Maintenance of Muscle Mass and Load-Induced Growth in Muscle RING Finger 1 Null Mice with Age.

Article (PDF Available)inAging cell 13(1) · August 2013with52 Reads
DOI: 10.1111/acel.12150 · Source: PubMed
Abstract
Age-related loss of muscle mass occurs to varying degrees in all individuals and has a detrimental effect on morbidity and mortality. Muscle Ring Finger 1 (MuRF1), a muscle specific E3 ubiquitin ligase, is believed to mediate muscle atrophy through the ubiquitin proteasome system (UPS). Deletion of MuRF1 (KO) in mice attenuates the loss of muscle mass following denervation, disuse and glucocorticoid treatment; however, its role in age-related muscle loss is unknown. In this study, skeletal muscle from male wild type (WT) and MuRF1 KO mice were studied up to the age of 24 months. Muscle mass and fiber cross-sectional area decreased significantly with age in WT, but not KO mice. In aged WT muscle, significant decreases in proteasome activities, especially 20S and 26S β5 (20-40% decrease), were measured and were associated with significant increases in the maladaptive endoplasmic reticulum (ER) stress marker, CHOP. Conversely, in aged MuRF1 KO mice 20S or 26S β5 proteasome activity was maintained or decreased to a lesser extent than in WT mice and no increase in CHOP expression was measured. Examination of the growth response of older (18 months) mice following functional overload, revealed that WT mice had significantly less growth relative to young mice (1.37 vs. 1.83 fold), whereas MuRF1 KO mice had a normal growth response (1.74 vs. 1.90 fold). These data collectively suggest that with age, MuRF1 plays an important role in the control of skeletal muscle mass and growth capacity through the regulation of cellular stress. This article is protected by copyright. All rights reserved.
Accepted Article
This article has been accepted for publication and undergone full peer review but has not been
through the copyediting, typesetting, pagination and proofreading process, which may lead to
differences between this version and the Version of Record. Please cite this article as doi:
10.1111/acel.12150
This article is protected by copyright. All rights reserved.
Accepted Date : 08-Aug-2013
Article type : Original Paper
Maintenance of Muscle Mass and Load-Induced Growth in Muscle RING
Finger 1 Null Mice with Age
Darren T. Hwee
1,3
, Leslie M. Baehr
2
, Andrew Philp
1
, Keith Baar
1,2
, and Sue C. Bodine
1,2
.
Departments of Neurobiology, Physiology, and Behavior
1
; and Physiology and Membrane
Biology
2
, Molecular, Cellular and Integrative Physiology Graduate Group
3
University of California, Davis, Davis, CA, 95616.
Running Head: MuRF1 Expression and Aging Muscle
Keywords: Sarcopenia, Ubiquitin Proteasome System, Anabolic Resistance, ER Stress
Corresponding author:
Sue C. Bodine, Ph.D.
Department of Neurobiology, Physiology, and Behavior, 196 Briggs Hall
University of California, Davis
One Shields Avenue, Davis, California. 95616
Phone: (530) 752-0694
Fax: (530) 752-5582
Email: scbodine@ucdavis.edu
Accepted Article
This article is protected by copyright. All rights reserved.
Check List
(4) List of Tables:
Table 1: Body Weight and Muscle Mass of WT and MuRF1 KO animals
(5) List of Figures
Figure 1: Maintenance of muscle mass in MuRF1 KO mice with aging. (Colour, 2-column)
Figure 2: Capillary Density, HIF-1α expression and Gene Expression in WT and MuRF1 KO
mice with age (Grey-Scale, 1-column)
Figure 3: Higher levels of proteasome activity in MuRF1 KO mice relative to WT with aging.
(Grey-scale, 2-column)
Figure 4: Oxidative Stress in WT and MuRF1 KO mice. (Grey-scale, 2 column)
Figure 5: Endoplasmic Reticulum stress is lower in MuRF1 KO mice. (Grey-scale, 1 –column)
Figure 6 Load-induced growth is maintained in older MuRF1 KO mice compared to WT mice.
(Grey-scale, 2-column)
Summary
Age-related loss of muscle mass occurs to varying degrees in all individuals and has a
detrimental effect on morbidity and mortality. Muscle Ring Finger 1 (MuRF1), a muscle specific
E3 ubiquitin ligase, is believed to mediate muscle atrophy through the ubiquitin proteasome
system (UPS). Deletion of MuRF1 (KO) in mice attenuates the loss of muscle mass following
denervation, disuse and glucocorticoid treatment; however, its role in age-related muscle loss is
unknown. In this study, skeletal muscle from male wild type (WT) and MuRF1 KO mice were
studied up to the age of 24 months. Muscle mass and fiber cross-sectional area decreased
significantly with age in WT, but not KO mice. In aged WT muscle, significant decreases in
proteasome activities, especially 20S and 26S β5 (20-40% decrease), were measured and were
associated with significant increases in the maladaptive endoplasmic reticulum (ER) stress
marker, CHOP. Conversely, in aged MuRF1 KO mice 20S or 26S β5 proteasome activity was
Accepted Article
This article is protected by copyright. All rights reserved.
maintained or decreased to a lesser extent than in WT mice and no increase in CHOP expression
was measured. Examination of the growth response of older (18 months) mice following
functional overload, revealed that WT mice had significantly less growth relative to young mice
(1.37 vs. 1.83 fold), whereas MuRF1 KO mice had a normal growth response (1.74 vs. 1.90
fold). These data collectively suggest that with age, MuRF1 plays an important role in the
control of skeletal muscle mass and growth capacity through the regulation of cellular stress.
Introduction
Muscle Ring Finger 1, MuRF1, is a muscle specific E3 ubiquitin ligase that is
transcriptionally increased in skeletal muscle in response to a variety of stressors that induce
muscle atrophy (Bodine et al., 2001). Deletion of MuRF1 in skeletal muscle has been shown to
attenuate the loss of muscle mass under catabolic conditions including: denervation, disuse, and
glucocorticoid treatment (Baehr et al., 2011; Gomes et al., 2012; Labeit et al., 2010). MuRF1
functions as an E3 ubiquitin ligase, and thus it has been predicted that muscle sparing in mice
with a null deletion of MuRF1 (i.e, MuRF1 KO) would be related to a decrease in proteasome
activity. However, a recent study revealed that muscle sparing following denervation is
associated with significant increases, not decreases, in both 20S and 26S proteasome subunit
activities in MuRF1 KO versus wild type (WT) mice (Gomes et al., 2012). Furthermore, deletion
of MuRF1 was shown to influence Akt/mTOR mediated signaling and protein synthesis (Baehr
et al., 2011; Hwee et al., 2011). Given the muscle sparing effects of MuRF1 deletion and the
possibility that MuRF1 has a role in the regulation of protein quality control, we examined
whether mice with a null deletion of MuRF1 demonstrated sparing of muscle mass and load-
induced growth as a consequence of aging.
Accepted Article
This article is protected by copyright. All rights reserved.
Sarcopenia is the age-related loss of muscle mass and function that occurs to a varying
extent in all individuals and can lead to frailty and a decrease in mobility and quality of life
(Janssen et al., 2002). A major factor believed to contribute to age-related muscle loss is a
change in protein turnover. The ubiquitin proteasome system (UPS) is a tightly regulated system
responsible for intracellular protein turnover, including the removal of short-lived normal
proteins as well as misfolded and dysfunctional proteins (Koga et al., 2011). The maintenance of
proteasome activity and subsequent protein turnover is believed to be necessary for proper
cellular function (Wong and Cuervo, 2010). For example, altered proteasome function and the
subsequent accumulation of ubiquitin-tagged proteins and protein aggregates have been
implicated in the pathology of several neurodegenerative diseases including Parkinson’s disease,
Alzheimer’s disease and Huntington’s disease (Riederer et al., 2011; Vernace et al., 2007). Like
other cell types, skeletal muscle fibers maintain a continual state of protein renewal through
dynamic rates of protein synthesis and degradation. The aging process has been associated with a
decrease in proteasome activity in several tissues including brain, liver, and cardiac muscle
however, in skeletal muscle controversy exists regarding whether proteasome activity is
increased, decreased or unchanged as a function of age (Koga et al., 2011; Low, 2011; Patterson
et al., 2007). A number of studies have reported a decrease in proteasome activity in skeletal
muscles with advanced age (Ferrington et al., 2005; Husom et al., 2004; Lee et al., 1999;
Strucksberg et al., 2010); however, others have reported an age-associated increase in
proteasome activity (Altun et al., 2010; Hepple et al., 2008). In the present study, we measured
the β1, β2 and β5 20S and 26S proteasome subunit activities in aged (24 month), but not
senescent WT and MuRF1 KO mice. Given our recent data showing that proteasome activity is
enhanced in the MuRF1 KO mice following denervation (Gomes et al., 2012), we hypothesized
Accepted Article
This article is protected by copyright. All rights reserved.
that with aging, deletion of MuRF1 would result in an elevated level of proteasome activity that
would be associated with muscle sparing.
The present study revealed a significant difference in the response of WT and MuRF1
KO mice to aging. Specifically, we found that the growth response to loading was impaired in
aged WT mice, but maintained in MuRF1 KO mice. Further, we found that muscle mass and
fiber cross-sectional area were maintained in the MuRF1 KO mice with advanced age. A major
finding was that both 20S and 26S proteasome activities decreased significantly with age in WT
mice. In contrast, the activities of the majority of the proteasome subunits in the old MuRF1 KO
mice were significantly higher than the activities measured in the old WT mice. Overall, the data
suggest that deletion of MuRF1 maintains protein quality control in skeletal muscle, leading to
reductions in endoplasmic reticulum and oxidative stress and the maintenance of muscle mass
and growth capacity.
Results
MuRF1 deletion spares muscle mass and fiber cross-sectional area and increases capillary
density with age.
Given that muscle mass is spared in MuRF1 KO mice following denervation and other atrophy-
inducing conditions, we examined whether MuRF1 KO mice were resistant to age-related
muscle loss. Skeletal muscle mass, fiber cross-sectional area and maximum isometric force were
similar in WT and MuRF1 KO mice up to the age of 18 months (Fig. 1, Table 1). At 24 months
of age, significant muscle atrophy occurred in WT mice as measured by a decrease in muscle
mass, fiber area and maximum isometric tension (Fig. 1, Table 1). In contrast, 24m KO mice had
no decrease in muscle mass or fiber cross-sectional area relative to young adult KO mice.
Unexpectedly, maximum isometric tension was significantly down in the 24m KO mice even
Accepted Article
This article is protected by copyright. All rights reserved.
though there was significant sparing of muscle mass. Moreover, the age-associated decrease in
tension output was greater in the KO than the WT mice (Suppl Fig. 1). Given that tension was
measured via direct nerve stimulation, the drop in tension output may reflect denervation or a
decrease in synaptic efficacy. Analysis of the isometric twitch revealed a slowing of both time-
to-peak tension and half relaxation time in both WT and KO mice (Suppl Table 1).
Another characteristic of aging muscle that was examined in WT and KO mice was capillary
density. Capillary density was not significantly different in WT and KO mice at 18m or
younger; however, at 24m capillary density significantly increased in the MuRF1 KO mice
resulting in a significant difference between KO and WT mice (Fig. 2A, Suppl Fig. 2).
Interestingly, expression of HIF-1α protein was significantly higher in KO than WT mice at both
18 and 24 months. Moreover, there was a significant increase in HIF-1α expression in KO mice
between 18 and 24 months (Fig. 2B).
MAFbx expression is elevated in MuRF1 KO, but not WT mice with aging.
The expression of select genes associated with denervation and aging was assessed in young
(6m) and old (24m) WT and KO mice (Fig. 2C). No significant changes were observed for
FOXO1 or MuRF1 expression with age. Embryonic myosin heavy chain, a gene associated with
inactivity and regeneration, was elevated significantly in both old WT and KO mice. MAFbx, a
muscle-specific E3 ligase associated with denervation and atrophy, significantly increased with
age in the KO, but not WT mice. Expression of CHIP, an ubiquitin ligase that promotes the
degradation of unfolded proteins, was slightly elevated in old KO (p=0.06), but not WT (p=0.11)
mice.
Accepted Article
This article is protected by copyright. All rights reserved.
The ubiquitin proteasome system is maintained in aged MuRF1 KO mice.
Accumulation of ubiquitinated and damaged proteins occurs in muscle with aging and has been
associated with a decrease in the UPS (Combaret et al., 2009). Here, we found that
polyubiquitinated proteins increased significantly in both WT and KO muscle as a function of
age, as assessed by western blot and ELISA (Fig. 3). Next, we measured the ATP-dependent
(26S) and ATP-independent (20S) activities of the catalytic subunits (β1, β2, β5) in the
gastrocnemius muscle of young (6m) and old (24m) WT and KO mice (Fig. 3C). In WT mice,
the activities of all 20S and 26S catalytic subunits, except for the 26S β2, significantly decreased
with age, accounting for the observed accumulation of polyubiquitinated proteins. For the
majority of subunits (4 of 6), proteolytic activity was significantly higher in the old KO than WT
mice.
To determine whether the change in proteasome subunit activity was related to alterations in the
amount of proteasome, western blots were performed for specific 19S (RPT6, RPT1) and 20S
(β5, PSMA6) proteasome subunits. No age-related changes were observed for any of the
subunits in WT or KO mice (Suppl Fig 3). Measurement of the inducible subunits β1i and β5i
did reveal age-related changes in both WT and KO mice. A significant increase in β1i
expression was measured in both WT and KO mice with age, while β5i expression significantly
increased only in WT mice with age. (Suppl Fig. 3). Expression of PA28α was greater in KO
than WT adult mice (9m), however, PA28α expression was similar in old (24m) WT and KO
mice due to a significant increase in expression in the WT mice from 9 to 24 months of age
(Suppl Fig 3).
Accepted Article
This article is protected by copyright. All rights reserved.
Oxidative and ER Stress are differentially regulated in WT and MuRF1 KO mice with age.
To determine whether there was an increase in oxidative stress with age, the level of oxidatively
modified proteins was measured in the gastrocnemius of young and old WT and KO mice (Fig.
4A). In young mice, the amount of oxidized proteins was significantly lower in MuRF1 KO than
WT mice. With age, however, the level of oxidized proteins significantly increased in the KO,
but not WT mice. Increases in oxidative stress have been associated with increases in calpain and
caspase-3 activities, which were subsequently measured in young and old mice (Fig. 4B, C)
(Nelson et al., 2012; Whidden et al., 2010). Calpain (I and II) activity was similar in WT and
KO mice at 6m, and significantly decreased in both WT and KO mice at 24m. In contrast,
caspase-3 activity was similar in WT and KO mice at 6m, but significantly increased at 24m in
the KO mice only. Interestingly, levels of the anti-apoptosis protein, Bcl-2, were significantly
higher in the KO mice at 24m (Fig 4D).
Endoplasmic reticulum (ER) stress, as measured by BiP, PDI and CHOP expression was also
examined as a function of age in the WT and KO mice (Fig. 5). Both of the adaptive stress
markers, BiP and PDI, increased significantly as a function of age (6m vs. 24m) in WT and KO
mice. In contrast, the maladaptive marker,CHOP, increased significantly at 24m in WT, but not
KO, mice.
The growth response to functional overload is blunted in aging WT, but not MuRF1 KO mice.
Aging not only results in a loss of muscle mass, but also anabolic resistance, i.e., the inability to
respond to growth cues. The growth response of skeletal muscle to increased mechanical loading
is attenuated in aging rodents as early as 18 month of age (Hwee and Bodine, 2009). Thus, we
examined the growth response of the plantaris muscle from young (6m) and older (18-20m) WT
Accepted Article
This article is protected by copyright. All rights reserved.
and MuRF1 KO mice to increase mechanical loading using the functional overload (FO) model.
At 18 month of age, WT and KO mice had similar muscle mass and demonstrated no age-related
muscle loss (Table 1). Following 14 days of overload, growth of the plantaris was similar in
young WT and KO mice (Fig 6A). In contrast, older WT mice showed a significant decrease in
the amount of growth relative to young mice (1.37 vs 1.83 fold), while older KO mice had a
growth response that was similar to the young mice (1.74 vs. 1.90 fold). To further examine the
dynamics of the growth response, we measured the response of older WT and KO mice to 7 and
14 days of overload. These experiments revealed that during the first 7 days of overload muscle
growth was similar in old WT and KO mice, however, between 7 and 14 days muscle growth
plateaued in the WT mice, while muscle growth continued in the KO mice (Fig. 6B).
Previous publications have shown that with age activation of the Akt/mTOR signaling pathway
is blunted leading to attenuated muscle hypertrophy in response to mechanical load (Hwee and
Bodine, 2009; Thomson and Gordon, 2006). In this study, we found that after 7 days of overload
activation of both PKB/Akt and S6K1 was significantly higher in KO compared to WT mice (Fig
6C, Suppl. Fig. 4).
In skeletal muscle, ER stress mediates anabolic resistance through PKB/Akt inhibition
(Deldicque et al., 2011). The accumulation of unfolded or misfolded proteins in the ER can occur
during periods of high rates of synthesis, as occur during functional overload (Zhang and
Kaufman, 2006). Examination of the expression of the adaptive and maladaptive ER stress
markers revealed a significant increase in ER stress in response to overload in both WT and KO
mice (Fig. 6D, E). Of particular interest was the finding that the maladaptive ER stress response,
Accepted Article
This article is protected by copyright. All rights reserved.
as denoted by CHOP levels, increased to a greater extent in both young and old WT compared to
KO mice following overload.
Discussion
Muscle Ring Finger-1 (MuRF1), a muscle specific E3 ubiquitin ligase, is an atrophy-associated
gene that is transcriptionally increased following denervation and disuse, two processes
associated with aging (Bodine et al., 2001). The extent to which MuRF1 is involved in the aging
process is controversial since both no change (Gaugler et al., 2011; Leger et al., 2008) and
increased (Clavel et al., 2006) expression of MuRF1 has been reported in aging muscle. A key
finding in this study was that the activities of both the 20S and 26S proteasomal subunits
decreased significantly with age in WT mice, but were maintained or decreased to a lesser extent
in the MuRF1 KO mice with age. Further, we demonstrate that the absence of MuRF1 results in
the maintenance of two properties shown to decrease with age, i.e. muscle mass and skeletal
muscle growth in response to increased loading, which suggests that MuRF1 expression plays an
important role in the regulation of skeletal muscle mass and function with age. These data are
contrary to prevailing theory that age-related loss of muscle mass is caused by an increase in the
ubiquitin proteasome system (Altun et al., 2010). Instead, these data suggest that a decrease in
proteasome activity with aging contributes to cellular dysfunction in skeletal muscle, as indicated
by an increase in ER stress. The current findings support the theory that maintaining or
increasing protein turnover decreases cellular dysfunction and is beneficial to maintaining
muscle mass during aging.
Accepted Article
This article is protected by copyright. All rights reserved.
The ubiquitin proteasome system and age-related muscle loss.
The UPS is responsible for the removal of short-lived, dysfunctional, and misfolded
proteins (Koga et al., 2011). Its role in protein turnover is critical for optimal cell performance,
as a decrease in proteasome activity has been shown to lead to an accumulation of protein
aggregates and overall cellular dysfunction (Wong and Cuervo, 2010). Increases in UPS activity
are implicated in a number of conditions that induce skeletal muscle atrophy and are believed to
play a role in age-related muscle loss (Combaret et al., 2009). Aging is a slow progressive
process that leads to decreases in skeletal muscle mass and strength; contributing to increases in
morbidity and mortality. Although it is generally accepted in other tissues that the UPS decreases
with aging, its activity in skeletal muscle with aging is less clear, as both increases (Altun et al.,
2010; Hepple et al., 2008) and decreases (Ferrington et al., 2005; Husom et al., 2004;
Strucksberg et al., 2010) in proteasome activity have been reported in aging muscle. The present
study measured the 20S and 26S proteasome activities of all three (β1, β2, β5) subunits in old
mice (24 months) on a C57Bl6 background and found a significant decrease in the activity in 5
of 6 of the subunits. In MuRF1 KO mice, the activity of 4 of these subunits and overall β5
activity was higher in the KO mice than the WT. The higher proteasome activities in the aged
MuRF1 KO versus WT mice could be playing a role in the observed maintenance of muscle
mass and fiber cross-sectional area with age. Recently, we reported that muscle sparing in the
MuRF1 KO mice following denervation was associated with an increase, not a decrease in
proteasome activity relative to WT mice (Gomes et al., 2012). The idea that elevated proteasome
activity is beneficial for cellular function is not new, and several recent studies have shown that
impairment of proteasome activity is harmful to muscle (Anvar et al., 2011). Recently, a
transgenic mouse was developed with decreased proteasome chymotrypsin-like (β5) activity and
Accepted Article
This article is protected by copyright. All rights reserved.
showed a shortened life span and a decrease in muscle mass (Haas et al., 2007; Tomaru et al.,
2012). Mice with a deletion of carboxyl terminus of HSP70-interacting protein (CHIP) also
demonstrate a shortened life span and accelerated loss of skeletal muscle mass, and
coincidentally have defects in protein quality control and an accelerated loss of chymotrypsin-
like (β5) activity with age (Min et al., 2008). Interestingly, we observed an increase in the
expression of CHIP, as well as MAFbx, in the aged KO mice.
The mechanism responsible for the elevated proteasome activity in the old MuRF1 KO is
unknown. One factor that could be contributing to the lack of inactivation of proteasome activity
in the MuRF1 KO mice with age is the increased MAFbx expression. In a previous study we
noted that in response to neural inactivity, the absence of MuRF1 results in sustained elevated
levels of MAFbx expression, suggesting that MuRF1 is involved in a feedback loop that controls
MAFbx expression (Gomes et al., 2012). Of relevance to the current study, was the finding that
following denervation, proteasome activity was higher in the MuRF1 KO compared to WT mice.
It is possible that the elevated proteasome activity in the old MuRF1 KO mice is linked to neural
inactivity. The mechanism by which MuRF1 deletion spares muscle mass under conditions of
inactivity may be related to an increased ability to decrease cellular stress and maintain global
protein synthesis.
The reciprocal UPS and ER Stress Relationship.
One potential consequence of diminished proteasome capacity is the accumulation of
misfolded or dysfunctional proteins that compromise endoplasmic reticulum associated protein
degradation (ERAD). The accumulation of misfolded or unfolded proteins in the endoplasmic
Accepted Article
This article is protected by copyright. All rights reserved.
reticulum can lead to ER stress and the unfolded protein response (Fu et al., 2008). The initial
ER stress response is adaptive yielding an increase in the protein folding capacity of the cell and
a decrease in protein translation. When the unfolded protein response fails, however, cells may
initiate a maladaptive response, i.e., apoptosis. We found that aged WT muscle had increased
BiP, a chaperone protein indicative of the adaptive ER stress response, and CHOP, a pro-
apoptotic marker of the maladaptive ER stress response. In contrast, in old MuRF1 KO muscle
BiP levels were high in the absence of changes in CHOP levels. Interestingly, we found an
increase in caspase-3 activity in the old KO mice. Classically, caspase-3 has been used as an
indicator of increases in apoptosis. However, in muscle, the elevated caspase-3 could be involved
in an increase in myofilament turnover (Du et al., 2004) and proteasome activation (Wang et al.,
2010), which is consistent with the elevated proteasome activity seen in the MuRF1 KO mice.
Our observed increase in the anti-apoptosis marker Bcl-2 in the MuRF1 KO mice with age could
suggest a mechanism to protect the muscle from the apoptotic affects of increased caspase-3.
Overall, the data suggest that deletion of MuRF1 results in reduced levels of cellular
stress. In young mice the amount of oxidized proteins was significantly lower in MuRF1 KO
mice than WT mice. With age, ER stress increased in the WT mice without an apparent increase
in the amount of oxidized proteins. In contrast, the amount of oxidized proteins significantly
increased in the MuRF1 KO mice with age, without an increase in the maladaptive ER stress
response but an increase in the adaptive ER stress response. The elevated oxidative stress in the
MuRF1 KO mice could be the result of denervation (discussed below), however, it appears that
the MuRF1 KO mice are capable of increasing anti-oxidant defenses that protect the muscle from
atrophy. Increases in HIF-1α, caspase-3, and Bcl-2 expression and proteasome activity in the
Accepted Article
This article is protected by copyright. All rights reserved.
old MuRF1 KO mice could all be playing a role in reducing ER stress and protecting the muscle
from atrophy.
MuRF1 Expression and Age-Associated Loss of Muscle Mass.
The loss of MuRF1 expression results in muscle sparing under a number of atrophy
inducing condition, including denervation (Baehr et al., 2011; Gomes et al., 2012). The present
results reveal that the deletion of MuRF1 also has a positive impact on the aging process
resulting in the sparing of muscle mass and the retention of the growth response. Aging is
associated with anabolic resistance, i.e., the loss of the ability to increase muscle mass in
response to anabolic signals such as increased loading, which is attributed to a decrease in the
activation of mTORC1-mediated signaling and protein translation. The retention of the load-
induced growth response in the MuRF1 KO mice was associated with less ER stress and greater
activation of PKB/Akt and S6K1, a downstream target of mTORC1, relative to WT mice and
suggests that there was greater activation of protein translation in the old MuRF1 KO compared
to WT mice. The attenuation of load-induced growth occurs with aging (Hwee and Bodine,
2009) and diet-induced obesity (Sitnick et al., 2009), and is related to a decrease or delay in the
activation of Akt and mTORC1-signaling. In mice, S6K1 activation peaks at around 7 days
following functional overload in young mice, however, in the present study we observed a
reduced and delayed activation of S6K1 in the old WT mice and normal activation of S6K1 in
the old MuRF1 KO mice. The pattern of Akt and S6K1 activation observed in the old WT mice
following FO is consistent with previously observations in old rats and DIO mice, which have a
reduced load-induced growth response (Hwee and Bodine, 2009; Sitnick et al., 2009). Our data
suggest that deletion of MuRF1 leads to less cellular stress and the ability to maintain a net
Accepted Article
This article is protected by copyright. All rights reserved.
positive protein balance in aged animals in response to increased loading. Previous data have
demonstrated that elevated ER Stress can inhibit the Akt/mTORC1 signaling and protein
translation in skeletal muscle (Deldicque et al., 2011). Additional experiments are required to
directly test the hypothesis that the ability to induce a normal growth response in muscle from
old MuRF1 KO mice is related to a reduced level of ER stress , leading to greater activation of
protein translation.
MuRF1 and the Neuromuscular Junction
One perplexing finding is the fact that muscle force output, as measured in situ through
stimulation of the nerve, was significantly less in the old MuRF1 KO mice relative to the old WT
mice. At 18 months of age, the maximum isometric force output of the WT and KO mice is
similar, however, by 24 months force output is diminished in both the WT and KO mice with a
greater decrease in the KO than WT mice. These data might suggest a greater loss of
myofilament proteins in the KO relative to the WT mice, however, the fiber CSA was higher in
the MuRF1 animals and the relative amount of myosin heavy chain and actin were similar in the
old MuRF1 and WT KO mice (data not shown). Another explanation could be that there is more
denervation or synaptic instability in the old MuRF1 KO mice compared to the WT mice.
Synaptic remodeling occurs as early as 18 months of age in C57BL6 mice as neuromuscular
junctions begin to lose innervation and either become reinnervated or remain denervated (Valdez
et al., 2010). We have observed that following denervation in the MuRF1 KO mice, there is a
decrease in expression of myogenin and acetylcholine receptor subunits (manuscript in
submission). The suppression of various activity-associated genes could stabilize the
neuromuscular junction and inhibit reinnervation in the MuRF1 KO mice during this time of
Accepted Article
This article is protected by copyright. All rights reserved.
motoneuron loss and synapse remodeling. Interestingly, a recent paper reports that MuRF1
controls the turnover of the acetylcholine receptor (AChR) (Rudolf et al., 2012). Under normal
fully innervated conditions, no difference was found in the turnover of the AChR in WT and
MuRF1 KO mice, however, following denervation, turnover of the AChR was significantly
higher in the WT compared to the KO mice. Our observations in aging MuRF1 KO mice suggest
that a lack of synaptic remodeling may suppress reinnervation resulting in chronically denervated
muscle fibers, however, this theory requires further investigation.
In conclusion, the deletion of the MuRF1 gene and protein expression is beneficial to
muscle during aging. The mechanism of action appears to be through the maintenance of protein
quality control and suppression of cellular stress. These data highlight the need for additional
efforts to identify the in vivo substrates of MuRF1 in skeletal muscle and to determine the
mechanism by which MuRF1 functions to reduce cellular stress and maintain muscle mass and
growth capacity
Experimental Procedures
Animals. The generation of mice with a null deletion of MuRF1 has been previously described
(Bodine et al., 2001). Homozygous knockout (KO) and wild type (WT) mice were obtained by
intercrossing heterozygous MuRF1 mice. A total of 78 male mice, ranging in age from 6 to 24
months were used in this study. Mice were kept under a 12h light-dark cycle and were fed
standard diets. The Institutional Animal Care and Use Committee at the University of California,
Davis approved all animal protocols used in this study.
Accepted Article
This article is protected by copyright. All rights reserved.
Functional Overload Model. The plantaris muscle in both legs was overloaded by the surgical
removal of its major synergists: the soleus and medial and lateral gastrocnemius muscles.
Animals were anesthetized with isoflurane gas and prepared for surgery using aseptic
procedures. Mice were given buprenorphine post surgery for pain and monitored on a daily basis
until the muscles were removed 7-14 days post surgery.
Histology. The gastrocnemius complex (soleus, medial and lateral gastrocnemius, plantaris) was
excised, cleaned, pinned to corkboard, and frozen in melting isopentane. Serial cross-sections
(10 µm) were stained with hematoxylin and eosin for evaluation of general histology, anti-
laminin (Sigma 1:1000) for the measurement of fiber cross-sectional area, and CD31 for the
measurement of capillary density. Digital images were taken under 200x total magnification and
analyzed by Axiovision software (Zeiss). For each muscle, six nonoverlapping regions of the
triceps surae complex were analyzed (~600 fibers/ muscle sections).
RNA isolation and quantitative PCR. Total RNA was isolated from mechanically homogenized
muscle in 1ml of Trizol reagent. All centrifuge steps were performed at 12,000 rpm at 4˚C.
Homogenized samples were centrifuged for 15 minutes, and the resulting top aqueous layer was
transferred to a microcentrifuge tube containing 200 μl of chloroform. After a 15 min incubation
period, the samples were centrifuged for 15 minutes. The top aqueous layer was added to 0.5 ml
of isopropyl alcohol, mixed well, and centrifuged for 10 min. The RNA pellet was washed with
75% ethanol, air-dried, and resuspended in DEPC water for RT-PCR analysis. cDNA was made
using a Quantitect Reverse Transcription Kit
(Qiagen, Valencia, CA). The resulting cDNA was
analyzed by quantitative PCR with unlabeled primers in SYBR Green PCR Master Mix (Applied
Accepted Article
This article is protected by copyright. All rights reserved.
Biosystems, Foster City, CA) for 40 cycles at an annealing temperature of 59˚C. Each sample
was run in triplicate. The following primer sequences were used in this study: MuRF1: 5’-
GCTGGTGGAAAACATCATTGACAT-3’ and 5’-CATCGGGTGGCTGCCTTT-3’; MAFbx:
5’-GACTGGACTTCTCGACTGCC-3’ and 5’-TCAGGGATGTGAGCTGTGAC-3’; FOXO1:
5’-AAGAGCGTGCCCTACTTCAA-3’ and 5’-TGCTGTGAAGGGACAGATTG-3’; eMHC: 5'-
ACT TCA CCT CTA GCC GGA TG-3' and 5'-ATT GTC AGG AGC CAC GAA A-3' ; Rpl39:
5’CAAAATCGCCCTATTCCTCA3’and 5’
AGACCCAGCTTCGTTCTCCT3’.
Western Blots. Muscle tissue was homogenized in sucrose lysis buffer. 10-20 μg were prepared
in Laemmli sample loading buffer, separated by SDS-page, and transferred to a polyvinylidene
diflouride membrane. Equal loading was verified by ponceau stain. The membranes were
incubated overnight at 4˚C in 1X Tris-buffered saline-Tween (TBST) with the appropriate
antibodies: Following three rinses in 1x TBST, membranes were incubated with corresponding
secondary antibodies (Vector and Pierce). After three additional washes, membranes were
visualized with chemiluminiscent substrate (Millipore). Protein Oxidation was measured using
the OxiSelect™ Protein Carbonyl Immunoblot Kit according to the manufacturer’s instructions,
except a 1:2000 dilution was made for the Anti-DNP antibody instead of the recommended
1:1000 (Cell Biolabs). A total of 10 μg of protein was loaded onto a 10% SDS-PAGE gel.
Immobilon Western Chemiluminescent HRP substrate (Millipore) was used to detect the
oxidized proteins. Image acquisition and band quantification was performed using the
ChemiDoc™ MP System and Image Lab 4.1 software (Biorad). The following antibodies were
used in this study: Actin (0.5 ng/mL, Sigma), anti-polyubiquitin (1:2000, FK1, Biomol), PA28α
Accepted Article
This article is protected by copyright. All rights reserved.
(1:1000, Biomol), β1i (1:1000, Biomol), RPT6 and β5i (1:1000, commercially made and affinity
purified by 21
st
Century Biochemicals), β5 (1:1250, Biomol), PSMA6 (1:1000, Epitomics),
RPT1 (1:1000, Enzo Life Sciences), HIF-1α (1:500, Santa Cruz), total S6K1 (1:1000, Santa
Cruz),and BiP (1:1000, BD Biosciences). CHOP (1:1000), PDI (1:1000), phospho S6K1
(1:1000), phospho and total AKT (1:1000), Bcl2 (1:1000) and B-actin (1:5000) were obtained
from Cell Signaling.
ELISA-based measurements of polyubiquitated proteins. Muscle homogenate (1 µg) was
incubated overnight at 4˚C to optimize binding to the bottom of 96-well ELISA plates (Santa
Cruz Biotech). Samples were incubated in blocking buffer (1% BSA/1x PBST), rinsed three
times in 1x PBS and incubated with anti-polyubiquitin (1:2000, FK1, Biomol). Following three
rinses in 1x PBST, secondary antibody conjugated to horseradish peroxidase (HRP) was added.
TMB substrate was added to initiate a color change reaction proportional to HRP activity, and
2.5M sulfuric acid was added to stop the reaction. The quantification of polyubiquinated proteins
was measured spectrophotometrically at a wavelength of 450 nm. Absorbance values for wells
containing 1% BSA were used as background controls. The specificity of the polyubiquitin
antibody was validated with purified ubiquitin and a penta-ubiquitinated chain (Biomol) (Hwee
et al., 2011).
Proteasome Activity. 20S and 26S proteasome activity assays were performed as previously
described (Gomes et al., 2006). All assays were carried out in a total volume of 100μl in 96-well
opaque plates. The final composition of the 20S assay buffer was 250 mM HEPES, 5mM EDTA,
and 0.03% SDS (pH 7.5). The final composition of the 26S assay buffer was 50 mM Tris, 1 mM
EDTA, 150 mM NaCl, 5 mM MgCl
2
, 50 μM ATP, and 0.5 mM dithiothreitol (pH 7.5).
Powdered muscle was homogenized by a dounce tissue grinder in 26S buffer. Samples were
Accepted Article
This article is protected by copyright. All rights reserved.
centrifuged for 30 minutes at 12,000g. The resulting supernatant was used to assess proteasome
activity. The individual caspase-like (β1), trypsin-like (β2), and chymotrypsin-like (β5) activity
of the 20S and 26S proteasome were measured by calculating the difference
between
fluorescence units recorded with or without
the specific inhibitors in the reaction medium. β1
was initiated by the addition of 10 μl of 1mM Z-Leu-Leu-Glu-7-AMC (Peptides Int ); β2 by 10
μl of 1 mM Boc-Leu-Ser-Thr-Arg-7- amido-4-methylcoumarin (Bachem); and β5 by 10 μl of
1mM of succinyl-Leu-Leu-Val-Tyr-7-amido-4-methylcoumarin (LLVY-AMC) (Bachem). The
β1, β2, and β5 subunit assays were conducted in the absence and presence of their respective
inhibitors: 40 nM Z-Pro-Nle-Asp-al (Biomol), 40 μM Epoxomicin, and 10 μM epoxomicin
(Peptides Int.). These substrates were cleaved by the proteasome subunits releasing free AMC.
Released AMC was measured using a Fluoroskan Ascent fluorometer (Thermo Electron) at an
excitation wavelength of 390 nm and an emission wavelength of 460 nm. Fluorescence was
measured at 15-minute intervals for 2 hours. All assays were linear in this range and each sample
was assayed in quadruplicate.
Caspase-3 Activity. Caspase-3 activity was measured fluorometrically in 96-well opaque plates.
50 µg of protein supernatant was added to an assay buffer containing 100 mM HEPES, 0.2%
CHAPS, 200mM NaCl, 2mM EDTA, 20% glycerol (v/v), fresh 20 mM dithiothreitol (pH 7.4).
Caspase activation was initiated by the addition of 100 μM of caspase-3 substrate
Ac-DEVD-AMC (Biomol). This substrate is cleaved by caspase-3, releasing free AMC which is
detected fluorometrically by a Fluoroskan Ascent fluorometer (Thermo Electron) at an excitation
wavelength of 390 nm and an emission wavelength of 460 nm. Caspase-3 activity was measured
by calculating the difference
between fluorescence units recorded with or without
caspase
Accepted Article
This article is protected by copyright. All rights reserved.
inhibitor 10 μM Ac-DEVD-CHO (Biomol). Fluorescence was measured at 15-minute intervals
for 2 hours. All assays were linear in this range and each sample was assayed in quadruplicate.
Activity is expressed as mean ± S.E.M.
Calpain Activity. Calpain activity was measured fluorometrically in 96-well opaque plates. 50
µg of protein supernatant was added to an assay buffer containing 50 mM Tris, 1 mM EDTA, 10
mM CaCl
2
, 150 mM NaCl, and fresh 0.5 mM dithiothreitol (pH 7.4). Calpain activity was
initiated by the addition of 200 μM of substrate LLVY-AMC (Bachem). This substrate is cleaved
by calpain, releasing free AMC which is detected fluorometrically by a Fluoroskan Ascent
fluorometer (Thermo Electron) at an excitation wavelength of 390 nm and an emission
wavelength of 460 nm. Calpain activity was measured by calculating the difference
between
fluorescence units recorded in the presence and absence of 50 µM calpain inhibitor IV
(Calbiochem). Fluorescence was measured at 15-minute intervals for 2 hours. All assays were
linear in this range and each sample was assayed in quadruplicate. Activity is expressed as mean
± S.E.M. This assay measures both calpain I and II activity.
Statistical analysis. Two-way ANOVA was performed to access the effect of age and genotype
using Sigma Stat 3.1 (Systat Software, San Jose, CA). Tukey’s post hoc analysis was used to
determine differences when interactions existed. A one-way ANOVA was performed to
determine significance in cases where only one independent variable (age or genotype) was
being examined. Results are expressed as mean ± S.E.M., with significance set as p < 0.05.
Acknowledgements:
This research was supported by grants from the Muscular Dystrophy Association and the
National Institutes of Health (DK75801). Partial support for DTH was provided by HHMI-
IMBS56006769 and T32HL086350 training fellowships.
Accepted Article
This article is protected by copyright. All rights reserved.
References
Altun, M., Besche, H.C., Overkleeft, H.S., Piccirillo, R., Edelmann, M.J., Kessler, B.M.,
Goldberg, A.L., and Ulfhake, B. (2010). Muscle wasting in aged, sarcopenic rats is associated
with enhanced activity of the ubiquitin proteasome pathway. The Journal of biological chemistry
285, 39597-39608.
Anvar, S.Y., t Hoen, P.A., Venema, A., van der Sluijs, B., van Engelen, B., Snoeck, M., Vissing,
J., Trollet, C., Dickson, G., Chartier, A., et al. (2011). Deregulation of the ubiquitin-proteasome
system is the predominant molecular pathology in OPMD animal models and patients. Skeletal
muscle 1, 15.
Baehr, L.M., Furlow, J.D., and Bodine, S.C. (2011). Muscle Sparing in Muscle RING Finger 1
Null Mice: Response to Synthetic Glucocorticoids. The Journal of physiology. 589, 4759-4776.
Bodine, S.C., Latres, E., Baumhueter, S., Lai, V.K., Nunez, L., Clarke, B.A., Poueymirou, W.T.,
Panaro, F.J., Na, E., Dharmarajan, K., et al. (2001). Identification of ubiquitin ligases required
for skeletal muscle atrophy. Science 294, 1704-1708.
Clavel, S., Coldefy, A.S., Kurkdjian, E., Salles, J., Margaritis, I., and Derijard, B. (2006).
Atrophy-related ubiquitin ligases, atrogin-1 and MuRF1 are up-regulated in aged rat Tibialis
Anterior muscle. Mechanisms of ageing and development 127, 794-801.
Combaret, L., Dardevet, D., Bechet, D., Taillandier, D., Mosoni, L., and Attaix, D. (2009).
Skeletal muscle proteolysis in aging. Curr Opin Clin Nutr Metab Care 12, 37-41.
Deldicque, L., Bertrand, L., Patton, A., Francaux, M., and Baar, K. (2011). ER stress induces
anabolic resistance in muscle cells through PKB-induced blockade of mTORC1. PloS one 6,
e20993.
Du, J., Wang, X., Miereles, C., Bailey, J.L., Debigare, R., Zheng, B., Price, S.R., and Mitch,
W.E. (2004). Activation of caspase-3 is an initial step triggering accelerated muscle proteolysis
in catabolic conditions. The Journal of clinical investigation 113, 115-123.
Ferrington, D.A., Husom, A.D., and Thompson, L.V. (2005). Altered proteasome structure,
function, and oxidation in aged muscle. FASEB journal : official publication of the Federation of
American Societies for Experimental Biology 19, 644-646.
Fu, H.Y., Minamino, T., Tsukamoto, O., Sawada, T., Asai, M., Kato, H., Asano, Y., Fujita, M.,
Takashima, S., Hori, M., et al. (2008). Overexpression of endoplasmic reticulum-resident
chaperone attenuates cardiomyocyte death induced by proteasome inhibition. Cardiovasc Res 79,
600-610.
Accepted Article
This article is protected by copyright. All rights reserved.
Gaugler, M., Brown, A., Merrell, E., Disanto-Rose, M., Rathmacher, J.A., and Reynolds, T.H.t.
(2011). PKB Signaling and Atrogene Expression in Skeletal Muscle of Aged Mice. J Appl
Physiol. 111, 192-199.
Gomes, A.V., Waddell, D.S., Siu, R., Stein, M., Dewey, S., Furlow, J.D., and Bodine, S.C.
(2012). Upregulation of proteasome activity in muscle RING finger 1-null mice following
denervation. FASEB journal : official publication of the Federation of American Societies for
Experimental Biology 26, 2986-2999.
Gomes, A.V., Zong, C., Edmondson, R.D., Li, X., Stefani, E., Zhang, J., Jones, R.C.,
Thyparambil, S., Wang, G.W., Qiao, X., et al. (2006). Mapping the murine cardiac 26S
proteasome complexes. Circ Res 99, 362-371.
Haas, K.F., Woodruff, E., 3rd, and Broadie, K. (2007). Proteasome function is required to
maintain muscle cellular architecture. Biology of the cell / under the auspices of the European
Cell Biology Organization 99, 615-626.
Hepple, R.T., Qin, M., Nakamoto, H., and Goto, S. (2008). Caloric restriction optimizes the
proteasome pathway with aging in rat plantaris muscle: implications for sarcopenia. American
journal of physiology Regulatory, integrative and comparative physiology 295, R1231-1237.
Husom, A.D., Peters, E.A., Kolling, E.A., Fugere, N.A., Thompson, L.V., and Ferrington, D.A.
(2004). Altered proteasome function and subunit composition in aged muscle. Archives of
biochemistry and biophysics 421, 67-76.
Hwee, D.T., and Bodine, S.C. (2009). Age-related deficit in load-induced skeletal muscle
growth. The journals of gerontology Series A, Biological sciences and medical sciences 64, 618-
628.
Hwee, D.T., Gomes, A.V., and Bodine, S.C. (2011). Cardiac Proteasome Activity in Muscle
Ring Finger-1 Null Mice at Rest and Following Synthetic Glucocorticoid Treatment. Am J
Physiol Endocrinol Metab. 301, E967-E977.
Janssen, I., Heymsfield, S.B., and Ross, R. (2002). Low relative skeletal muscle mass
(sarcopenia) in older persons is associated with functional impairment and physical disability. J
Am Geriatr Soc 50, 889-896.
Koga, H., Kaushik, S., and Cuervo, A.M. (2011). Protein homeostasis and aging: The importance
of exquisite quality control. Ageing research reviews 10, 205-215.
Labeit, S., Kohl, C.H., Witt, C.C., Labeit, D., Jung, J., and Granzier, H. (2010). Modulation of
muscle atrophy, fatigue and MLC phosphorylation by MuRF1 as indicated by hindlimb
suspension studies on MuRF1-KO mice. Journal of biomedicine & biotechnology 2010, 693741.
Lee, C.K., Klopp, R.G., Weindruch, R., and Prolla, T.A. (1999). Gene expression profile of
aging and its retardation by caloric restriction. Science 285, 1390-1393.
Accepted Article
This article is protected by copyright. All rights reserved.
Leger, B., Derave, W., De Bock, K., Hespel, P., and Russell, A.P. (2008). Human sarcopenia
reveals an increase in SOCS-3 and myostatin and a reduced efficiency of Akt phosphorylation.
Rejuvenation research 11, 163-175B.
Low, P. (2011). The role of ubiquitin-proteasome system in ageing. Gen Comp Endocrinol 172,
39-43.
Min, J.N., Whaley, R.A., Sharpless, N.E., Lockyer, P., Portbury, A.L., and Patterson, C. (2008).
CHIP deficiency decreases longevity, with accelerated aging phenotypes accompanied by altered
protein quality control. Molecular and cellular biology 28, 4018-4025.
Nelson, W.B., Smuder, A.J., Hudson, M.B., Talbert, E.E., and Powers, S.K. (2012). Cross-talk
between the calpain and caspase-3 proteolytic systems in the diaphragm during prolonged
mechanical ventilation. Critical care medicine 40, 1857-1863.
Patterson, C., Ike, C., Willis, P.W.t., Stouffer, G.A., and Willis, M.S. (2007). The bitter end: the
ubiquitin-proteasome system and cardiac dysfunction. Circulation 115, 1456-1463.
Riederer, B.M., Leuba, G., Vernay, A., and Riederer, I.M. (2011). The role of the ubiquitin
proteasome system in Alzheimer's disease. Exp Biol Med (Maywood) 236, 268-276.
Rudolf, R., Bogomolovas, J., Strack, S., Choi, K.R., Khan, M.M., Wagner, A., Brohm, K.,
Hanashima, A., Gasch, A., Labeit, D., et al. (2012). Regulation of nicotinic acetylcholine
receptor turnover by MuRF1 connects muscle activity to endo/lysosomal and atrophy pathways.
Age (Dordr).
Sitnick, M., Bodine, S.C., and Rutledge, J.C. (2009). Chronic high fat feeding attenuates load-
induced hypertrophy in mice. The Journal of physiology 587, 5753-5765.
Strucksberg, K.H., Tangavelou, K., Schroder, R., and Clemen, C.S. (2010). Proteasomal activity
in skeletal muscle: a matter of assay design, muscle type, and age. Analytical biochemistry 399,
225-229.
Thomson, D.M., and Gordon, S.E. (2006). Impaired overload-induced muscle growth is
associated with diminished translational signalling in aged rat fast-twitch skeletal muscle. The
Journal of physiology 574, 291-305.
Tomaru, U., Takahashi, S., Ishizu, A., Miyatake, Y., Gohda, A., Suzuki, S., Ono, A., Ohara, J.,
Baba, T., Murata, S., et al. (2012). Decreased proteasomal activity causes age-related phenotypes
and promotes the development of metabolic abnormalities. The American journal of pathology
180, 963-972.
Valdez, G., Tapia, J.C., Kang, H., Clemenson, G.D., Jr., Gage, F.H., Lichtman, J.W., and Sanes,
J.R. (2010). Attenuation of age-related changes in mouse neuromuscular synapses by caloric
restriction and exercise. Proceedings of the National Academy of Sciences of the United States
of America 107, 14863-14868.
Accepted Article
This article is protected by copyright. All rights reserved.
Vernace, V.A., Schmidt-Glenewinkel, T., and Figueiredo-Pereira, M.E. (2007). Aging and
regulated protein degradation: who has the UPPer hand? Aging cell 6, 599-606.
Wang, X.H., Zhang, L., Mitch, W.E., LeDoux, J.M., Hu, J., and Du, J. (2010). Caspase-3 cleaves
specific 19 S proteasome subunits in skeletal muscle stimulating proteasome activity. The
Journal of biological chemistry 285, 21249-21257.
Whidden, M.A., Smuder, A.J., Wu, M., Hudson, M.B., Nelson, W.B., and Powers, S.K. (2010).
Oxidative stress is required for mechanical ventilation-induced protease activation in the
diaphragm. J Appl Physiol 108, 1376-1382.
Wong, E., and Cuervo, A.M. (2010). Integration of clearance mechanisms: the proteasome and
autophagy. Cold Spring Harb Perspect Biol 2, a006734.
Zhang, K., and Kaufman, R.J. (2006). Protein folding in the endoplasmic reticulum and the
unfolded protein response. Handb Exp Pharmacol, 69-91.
Table 1
Body Weight and Muscle Mass of WT and MuRF1 KO animals
BW (g) Heart (g) TA (g) GA complex (g)
6m WT 31.9 ± 1.8 0.144 ± .006 0.054 ± .002 0.183 ± .007
6m KO 35.7 ± 2.1 0.175 ± .005* 0.056 ± .002 0.193 ± .004
12m WT 35.4 ± 1.4 0.158 ± .004
α
0.058 ± .001 0.192 ± .003
12m KO 32.0 ± 1.1 0.210 ± .003
*
, #
0.056 ± .001 0.199 ± .003
18m WT 36.7 ± 3.7 0.168 ± .007 0.173 ± .003
18m KO 36.2 ± 2.0 0.208 ± .004 0.181 ± .005
24m WT 36.4 ± 0.8 0.179 ± .005
#
0.051 ± .002 0.159 ± .006
#
24m KO 39.1 ± 1.3 0.247 ± .008
*
,#
0.055 ± .001 0.184 ± .004*
Body weight (BW) , heart and hindlimb skeletal muscle (tibialis anterior (TA), gastrocnemius
(GA) complex (medial and laterial gastrocnemius, soleus, and plantaris) masses (wet weight)
from WT and MuRF1 KO male mice at 6, 12, 18 and 24 months of age. Values are
expressed as mean ± SEM. A two-way ANOVA was performed with Tukey’s post hoc
analysis. Statistical significance was set at p<0.05; * indicates significant difference between
WT and KO mice at a specific age; # indicates significance difference between ages within a
specific genotype.
Accepted Article
This article is protected by copyright. All rights reserved.
Figure Legends
Figure 1: Maintenance of muscle mass in MuRF1 KO mice with aging. (A) Representative
laminin-stained sections from 18 and 24 month old WT and MuRF1 KO mice. (B) Average fiber
cross-sectional area of the gastrocnemius muscle (medial and lateral heads) of WT (black) and
MuRF1 KO (white) at 18 and 24 months. (C) In situ isometric contractile force measurements of
the gastrocnemius muscle of WT and MuRF1 KO mice at 8 (black), 18 (blue) and 24 (red)
months of age. Data are mean ± SEM, n 5 mice per group. Statistical significance was set at
p<0.05 and determine using a two-way ANOVA for CSA and one-way ANOVA for force
output.
Figure 2: Capillary Density and Differential Gene Expression in WT and MuRF1 KO mice with
age. (A) Capillary density, measured as the number of capillaries per muscle fiber, was
determined in the medial and lateral gastrocnemius muscle from CD31 stained cross-sections in
18 and 24 month old WT (black) and KO (white) mice. (B) Representative western blot of HIF-
1α from homogenates of the gastrocnemius complex taken from young adult (9m) and old (24m)
WT and MuRF1 KO mice. Means ± SEM (n=4 per group) are expressed as a fold change
relative to the 9m WT mean. (C) The mRNA expression levels of selected genes were
determined from homogenates of the gastrocnemius complex of young (6m) and old (24m) WT
and MuRF1 KO mice. Means (±SEM, n4 per group) are expressed as a fold change relative to
the 6m WT mean. Statistical significance was set at p<0.05 and determined using a two-way
ANOVA.
Figure 3: Higher levels of proteasome activity in MuRF1 KO mice relative to WT with aging.
(A) Western blots of lysates from the gastrocnemius complex of young (6m, n=3) and old (24m,
n=4) WT and MuRF1 KO mice. Polyubiquitinated proteins were determined by immunoblotting
with an anti-ubiquitin antibody (FK1). (B) Polyubiquitin levels were quantified by ELISA in 6m
and 24 m old wild type (black) and MuRF1 KO (white). Data are mean ± SEM for n=4-5 per
group. (C) ATP-dependent (26S) and ATP-independent (20S) proteasome activities in lysates
from the gastrocnemius complex of WT (black) and MuRF1 KO (white) mice at 6 and 24
months. Individual subunit activities are shown for: β1, caspase-like activity; β2, trypsin-like
activity; and β5, chymotrypsin-like activity. Data are mean ± SEM, n=4 mice per group.
Statistical significance was set at p<0.05 and determined using a two-way ANOVA. * indicates
Accepted Article
This article is protected by copyright. All rights reserved.
significant difference between young and old within a specific genotype, # indicates significant
difference between WT and KO mice at a given age.
Figure 4: Oxidative stress in WT and KO mice. (A) Oxidized proteins were measured in the
gastrocnemius muscle of young (6m) and old (24m) WT (black) and KO (white) mice using the
OxiSelect™ Protein Carbonyl Immunoblot Kit. Data are mean ±SEM, n=3-4 mice. Calpain (B)
and Caspase-3 (C) activity were measured in the gastrocnemius of WT (black) and KO (white)
mice. Means ± SEM are expressed as a percent of 6m WT mean. (D) Western blot of Bcl-2
from homogenates of the gastrocnemius taken from young adult (9m) and old (24m) WT and
MuRF1 KO mice. Means ± SEM (n=3 per group) are expressed as a fold change relative to the
6m WT mean. Statistical significance was set at p<0.05 and determined using a two-way
ANOVA.
Figure 5: Markers of endoplasmic reticulum (ER) stress are elevated in old WT, but not MuRF1
KO mice. Representative western blots of ER stress markers (BiP, PDI, and CHOP) from
homogenates of the gastrocnemius taken from young adult (6m) and old (24m) WT and MuRF1
KO mice. Means ± SEM (n=4 per group) are expressed as a fold change relative to the 6m WT
mean. Statistical significance was set at p<0.05 and determined using a two-way ANOVA.
Figure 6: Load-induced growth is maintained in older MuRF1 KO mice compared to WT mice.
(A) Growth of the plantaris muscle (fold change relative to control, mean ± SEM, n=5) following
14 days of functional overload (FO) in young (6m) and older (18-20m) WT (black) and MuRF1
KO (white) mice. (B) Growth of the plantaris muscle (wet weight in grams) following 7 and 14
days of FO in 18-20 month old WT (solid) and MuRF1 KO (dashed) mice. (C) Representative
western blots (n=2) and quantification (n=4) of the phosphorylation levels of Akt and S6K1 in
the plantaris muscle of old (18-20 m) WT and KO mice following no treatment (Con, black) and
FO for 7 (hatched) and 14 (white) days. (D) Representative western blot (n=3) and quantification
(n=5) of CHOP protein levels in the plantaris of young WT and MuRF1 KO mice following no
treatment (Con, black) and 14 days of FO (white). (E) Representative western blot (n=2) and
quantification (n=4) of BiP and CHOP protein levels in the plantaris of older (18 m) WT and
MuRF1 KO mice following no treatment (Con, black) and FO for 7 (hatched) and 14 days
(white). Data are expressed as a fold change relative to WT control (mean ± SEM). Statistical
significance was set at p<0.05 and determined using a two-way ANOVA for growth and a one-
way ANOVA for protein expression.
Accepted Article
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
    • "One explanation for this may be the energetic defects seen in the MuRF1 Tg+ mice, such as decreased creatine kinase activity and altered fatty acid oxidation (Rodriguez et al. 2015, Willis et al. 2009b). Conversely, the enhanced MuRF1 -/-function seen with T3 stimulation (Fig. 8A ) may reflect an athletic phenotype previously identified in the MuRF1 -/-hearts that may be related (Hwee et al. 2014), but not fully due to enhanced T3 activity resulting from decreased ubiquitination. This study may offer several clinically relevant insights into approaches to treating heart failure. "
    [Show abstract] [Hide abstract] ABSTRACT: Thyroid hormone (T3) is classically recognized for its role in cellular metabolism and growth and participates in homeostasis of the heart. T3 activates pro-survival pathways including Akt and mTOR. Treatment with T3 following myocardial infarction is cardioprotective and promotes elements of the physiological hypertrophic response following cardiac injury. While T3 is known to benefit the heart, very little about how it is regulated at the molecular level has been described to date. The ubiquitin proteasome system (UPS) regulates nuclear hormone receptors such as the estrogen, progesterone, androgen, and glucocorticoid receptors by both degradation and by non-degradatory mechanisms. However, how the UPS regulates the T3-mediated activity is not well understood. In the present study, we sought to determine the role of the muscle specific ubiquitin ligase Muscle Ring Finger-1 (MuRF1), in regulating T3 induced cardiomyocyte growth. Increasing MuRF1 inhibits T3-induced physiological cardiac hypertrophy, while decreasing MuRF1 enhances its activity both in vitro and in cardiomoycytes in vivo. MuRF1 interacts directly with TRα to inhibit is activity by post-translationally ubiquitinating it in a non-canonical manner. We then demonstrated that a nuclear localization apparatus that regulates/inhibits nuclear receptors by sequestering them within a subcompartment of the nucleus was necessary for MuRF1 to have its inhibitory T3 activity. This work implicates a novel mechanism that enhances the beneficial T3 activity within the heart specifically, thereby offering a potential target to enhance cardiac T3 activity in an organ specific manner.
    Full-text · Article · Feb 2016
    • "An alternative interpretation argues that atrogenes and the ubiquitin–proteasome system (UPS) are activated to remove damaged proteins that accumulate as toxic aggregates in atrophying muscle. In fact, mice lacking MURF1 lose less muscle mass upon ageing, but display poorer muscle function than wild-type (Hwee et al. 2014). This is consistent with the notion that UPS is activated as a consequence of muscle damage, and blocking this activation results in accumulation of dysfunctional proteins. "
    [Show abstract] [Hide abstract] ABSTRACT: No abstract is available for this article.
    Article · Jan 2016
    • "Although the mRNA expression of muscle-specific ubiquitin ligases is increased, the induction is very limited (1.5–2.5 folds) when compared with other catabolic situations (Clavel et al., 2006). In addition, MuRF-1-null mice show more weakness of muscle strength during aging process than wild-type mice although skeletal muscle mass is partly preserved, indicating that the activity of ubiquitin ligase is required to preserve the muscle mass during aging process (Hwee et al., 2014). Moreover, the atrogin-1-knockout mice reveal similar results with higher loss rate of skeletal muscle mass during aging process than that from controls. "
    [Show abstract] [Hide abstract] ABSTRACT: Sarcopenia is an aging-related disease with a significant reduction in mass and strength of skeletal muscle due to the imbalance between protein synthesis and protein degradation. The loss of skeletal muscle is an inevitable event during aging process, which can result in the significant impact on the quality of life, and also can increase the risk for other aging-associated diseases in the elderly. However, the underlying molecular mechanism of aging-related skeletal muscle loss is still poorly understood. Autophagy is a degradation pathway for the clearance of dysfunctional organelles and damaged macromolecules during aging process. Appropriate induction or accurate regulation of autophagic process and improved quality control of mitochondria through autophagy or other strategies are required for the maintenance of skeletal muscle mass. In this article, we have summarized the current understanding of autophagic pathways in sarcopenia, and discussed the functional status of autophagy and autophagy-associated quality control of mitochondria in the pathogenesis of sarcopenia. Moreover, this article will provide some theoretical references for the exploration of scientific and optimal intervention strategies such as exercise and caloric restriction for the prevention and treatment of sarcopenia through the regulation of autophagic pathways. This article is protected by copyright. All rights reserved.
    Full-text · Article · Nov 2015
Show more

Supplementary resources