ArticlePDF Available

Identifying the Sister Species to the Rapid Capuchino Seedeater Radiation (Passeriformes: Sporophila)

Authors:

Abstract and Figures

Within the Neotropical genus Sporophila, a group of eight species known colloquially as southern capuchinos shows remarkable phenotypic variation (mainly male coloration and song) despite lack of mitochondrial DNA monophyly and extremely low differentiation in other putatively neutral genetic markers. Previous studies have interpreted this to reflect recent common ancestry and perhaps ongoing hybridization and introgression. A recent taxonomic revision of the only polytypic southern capuchino species S. bouvreuil (with four previously recognized subspecies), prompted the designation of S. bouvreuil and S. pileata as two distinct species based on plumage color and geographic distribution. Here we use DNA sequence and microsatellite data to corroborate these new species designations and explore for the first time the relationship between these taxa and the remaining southern capuchinos. Phylogenetic and population genetic analyses show that S. bouvreuil and not S. minuta, as was previously thought, is the sister species to the core radiation of which S. pileata is part. Our data suggest that the ancestor of the southern capuchinos derives from northern South America and began to radiate during the lower to middle Pleistocene into at least eight species within the grasslands of northeastern Argentina, eastern Paraguay and southern Brazil. Consistent with earlier studies, we could not distinguish among southern capuchino species using neutral genetic markers, an expected signature of a rapid and recent radiation.
Content may be subject to copyright.
IDENTIFYING THE SISTER SPECIES TO THE RAPID CAPUCHINO SEEDEATER
RADIATION (PASSERIFORMES: SPOROPHILA)
Leonardo Campagna,
1,2,4
Luís Fábio siLveira,
3
pabLo L. Tubaro,
2
and sTephen C. Lougheed
1
1
Department of Biology, Queen’s University, Kingston, Ontario K7L 3N6, Canada;
2
División de Ornitología, Museo Argentino de Ciencias Naturales “Bernardino Rivadavia” (MACN), Avenida Ángel Gallardo 470,
Ciudad de Buenos Aires, Buenos Aires C1405DJR, Argentina; and
3
Seção de Aves, Museu de Zoologia, Universidade de São Paulo, Caixa Postal 42.494, CEP 04218-970, São Paulo, SP, Brazil
A.—Within the Neotropical genus Sporophila, a group of eight species known colloquially as southern capuchinos”
shows remarkable phenotypic variation despite lack of (species level) mitochondrial DNA monophyly and extremely low differentiation
in other putatively neutral genetic markers. Previous studies have interpreted this as reflecting recent common ancestry and, perhaps,
ongoing hybridization and introgression. A recent taxonomic revision of the only polytypic southern capuchino species, Sporophila
bouvreuil (with four previously recognized subspecies), prompted the designation of S. bouvreuil and S. pileata as two distinct species
on the basis of plumage color and geographic distribution. We used DNA sequence and microsatellite data to corroborate these new
species designations and explored for the rst time the relationship between these taxa and the remaining southern capuchinos.
Phylogenetic and population genetic analyses showed that S. bouvreuil and not S. minuta, as was previously thought, is the sister
species to the core radiation of which S. pileata is part. Our data suggest that the ancestor of the southern capuchinos is derived from
northern South America and began to radiate during the lower to middle Pleistocene into at least eight species within the grasslands
of northeastern Argentina, eastern Paraguay, and southern Brazil. Consistent with earlier studies, we could not distinguish among
southern capuchino species using neutral genetic markers, an expected signature of a rapid and recent radiation. Received  April ,
accepted  July .
Key words: grassland birds, Neotropics, recent radiation, Sporophila bouvreuil, S. pileata.
Identificación de la Especie Hermana de la Radiación Rápida de los Capuchinos del Sur (Sporophila, Passeriformes)
R.—El género Neotropical Sporophila contiene un grupo de ocho especies conocido coloquialmente como los capuchinos del
sur. Dicho grupo muestra una marcada variación fenotípica (principalmente en la coloración y el canto de los machos) que contrasta con
la falta de monofilia a nivel de especie y bajos niveles de diferenciación en marcadores genéticos neutros. Este patrón ha sido atribuido al
origen reciente del grupo y a la hibridación e introgresión entre especies. Una revisión taxomica reciente de la única especie politípica,
S. bouvreuil (la cuál contenía cuatro subespecies), designó a S. bouvreuil y S. pileata como nuevas especies en base a patrones de coloración y
distribución geográfica. En el presente estudio utilizamos secuencias de ADN y frecuencias de alelos de ADN microsatélite para corroborar
la designación de dichas especies y estudiar por primera vez la relación entre ellas y con respecto a los demás capuchinos del sur. Utilizando
análisis filogenéticos y herramientas de genética de poblaciones mostramos que S. bouvreuil y no S. minuta, como se creía anteriormente, es
la especie hermana del grupo, al cual pertenece S. pileata. Posiblemente el ancestro de los capuchinos del sur provino del norte de América
del Sur y comenzó a radiar durante el Pleistoceno inferior o medio en al menos ocho especies en los pastizales del noreste Argentino, este
de Paraguay, y sur de Brasil. Como en estudios previos, no fue posible distinguir entre capuchinos del sur utilizando marcadores genéticos
neutros, un resultado esperable en el contexto de una radiación rápida y reciente.
645
e Auk 130(4):645655, 2013
e American Ornithologists’ Union, 2013.
Printed in USA.
e Auk, Vol.
, Number , pages . ISSN -, electronic ISSN -.  by e American Ornithologists’ Union. All rights reserved. Please direct all
requests for permission to photocopy or reproduce article content through the University of California Press’s Rights and Permissions website, http://www.ucpressjournals.
com/reprintInfo.asp. DOI: ./auk..
4
Present address: Fuller Evolutionary Biology Program, Cornell Laboratory of Ornithology, 159 Sapsucker Woods Road, Ithaca, New York 14850,
USA. E-mail: leocampagna@gmail.com.
T  N genus Sporophila harbors within it a
remarkable radiation of  granivorous species, colloquially known
as capuchinos or caboclinhos in Spanish and Portuguese, respec-
tively, but lacking a common name in English (Ridgely and Tudor
, Rising et al. , Remsen et al. ). Eight of the capuchino
species are endemic to central and southern South America,
where they are predominantly sympatric and often syntopic, and
appear to have radiated rapidly during the Pleistocene (Ridgely
and Tudor ; Lijtmaer et al. ; Campagna et al. , ).
ese eight species (S. cinnamomea, S. hypochroma, S. hypoxantha,
646 Campagna eT aL. auk, voL. 130
phylogenetic relationships between S. bouvreuil and the species
that comprise the southern capuchino radiation? Is S. bouvreuil
part of the radiation, or is S. bouvreuil and not S. minuta the sister
species to the southern capuchinos? If S. bouvreuil is the sister
lineage, we can then narrow down the geographic and temporal
scenarios for the southern capuchino radiation.
Methods
Sampling and data set.We augmented the data set of Campagna
et al. () with genetic data from new individuals of S. bouvreuil
(n = ) and S. pileata (n = ). In total, the augmented data set
includes the eight southern capuchino species (n =  of which
 belong to S. pileata), S. bouvreuil (n = ), S. minuta (n = ),
S. castaneiventris (n = ), and  individuals from four closely
related outgroup species (numbers of samples per southern
capuchino species are summarized for each marker in Table ; for
other details, see Table S in the online supplementary material).
Most tissue samples were from vouchered males in adult plumage
(with study skin, skeleton, or specimen in ethanol deposited at the
Museo Argentino de Ciencias Naturales “Bernardino Rivadavia,
the Museu de Zoologia da Universidade de São Paulo, or another
institution; for details, see Table S). For individuals for which
we have blood samples, a picture was taken to serve as a digital
voucher before the bird was released and is available upon request.
Genetic markers.—Samples in Campagna et al.s () data
set were genotyped for six previously published microsatellite loci
(Esc, Hanotte et al. ; Mcy, Double et al. ; Pdo,
Neumann and Wetton ; Gf, Gf, and Gf, Petren ).
is data set also includes DNA sequences from eight markers for
most individuals from which fresh tissue samples were available
(i.e., not taken from museum study-skin toe pads). ese mark-
ers included three mitochondrial regions (cytochrome b [cyt b],
 base pairs [bp]; cytochrome c oxidase I [COI],  bp; mito-
chondrial control region [CR], ~, bp), one autosomal intron
(intron  of the β-fibrinogen gene: Fib, ~bp), two previously
described nuclear sequences of mitochondrial origin (Numt:
~ bp; Numt: ~ bp; see Sato et al. ), and two Z-linked
markers (chromodomain-helicase-DNA binding protein: CHDZ:
~ bp; intron  of the muscle skeletal receptor tyrosine kinase
gene: MUSK, ~ bp) (for details, see Tables  and S).
For the present study, we genotyped the new S. bouvreuil and
S. pileata samples for the six aforementioned DNA microsatellite
loci, and amplified and sequenced COI, cyt b, CR, and CHDZ. DNA
extraction, amplification, sequencing, and genotyping followed pro-
cedures described by Campagna et al. (). We generated additional
sequences ( COI, cyt b, and two CR) for some southern capu-
chinos to assemble a data set of  individuals for which most had
been sequenced for all three mitochondrial regions. Table Sprovides
details and GenBank accession numbers. All sequences were aligned
using BIOEDIT, version .. (Hall ).
Phylogenetic analyses.e model of nucleotide evolu-
tion was selected for each marker using JMODELTEST, version
..(Darriba et al. ). We used three strategies to explore
the phylogenetic anities among Sporophila species. First
we obtained a Bayesian gene tree using MRBAYES, version
. (Ronquist etal. ), and data from the three mitochon-
drial markers (COI, cyt b, and CR). We placed each marker in
a separate unlinked partition, and for each we used the model
S. melanogaster, S. nigrorufa, S. pileata, S. palustris, and S. ruficollis)
can show eclipse plumage and gather in mixed flocks when not
breeding (Ridgely and Tudor ). Evidence from molecular stud-
ies shows extremely low neutral genetic differentiation among
these taxa, interpreted to be the consequence of recent common
ancestry and, perhaps, ongoing hybridization and introgression
(Lijtmaer etal. ; Campagna et al. , ). Phylogenetic af-
finities among these eight species (hereafter southern capuchinos”)
remain unresolved, despite the marked phenotypic differences
that exist mainly in male reproductive plumage and vocalizations
(Campagna et al. ). Southern capuchinos are strikingly sexu-
ally dimorphic; females are brown and olive and hard to distin-
guish among species, whereas males show distinct reproductive
plumage patterns that are generally based on the color cinnamon
(Ridgely and Tudor ). Plumage differences in the UV-portion
of the spectrum are found between some female southern capuchi-
nos (Benites et al. ). Aside from these phenotypic differences,
southern capuchinos are extremely similar in size and shape (Meyer
de Schauensee , Ridgely and Tudor , Ouellet ).
Recent studies of southern capuchino species have led to
the discovery of various alternative color morphs of already
recognized species and, in some cases, have prompted taxonomic
changes. Traditionally, S. zelichi was considered a distinct species,
but, primarily on the basis of overall similarity in song and habi-
tat use, it is now regarded as a color morph of S. palustris and has
been subsumed within the latter taxon (Areta , Remsen et al.
). Similarly, a series of alternative adult male color morphs
that share song types with different southern capuchinos have
been described (for S. melanogaster, see Repenning etal. ; for
S. hypoxantha, see Areta and Repenning ; for S. ruficollis, see
Areta et al. ). Finally, Machado and Silveira () conducted
a detailed taxonomic revision of the four subspecies (S. bouvreuil
bouvreuil, S. b. pileata, S. b. saturata, and S. b. crypta) from the only
polytypic species of the group. ey diagnosed only two species
based on plumage patterns: S. bouvreuil (which now includes S. b.
bouvreuil, S. b. saturata, and S. b. crypta) and S. pileata (includ-
ing the former S. b. pileata) (Machado and Silveira , Remsen
et al. ). ese newly diagnosed taxa are predominantly allo-
patric, with a small area of range overlap in southeastern Brazil
(Machado and Silveira ) where they appear to maintain their
phenotypic integrity.
Sporophila bouvreuil is found in open areas from northern
South America to central and southern Brazil, whereas S. pileata
occurs in central and southeastern Brazil, Paraguay, and north-
eastern Argentina (Machado and Silveira ; Fig. ). us, the
distribution of S. bouvreuil is geographically intermediate to that
of other southern capuchino species (including S. pileata) and
S. minuta, the putative sister species of the southern capuchino
radiation (Campagna et al. , ; Fig. ). Previous studies also
found the former S. b. bouvreuil (now included in S. bouvreuil) to
be more closely allied to the southern capuchino radiation than
is S. minuta (Campagna et al. , ). However, these studies
included mostly S. b. pileata (now S. pileata) and only one individ-
ual S. b. bouvreuil (now included in S. bouvreuil); thus, tests of the
monophyly of the latter taxon could not be performed.
Here, we use putatively neutral mitochondrial and nuclear
sequences as well as DNA microsatellites to address the following
questions. () Is there genetic evidence supporting the designation
of S. bouvreuil and S. pileata as separate species? () What are the
oCTober 2013 CapuChino seedeaTer radiaTion 647
of nucleotide evolution chosen with JMODELTEST (COI and
cyt b: HKY+I+G, Hasegawa et al. ; CR: GTR+I+G, Tava
). e Bayesian analysis consisted of two independent,
simultaneous runs with four chains each (under default pri-
ors for all parameters) for  × 
generations, sampling trees
every  generations. At this point, both runs had reached a
stationary state and converged, which was confirmed using the
cumulativeand “compare” functions in the software AWTY
(Wilgenbusch et al. ). A % majority rule consensus was
obtained from the combined posterior tree distribution after
discarding the initial % of trees as burn-in.
e second strategy combined mitochondrial and nu-
clear data to estimate a species tree using the Bayesian coales-
cent approach implemented in *BEAST (Heled and Drummond
), included in the BEAUTI/BEAST, version .., package
(Drummond et al. ). e concatenated mitochondrial genes
(COI, cyt b, and CR) and each of the five nuclear markers were
placed in different partitions under the model of nucleotide evo-
lution chosen using JMODELTEST (CHDZ and Fib: HKY;
MUSK: HKY+I; Numt: HKY+G; Numt: GTR+G; and mito-
chondrial: GTR+I+G). We used a Yule speciation model and a
piecewise linear and constant-root population size model. We im-
plemented a relaxed uncorrelated log normal clock and ran the
analysis for × 
generations (sampling every ,). We used
TRACER, version . (Rambaut and Drummond ), to confirm
convergence in parameter estimates and that effective sample
sizes exceeded . Finally, we used TREE ANNOTATOR, ver-
sion .., from the BEAUTI/BEAST package to summarize the
. × 
(%) post-burn-in sampled trees. We obtained a max-
imum-clade-credibility tree using mean node heights; posterior
Fig. 1. Approximate range map for Sporophila minuta (the distribution of this species outside of South America is not represented here), S. bouvreuil,
and the eight species that comprise the southern capuchino radiation (the distribution of S. pileata is shown separately) following Ridgely and Tudor
(1989), Machado and Silveira (2010), and Somenzari et al. (2011). Circles represent sampling locations. Examples of adult male S. pileata and S. bou-
vreuil are shown in the right panels, together with a schematic representation of the phylogenetic affinities among capuchinos.
648 Campagna eT aL. auk, voL. 130
probability indicated node support. Finally we used DENSITREE,
version .. (Bouckaert ), to overlay a subsample ( ×
)
of the post-burn-in trees. We also estimated species trees using
individual markers to assess the relative contribution of each to
the multigene topology.
e third strategy also combined mitochondrial (concate-
nated COI, cyt b, and CR sequences) and nuclear data (CHDZ,
Fib, MUSK, Numt, and Numt sequences placed in separate
partitions) to perform species delimitation using the Bayesian
framework implemented in BP&P, version .b (Rannala and
Yang , Yang and Rannala ). BP&P generates a posterior
distribution of species assignments while accommodating the
effects of incomplete lineage sorting on gene trees. We used the
topology generated by *BEAST as a guide tree, from which BP&P
collapses each internal node while calculating the probabilities of
models containing different numbers of species. We used a gamma
prior for each population size parameter ) and the age of the root
in the species tree (τ). For the gamma distributions, we speci-
fied a shape parameter (α = ) and a scale parameter = ,)
in both cases. Other divergence time parameters were assigned
default Dirichlet priors. We conducted multiple analyses imple-
menting reversible-jump Markov chain Monte Carlo (rjMCMC)
algorithms (using ε = , , , or ) or (trying all combinations
of α = , ., or and m = ., , or ) (Yang and Rannala ). e
analyses were run for , generations, sampling every  and
discarding the first , as burn-in.
F-statistics.—We explored the degree of genetic divergence
among Sporophila species by calculating all pairwise F
ST
or Φ
ST
values with ARLEQUIN, version . (Excoffier and Lischer );
significance was tested using , random permutations with
sequential Bonferroni corrections (Rice ). We subsequently
displayed these matrices graphically by building neighbor-joining
trees with the program NEIGHBOR provided in PHYLIP, ver-
sion .. (Felsenstein ). Φ
ST
and F
ST
neighbor-joining trees
were constructed for both the mitochondrial and the microsatellite
data. For these trees, we included only species for which at least five
individuals had been sequenced or genotyped. We also calculated
F
ST
based on a single nucleotide polymorphism in CHDZ, between
S. bouvreuil and all the southern capuchinos pooled. Finally, analyses
of molecular variance (AMOVA) were performed in ARLEQUIN,
grouping samples by either species or sampling locality.
Genetic distance and ordination analyses.—We calculated
inter-individual genetic distances using either sequence data or
the six DNA microsatellite loci. For the former, we estimated
uncorrected p-distances in MEGA, version (Tamura et al. ),
whereas for the latter we computed D
SW
genetic distances (Shriver
et al. ) in POPULATIONS, version .. (Langella ).
Pairwise matrices of inter-individual genetic distances were dis-
played using principal coordinate analyses (PCoA) computed in
GENALEX, version . (Peakall and Smouse ).
Bayesian clustering analysis.—We used the Bayesian approach
implemented in STRUCTURE, version .. (Pritchard et al.
TabLe 1. Sample sizes for each capuchino species and molecular marker (see text) used in this study. Genetic divergence was estimated independently
for each marker; the average divergence between the southern capuchinos and Sporophila bouvreuil and the highest divergence between two south-
ern capuchino species is shown. For sequence data (mitochondrial and nuclear), we calculated average percent p-distances and standard deviations,
and for the DNA microsatellite data we computed pairwise F
ST
values between species.
Species COI Cyt b CR Numt2 Numt3 Fib5 CHD1Z MUSK
DNA mic-
rosatellites
Sporophila
castaneiventris
3 3 3 1 3 5
S. minuta
7 7 7 6 7 7
S. bouvreuil
19 17 19 1 17 20
S. cinnamomea
3 3 3 2 2 3 3 3 14
S. hypochroma
2 2 2 1 1 2 2 1 26
S. hypoxantha
30 30 42 8 33 21 4 5 62
S. melanogaster
7 7 7 4 7 7 7 1 7
S. nigrorufa
1 2
S. pileata
10 10 10 6 6 6 8 4 37
S. palustris
10 10 10 4 11 11 5 3 15
S. ruficollis
7 7 7 7 7 7 4 4 44
Southern
capuchinos vs.
S. bouvreuil
1.63 ± 0.51 1.09 ± 0.23 0.89 ± 0.33 0.82 ± 0.31 0.18 ± 0.17 0.041
Maximum
among south-
ern capuchino
species
0.97 ± 0.44
a
0.61 ± 0.24
b
0.60 ± 0.31
c
0.17 ± 0.18
d
1.98 ± 0.09
e
0.11 ± 0.23
f
0.062 ± 0.12
g
0.54 ± 0.16
e
0.013
h
a
S. melanogaster vs. S. pileata.
b
S. melanogaster vs. S. palustris.
c
S. melanogaster vs. S. hypoxantha.
d
S. ruficollis vs. S. hypoxantha.
e
S. cinnamomea vs. S. hypochroma.
f
S. cinnamomea vs. S. ruficollis.
g
S. pileata vs. S. hypoxantha.
h
S. melanogaster vs. S. cinnamomea.
oCTober 2013 CapuChino seedeaTer radiaTion 649
), and our DNA microsatellite data to assign individuals to
different genetic populations (K). Before conducting this analysis,
for each species we assessed Hardy-Weinberg equilibrium (HWE)
and linkage disequilibrium (LD) using ARLEQUIN and sequential
Bonferroni corrections. e following locus–species combinations
were not in HWE: Pdo in S. palustris and S. pileata, Mcy in
S. pileata and S. bouvreuil, and Gf in S. bouvreuil. Mcy and
Gf were in LD in S. cinnamomea, S. hypochroma, S. hypoxantha,
and S. ruficollis. Deviations from HWE and LD had been observed
before for some of these loci (Campagna et al. ) and could be
the product of population-level genetic structure (Wahlund ),
ongoing hybridization and introgression, or technical difficulties
such as undetected allele dropout or null alleles. us, our mic-
rosatellite data may not fit the model assumed by STRUCTURE,
potentially leading to the overestimation of the number of genetic
populations. However, the STRUCTURE analyses found very lit-
tle species-level structure in our data, confirming results from
F-statistics (see below), which suggests that our results were not
spurious.
e STRUCTURE analysis was conducted using the admix-
ture ancestry model, correlated allele frequencies, and, in separate
analyses, both with and without locprior (i.e., a prior indicat-
ing species identity). We included the eight southern capuchino
species and S. bouvreuil, exploring values of K between and
(based on previous results that showed lack of differentiation in
these markers among southern capuchino species; Campagna
etal. ). We performed  iterations per value of K, each with
. × 
generations, discarding the initial % as burn-in. e
most likely value of K was determined using Evanno et al.’s ()
method implemented in STRUCTURE HARVESTER, version
.. (Earl and vonHoldt ).
Divergence time estimations.We calculated the age of the
mitochondrial ancestor (time to most recent common ancestor,
TMRCA) between the southern capuchinos and S. bouvreuil using
BEAUti/BEAST. An estimation of absolute time was reached us-
ing cyt b data and a calibration of .% divergence per million
years (Weir and Schluter ). e BEAST analysis was run with
a random starting tree for  × 
generations, assumed constant
population sizes and a relaxed uncorrelated lognormal clock,
and implemented the HKY+I+G model of nucleotide evolution.
Results were inspected for convergence and adequate effective
samples sizes in TRACER.
Results
e mitochondrial Bayesian tree (based on COI, cyt b, and CR
sequences; Fig. A) suggests that S. bouvreuil is phylogenetically
distinguishable from S. pileata and is indeed the sister species
to the southern capuchino radiation. Most S. bouvreuil form a
highly supported clade that is sister to all individuals involved in
the southern capuchino radiation. Using cyt b data and a clock
calibration of .% divergence Ma
–
, we estimated the age of the
common ancestor between S. bouvreuil and the southern capu-
chinos to be . Ma before present (% high posterior density
interval: .–.). e clade composed of the southern capu-
chinos and S. bouvreuil is, in turn, sister to S. minuta (Fig. A).
Two of  individual S. bouvreuil (marked with arrows in Fig. A)
carry “southern capuchino” mitochondrial haplotypes. Both
individuals are male S. bouvreuil with adult reproductive
plumage (see Fig. S in the online supplementary material).
Southern capuchino species for which more than one individ-
ual was sampled (S. nigrorufa being the exception) show lack of
species-level monophyly at these loci. However, some southern
capuchino species have significant dierences in mitochondrial
haplotype frequency (measured using Φ
ST
calculations per-
formed on concatenated COI, cyt b, and CR sequences; Fig. B;
for Φ
ST
values obtained from individual mitochondrial markers,
see Fig. S in the online supplementary material). Although Φ
ST
values between southern capuchino species were generally <.,
comparisons with S. bouvreuil were larger and were in all cases
statistically significant (Fig. B; for comparisons using genetic
distances, see Table ). e PCoA derived from inter-individual
P-distances (Fig. C) also illustrates the relationship among
individual S. minuta, S. bouvreuil, and southern capuchinos.
Southern capuchinos cluster into two groups: individuals that
belong to the main clade found within the radiation (Fig. A) and
a separate cluster comprised of all those remaining. As shown in
Figure A, one S. bouvreuil is found in each southern capuchino
cluster. A small percentage of the variation among southern
capuchinos is attributable to differentiation among either spe-
cies or sampling locality (AMOVA: .%, P = . for species;
.%, P = . for sampling locality).
Similar results were obtained from the multilocus species-tree
analysis (Fig. ) that included  individuals from nine species and
data from six unlinked genetic markers. e seven southern capu-
chino species included in this analysis comprised a highly supported
clade that was sister to S. bouvreuil. Phylogenetic affinities among
southern capuchino species were again uncertain, with low posterior
probabilities for all clades within this group (ranging from .in the
clade including S. hypochroma, S. melanogaster, and S. cinnamomea
to .between S. hypoxantha and S. ruficollis). Alternative topolo-
gies to that of the consensus tree (in white) are visible in gray in
the cloudogram generated from a subsample of the posterior tree
distribution (Fig. ). Darker shades of gray imply larger numbers of
trees with that topology, thus resembling the consensus tree. Trees
derived from nuclear data alone did not resolve differences among
the southern capuchinos, and Figure is similar to the species tree
obtained from mitochondrial DNA alone (for species trees derived
from individual markers, see Fig. S in the online supplementary
material). However, there was a single nucleotide polymorphism in
CHDZ that was close to fixation between individual S. bouvreuil and
southern capuchinos (F
ST
= .), and the DNA microsatellite data (see
below) also support our conclusion that the differentiation between
southern capuchinos and S. bouvreuil is not solely attributable to
mitochondrial markers. Results from the BP&P analysis varied across
runs that used different algorithms and combinations of priors but
were generally consistent with the results obtained using *BEAST.
e data allowed us to distinguish S. minuta from the remaining
species regardless of the conditions under which the program was
run, and in some cases to distinguish between S. bouvreuil and the
southern capuchinos. However, differences among southern capu-
chino species were generally not supported.
The F
ST
neighbor-joining tree based on DNA microsatellite
data also shows higher values between southern capuchinos
and S. bouvreuil than among the former species (the largest
inter-capuchino F
ST
value was .between S. cinnamomea
650 Campagna eT aL. auk, voL. 130
Fig. 2. (A) Bayesian tree for Sporophila derived from mitochondrial DNA sequence data (112 individuals; 2,650 base pairs from cytochrome c oxidase
I [COI], cytochrome b [cyt b], and mitochondrial control region [CR]) with posterior probabilities indicating node support. Arrows indicate two male
S. bouvreuil that fall within the southern capuchino clade. Posterior probabilities of nodes with low support were omitted for clarity. When individuals
belonging to the same species form a clade, species name is mentioned only once. (B) Neighbor-joining trees built using pairwise Φ
ST
calculations
derived from concatenated COI, cyt b, and CR data. Comparisons between southern capuchino species that were statistically significant after sequen-
tial Bonferroni correction are indicated by asterisks (α = 0.05). All comparisons between southern capuchinos and S. bouvreuil or S. minuta were
statistically significant (as was the comparison between S. bouvreuil and S. minuta). (C) PCoA derived from inter-individual p-distances calculated using
concatenated COI, cyt b, and CR data. Parentheses indicate the percentage of variation explained by each axis.
oCTober 2013 CapuChino seedeaTer radiaTion 651
and S. melanogaster; Fig. A and Table ). Only comparisons
between southern capuchinos and S. bouvreuil were statisti-
cally significant. Similar results can be observed in the biplot
from a PCoA of inter-individual D
SW
distances (Fig. B). We
found no significant differentiation among southern capuchino
species (AMOVA: .%, P = .), and only a small fraction
of the total variation was attributable to sampling locality
(AMOVA: .%, P = .). For the STRUCTURE analysis
using microsatellites, the most likely scenario was K = with
S. bouvreuil assigned to a different cluster than all southern
capuchinos (online supplementary material Fig. S). However,
this result was obtained only when species information was
used as prior, which suggests that the overall signal in these
data is weak (F
ST
= . between S. bouvreuil and all southern
capuchinos pooled; Table ).
discussion
Our analyses of mitochondrial and nuclear DNA sequence data
together with evidence derived from DNA microsatellites sup-
port the recent taxonomic change that elevated S. bouvreuil and
S. pileata to species status (Remsen et al. ) based on evidence
from adult male plumage and geographic distribution of these
taxa (Machado and Silveira , ). ese species can be dis-
tinguished using neutral markers and there are, in fact, other
southern capuchino species that are closer phylogenetically to
S. pileata (e.g., S. palustris) than is S. bouvreuil, despite the similarity
in plumage between S. palustris and S. bouvreuil (see Fig. ). Our
analyses also show that S. bouvreuil, and not S. minuta as was
previously thought (Campagna et al. , ), is the sister spe-
cies to the southern capuchino radiation. e aforementioned
studies included only one S. bouvreuil, precluding tests for species-
level monophyly. Two of the  S. bouvreuil in the present study
have mitochondrial COI, cyt b, and CR sequences that place them
within the southern capuchino clade and not with the remaining
S. bouvreuil. ese two individuals are adult males that have
typical S. bouvreuil reproductive plumage and were assigned to
the S. bouvreuil genetic cluster using DNA microsatellite data.
Nuclear DNA sequences alone did not provide sufficient resolution
to distinguish among southern capuchinos and S. bouvreuil, pos-
sibly as a consequence of lower substitution rates, larger effective
population size, and incomplete lineage sorting. However, when
data from the same individuals were incorporated into the species
tree estimation using *BEAST that explicitly models the effects of
incomplete lineage sorting and ancestral polymorphism (Heled
and Drummond ), both the southern capuchino clade and
the clade involving these species and S. bouvreuil received poste-
rior probability support of (a similar result was obtained from
the BP&P analysis). is implies that incomplete lineage sorting
could be the reason that a small proportion of S. bouvreuil share
mitochondrial haplotypes with the southern capuchinos, a pattern
that could also have been generated through hybridization. e
methodology used to estimate the species tree assumes that admix-
ture (i.e., hybridization and introgression) does not occur among
individuals of the different species (Heled and Drummond ).
us, regardless of the results from the species tree analysis, we
cannot rule out the possibility of hybridization and introgression
between a female of a species belonging to the southern capuchino
clade and male S. bouvreuil, resulting in mitochondrial introgres-
sion from the former into the latter.
Identifying S. bouvreuil as the sister species to the southern
capuchino radiation allows us to reevaluate the timing and
geographic context of the radiation. Using data from cyt b and
S. minuta as the closest species to the southern capuchinos,
Campagna et al. () used TMRCA to estimate that the radia-
tion began in the Pleistocene. Here, with nearly double the number
of sequences and an improved phylogeny (with S. bouvreuil as the
sister species to the southern capuchinos), we obtained a similar
TMRCA estimate, perhaps as a consequence of the short internode
distance between S. minuta and S. bouvreuil. e % high poste-
rior density estimate of the age of the common ancestor between
S. bouvreuil and the southern capuchinos encompasses the lower
to middle Pleistocene. us, it is possible that Pleistocene climatic
changes and concomitant fluctuations in the distribution of rain-
forest over open areas (Clapperton , Servant et al. , Ledru
et al. ) contributed to isolating populations and promoting
the southern capuchino radiation. Having excluded S. bouvreuil
from the core radiation, we can delimit the northern boundar-
ies of the range within which the southern capuchino radiation
likely occurred (see Fig. ). Our data suggest that the ancestor of
the southern capuchinos came from northern South America and
radiated rapidly into at least eight species within the grasslands
of northeastern Argentina, eastern Paraguay, and southern Brazil
(the area that shows the highest species concentration; for indi-
vidual species maps, see Ridgely and Tudor ).
Fig. 3. Species tree for Sporophila inferred from mitochondrial (concate-
nated COI, cyt b, and CR) and nuclear (Numt2, Numt3, CHD1Z, MUSK,
and Fib5) sequence data from 95 individuals belonging to nine species.
The consensus tree (in white) was superimposed onto a cloudogram de-
rived from 20,000 post-burn-in trees. Each tree is represented in gray,
with darker shades implying greater degree of overlap. Node support
within the southern capuchino radiation was low (0.4–0.7) and, thus,
was omitted for simplicity (see Fig. S3 in the online supplementary mate-
rial for details).
652 Campagna eT aL. auk, voL. 130
Although the diversification of the southern capuchinos is
relatively recent compared with other avian radiations (e.g., for war-
blers in genus Dendroica, see Lovette and Bermingham ; or
for Hawaiian honeycreepers in tribe Drepanidini, see Lerner etal.
), the time elapsed since the lower to middle Pleistocene has
been sufficient to show striking phylogeographic structure in other
Neotropical avian taxa (e.g., for Zonotrichia capensis, see Lougheed
et al. ). In the present study, we did not nd species-level mono-
phyly or clear affinities among the eight southern capuchino species,
consistent with results from previous studies (Lijtmaer et al. ;
Campagna et al. , ), even in those analyses that account
for the effect of ancestral polymorphism and incomplete lineage
sorting. is does not mean that southern capuchinos should not
be considered good biological species, and various studies have
identified differences in male and female plumage and song that are
maintained in sympatry (Benites etal. , Areta , Campagna
et al. ). We interpret this genetic pattern as the consequence
of a rapid and ongoing radiation. Using Bayesian simulations that
implement the isolation with migration model (IMa; Hey ),
Campagna et al. () obtained results consistent with gene flow
among southern capuchino species. us, ongoing hybridization
and introgression since these species split from a common ancestor
could preclude us from reconstructing their phylogenetic affini-
ties (both *BEAST and BP&P assume lack of admixture). It is also
possible that insufficient time has elapsed for stochastic sorting of
neutral genetic markers to have occurred (McKay and Zink );
incomplete lineage sorting would be accentuated if the speciation
events that led to the eight southern capuchino species occurred
rapidly over a short time span.
A similar challenge in reconstructing phylogenetic ani-
ties has been documented for Darwins ground finches (Freeland
and Boag , Sato et al. ). In contrast to Darwin’s nches
(Geospiza spp.), southern capuchino seedeaters exhibit similar
morphology, including bill dimensions, differing mainly in male
plumage and song (Campagna et al. ). ese differences in key
aspects of the avian mate-recognition system (Price ) suggest
Fig. 4. (A) Neighbor-joining tree for Sporophila derived from F
ST
calculations based on allele frequencies at six DNA microsatellite loci. (B) PCoA
displaying an inter-individual pairwise D
SW
distance matrix (percentage of variation explained by each axis in parenthesis).
oCTober 2013 CapuChino seedeaTer radiaTion 653
sexual selection as a driver of speciation in the group (Campagna
et al. ), and future work should focus on the possible role of
these phenotypic differences as mechanisms of reproductive
isolation. We expect that identification of genes that underpin
phenotypic differences among southern capuchinos will help us
understand the relationship among species and provide insight
into the mechanisms that promoted speciation in the group. It
is worth noting that the same patches and colors, combined into
different patterns, are implicated in male plumage differences
among southern capuchinos (for representative illustrations,
see Ridgely and Tudor ; for alternative color morphs within
some species, see Areta , Repenning et al. , Areta and
Repenning , Areta et al. ). Certainly, plumage attributes
seem to be evolutionary malleable in the group, possibly meaning
that a limited suite of genes and mutations underlie these differ-
ences in male coloration. Our future work will focus on employing
next-generation sequencing to recover large numbers of loci and
search for those loci that show patterns consistent with selection.
AcknowledgMents
Supplementary material is available with the online version
of this article at dx.doi.org/./auk... We are
indebted to É. Machado and to the staff and students from
Museu de Zoologia, Universidade de São Paulo; to W. Lemos
Morais Neto and the staff from Fazenda Fartura; and to
B. Ehlers (UPS Brazil) for their help in collecting the specimens
used in this study. We thank the Instituto Chico Mendes de
Conservação da Biodiversidade (Brazil) for granting col-
lection permits and the Canadian Food Inspection Agency
for providing import permits. Photographs in Figure were
kindly provided by E. Endrigo (S. bouvreuil) and R. Güller
(S. pileata). L.C. thanks the Senate Advisory Research Com-
mittee at Queen’s University for postdoctoral funding. This
study was funded by grants to L.F.S. from the Fundação de
Amparo à Pesquisa no Estado de São Paulo and Conselho
Nacional de Desenvolvimento Científico e Tecnológico (CNPq
/-: Evolução da Fauna de Vertebrados Terrestres
Brasileiros do Cretáceo ao Presente: Paleontologia e Filogenia).
The study was also funded by grants to P.L.T. from Agencia
Nacional de Promoción Científica y Tecnológica (PICT
-, Argentina), Consejo Nacional de Investigaciones
Científicas y Técnicas (PIP --, Argentina), Uni-
versidad de Buenos Aires (UBACyT -, Argentina),
International Development Research Centre (Canada), and the
Richard Lounsbery Foundation (USA), and by a Natural Sci-
ences and Engineering Research Council of Canada Discovery
Grant to S.C.L. We thank L. Joseph and two anonymous
reviewers for valuable feedback on the manuscript.
liteR AtuRe cited
A, J. I.
. e Entre Ríos Seedeater (Sporophila zelichi): A
species that never was. Journal of Field Ornithology :–.
A, J. I.
. Winter songs reveal geographic origin of three
migratory seedeaters (Sporophila spp.) in southern Neotropical
grasslands.
Wilson Journal of Ornithology
:–.
A, J. I., J. I. N, L. P,  I. R.
. Unrav-
elling the ecological radiation of the capuchinos: Systematics of
Dark-throated Seedeater Sporophila ruficollis and description of
a new dark-collared form. Bulletin of the British Ornithologists’
Club :–.
A, J. I.,  M. R.
.
Systematics of the Tawny-
bellied Seedeater (
Sporophila hypoxantha
). II. Taxonomy and
evolutionary implications of the existence of a new tawny morph.
Condor :–.
B, P., M. D. E, D. A. L, S. C. L,
 P. L. T.
. Analysis from avian visual perspec-
tive reveals plumage colour differences among females of
capuchino seedeaters (Sporophila). Journal of Avian Biology
:.
B, R. R.
. DensiTree: Making sense of sets of phyloge-
netic trees. Bioinformatics :–.
C, L., P. B, S. C. L, D. A. L, A. S.
DG, M. D. E,  P. L. T.
. Rapid phe-
notypic evolution during incipient speciation in a continental avian
radiation. Proceedings of the Royal Society of London, Series B
:.
C, L., D. A. L, K. C. K, A. S. B, P. D.
H, S. C. L,  P. L. T.
. DNA bar-
codes provide new evidence of a recent radiation in the genus
Sporophila (Aves: Passeriformes). Molecular Ecology Resources
:–.
C, C. M.
. Nature of environmental changes in South
America at the last glacial maximum. Palaeogeography, Palaeocli-
matology, Palaeoecology :.
D, D., G. L. T, R. D,  D. P.
.
jModelTest : More models, new heuristics and parallel computing.
Nature Methods :.
D, M. C., D. D, T. B,  A. C.
.
Finding the fathers in the least faithful bird: A microsatellite-based
genotyping system for the Superb Fairy-Wren Malurus cyaneus.
Molecular Ecology :–.
D, A. J., M. A. S, D. X,  A. R.
.
Bayesian phylogenetics with BEAUti and the BEAST ..
Molecular
Biology and Evolution
:.
E, D. A.,  B. M. H.
. STRUCTURE HAR-
VESTER: A website and program for visualizing STRUCTURE
output and implementing the Evanno method. Conservation
Genetics Resources :–.
E, G., S. R, J. G.
. Detecting the
number of clusters of individuals using the software STRUC-
TURE: A simulation study. Molecular Ecology :–.
E, L.,  H. E. L. L.
. ARLEQUIN suite, version
.: A new series of programs to perform population genetics anal-
yses under Linux and Windows. Molecular Ecology Resources
:–.
F, J.
. PHYLIP (Phylogeny Inference Package),
version ... Distributed by the author, Department of Genome
Sciences, University of Washington, Seattle.
F, J. R.,  P. T. B.
. e mitochondrial and nuclear
genetic homogeneity of the phenotypically diverse Darwins ground
finches. Evolution :–.
H, T. A. . BioEdit: A user-friendly biological sequence align-
ment editor and analysis program for Windows //NT.
Nucleic Acids Symposium Series :–.
H, O., C. Z, A. P, C. G, A. D, 
T. B.
. Isolation and characterization of microsatellite
654 Campagna eT aL. auk, voL. 130
loci in a passerine bird: e Reed Bunting Emberiza schoeniclus.
Molecular Ecology :–.
H, M., H. K,  T. A. Y. . Dating of the
human–ape splitting by a molecular clock of mitochondrial
DNA. Journal of Molecular Evolution :–.
H, J.,  A. J. D.
. Bayesian inference of
species trees from multilocus data.
Molecular Biology and Evo-
lution
:–.
H, J.
. Isolation with migration models for more than two
populations. Molecular Biology and Evolution :–.
L, O.
. Populations ..: A population genetic
software. CNRS UPR. [Online.] Available at bioinformatics.
org/~tryphon/populations/.
L, M.-P., D.-D. R, F. W. C, J., C. R,
I. K,  L. M.
. Paleoclimate changes
during the last , yr from a record in the Brazilian Atlantic
rainforest region and interhemispheric comparison. Quater-
nary Research :–.
L, H. R. L., M. M, H. F. J, M. H, 
R. C. F.
. Multilocus resolution of phylogeny and
timescale in the extant adaptive radiation of Hawaiian honey-
creepers.
Current Biology
:.
L, D. A., N. M. S, P. L. T, S. C.
L.
. Molecular phylogenetics and diversification
of the genus Sporophila (Aves: Passeriformes). Molecular Phylo-
genetics and Evolution :–.
L, S. C., L. C, J. A. D, P. L. T, D. A.
L,  P. H.
. Continental phylogeogra-
phy of an ecologically and morphologically diverse Neotropical
songbird, Zonotrichia capensis.
BMC Evolutionary Biology
:.
L, I. J.,  E. B.
. Explosive speciation
in the New World Dendroica warblers.
Proceedings of the Royal
Society of London, Series B :–.
M, E.,  L. F. S.
. Geographical and sea-
sonal distributions of the seedeaters Sporophila bouvreuil and
Sporophila pileata (Aves: Emberizidae). Papeis Avulsos de
Zoología :–.
M, E.,  L. F. S.
. Plumage variability and
taxonomy of the Capped Seedeater Sporophila bouvreuil (Aves:
Passeriformes: Emberizidae). Zootaxa :–.
MK, B. D.,  R. M. Z.
. e causes of mitochondrial
DNA gene tree paraphyly in birds. Molecular Phylogenetics and
Evolution :–.
M  S, R. M.
. A review of the genus
Sporophila. Proceedings of the Academy of Natural Sciences of
Philadelphia :–.
N, K.,  J. H. W.
. Highly polymorphic
microsatellites in the House Sparrow Passer domesticus. Molec-
ular Ecology :–.
O, H.
. Speciation, zoogeography and taxonomic prob-
lems in the Neotropical genus Sporophila (Aves: Emberizinae).
Bulletin of the British OrnithologistsClub :–.
P, R.,  P. E. S.
. GENALEX : Genetic
analysis in Excel. Population genetic software for teaching and
research. Molecular Ecology Notes :.
P, K.
. Microsatellite primers from Geospiza fortis and
cross-species amplification in Darwin’s nches. Molecular Ecol-
ogy :–.
P, T.
. Speciation in Birds. Roberts, Englewood, Colorado.
P, J. K., M. S,  P. D.
. Infer-
ence of population structure using multilocus genotype data.
Genetics :–.
R, A.,  A. J. D.
. TRACER, version ..
[Online.] Available at beast.bio.ed.ac.uk/Tracer.
R, B.,  Z. Y.
. Bayes estimation of species
divergence times and ancestral population sizes using DNA
sequences from multiple loci. Genetics
:.
R, J. V., J., C. D. C, A. J, M. N,
J. F. P, J. P-E, M. B. R, F. G. S,
D. F. S, K. J. Z.
. A classification of the
bird species of South America. American Ornithologists’
Union. [Online.] Available at www.museum.lsu.edu/~Remsen/
SACCBaseline.html.
R, M., C. R,  C. S. F.
. Another
color morph of Sporophila Seedeater from capuchinos group
(Aves, Emberizidae). Iheringia, Série Zoologia :–.
R, W. R.
. Analyzing tables of statistical tests. Evolution
:–.
R, R. S.,  G. T.
. e Birds of South America.
University of Texas Press, Austin.
R, J. D., A. J, J. L. C, P. G. R,  S. C.
M.
. Family Emberizidae (Buntings and New World
Sparrows). Pages – in Handbook of the Birds of the
World, vol. : Tanagers to New World Blackbirds (J. del Hoyo,
A. Elliott, and D. A. Christie, Eds.). Lynx Edicions, Barcelona,
Spain.
R, F., M. T, P.  M, D. L. A,
A. D, S. H, B. L, L. L, M. A. S,
J. P. H.
. MrBayes .: Efficient Bayesian
phylogenetic inference and model choice across a large model
space.
Systematic Biology
:–.
S, A., C. O’U, F. F, P. R. G, B. R. G,
H. T,  J. K.
. Phylogeny of Darwin’s nches
as revealed by mtDNA sequences. Proceedings of the National
Academy of Sciences USA :–.
S, A., H. T, C. O’U, P. R. G, B. R. G, 
J. K.
. On the origin of Darwin’s nches. Molecular
Biology and Evolution :–.
S, M., J. M, B. T, M.-L. A, P. B, M.
F,  M.-P. L.
. Tropical forest changes
during the Late Quaternary in African and South American
lowlands. Global and Planetary Change :–.
S, M. D., L. J, E. B, R. D, R. E. F,
R. C.
. A novel measure of genetic dis-
tance for highly polymorphic tandem repeat loci. Molecular
Biology and Evolution :–.
S, M., L. F. S, V. Q. P, M. A. R,
F. S,  V. C. 
.
Birds of an Amazonia-
Cerrado ecotone in southern Pará, Brazil, and the efficiency of
associating multiple methods in avifaunal inventories
.
Revista
Brasileira de Ornitologia 
:


.
T, K., D. P, N. P, G. S, M. N,
S. K.
. MEGA: Molecular evolutionary genetics
analysis using maximum likelihood, evolutionary distance, and
maximum parsimony methods.
Molecular Biology and Evolu-
tion
:–.
oCTober 2013 CapuChino seedeaTer radiaTion 655
T, S. . Some probabilistic and statistical problems in the
analysis of DNA sequences. Pages – in Some Mathemati-
cal Questions in Biology: DNA Sequence Analysis (R. M. Miura,
Ed.). American Mathematical Society, Providence, Rhode Island.
W, S.
. Zusammensetzung von Populationen und Kor-
relationserscheinungen vom Standpunkt der Vererbungslehre
aus betrachtet.
Hereditas
:–.
W, J. T., D. S.
. Calibrating the avian molec-
ular clock. Molecular Ecology :–.
W, J. C., D. L. W,  D. L. S. .
AWTY: A system for graphical exploration of MCMC conver-
gence in Bayesian phylogenetic inference.
[Online.] Available
at
ceb.csit.fsu.edu/awty
.
Y, Z.,  B. R.
. Bayesian species delimitation
using multilocus sequence data.
Proceedings of the National
Academy of Sciences USA :–.
Associate Editor: L. Joseph
... To achieve this purpose we PCR-amplified 631bp of the mitochondrial gene Cytochrome Oxidase I (COI; barcode), using the primers COIBirdF1 (TTCTCCAACCACAAAGACATTGGCAC) and COIbirdR2 (ACGTGGGAGATAAT TCCAAATCCTGG) [28]. The COI was chosen because variable sites present in this gene were responsible for the identification of the Copper-seedeater as the sister taxa of the southern capuchinos in the study of [13]. PCR reactions were conducted in an Eppendorf MasterCycler Gradient thermocycler, in a 25 μl volume, containing 100 ng of DNA, 150 μM of each dNTP, 6.6 μl of the amplification buffer (200 mM Tris-HCl, pH 8.4 and 500 mM KCl; Promega), 0.4 μM of each primer, 2.5 μl of BSA (25 μg / ml) and 1 U Taq-Polymerase (Promega). ...
... PCR products were purified using the Wizard SV Gel and PCR Clean-Up System, Promega, and were sequenced on an ABI 3730 automated sequencer using the BigDye 1 Terminator v3.1 Cycle Sequencing Kit. For the phylogetic analysis, in addition to all of the individuals captured in our three study areas, we added 10 sequences of S. pileata (GU070595, GU070599, GU070598, GU070597, GU070596, GU070594, KF316357, KF316356, KF316354, KF316355), and 15 samples of S. bouvreuil (KF316360, KF316362, KF316363, KF316364, KF316365, KF316366, KF316367, KF316368, KF316369, KF316370, KF316371, KF316372, KF316373, KF316374, KF316375) that were used in the study of [13], all available from GenBank. All of these GenBank sequences were of adult males with typical plumages of each taxa, and were deposited in the ornithological collection of Museu de Zoologia da Universidade de São Paulo-MZUSP; these voucher specimens permitted us to check their color patterns again. ...
... The Bayesian maximum credibility tree revealed two distinct clades with high posterior probability support (Fig 4). The homologous sequences deposited in GENBANK identified as belonging to S. pileata and S. bouvreuil [13] remained within their respective clades, reinforcing the potential of this mtDNA region to identify these two species (Fig 4). The only exceptions were the sequences KF316369 and KF316370, for which mtDNA and morphology were incongruent, likely due to hybridization (see Discussion bellow). ...
Article
Full-text available
The small Neotropical finches called capuchinos are outstanding because they have experienced one of the most recent and explosive avian radiations ever documented for birds. Despite very low morphological and niche divergence among species, many of them are reproductively isolated when in sympatry due to strong sexual selection in plumage traits. However, a specific pair of mostly parapatric species, the Pearly-bellied, Sporophila pileata, and the Copper Seedeaters, S. bouvreuil, has confounded taxonomists because individuals with intermediate color patterns can be found. By analyzing diagnostic COI mtDNA sequences and adult male plumage we provide evidence for hybridization. Paternity tests using microsatellites also indicated that representatives with intermediate plumage pattern can be fertile. Our findings are consistent with the classification of S. bouvreuil and S. pileata as distinct taxa, but we demonstrate that the sexual selection mechanisms involved in the isolation of other reproductively sympatric capuchinos are not applicable to this pair of species, likely because of reduced barriers to mate recognition.
... The Pearly-bellied Seedeater (S. pileata; Sclater, 1864) was formerly considered a subspecies of the Copper Seedeater (S. bouvreuil) but was recently elevated to species based on adult male plumage, geographic distribution (Machado andSilveira 2010, 2011), and molecular analyses (Campagna et al. 2013). It occurs in southeastern and southern Brazil and western to Mato Grosso do Sul, Paraguay and eastern Argentina (Machado and Silveira 2011). ...
... The Pearly-bellied Seedeater is included in a group called ''Southern Capuchinos,'' which includes the Chestnut Seedeater, Tawny-billed Seedeater, Black-billed Seedeater, Black-and-tawny Seedeater, Marsh Seedeater, Rufous-rumped Seedeater, and the Dark-throated Seedeater (S. ruficollis; Lijtmaer et al. 2004, Campagna et al. 2013. Except for the Black-and-tawny Seedeater, which is restricted to eastern Bolivia and western Brazil, the Pearly-bellied Seedeater presents the northernmost breeding area identified for a Southern Capuchino (Narosky 1973, Ridgely and Tudor 1989, Roda and López-Lanús 2008, Rovedder and Fontana 2012, Franz and Fontana 2013, Vinzentin-Bugoni et al. 2013. ...
Article
Full-text available
The "capuchinos" form a monophyletic group within the Neotropical seedeaters of the genus Sporophila and are typically smaller than the other congeners. Many of the 12 species of this group are endangered, but reproductive information is scarce for most of them. Here we present the descriptions of nests, eggs, nestlings, and nesting habitats for the Pearly-bellied Seedeater (Sporophila pileata). From 2012 to 2017 we found 83 nests constructed in herbaceous plants present in open marshlands, 15-73 cm above water or humid ground. Nests were deep cups built of grass stems, inflorescences, and rootlets, attached with spider web. Nests measured 59.3 ± 4.7 mm outside diameter, 50.7 ± 6.5 mm outside height, 41.6 ± 3.2 mm internal diameter, and 35.7 ± 3.3 mm internal depth. Eggs were oval with white, grayish, or greenish background color with black and brown spots mainly in the obtuse pole. They weighed 1.2 ± 0.1 g and measured 16.3 ± 0.8 per 12.2 ± 0.3 mm. Clutches consisted of 1-3 eggs. Our study sites represent the northernmost reproductive areas ever documented for a migratory capuchino.
... The Pearly-bellied Seedeater (S. pileata; Sclater, 1864) was formerly considered a subspecies of the Copper Seedeater (S. bouvreuil) but was recently elevated to species based on adult male plumage, geographic distribution (Machado andSilveira 2010, 2011), and molecular analyses (Campagna et al. 2013). It occurs in southeastern and southern Brazil and western to Mato Grosso do Sul, Paraguay and eastern Argentina (Machado and Silveira 2011). ...
... The Pearly-bellied Seedeater is included in a group called ''Southern Capuchinos,'' which includes the Chestnut Seedeater, Tawny-billed Seedeater, Black-billed Seedeater, Black-and-tawny Seedeater, Marsh Seedeater, Rufous-rumped Seedeater, and the Dark-throated Seedeater (S. ruficollis; Lijtmaer et al. 2004, Campagna et al. 2013. Except for the Black-and-tawny Seedeater, which is restricted to eastern Bolivia and western Brazil, the Pearly-bellied Seedeater presents the northernmost breeding area identified for a Southern Capuchino (Narosky 1973, Ridgely and Tudor 1989, Roda and López-Lanús 2008, Rovedder and Fontana 2012, Franz and Fontana 2013, Vinzentin-Bugoni et al. 2013. ...
Preprint
Full-text available
The ''capuchinos'' form a monophyletic group within the Neotropical seedeaters of the genus Sporophila and are typically smaller than the other congeners. Many of the 12 species of this group are endangered, but reproductive information is scarce for most of them. Here we present the descriptions of nests, eggs, nestlings, and nesting habitats for the Pearly-bellied Seedeater (Sporophila pileata). From 2012 to 2017 we found 83 nests constructed in herbaceous plants present in open marshlands, 15-73 cm above water or humid ground. Nests were deep cups built of grass stems, inflorescences, and rootlets, attached with spider web. Nests measured 59.3 6 4.7 mm outside diameter, 50.7 6 6.5 mm outside height, 41.6 6 3.2 mm internal diameter, and 35.7 6 3.3 mm internal depth. Eggs were oval with white, grayish, or greenish background color with black and brown spots mainly in the obtuse pole. They weighed 1.2 6 0.1 g and measured 16.3 6 0.8 per 12.2 6 0.3 mm. Clutches consisted of 1-3 eggs. Our study sites represent the northernmost reproductive areas ever documented for a migratory capuchino.
... An extreme example is the "capuchinos" group, a clade of 12 South American Sporophila seedeaters that show low mitochondrial DNA (mtDNA) sequence divergence due to recent divergence and ongoing gene flow (Campagna et al. 2010), but substantial reproductive isolation based on secondary sexual characters (e.g., Turbek et al. 2021). In that group, multiple genetic markers were necessary to resolve the relationships (Campagna et al. 2013). More comprehensive studies have partially resolved the phylogeny of additional Sporophila species Burns, 2013, Burns et al. 2014), but with limited taxon and genomic sampling. ...
Article
Disentangling the evolutionary relationships of rapidly radiating clades is often challenging because of low genetic differentiation and potentially high levels of gene flow among diverging taxa. The genus Sporophila consists of small Neotropical birds that show, in general, relatively low genetic divergence, but particularly high speciation rates and pronounced variation in secondary sexual traits (e.g., plumage color), which can be important in generating premating reproductive isolation. In cases like these, the use of genome-wide sequence data can increase the resolution to uncover a clade’s evolutionary history. Here, we used a phylogenomic approach to study the evolutionary history and genetic structure of the Variable Seedeater superspecies complex, which includes S. corvina, S. intermedia, and S. americana. Using ∼25,000 genome-wide single nucleotide polymorphisms (SNPs), we confirmed that the Variable Seedeater superspecies complex is monophyletic. However, a phylogenetic reconstruction based on a mitochondrial marker (ND2) resulted in a discordant tree topology, particularly in the position of Wing-barred Seedeater S. americana, which might be due to a mitochondrial capture event. Our results suggest historical gene flow among lineages, particularly between species with conflicting topologies. Among the four phenotypically variable S. corvina subspecies, our structure analyses identified three main distinct genetic groups (K = 3), and that the entirely black subspecies, S. c. corvina, is derived from within a pied-colored clade. Further, we inferred widespread gene flow across the whole species’ distribution, including between subspecies. However, gene flow was about 100 times lower at the geographic boundaries of the entirely black and the pied subspecies, suggesting an important role for plumage divergence in limiting gene flow. Overall, our findings suggest that the early diversification of the Sporophila genus occurred rapidly despite historical gene flow between lineages and that divergence in plumage color possibly influences the extent of gene flow among taxa.
... Traditionally classifi ed within the Emberizidae, recent morphological and molecular studies have revealed the genus to belong to the Th raupidae (Mason & Burns 2013). Systematics have been particularly confusing for the "capuchino" group, which is primarily found in the grasslands of central and southern South America (Campagna et al. 2013). Recently, a new species of capuchino seedeater, Ibera Seedeater Sporophila iberaensis, was described from northern Argentina based on an analysis of vocalizations and plumages (Di Giacomo & Kopuchian 2016). ...
Article
Full-text available
Paraguayan records of the recently described Ibera Seedeater Sporophila iberaensis are compiled and reviewed. Observations of birds identifiable to this species in Paraguay date from at least 1998, with the first photographic documentation in December 2004. The species has now been recorded at a minimum of 11 localities in the departments of Cordillera, Itapúa, Misiones, San Pedro and Presidente Hayes. The first two records of the species from Brazil (both from Mato Grosso do Sul) are also listed. Most Paraguayan records are of singing males, and breeding has been documented (a pair feeding fledglings) at one locality in Cordillera department, significantly expanding the known breeding range of the species. At least three localities appear to hold small populations (observations of multiple territorial males and/or pairs). In Paraguay, as in Argentina, the species appears to prefer wet tall grasslands bordering wetland areas. Its preference for tall grasslands makes the species particularly susceptible to habitat loss and degradation through overgrazing, frequent burning, and conversion to agriculture. These threats are all present at the principal localities for the species in the country. A reassessment of the species global conservation status taking into consideration the Paraguayan range and population suggests that it may best be treated as “Vulnerable”.
... Grasslands located in the north of the Amazon Basin were colonized much later according to our biogeographic analyses, resulting in a discrepancy in diversity. This pattern is not always shared by other Neotropical grassland taxa (seeCampagna, Silveira, Tubaro, & Lougheed, 2013), for which Pleistocene landscape perturbations may have driven rapid speciation in southern South American grasslands ...
Article
Full-text available
The evolution of Neotropical birds of open landscapes remains largely unstudied. We investigate the diversification and biogeography of a group of Neotropical obligate grassland birds (Anthus: Motacillidae). We use a multilocus phylogeny of 22 taxa of Anthus to test the hypothesis that these birds radiated contemporaneously with the development of grasslands in South America. We employ the R package DDD to analyze the dynamics of Anthus diversification across time in Neotropical grasslands, explicitly testing for shifts in dynamics associated with the Miocene development of grasslands, the putative Pleistocene expansion of arid lowland biomes and Pleistocene sundering of Andean highland grasslands. A lineage-through-time plot revealed increases in the number of lineages, and DDD detected shifts to a higher clade-level carrying capacity during the late Miocene, indicating an early burst of diversification associated with grassland colonization. However, we could not corroborate the shift using power analysis, probably reflecting the small number of tips in our tree. We found evidence of a divergence at ~1 mya between northern and southern Amazonian populations of A. lutescens, countering Haffer’s idea of Pleistocene expansion of open biomes in the Amazon Basin. We used BioGeoBears to investigate ancestral areas, and directionality of colonization of Neotropical grasslands. Members of the genus diversified into, out of, and within the Andes, within-Andean diversification being mostly Pleistocene in origin.
... data). Sporophila hypoxantha belongs to the capuchino group, which has undergone a rapid and recent radiation (Campagna et al. 2013). We studied only the easternmost population of S. hypoxantha (of five recognised allopatric populations) which breeds in the highlands of southern Brazil (Areta and Repenning 2011).This is the smallest of the three species analysed here, measuring 100.3 mm (97.5-105.1 mm) long and 8.6 g (7.8-9.6 g) in body mass (Franz and Fontana 2013). ...
Article
Song structure can be constrained by morphological characters such as beak size. Studies have shown that songbirds with larger beaks produce songs with a lower frequency, narrower frequency range and lower note rates than birds with smaller beaks. We tested whether beak volume and bite force constrain song parameters in three Neotropical seedeaters that show a gradient of beak size and force (Sporophila beltoni, S. caerulescens and S. hypoxantha). We also determined the relationship between body size and song structure. We evaluated the song structure of these species, measuring differences that may help them to segregate the acoustic space, since they occur in sympatry. These birds can be predicted to segregate the acoustic space to reduce overlapping of their songs, which is a possible result of the force of sexual selection. Individuals of each species had their beaks and bite forces measured and their own territorial songs recorded in the field. Only S. caerulescens showed a positive relationship between beak volume and song parameters (maximum frequency and frequency bandwidth). No song parameters showed an association with bite force or body size. The use of acoustical space seemed to be unique to each species with respect to note rate and song duration. Sporophila beltoni and S. hypoxantha showed the most differences from each other in all song parameters analysed. In contrast to other studies of finch species with conical beaks, our findings suggested that for these three species, beak volume and bite force do not limit the song structure.
Article
Behavioral isolation can catalyze speciation and permit the slow accumulation of additional reproductive barriers between co-occurring organisms. We illustrate how this process occurs by examining the genomic and behavioral bases of pre-mating isolation between two bird species ( Sporophila hypoxantha and the recently discovered S. iberaensis ) that belong to the southern capuchino seedeaters, a recent, rapid radiation characterized by variation in male plumage coloration and song. Although these two species co-occur without obvious ecological barriers to reproduction, we document behaviors indicating species recognition by song and plumage traits and strong assortative mating associated with genomic regions underlying male plumage patterning. Plumage differentiation likely originated through the reassembly of standing genetic variation, indicating how novel sexual signals may quickly arise and maintain species boundaries.
Technical Report
Full-text available
Between 1993 and 1999 the Swedish Museum of Natural History and the Dirección de Parques Nacionales y Vida Silvestre in Paraguay collaborated in a biodiversity training program (PROVEPA, Proyecto Vertebrados del Paraguay) focusing on vertebrate systematics and taxonomy, biological diversity estimation, and natural history museum practices. The program was partly funded by the Swedish International Development Agency (SIDA) and included the ornithological fieldwork that is reported here. The purpose of the fieldwork was to expose participating Paraguayan trainees to various aspects of ornithological fieldwork (estimating size and diversity of local bird faunas by means of standardized inventory methods, sound recordings, bird ringing, collecting and preparation of voucher specimens, etc.). Another aim was to gather data on the geographic distribution of Paraguayan bird species. We here present an annotated list of birds collected or captured and released during the PROVEPA ornithological fieldwork.
Article
Many traits influence birdsong diversity. Patterns observed in the acoustic parameters can be a result of morphological constraint and can also be explained by phylogenetic relationships. Understanding morphologic mechanisms that can act on song structure might account how they can catalyze speciation and how they evolve in lineages sort. We analyzed the evolution of beak volume and song constraints in "finch-like" species of Neotropical seedeaters. We tested if beak volume limits the song structure of territorial songs, based on differences in the beaks of 19 species from the genus Sporophila (Thraupidae, tanagers). We also tested (1) if body size constrained song structure, and (2) if beak volume and body size were related to each other. The relationship of song parameters (e.g. maximum and minimum frequencies, frequency bandwidth and note rate) to these two morphological variables was evaluated through an analysis which phylogenetic relations were controlled (PGLS), testing a null and Brownian model. To perform a faithful analysis between morphologic and acoustic parameters, our data was based on measurements of the beak and territorial song for each individual that we analyzed. None of the analyzed parameters was related to beak volume or body mass, and beak volume was not associated with body mass. Beak volume, note rate, and minimum frequency showed a phylogenetic signal. These results do not support the theoretically motivated prediction that beak size acts as a limit on song structure in oscine birds. The shape and variations of song in Sporophila tanagers (Seedeaters) may be a consequence of the species' phylogenetic history, since the seedeaters showed wide plasticity in many acoustic parameters, unrelated to their beak volume and body mass. Song structure was better explained by the evolutionary relationships among the species than by morphological constraints.
Article
Full-text available
The diverse genus Sporophila has a complex systematic history. A new dark-collared form of Sporophila seedeater, herein described on the basis of three adult males, resembles male S. ruficollis but has a dark nape and rufous back. We informally name the new form 'caraguata' for its preferred habitat. We tested four hypotheses regarding the systematic situation of the 'caraguata' form: valid species, hybrid S. ruficollis × S. cinnamomea, colour morph of S. cinnamomea, and colour morph of S. ruficollis. Vocally and ecologically, the 'caraguata' form cannot be diagnosed from S. ruficollis. This evidence strongly suggests that S. 'caraguata' is a colour morph of S. ruficollis, although a hybrid origin is hard to assess and cannot be discarded. Sporophila ruficollis differs in preferred habitat, plumage and vocalisations from the rest of the capuchinos, and must be considered a valid species. The pattern of morphological variation exhibited by dark-throated and grey-backed S. ruficollis and dark-collared and rufous-backed 'caraguata' is repeated in the white-throated and grey-backed Marsh Seedeater S. palustris and white-collared and rufous-backed Entre Ríos Seedeater S. zelichi; moreover, the members of each pair are indistinguishable ecologically and vocally. The 'fuzzy' species borders and complicated taxonomy of the ruficollis group could stem from an ongoing evolutionary radiation in the capuchinos. This radiation has apparently proceeded with little genetic divergence, simple changes in colour of male plumage, virtually no differences in females, and little morphological change in size and shape, but marked divergence in habitat use and voices of the involved forms.
Article
Full-text available
Birds of an Amazonia-Cerrado ecotone in southern Pará, Brazil, and the efficiency of associating multiple methods in avifaunal inventories. The southeastern Pará remains little known, and has only recently been covered by a few representative surveys of its avifauna. Herein, we present the results of a bird survey in Fazenda Fartura (Fartura Farm), located on the border between the states of Pará and Mato Grosso, in the transition of the Amazonia and Cerrado biomes. The area was sampledin four field trips (two in the dry season, two in the rainy season) between 2009 and 2010. As a result, we recorded 509 species, most of them documented through vouchers. Seven additional species were recorded by indirect evidence, rendering Fartura Farm the second most diverse Brazilian locality regarding bird species. We also briefly discuss the importance of applying diverse sampling methods to achieve efficiency in short-term inventories.
Article
Full-text available
The species Sporophila bouvreuil comprises four subspecies: S. b. bouvreuil, S. b. pileata, S. b. saturata and S. b. crypta. The males of each subspecies differ in plumage whereas the females and juveniles are very similar and difficult to identify to subspecies. Here we use external morphological characters, mostly plumage, to examine the validity of the subspecies. A total of 209 specimens was examined (131 S. b. bouvreuil, 29 S. b. crypta, 43 S. b. pileata and 6 S. b. saturata). Although morphological measurements did not separate any taxa, plumage patterns support recognition of two taxonomic units, one of birds having reddish brown male plumage and the other of birds with grayish to white male plumage. Discrete diagnostic characters and sympatry in SE Brazil allow separation of Sporophila pileata (Sclater 1864) from S. bouvreuil (Müller 1776). On the other hand, S. b. saturata Hellmayr 1904 and S. b. crypta Sick 1968 should be considered synonyms of S. bouvreuil.
Article
Full-text available
The genus Sporophila (Cabanis, 1844) unites about 30 species of small seedeaters that predominantly inhabit open or semi-open areas in the Neotropical region. The taxonomy of this group is based on morphological studies from collected male specimens. The dynamic spatial and temporal variation in the male plumage and lack of knowledge of their vocalizations make it difficult to properly diagnose some species even today, so these two aspects account for the existing taxonomic dilemmas involving Sporophila. During a four-year field study, we investigated the natural history of a breeding population of Sporophila melanogaster (Pelzeln, 1870). This is an endemic species in Brazil, which reproduces in the high-altitude grasslands of the Atlantic Forest biome. We found four male specimens with clearly diagnosable plumage, distinct from the typical form of the species. Here we describe this previously unreported plumage form. Based on the evaluation of habitat use, vocalization, and reproductive behavior, we tested two hypotheses regarding its taxonomic status. We concluded that this is another case of an intra-specific color morph within the seedeaters of the ''capuchinos'' group.
Article
Full-text available
Many species in the genus Sporophila are migratory. Migration patterns, while poorly studied, may be influenced by seed production which can be very seasonal in some regions. The distribution of S. bouvreuil extends from the Amazon and Suriname south through a large part of the open regions of Brazil. Sporophila pileata, on the other hand, is found in southeastern and southern Brazil as well as Argentina and Paraguay. Both of these species migrate, but their movement patterns are poorly known. To better understand the geographical and the seasonal distributions of S. bouvreuil and S. pileata, we grouped the records into two categories: the breeding season (September to March) and the putative migration season (April to August). We found two areas of sympatry between S. bouvreuil and S. pileata in the Brazilian states of Minas Gerais and São Paulo. For S. bouvreuil we suggest that populations that breed in the Amazon migrate to the Cerrado or Caatinga, where they will encounter resident populations of the same species. These resident populations may take part in short distance migrations. Sporophila pileata, on the other hand, occur in the Cerrado and open areas within the Atlantic Forest and it is not yet possible to determine migratory tendencies or destinations in the non-breeding season.