Available via license: CC BY-NC 3.0
Content may be subject to copyright.
Cumulative risk on the oxytocin receptor gene (OXTR)
underpins empathic communication difficulties at
the first stages of romantic love
Inna Schneiderman, Yaniv Kanat-Maymon, Richard P. Ebstein, and Ruth Feldman
Empathic communication between couples plays an important role in relationship quality and individual well-being and research has pointed to the role
of oxytocin in providing the neurobiological substrate for pair-bonding and empathy. Here, we examined links between genetic variability on the oxytocin
receptor gene (OXTR) and empathic behaviour at the initiation of romantic love. Allelic variations on five OXTR single nucleotide polymorphisms (SNPs)
previously associated with susceptibility to disorders of social functioning were genotyped in 120 new lovers: OXTRrs13316193, rs2254298, rs1042778,
rs2268494 and rs2268490. Cumulative genetic risk was computed by summing risk alleles on each SNP. Couples were observed in support-giving
interaction and behaviour was coded for empathic communication, including affective congruence, maintaining focus on partner, acknowledging
partner’s distress, reciprocal exchange and non-verbal empathy. Hierarchical linear modelling indicated that individuals with high OXTR risk exhibited
difficulties in empathic communication. OXTR risk predicted empathic difficulties above and beyond the couple level, relationship duration, and anxiety
and depressive symptoms. Findings underscore the involvement of oxytocin in empathic behaviour during the early stages of social affiliation, and
suggest the utility of cumulative risk and plasticity indices on the OXTR as potential biomarkers for research on disorders of social dysfunction and the
neurobiology of empathy.
Keywords: oxytocin; OXTR; empathy; romantic relationships; bonding; genetic risk
INTRODUCTION
Extant evidence suggests that intimate relationships exert both bene-
ficial and harmful effects on the individual’s physical and psychological
health (Cohen and Wills, 1985;Enns et al., 2002;Anderson and
Saunders, 2003). Communication patterns within romantic relation-
ships are central predictors of adults’ well-being and life satisfaction
(Burman and Margolin, 1992;Gottman and Levenson, 1992), and re-
search has demonstrated associations between positive communication
between couples and marital satisfaction. On the other hand, commu-
nication difficulties often precede the onset of marital distress
(Markman, 1981) and serve as better predictors of daily marital dis-
satisfaction as compared to problems in other domains (Jacobson and
Moore, 1981). Observational studies have further confirmed that inter-
action patterns between couples are reliable predictors of change in
marital stability (Gottman and Levenson, 1992). In particular, studies
employing direct observations of dyadic behaviour indicated that em-
pathic communication patterns serve as important building blocks of
the couple’s relationship, whereas empathic difficulties may play a
causal role in relationship decline and the development of psychopath-
ology (Gottman and Levenson, 1992;Lyons-Ruth, 2008). As relational
patterns tend to persist over time and relational difficulties
often escalate into behavioural cycles that may lead to separation or
divorce, assessing the couple’s behaviour at the first months of pair-
bonding and identifying biomarkers that may underpin empathic
communication difficulties during this period is of empirical and clin-
ical relevance.
The major neuroendocrine system mediating bond formation is the
oxytocin (OT) system (Carter, 1998). Research in both human and
non-human mammals has implicated OT, a neuropeptide synthesized
primarily in the paraventricular and supraoptic nuclei of the
hypothalamus, in social cognition, social behaviour and affiliation
(Hollander et al., 2007;Acevedo et al., 2011;Nagasawa et al., 2012).
Furthermore, disruptions to OT are found in disorders involving
severe dysfunction to social communication, including autism, depres-
sion and schizophrenia (Gregory et al., 2009;Souza et al., 2010;Apter-
Levi et al., 2013;Mah et al., 2013). Animal studies indicate that OT
receptor (OXTR) distributions across multiple areas of the brain me-
diate reproductive and sexual behaviour, parental care, social memory
and attachment (Insel and Hulihan, 1995;Champagne et al., 2001;
Burri et al., 2008;Feifel et al., 2012). In addition, OT has shown to
support processes of pair-bonding in humans and mammals (Bales
et al., 2007;Feldman et al., 2012). OT is essential for the formation
and regulation of pair-bonding behaviour in monogamous prairie
voles (Microtus ochrogaster), especially in females (Insel and Hulihan,
1995;Young and Wang, 2004); central OT administration facilitates
partner preference in female prairie voles (Williams et al., 1994); and
an OT antagonist prevents pair-bond formation (Insel and Hulihan,
1995). In humans, plasma OT levels show a substantial increase during
the first year of romantic relationships in both men and women as
compared to romantically unattached individuals (Schneiderman
et al., 2012), and peripheral OT is linked with affiliation, emotional
support and positive communication between couples (Grewen, 2005;
Gonzaga et al., 2006;Holt-Lunstad et al., 2008). Imaging studies of
romantically attached individuals showed neural activations in regions
associated with pair-bonding in monogamous prairie voles (Acevedo
et al., 2011), and intranasal OT administration increased positive com-
munication between couples (Ditzen et al., 2009). Furthermore, intra-
nasal OT administration was found to enhance emotional empathy
and positive communication and to modulate amygdala activity
(Ditzen et al., 2008;Singer et al., 2008;Bartz et al., 2010;Hurlemann
et al., 2010). Finally, Walum et al. (2012) found associations between
allelic variations on the OXTR gene and self-reported bonding
behaviour.
Although social behaviour is a complex multi-dimensional pheno-
type, twin and family studies suggest moderate heritability of social
traits, including empathy, aggression and prosocial behaviour (Ebstein
Received 5 February 2013; Revised 9 August 2013; Accepted 18 August 2013
Advance Access publication 22 August 2013
The study was supported by the German-Israeli Foundation (#1114-101.4/2010) and the Irving B. Harris
Foundation, Israel Center for Excellence (ICORE) to Ruth Feldman.
Correspondence should be addressed to Ruth Feldman, PhD, Department of Psychology and the Gonda Brain
Sciences Center, Bar-Ilan University, Ramat-Gan 52900, Israel. E-mail: feldman@mail.biu.ac.il
doi:10.1093/scan/nst142 SCAN ( 2014) 9, 1524 ^1529
ßThe Aut hor (2013). Publishe d by Oxford University Press. For Permissions, please email: journals.permissions @oup.co m
Downloaded from https://academic.oup.com/scan/article/9/10/1524/1653161 by guest on 21 March 2023
et al., 2010). As OT is highly conserved across mammalian evolution
(Insel and Young, 2000), it is possible that OXTR gene polymorphisms
may underpin individual differences in social behaviour and empathy.
In humans, the OXTR gene is localized as a single copy on chromo-
some 3, contains three introns and four exons (Inoue et al., 1994), and
codes for the OT receptor (OXTR) which belongs to the class I G
protein-coupled receptor family (Gimpl and Fahrenholz, 2001).
Several single nucleotide polymorphisms (SNPs) on the OXTR gene
have been associated with prosocial behaviour and bonding as well as
with greater susceptibility to psychopathology (Lerer et al., 2007;Israel
et al., 2009;Wu et al., 2012;Feldman et al., 2012,2013). In particular,
the SNP rs13316193 C allele has been associated with empathy (Wu
et al., 2012), whereas the T allele has been linked to decreased expres-
sion of OT receptors in the brain, depressive mood and greater risk for
Autism Spectrum Disorder (ASD) (Lerer et al., 2007;Kawamura et al.,
2010;Tansey et al., 2010). The G allele of the OXTR rs2254298 has
been related to greater risk for autism, depression and separation anx-
iety (Jacob et al., 2007;Lerer et al., 2007;Costa et al., 2009) and with
amygdala volume decrease in both Caucasian and Asian populations
(Inoue et al., 2010;Furman et al., 2011). The T allele of the OXTR
rs2268490 and the G allele of the OXTR rs1042778 were each impli-
cated in prosocial decision making (Israel et al., 2009), and carriers of
the rs1042778 G allele exhibited more parenting behaviour and had
higher plasma OT levels than T carriers (Feldman et al., 2012). The A
allele of the SNP rs2268494 was associated with risk for ASD (Lerer
et al., 2007). Finally, the SNP rs53576 has been associated with autism,
empathy and prosocial behaviour (Wu et al., 2005;Rodrigues et al.,
2009;Kogan et al., 2011). Overall, these data provide evidence for the
involvement of OXTR variants in bond formation and empathic beha-
viour in humans.
In this study, we chose a cumulative risk approach to study risk on
the OXTR by combining multiple SNPs into a single index. Our as-
sumption was that as these OXTR variants are individually associated
with prosocial traits, affiliative behaviours and psychopathology of
social dysfunction, a cumulative risk score may provide an integrative
measure that can be more predictive of social outcomes than each SNP
alone. Using a cumulative risk score on the OXTR, we recently found
that mothers’ and fathers’ cumulative OXTR risk predicted children’s
OT production and social reciprocity with their best friends (Feldman
et al., 2013), pointing to the utility of testing cumulative risk on the
OXTR. This approach is consistent with current models on the com-
bined contribution of risk and plasticity alleles in shaping psychopath-
ology and social adaptation (Belsky et al., 2009)
The overall goal of this study was to test the relations between OXTR
polymorphisms and empathic communication between couples during
a support-giving interaction that required empathy to the partner’s
distress (Collins and Feeney, 2000). As support in social relationships
is an important contributor to well-being and relationship satisfaction
(Bowlby, 1969;Feeney and Lemay, 2012) and empathic support is
among the central emotional capital of intimate bonds (Feeney and
Lemay, 2012), empathic support-giving behaviour was expected to
index an important social attribute of the individual and to serve as
a central marker of the relationship. Periods of bond formation involve
adaptation of the OT system and are associated with increase in per-
ipheral OT production (Feldman, 2012), and we thus expected OXTR
risk to predict empathic difficulties at the first 3 months of a romantic
relationship. Five OXTR variants that have been linked with social
behaviour and pathology of social functioning were tested:
rs13316193, rs2254298, rs1042778, rs2268494 and rs2268490. It was
expected that greater number of risk alleles on these SNPs would pre-
dict empathic difficulties at the first stages of romantic love in a
dose–response manner.
METHODS
Participants
Participants included 120 young adults (60 couples) who began a ro-
mantic relationship in the past 3 months. Men were on average 25.03
years (s.d. ¼8.78) and women’s age averaged 22.84 (s.d. ¼4.50). All
participants were Caucasians, healthy, and completed at least 12 years
of education.
Exclusion criteria included couples who were in a romantic relation-
ship <2 weeks or more than 4 months, used medication for a physical
or psychiatric condition, or reported not being generally healthy.
Participants were recruited through ads in several universities located
in central Israel, and as participants were all college students their age
range was 18–35.
Procedure
Experiments were conducted in a comfortable laboratory during the
mid-afternoon hours (4:00–7:00 PM). After receiving a brief explan-
ation on the experimental procedure and signing an informed consent,
participants completed self-report measures that assessed a range of
demographic and health variables (e.g. weight, height, smoking, medi-
cation). Next, mouthwashes of DNA were collected. Following these
activities, participants engaged in a social support interaction paradigm.
Partners were instructed to describe to each other a situation that
caused them personal distress but was not related to the romantic
relationships (e.g. work problems, family problems) and take turns
within the paradigm for approximately 7 min each. Order of
speaker–listener was decided by the couple. Discussions were video-
taped and analysed offline using the Coding Interactive Behavior
Manual (CIB) (Feldman, 1998). Each couple received 70 USD for
participation. The research was approved by the University
Institutional Review Board and all participants signed an informed
consent.
Genotyping
Genotyping of the OXTR SNPs rs1042778, rs2268494, rs13316193,
rs2254298 and rs2268490 was done as previously described (Lerer
et al., 2007;Feldman et al., 2012). DNA was extracted from 20 ml of
mouthwash samples using the Master Pure kit (Epicentre, Madison
WI). Genotyping of the OXTR SNPs was performed using the
SNaPshot Method (Applied BioSystems, Foster City, CA, USA) as pre-
viously described (Lerer et al., 2007;Feldman et al., 2012). All PCR
reactions and High Resolution Melt (HRM) analysis were performed
on a Rotor-Gene 3000 (Corbett Life Science, Australia), using the fol-
lowing primers that produced a 162 bp amplicon: F50GGT
GCACAGACCACTTAGCA03; R50TCGGAAGAGAGGAAAGCAAA03.
PCR reaction conditions were as follows: activating enzyme step at
95.08C for 15 min, 45 cycles of denaturation at 95.08C for 5 s, reanneal-
ing at 608C for 15 s and extension at 728C for 10 s. The reaction pro-
ceeded to a hold at 408C for 2 min, a second hold at 828C for 2 min and
then the melt procedure ramped from 82 to 908C raising by 0.18C
every 3 s where fluorescence was acquired. HRM distinguished between
the three genotypes (AA, AG, GG) and the method was verified by
comparison of a portion of HRM results to those obtained by geno-
typing the same samples using the SNaPShot procedure (Applied
Biosystems) described above. All genotype frequencies of the OXTR
SNPs were in Hardy–Weinberg equilibrium.
Cumulative susceptibility to social and communicative difficulties
was calculated by summing the number of SNPs on which the indi-
vidual was homozygote for the risk allele. These included the OXTR
rs1042778 TT allele, the OXTRrs2268494 AA allele, the OXTR
rs13316193 TT allele, the OXTR rs2254298 GG allele and the
OXTRrs2268490 TT allele. Thus, for each individual, the OXTR risk
OXTR, genetic risk and empathy SCAN (2014) 1525
Downloaded from https://academic.oup.com/scan/article/9/10/1524/1653161 by guest on 21 March 2023
score could range from 0 (no risk alleles) to 5 (risk factors on all five
investigated OXTR SNPs). Descriptive statistics for the OXTR distri-
bution indicate that the distribution was approximately normal as both
skewness of 0.09 (s.e. ¼0.22) and kurtosis of 0.24 (s.e. ¼0.44) did
not exceed twice their standard errors. No outliers were detected.
Behavioural coding
Support-giving interactions were coded with the CIB (Feldman, 1998),
adult version, by trained coders who were blind to genetic or any other
information about the participants. The CIB is a well-validated rating
system of dyadic interactions with versions for coding social inter-
actions in infancy, childhood, adolescence and adulthood. The CIB
has shown adequate psychometric properties across multiple attach-
ments in health and psychopathology, including romantic attachment
(Feldman, 2012;Feldman et al., 2012;Schneiderman et al., 2012).
The adult–adult version of the CIB included 33 scales: 28 are iden-
tical scales that are coded independently for each partner (e.g. atten-
tion to partner) and five scales are coded for the couple as a whole and
address dyadic measures (e.g. dyadic reciprocity). Each scale is rated on
a Likert scale of 1 ¼low to 5 ¼high. Consistent with our previous
research the communicative empathy construct was averaged from
several scales coded for each partner and included the following
codes: affective congruence, emotional flow and harmony, degree of
emotional coherence and complexity, nonverbal signs of empathy
particularly the provision of affectionate touch, attention and acknow-
ledgement of partner’s distress and communications, and maintaining
focus on other’s distress (Cronbach’s alpha ¼0.71).
Self-report instruments
Depression was measured by the Beck Depression Inventory (BDI), a
well-validated instrument for the assessment of depressive symptoms
(Beck, 1978), whereas Anxiety was assessed by the Trait Anxiety
Inventory (STAI-T) (Spielberger et al., 1983). The standardized BDI
and STAI-T scores were summed to crease a composite of the individ-
ual’s emotional distress.
Statistical analysis
Associations among the research variables and between romantic part-
ners were assessed with the Pearson correlation coefficient. As partici-
pants were nested within dyads, multi-level modelling (MLM) was
used to examine the effects of cumulative OXTR risk on empathic
communication while controlling for dyadic dependency. All
P-values were two-tailed. Data were analysed using SPSS software for
Windows, version 19 (SPSS Inc., Chicago, IL, USA).
RESULTS
As a first step, we computed correlations between all study variables for
women and men. Table 1 presents the inter-correlations, means and
standard deviations for all study variables. As seen, empathic commu-
nication difficulties showed a significant negative correlation with the
degree of genetic risk on the OXTR for both men and women, indicat-
ing that the greater the cumulative risk on the OXTR the less the
individual engaged in empathic support-giving behaviour. Genetic
risk was negatively associated with emotional distress for men, but
not for women.
Next, we examined whether genetic risk on the OXTR predicts vari-
ability in empathic communication while controlling for gender, rela-
tionship duration and emotional distress. The structure of the data was
nested because data were collected from both romantic partners during
the conversation. Indeed, as seen in Table 1, significant positive
correlation was found between the partners’ scores on empathic com-
munication, indicating dyadic dependency. An MLM analysis
(Campbell and Kashy, 2002;Kenny et al., 2006) was used to model
the dyadic dependency (i.e. non-independence) and to test whether the
individual’s OXTR risk uniquely predicts his or her own empathic
communication above and beyond the dyadic level. Prior to comput-
ing the model we checked for order effect (who spoke first) and as
no main or interactive effects for order were found and thus order was
not included in the final model. We used the MIXED procedure in
SPSS (Heck et al., 2010) with restricted likelihood estimation to
estimate the coefficients (Kenny et al., 2006). Gender, relationship
duration and emotional distress were included as important correlates
in order to control for their potential variation. All the predictors were
centred around the grand mean. Interactions between OXTR risk
and gender were also included to examine whether the association
between genetic risk and empathic communication vary across
genders.
We started by running a null model for empathic communication to
assess whether our data met the condition justifying dyadic analysis,
that is, the data show systematic between-dyad variance in the depend-
ent variable. Results suggest that this condition has been satisfied
(Wald Z¼5.05, df ¼59, P< .001). Estimating the null model also pro-
duces information necessary for computing intraclass correlation
coefficient (ICC) that indicates the proportion of between-dyad vari-
ance in empathic communication (cf. Kenny et al., 2006). The results
of this analysis indicate that 88% of the variance in empathic commu-
nication lies between dyads. We also assessed the ICC for the rest of
dyadic predictors and found that 17% of the variance in OXTR risk lies
between dyads and 1% of the variance in emotional distress lies
between dyads.
Next, we ran a model which included all the predictors. Comparing
the estimates of the residual variance produced in the null model and
the current model allowed for the computation of the variance
explained (R
2
). Results indicated the current model accounted for
12% of the variance. Table 2 provides coefficients for the study vari-
ables predicting empathic communication. As seen, genetic risk on the
OXTR uniquely predicted the individual’s own empathic communica-
tion, indicating that the higher the cumulative risk on the OXTR the
less the individual engaged in empathic support-giving behaviour
during the interaction. Importantly, the OXTR risk by gender inter-
action term was not statistically significant. This indicates that the
association between genetic risk and empathic communication does
not vary between men and women. Gender was found to be a signifi-
cant predictor of empathic communication with men being more
empathic to the distress of their partners during the first months of
a romantic relationship. Relationship duration and emotional distress
were not significantly predictive of empathic communication in men
or women.
Table 1 Inter-correlations, means, and standard deviations of study variables for women
and men
Measures 1 2 3 Ms.d.
1. OXTR genetic risk 0.16 0.27* 0.20* 2.02 0.74
2. Emotional distress 0.05 0.05 0.04 0.56 0.42
3. Empathic communication 0.30* 0.17 0.88** 4.11 0.57
M1.98 0.61 4.01
s.d. 0.87 0.73 0.58
Men above the diagonal, women below the diagonal and dyads on the diagonal. *P< 0.05,
**P< 0.01.
15 26 S C AN ( 2 014 ) I. Schneiderman et al.
Downloaded from https://academic.oup.com/scan/article/9/10/1524/1653161 by guest on 21 March 2023
Finally, to supplement our cumulative risk approach and the MLM
analysis, Table 3 presents means, s.d., and F-values of the differences
between high- and low OXTR risk for each SNP separately. As seen,
although the results for each OXTR SNP show higher empathic com-
munication among individuals with the low risk allele, only the
OXTRrs1042778 independently differentiated those with high and
low risk alleles. These data support our cumulative risk approach
and demonstrate the utility of combining several theoretically mean-
ingful SNPs into a single composite.
DISCUSSION
Empathic communication between couples provides the foundation
for growth-promoting intimate relationships, whereas empathic diffi-
culties often result in relationship deterioration and emotional distress
(Anderson and Saunders, 2003). Yet, whereas much current research
points to the interactions between genetic markers and human social
behaviour, most studies on the genetic basis of empathy utilized self-
reports or experimental paradigms and no study, to our knowledge,
employed direct observations of empathic behaviour within real rela-
tionships (Feldman, 2012). Results of this study are also the first to link
genetic variability with observed behaviour in the context of romantic
bonding. Furthermore, our findings are the first to describe associ-
ations between cumulative genetic risk on the OXTR and empathy.
The findings indicate that risk alleles on the OXTR underpin difficul-
ties in empathic communication at the early stages of romantic love, a
period associated with alterations in brain activity and neurohormonal
processes (Marazziti et al., 1999;Bartels and Zeki, 2000;Aron, 2005;
Emanuele et al., 2006;Kim et al., 2009). Specifically, individuals with
greater cumulative risk on the OXTR variants rs13316193, rs2254298,
rs1042778, rs2268494 and rs226849 exhibited less empathic concern to
their partner’s distress, showed lower affective congruence, displayed
lower social reciprocity in a support-giving interaction, and persisted
less in attending to their partner’s communication and maintaining
focus on providing support. Furthermore, the MLM analysis demon-
strates that the association between OXTR risk and the individual’s
empathic behaviour is significant above and beyond the dyadic level,
relationship duration and emotional distress. These data extend pre-
vious research on the involvement of the OT system in human
empathy and social affiliation and demonstrate for the first time asso-
ciations between the OXTR genotype and communication patterns
between couples.
Our results are consistent with studies reporting associations
between OXTR variants and greater susceptibility to social deficits.
Previous research has linked these OXTR variants with less empathic
and prosocial behaviour and with conditions associated with severe
social dysfunction, such as ASD and depression (Lerer et al., 2007;
Costa et al., 2009;Israel et al., 2009;Kawamura et al., 2010;
Wu et al., 2012). It has been proposed that the social deficits in
these disorders, which are particularly noted in aspects of interpersonal
communication, may be mediated by individual differences in amyg-
dala development that are related to the OXTR genotype (Inoue et al.,
2010;Meyer-Lindenberg et al., 2011). Indeed, some of the OXTR vari-
ants studied here have been associated with amygdala volume, morph-
ology and activity (Inoue et al., 2010;Tost et al., 2010;Furman et al.,
2011). Similarly, animal research indicates that OT shows significant
binding in the amygdala (Bale et al., 2001;Huber et al., 2005), and OT
in the medial amygdala is essential for social recognition in mice
(Ferguson et al., 2001). In humans, intranasal OT administration
was found to reduce right amygdala responses (Domes et al., 2007).
Taken together, these findings underscore the links between the OT
system and individual differences in interpersonal relationships as well
as difficulties in social communication, possibly via the close connec-
tion between brain OT and the extended amygdala network. The pre-
sent findings add the dimension of cumulative genetic risk on the
OXTR in shaping the individual’s concrete empathic behaviour
during the initial stages of pair-bonding in humans.
Current conceptual models highlight the utility of assessing cumu-
lative genetic risk as an underlying explanatory framework for the
study of psychiatric disorders (Belsky et al., 2009). It is important to
note that there is always a challenge in how best to use all the genetic
information in a set of SNPs available from the dbSNP database.
Approaches include genotype and haplotype-based methods as well
as principle components analysis. Genotype strategies, for example,
may use a single-SNP analysis and each marker is tested individually
for its contribution to the phenotype (Chapman and Wijsman, 1998;
Schork et al., 2000;Kaplan and Morris, 2001). On the other hand,
Gauderman et al. (2007) has suggested a principle components ana-
lysis. There is also a joint-SNP approach using multiple SNPs simul-
taneously in the statistical model (Chapman et al., 2003;Clayton et al.,
2004). In our study, which contains a relatively small sample for a
genetic study, we chose to reduce the dimensionality associated with
a large number of possible haplotypes and to eliminate the uncertainty
connected with the need to estimate haplotypes or haplotype blocks.
For these reasons, we implemented a joint-SNP analysis.
It has been suggested that allelic variations on multiple genes can
mark either risk or resilience pending on the individual’s rearing en-
vironment, and some allelic variations that predispose individuals to
psychopathology under aversive rearing conditions may have beneficial
effects in more favourable environments (Belsky et al., 2009). These
conceptual models may explain the mixed results reported with regards
to OXTR variants. For instance, whereas some researchers found that
the OXTR rs1042778 G allele is implicated in prosocial behaviour and
parental care (Israel et al., 2009;Feldman et al., 2012), as we found
here, others reported associations between rs1042778 G allele and
social deficits. Similarly, culture effects have been noted with respect
to the OXTR rs2254298 variant. Whereas in Caucasian samples the G
genotype was related to unipolar depression, adult separation anxiety
and higher risk for autism (Lerer et al., 2007;Costa et al., 2009), in
Asian population the opposite A allele was associated with ASD (Wu
et al., 2005). In addition, some studies did not find OXTR gene in-
volvement in social behaviour or in the aetiology of autism (Apicella
Table 2 MLM unstandardized and standardized coefficients predicting empathic com-
munication from gender, relationship duration, emotional distress, cumulative OXTR risk
and cumulative OXTR genetic risk by gender
bs.e. 95% CI
Gender 0.05* 0.02 0.10 to 0.01 0.09
Relationship duration 0.07 0.06 0.09 to 0.22 0.05
Emotional distress 0.01 0.01 0.01 to 0.01 0.06
Cumulative OXTR risk 0.09* 0.03 0.18 to 0.01 0.14
Cumulative OXTR risk gender 0.05 0.03 0.13 to 0.02 0.06
Table 3 Risk on each SNP of the OXTR and empathic communication between romantic
partners
SNPs Low risk
mean (s.d.)
High risk
mean (s.d.)
FP-value
rs1042778 4.10 (0.55) 3.70 (0.72) 4.91 0.03
rs2268494 4.21 (0.54) 4.03 (0.58) 1.67 N.S.
rs13316193 4.09 (0.50) 4.04 (0.65) 0.25 N.S.
rs2254298 4.15 (0.59) 4.01 (0.58) 1.6 N.S.
rs2268490 4.06 (0.58) 4.00 (0.55) 0.01 N.S.
OXTR, genetic risk and empathy SCAN (2014) 1527
Downloaded from https://academic.oup.com/scan/article/9/10/1524/1653161 by guest on 21 March 2023
et al., 2010;Tansey et al., 2010). These findings underscore the need for
much further research on the potential utility of assessing plasticity
variants on the OXTR in combination with measures that provide a
detailed assessment of early environmental experiences. It is important
to carefully chart cultural, environmental and allelic biomarkers in
order to compute comprehensive indices that can be used as markers
of risk or resilience in the context of psychiatric vulnerability.
The finding that men showed greater empathy than women during a
support-giving encounter was somewhat surprising. While we do not
have a clear explanation for this finding, it is possible that during the
first months of romantic courtship men are especially attentive to their
partner’s signals whereas women may be more anxious and preoccu-
pied, which may deploy their support-giving abilities. Support for this
hypothesis comes from our finding that during the first months of
romantic love, women’s cortisol levels show a substantial rise whereas
men’s cortisol levels remain unchanged. In addition, we found that
during the first months of romantic love men show greater ERP re-
sponse to attachment-related cues (Weisman et al., 2012). Still, much
further research is required to test gender-specific patterns of commu-
nication and their biological underpinnings during the period of falling
in love.
Evolutionary models suggest that periods of bond formationin
particular parental and romantic bondingare associated with func-
tional adaptation of brain and behaviour, share underlying bio-beha-
vioural mechanisms, and are associated with the OT system and with a
specific repertoire of bonding-related behaviour (Feldman et al., 2012).
However, whereas much research explored the neurobiological mech-
anisms underlying parental bonding, very little research examined gen-
etic, brain, or hormonal correlates of romantic bond-formation in
humans and little, if any, research included direct observations of
dyadic behaviour during the stage of falling in love. Applying an etho-
logical approach to the study of affiliative bonds, long advocated by
Lorenz (1950) and Tinbergen (1963), we suggest that observation of
specific affiliative behaviour during periods when bonds are consoli-
dated may provide an important lens to study human attachment. As
suggested by the ethologists, observed patterns of behaviour may be
more closely related to underlying neurobiological processes and may
provide a bottom-up, behaviour-based evaluation of distress or psy-
chopathology at an earlier stage of the relationship as compared to
more formal assessments.
Limitations of the study include the omission of the OXTR rs53576,
which has been associated with prosocial behaviour, maternal sensitiv-
ity and attachment (Bakermans-Kranenburg and Van IJzendoorn,
2008;Costa et al., 2009;Tost et al., 2010), from the panel of OXTR
SNPs tested in this study. The rs53576 SNP was not assayed as we were
unable to find appropriate primers to fit the existing SNAPSHOT
panel. Similarly, although the study included healthy, functioning
adults we do not have detailed information on their rearing conditions
apart from general report of growing within typical rearing environ-
ments. Future studies should examine the associations between social
behaviour, OXTR genotypes, brain structures associated with social
behaviour and early environmental conditions in an attempt to
create a cumulative risk index from these multiple biological
and behavioural markers that can serve as an early diagnostic tool
for identifying vulnerability to psychopathology at its earliest stages.
Understanding the differential influence of OXTR genotypes on social
communication behaviour via the modulation of brain development
and activity may enable gene-based therapy in conditions associated
with severe social dysfunctions, such as autism, post-traumatic stress
disorder, or depression. Such research may provide new avenues for
understanding the roles of specific allelic variations on the OXTR
and their cumulative activity on brain, social behavioural patterns
and the development of empathy under conditions of health and
psychopathology.
REFERENCES
Acevedo, B.P., Aron, A., Fisher, H.E., Brown, L.L. (2011). Neural correlates of long-term
intense romantic love. Social Cognitive and Affective Neuroscience,7,145–59.
Anderson, D.K., Saunders, D.G. (2003). Leaving an abusive partner an empirical review of
predictors, the process of leaving, and psychological well-being. Trauma, Violence, &
Abuse,4, 163–91.
Apicella, C.L., Cesarini, D., Johannesson, M., et al. (2010). No association between oxytocin
receptor (OXTR) gene polymorphisms and experimentally elicited social preferences.
PLoS One,5, e11153.
Apter-Levi, Y., Feldman, M., Vakart, A., Ebstein, R.P., Feldman, R. (2013). Impact of
maternal depression across the first six years of life on the child’s mental health,
social engagement, and empathy: the moderating role of oxytocin. American Journal
of Psychiatry,170(10), 1161–68.
Aron, A. (2005). Reward, motivation, and emotion systems associated with early-stage
intense romantic love. Journal of Neurophysiology,94, 327–37.
Bakermans-Kranenburg, M.J., Van IJzendoorn, M.H. (2008). Oxytocin receptor (OXTR)
and serotonin transporter (5-HTT) genes associated with observed parenting. Social
Cognitive and Affective Neuroscience,3, 128–34.
Bale, T.L., Davis, A.M., Auger, A.P., Dorsa, D.M., McCarthy, M.M. (2001). CNS region-
specific oxytocin receptor expression: importance in regulation of anxiety and sex
behavior. The Journal of Neuroscience,21,2546–52.
Bales, K.L., Mason, W.A., Catana, C., Cherry, S.R., Mendoza, S.P. (2007). Neural correlates
of pair-bonding in a monogamous primate. Brain Research,1184,245–53.
Bartels, A., Zeki, S. (2000). The neural basis of romantic love. Neuroreport,11, 3829–34.
Bartz, J.A., Zaki, J., Bolger, N., et al. (2010). Oxytocin selectively improves empathic
accuracy. Psychological Science,21, 1426–8.
Beck, A.T. (1978). Beck Depression Inventory. San Antonio, TX: Harcourt Brace Jovanovich.
Belsky, J., Jonassaint, C., Pluess, M., Stanton, M., Brummett, B., Williams, R. (2009).
Vulnerability genes or plasticity genes? Molecular Psychiatry,14,746–54.
Bowlby, J. (1969). Attachment and Loss: Attachment. London: The Hogarth Press and the
Institute of Psychoanalysis.
Burman, B., Margolin, G. (1992). Analysis of the association between marital relationships
and health problems: an interactional perspective. Psychological Bulletin,112,39.
Burri, A., Heinrichs, M., Schedlowski, M., Kruger, T.H.C. (2008). The acute effects of
intranasal oxytocin administration on endocrine and sexual function in males.
Psychoneuroendocrinology,33, 591–600.
Campbell, L., Kashy, D.A. (2002). Estimating actor, partner, and interaction effects for
dyadic data using PROC MIXED and HLM: a user-friendly guide. Personal Relationships,
9, 327–42.
Carter, C.S. (1998). Neuroendocrine perspectives on social attachment and love.
Psychoneuroendocrinology,23, 779–818.
Champagne, F., Diorio, J., Sharma, S., Meaney, M.J. (2001). Naturally occurring variations
in maternal behavior in the rat are associated with differences in estrogen-inducible
central oxytocin receptors. Proceedings of the National Academy of Sciences of the
United States of America,98, 12736–41.
Chapman, J.M., Cooper, J.D., Todd, J.A., Clayton, D.G. (2003). Detecting disease associ-
ations due to linkage disequilibrium using haplotype tags: a class of tests and the
determinants of statistical power. Human Heredity,56,18–31.
Chapman, N.H., Wijsman, E.M. (1998). Genome screens using linkage disequilibrium tests:
optimal marker characteristics and feasibility. American Journal of Human Genetics,63,
1872–85.
Clayton, D., Chapman, J., Cooper, J. (2004). Use of unphased multilocus genotype data in
indirect association studies. Genetic Epidemiology,27,415–28.
Cohen, S., Wills, T.A. (1985). Stress, social support, and the buffering hypothesis.
Psychological Bulletin,98, 310–57.
Collins, N.L., Feeney, B.C. (2000). A safe haven: an attachment theory perspective on
support seeking and caregiving in intimate relationships. Journal of Personality and
Social Psychology,78, 1053–73.
Costa, B., Pini, S., Gabelloni, P., et al. (2009). Oxytocin receptor polymorphisms and adult
attachment style in patients with depression. Psychoneuroendocrinology,34, 1506–14.
Ditzen, B., Schaer, M., Gabriel, B., Bodenmann, G., Ehlert, U., Heinrichs, M. (2009).
Intranasal oxytocin increases positive communication and reduces cortisol levels
during couple conflict. Biological Psychiatry,65,728–31.
Ditzen, B., Schmidt, S., Strauss, B., Nater, U.M., Ehlert, U., Heinrichs, M. (2008). Adult
attachment and social support interact to reduce psychological but not cortisol
responses to stress. Journal of Psychosomatic Research,64, 479–86.
Domes, G., Heinrichs, M., Gla
¨scher, J., Bu
¨chel, C., Braus, D.F., Herpertz, S.C. (2007).
Oxytocin attenuates amygdala responses to emotional faces regardless of valence.
Biological Psychiatry,62, 1187–90.
Ebstein, R.P., Israel, S., Chew, S.H., Zhong, S., Knafo, A. (2010). Genetics of human social
behavior. Neuron,65, 831–44.
1528 SCAN (2014) I. Schneiderman et al.
Downloaded from https://academic.oup.com/scan/article/9/10/1524/1653161 by guest on 21 March 2023
Emanuele, E., Politi, P., Bianchi, M., Minoretti, P., Bertona, M., Geroldi, D. (2006). Raised
plasma nerve growth factor levels associated with early-stage romantic love.
Psychoneuroendocrinology,31, 288–94.
Enns, M.W., Cox, B.J., Clara, I., et al. (2002). Parental bonding and adult psychopathology:
results from the US National Comorbidity Survey. Psychological Medicine,32, 997–1008.
Feeney, B.C., Lemay, E.P., Jr (2012). Surviving relationship threats: the role of emotional
capital. Personality & Social Psychology Bulletin,38, 1004–17.
Feifel, D., Macdonald, K., Cobb, P., Minassian, A. (2012). Adjunctive intranasal oxytocin
improves verbal memory in people with schizophrenia. Schizophrenia Research,139,
207–10.
Feldman, R. (1998). Coding Interactive Behavior. Unpublished manual.
Feldman, R. (2012). Oxytocin and social affiliation in humans. Hormones and Behavior,61,
380–91.
Feldman, R., Gordon, I., Influs, M., Gutbir, T., Ebstein, R.P. (2013). Parental oxytocin and
early caregiving jointly shape children’s oxytocin response and social reciprocity.
Neuropsychopharmacology: Official Publication of the American College of
Neuropsychopharmacology,38, 1154–62.
Feldman, R., Zagoory-Sharon, O., Weisman, O., et al. (2012). Sensitive parenting is asso-
ciated with plasma oxytocin and polymorphisms in the OXTR and CD38 genes.
Biological Psychiatry,72, 175–81.
Ferguson, J.N., Aldag, J.M., Insel, T.R., Young, L.J. (2001). Oxytocin in the medial amyg-
dala is essential for social recognition in the mouse. The Journal of Neuroscience,21,
8278–85.
Furman, D.J., Chen, M.C., Gotlib, I.H. (2011). Variant in oxytocin receptor gene is asso-
ciated with amygdala volume. Psychoneuroendocrinology,36, 891–7.
Gauderman, W.J., Murcray, C., Gilliland, F., Conti, D.V. (2007). Testing association be-
tween disease and multiple SNPs in a candidate gene. Genetic Epidemiology,31, 383–95.
Gimpl, G., Fahrenholz, F. (2001). The oxytocin receptor system: structure, function, and
regulation. Physiological Reviews,81, 629–83.
Gonzaga, G.C., Turner, R.A., Keltner, D., Campos, B., Altemus, M. (2006). Romantic love
and sexual desire in close relationships. Emotion (Washington, DC),6, 163–79.
Gottman, J.M., Levenson, R.W. (1992). Marital processes predictive of later dissolution:
behavior, physiology, and health. Journal of Personality and Social Psychology,63, 221–33.
Gregory, S.G., Connelly, J.J., Towers, A.J., et al. (2009). Genomic and epigenetic evidence
for oxytocin receptor deficiency in autism. BMC Medicine,7, 62.
Grewen, K.M. (2005). Effects of partner support on resting oxytocin, cortisol, norepineph-
rine, and blood pressure before and after warm partner contact. Psychosomatic Medicine,
67, 531–8.
Heck, R.H., Thomas, S.L., Tabata, L.N. (2010). Multilevel and Longitudinal Modeling with
IBM SPSS, 1st edn. Chicago, IL: Routledge Academic.
Hollander, E., Bartz, J., Chaplin, W., et al. (2007). Oxytocin increases retention of social
cognition in autism. Biological Psychiatry,61, 498–503.
Holt-Lunstad, J., Birmingham, W.A., Light, K.C. (2008). Influence of a ‘warm touch’
support enhancement intervention among married couples on ambulatory blood pres-
sure, oxytocin, alpha amylase, and cortisol. Psychosomatic Medicine,70, 976–85.
Huber, D., Veinante, P., Stoop, R. (2005). Vasopressin and oxytocin excite distinct neur-
onal populations in the central amygdala. Science (New York, NY),308, 245–8.
Hurlemann, R., Patin, A., Onur, O.A., et al. (2010). Oxytocin enhances amygdala-depend-
ent, socially reinforced learning and emotional empathy in humans. Journal of
Neuroscience,30, 4999–5007.
Inoue, H., Yamasue, H., Tochigi, M., et al. (2010). Association between the oxytocin re-
ceptor gene and amygdalar volume in healthy adults. Biological Psychiatry,68, 1066–72.
Inoue, T., Kimura, T., Azuma, C., et al. (1994). Structural organization of the human
oxytocin receptor gene. The Journal of Biological Chemistry,269, 32451–6.
Insel, T.R., Hulihan, T.J. (1995). A gender-specific mechanism for pair bonding: oxytocin
and partner preference formation in monogamous voles. Behavioral Neuroscience,109,
782–9.
Insel, T.R., Young, L.J. (2000). Neuropeptides and the evolution of social behavior. Current
Opinion in Neurobiology,10, 784–9.
Israel, S., Lerer, E., Shalev, I., et al. (2009). The oxytocin receptor (OXTR) contributes to
prosocial fund allocations in the dictator game and the social value orientations task.
PLoS One,4, e5535.
Jacob, S., Brune, C.W., Carter, C.S., Leventhal, B.L., Lord, C., Cook, E.H., Jr (2007).
Association of the oxytocin receptor gene (OXTR) in Caucasian children and adoles-
cents with autism. Neuroscience Letters,417,6–
9.
Jacobson, N.S., Moore, D. (1981). Spouses as observers of the events in their relationship.
Journal of Consulting and Clinical Psychology,49, 269–77.
Kaplan, N., Morris, R. (2001). Prospects for association-based fine mapping of a suscep-
tibility gene for a complex disease. Theoretical Population Biology,60, 181–91.
Kawamura, Y., Liu, X., Akiyama, T., et al. (2010). The association between oxytocin
receptor gene (OXTR) polymorphisms and affective temperaments, as measured by
TEMPS-A. Journal of Affective Disorders,127,31–7.
Kenny, D.A., Kashy, D.A., Cook, W.L. (2006). Dyadic Data Analysis. New York, NY:
Guilford Press.
Kim, W., Kim, S., Jeong, J., et al. (2009). Temporal changes in functional magnetic reson-
ance imaging activation of heterosexual couples for visual stimuli of loved partners.
Psychiatry Investigation,6,19–25.
Kogan, A., Saslow, L.R., Impett, E.A., Oveis, C., Keltner, D., Saturn, S.R. (2011). Thin-
slicing study of the oxytocin receptor (OXTR) gene and the evaluation and expression of
the prosocial disposition. Proceedings of the National Academy of Sciences of the United
States of America,108, 19189–92.
Lerer, E., Levi, S., Salomon, S., Darvasi, A., Yirmiya, N., Ebstein, R.P. (2007). Association
between the oxytocin receptor (OXTR) gene and autism: relationship to Vineland
Adaptive Behavior Scales and cognition. Molecular Psychiatry,13,980–8.
Lorenz, K.Z. (1950). The comparative method in studying innate behavior patterns.
Physiological Mechanisms in Animal Behavior. (Society’s Symposium IV.). Oxford,
England: Academic Press, pp. 221–68.
Lyons-Ruth, K. (2008). Contributions of the mother-infant relationship to dissociative,
borderline, and conduct symptoms in young adulthood. Infant Mental Health Journal,
29, 203–18.
Mah, B.L., Van Ijzendoorn, M.H., Smith, R., Bakermans-Kranenburg, M.J. (2013).
Oxytocin in postnatally depressed mothers: its influence on mood and expressed emo-
tion. Progress in Neuro-Psychopharmacology & Biological Psychiatry,40,267–72.
Marazziti, D., Akiskal, H.S., Rossi, A., Cassano, G.B. (1999). Alteration of the platelet
serotonin transporter in romantic love. Psychological Medicine,29, 741–5.
Markman, H.J. (1981). Prediction of marital distress: a 5-year follow-up. Journal of
Consulting and Clinical Psychology,49, 760–2.
Meyer-Lindenberg, A., Domes, G., Kirsch, P., Heinrichs, M. (2011). Oxytocin and vaso-
pressin in the human brain: social neuropeptides for translational medicine. Nature
Reviews. Neuroscience,12, 524–38.
Nagasawa, M., Okabe, S., Mogi, K., Kikusui, T. (2012). Oxytocin and mutual communi-
cation in mother-infant bonding. Frontiers in Human Neuroscience,6, 31. doi:10.3389/
fnhum.2012.00031.
Rodrigues, S.M., Saslow, L.R., Garcia, N., John, O.P., Keltner, D. (2009). Oxytocin
receptor genetic variation relates to empathy and stress reactivity in humans.
Proceedings of the National Academy of Sciences of the United States of America,106,
21437–41.
Schneiderman, I., Zagoory-Sharon, O., Leckman, J.F., Feldman, R. (2012). Oxytocin during
the initial stages of romantic attachment: relations to couples’ interactive reciprocity.
Psychoneuroendocrinology,37, 1277–85.
Schork, N.J., Nath, S.K., Fallin, D., Chakravarti, A. (2000). Linkage disequilibrium analysis
of biallelic DNA markers, human quantitative trait loci, and threshold-defined case and
control subjects. American Journal of Human Genetics,67, 1208–18.
Singer, T., Snozzi, R., Bird, G., et al. (2008). Effects of oxytocin and prosocial behavior on
brain responses to direct and vicariously experienced pain. Emotion (Washington, DC),
8, 781–91.
Souza, R.P., De Luca, V., Meltzer, H.Y., Lieberman, J.A., Kennedy, J.L. (2010).
Schizophrenia severity and clozapine treatment outcome association with oxytocinergic
genes. The International Journal of Neuropsychopharmacology,13,793–8.
Spielberger, C.D., Gorsuch, R.L., Lushene, R. (1983). Manual for the State-Trait Anxiety
Inventory. Palo Alto, CA: Consulting Psychologists Press.
Tansey, K.E., Brookes, K.J., Hill, M.J., et al. (2010). Oxytocin receptor (OXTR) does not
play a major role in the aetiology of autism: genetic and molecular studies. Neuroscience
Letters,474, 163–7.
Tinbergen, N. (1963). On aims and methods of ethology. Zeitschrift fu
¨r Tierpsychologie,20,
410–33.
Tost, H., Kolachana, B., Hakimi, S., et al. (2010). A common allele in the oxytocin receptor
gene (OXTR) impacts prosocial temperament and human hypothalamic-limbic struc-
ture and function. Proceedings of the National Academy of Sciences of the United States of
America,107, 13936–41.
Walum, H., Lichtenstein, P., Neiderhiser, J.M., et al. (2012). Variation in the oxytocin
receptor gene is associated with pair-bonding and social behavior. Biological
Psychiatry,71, 419–26.
Weisman, O., Feldman, R., Goldstein, A. (2012). Parental and romantic attachment shape
brain processing of infant cues. Biological Psychology,89, 533–8.
Williams, J.R., Insel, T.R., Harbaugh, C.R., Carter, C.S. (1994). Oxytocin administered
centrally facilitates formation of a partner preference in female prairie voles (Microtus
ochrogaster). Journal of Neuroendocrinology,6, 247–50.
Wu, N., Li, Z., Su, Y. (2012). The association between oxytocin receptor gene polymorph-
ism (OXTR) and trait empathy. Journal of Affective Disorders,138,468–72.
Wu, S., Jia, M., Ruan, Y., et al. (2005). Positive association of the oxytocin receptor gene
(OXTR) with autism in the Chinese Han population. Biological Psychiatry,58,74–7.
Young, L.J., Wang, Z. (2004). The neurobiology of pair bonding. Nature Neuroscience,7,
1048–54.
OXTR, genetic risk and empathy SCAN (2014) 1529
Downloaded from https://academic.oup.com/scan/article/9/10/1524/1653161 by guest on 21 March 2023
