-15.5.6, Copyright © 2001 by John
Wiley & Sons, Inc.
6. Booth, J. (1993): Food inolerance in a child with
urticaria. J. Human Nutrition and Dietetics,
6(4):377-380.
http://www.lifesciencesite.com) 22013;10(Life Science Journal,
7. Branen, A.L.;Davidson, P.M. and Salminen,
S.(1990):Food additives ,Marcel,INC.,270 Madison
Avenue, New York 10016, Printed in the USA.
8. Brozelleca, J.F. and Hallagan, J.B. (1988a): A
chronic toxicity/carcinogenicity study of FD & C
yellow No. 5 (tartrazine) in mice. Fd. Chem. Toxic., 26
(3):189-194.
9. Brozelleca, J.F. and Hallagan, J.B. (1988b): Chronic
toxicity/carcinogenicity studies of FD & C yellow No.
5 (tartrazine) in rats. Fd. Chem. Toxic., 26 (3):179-187.
10. Brozelleca, J.F.; Olson, J.W. and Reno, F.E. (1989):
Life time toxicity/carcinogenicity study of FD & C Red
no. 40 (Allura Red) in Sprague-Dawley rats. Fd. Chem.
Toxic., 27 (11): 701-706.
11. Chromoczynski, P. and N. Sacchi, 1987. Single-step
method for RNA isolation by acid guanidium U.S.
thiocyanate-phenol-chloroform extraction. Anal
Biochem., 162: 156-9.
12. El-Saadany, S.S. (1991): Biochemical effect of
chocolate colouring and flavouring like substances on
thyroid function and protein biosynthesis. Die
Nahrung., 35 (4):335-343.
13. FDA (1982): Toxicological principles for safety
assessment of direct food additives used in foods. In :
Red book. Food and Drug Administration, Washington,
D.C.
14. Feingold, B.F. (1979): Dietary management of
nystagmus. J. Neural. Transm., 45 (2):107-115.
15. Ford, G.P.; Stevenson, B.I. and Evans, J.G. (1987):
Long term toxicity study of carmoisine in rats using
animals exposed in utero. Fd. Chem., 25 (12):919-925.
16. Gaunt, I.F.; Carpanini, F.M.B.; Grasso, P.; Kis,
Idas, S. and Gangolli, S.D. (1972): Long term feeding
study on brilliant blak PN in rats. Fd Cosmet. Toxicol.,
10 (1):17-27.
17. Gaunt, I.F.; Grasso, P.; Kiss, Ida, S. and Gangolli,
S.D. (1969): Short-term toxicity study on carmoisine in
the miniature pig. Food Cosmet. Toxicol., 7(1):1-7.
18. Gaunt, I.F.;Madge Farmer;Grasso , P. and
Gangolli, S. D.(1967):Acute (mouse and rat ) and short
term (rat) toxicity studies on Carmoisine.Food Cosmet.
Toxicol.5(2),179-185.
19. George, J. and Liddle, C. (2008) Nonalcoholic fatty
liver disease: pathogenesis and potential for nuclear
receptors as therapeutic targets. Molecular
Pharmaceutics. 5(1) 49–59.
20. Gerd, M. and Lennart. J. (1973): Urticaria induced
by preservatives and dye additives in food and drugs.
Bull. JSME (Jap. Soc. Mech. Engl.), 88 (6):525-532.
21. Hall, R.L. (1958): Flavor study approach at
McCormick and Company, Inc. In : Flavor Research
and Food Acceptance, Reinhold, New York, p. 224.
22. Haveland-Smith, R.B. (1980): An evalauation of the
genetic effects of some food colors using microbial test
systems. Ph. D. Thesis, Council for National Academic
Awards, London.
23. Hong, S.P.; Park, H.S.; Lee, M.K. and Hong, C.S.
(1989): Oral provocation tests with aspiring and food
additives in asthmatic patients. Yonsei Medical J., 30
(4):339-345.
24. ILSI/NF (1981): Catalog of Food Colors. International
Life Sciences Institute/ Nutrition Foundation,
Washington, D.C.
25. Juhlin, L. (1981): Recurrent urticaria : Clinical
investigation of 330 patients. Br. J. Dermatol.,
104:369-381.
26. Kim, J.H.; Hahm, D.H.; Yang, D.C.; Lee, H.J.;
Shim, I. (2005) Effect of crude saponin of Korean
red ginseng on high-fat diet-induced obesity in the rat.
J. Pharmacol. Sci. 97: 124–131.
27. Marmion, D.M. (1984): Handbook of U.S colorants
for foods, drugs and cosmetics. Wiley, New York.
28. Murdoch, R.D.; Pollock, I. and naeem, S. (1987):
Tartrazine induced histamine release in vivo in normal
subjects. J. Royal College Physicans (London),
21(4):257-261.
29. NAS/NRC (1971): Food colors. Nat. Acad. Sci./Nat.
Res. Council. Nat. acad. Press, Washington, D.C.
30. Newsome, R. L.(1986): Food colors. Food
Technol.40(7):49-56
31. Osman, M.A.; Afifi, A.; Hussien, R.M.; Kamilia, B.;
Abdel-Aziz and Salah, S.H. (1995): Long-term
biochemical and genotoxicity studies of four synthetic
food and drug colorants in mice. Bull. Fac. Pharm.
(Cairo Univ.), 33 (1):13-21.
32. Pollock, I. and Warner, J.O. (1990): Effect of
artificial food colors on childhood behaviour.
Archieves of Disease in Childhood, 65(1): 74-77.
33. Rowe, S.K. (1988): Synthetic food colourings and
hyperactivity : a double-blind crossover study. Aust.
Paediat. J., 24 (2):143-147.
34. Sato, H.; Tsai-Morris, C.; Dufau, M. L. (2010)
Relevance of gonadotropin-regulated testicular RNA
helicase (GRTH/DDX25) in the structural integrity of
the chromatoid body during spermatogenesis. Bioch et
Bioph Acta, 1803: 534-543.
35. Shaker, A.M.H.; Ismail, I.A. and Eilnemr, S.E.
(1989): Effect of different food stud colurants added to
case in diet on biological evaluation. Bull. Nutr. Inst.,
Cairo, Egypt, 9 (1):77-86.
36. Tannahill, R. (1973): Food in history. Stein and Day,
New York.
37. Twaroj, F.J. (1983): Urticaria in childhood:
pathogenesis and management. Paediat. Clin. North.
Am., 30:887-898.
38. Van Bever, H..P.; Doxx, M. and Stevens, W.J.
(1989): Food and food additives in severe atopic
dermatitis. Allergy (Copenhagen), 44 (8):588-594.
39. Videla, L.A. and Pettinelli, P. (2012) Misregulation of
PPAR Functioning and Its Pathogenic Consequences
Associated with Nonalcoholic Fatty Liver Disease in
Human Obesity. PPAR Research. Article ID
107434:pp14.
5/15/2013
