ArticlePDF Available

Abstract and Figures

Salinity and Orobanche or Phelipanche spp. infection are important crop stress factors in agricultural areas. In this study, we investigated the effect of salt stress on Phelipanche ramosa seed germination and its attachment onto Arabidopsis thaliana roots. We also evaluated the effect of both stresses on the expression of genes regulated by abiotic and biotic stresses. According to our results, high concentration of NaCl delayed P. ramosa seed germination in the presence of a strigolactone analogue (GR24). A similar pattern was observed in the presence of A. thaliana plants. Furthermore, we found that salt-treated A. thaliana seedlings were more sensitive to P. ramosa attachment compared with the untreated plants, indicating that there was a positive correlation between salt sensitivity and the ability of P. ramosa to infect A. thaliana plants. At the molecular level, a synergistic effect of both salt and P. ramosa stresses was observed on the cold-regulated (COR) gene expression profile of treated A. thaliana seedlings. Our data clarify the interaction between parasitic plants and their hosts under abiotic stress conditions.
Content may be subject to copyright.
The effect of salt stress on Arabidopsis thaliana
and Phelipanche ramosa interaction
S DEMIRBAS*, K E VLACHONASIOS, O ACAR* & A KALDIS
*Biology Department, Sciences and Arts Faculty, C
ßanakkale Onsekiz Mart University, C
ßanakkale, Turkey, and Department of Botany,
Faculty of Sciences, School of Biology, Aristotle University of Thessaloniki, Thessaloniki, Greece
Received 5 June 2013
Revised version accepted 20 June 2013
Subject Editor: Maurizio Vurro, CNR, Bari, Italy
Summary
Salinity and Orobanche or Phelipanche spp. infection
are important crop stress factors in agricultural areas.
In this study, we investigated the effect of salt stress
on Phelipanche ramosa seed germination and its
attachment onto Arabidopsis thaliana roots. We also
evaluated the effect of both stresses on the expression
of genes regulated by abiotic and biotic stresses.
According to our results, high concentration of NaCl
delayed P. ramosa seed germination in the presence of
a strigolactone analogue (GR24). A similar pattern
was observed in the presence of A. thaliana plants.
Furthermore, we found that salt-treated A. thaliana
seedlings were more sensitive to P. ramosa attachment
compared with the untreated plants, indicating that
there was a positive correlation between salt sensitivity
and the ability of P. ramosa to infect A. thaliana
plants. At the molecular level, a synergystic effect of
both salt and P. ramosa stresses was observed on the
cold-regulated (COR) gene expression profile of treated
A. thaliana seedlings. Our data clarify the interaction
between parasitic plants and their hosts under abiotic
stress conditions.
Keywords: parasitic plant, salt-induced gene expres-
sion, cold-regulated genes, relative gene expression
level, biotic stress, abiotic stress, cross-protection.
DEMIRBAS S, VLACHONASIOS KE, ACAR O&KALDIS A (2013). The effect of salt stress on Arabidopsis thaliana and
Phelipanche ramosa interaction. Weed Research 53, 452–460.
Introduction
Plants are sessile organisms which are always exposed
to a variety of biotic and abiotic stress factors. To sur-
vive, they develop mechanisms both for rapid sensing
of signals from a changing environment and for trans-
mitting these in specific adaptive or defensive responses
(Agarwal et al., 2006). Orobanche and Phelipanche spp.
(broomrapes) are obligate root parasites, completely
devoid of leaves and chlorophyll, whose growth and
development fully depend on their hosts for a hetero-
trophic supply of resources (Joel, 2000). Phelipanche
ramosa (L.) Pomel (syn. O. ramosa L.) is the most
widespread and destructive of broomrape species,
affecting tomato, potato and tobacco mainly in the
Mediterranean region and in Mediterranean-like cli-
mates (Parker, 2009). These parasitic weeds are diffi-
cult to control, because they are closely associated
with the host root and are hidden underground for
most of their life cycle (Vurro et al., 2009).
The knowledge of mechanisms involved in resis-
tance against the plant parasite is important for devel-
oping strategies of control. Therefore, we have chosen
Arabidopsis thaliana (L.) Heynh. as a P. ramosa host
model plant. Even though it is not a crop, it is able to
stimulate germination and parasitism of P. ramosa,
Phelipanche aegyptiaca Pomel and Orobanche minor
Smith seeds (Goldwasser et al., 2002). Arabidopsis
Correspondence: Dr. S Demirbas, Biology Department, Sciences and Arts Faculty, C
ßanakkale Onsekiz Mart University, 17100 C
ßanakkale,
Turkey. Tel: (+90) 286 2180018; Fax: (+90) 286 2180533; E-mail: sefer.demirbas@gmail.com
©2013 European Weed Research Society 53, 452–460
DOI: 10.1111/wre.12041
thaliana stimulated seed germination and allowed tuber-
cle development of P. aegyptiaca and P. ramosa, but
did not significantly stimulate seeds of Orobanche cre-
nata Forsk., O. minor or Orobanche cernua Loefl.
(Westwood, 2000). However, if Orobanche spp. seeds
were artificially stimulated with a strigolactone analogue
(GR24), O. crenata and O. minor successfully estab-
lished tubercles on A. thaliana (Westwood, 2000; Gold-
wasser et al., 2002).
The molecular bases of host plantparasitic plant
interaction remain mostly unknown, while studies of
gene expression changes in host response to Oroban-
che spp. are at a preliminary stage (Rispail et al.,
2007). Promoter analysis studies have shown the
specific activation of gene promoters in response to
P. aegyptiaca (Westwood, 2000; Griffitts et al., 2004).
Expression changes in genes known to be involved in
defence reactions to pathogens were investigated in the
A. thalianaP. ramosa interaction (Vieira Dos Santos
et al., 2003a,b; Die et al., 2007). In host plantparasitic
plant interactions, microarrays were used to study the
global expression patterns of rice cultivars against
Striga hermonthica (Delile) Benth. (Swarbrick et al.,
2008) and of Medicago trunculata Gaertn. roots
against O. crenata (Dita et al., 2009).
Salinity is a major abiotic stress affecting approxi-
mately 7% of the world’s total land area, resulting in a
billion dollar losses in crop production around the
world. Salt stress could have major effects on plant
growth and development (Munns, 2002). Salinity entails
ionic stress, osmotic stress and secondary stresses, such
as nutritional imbalances and oxidative stress for glyco-
phytes. To cope with the detrimental effects of salt
stress, plants have evolved many biochemical and
molecular mechanisms. Some of the biochemical strate-
gies are (i) selective build-up or exclusion of salt ions,
(ii) control of ion uptake by roots and transport into
leaves, (iii) ion compartmentalisation, (iv) synthesis of
compatible osmolytes, (v) alteration in photosynthetic
pathway, (vi) changes in membrane structure, (vii)
induction of antioxidative enzymes and (viii) stimulation
of phytohormones (Turkan & Demiral, 2009). Gene
expression is also altered during salt stress. For exam-
ple, COR (cold-regulated) genes are induced by several
abiotic stresses and are related to the hydrophilic
nature of plant cells (Table 1) (Horvath et al., 1993;
Rekarte-Cowie et al., 2008). The gene RD29B (LTI65)
is induced by drought, salt and ABA application
(Table 1) (Thomashow, 1999). Moreover, cytotoxic
reactive oxygen species (ROS) could also occur during
salinity stress. ROS are continuously generated during
normal metabolic processes and can destroy normal
metabolism through oxidative damage of lipids, pro-
teins and nucleic acids when they are produced in
excess (Turkan & Demiral, 2009). In plants, glutathi-
one S-transferase (GST) gene expression is related to
detoxification of ROS and induced by phytohormones
and various stress factors (Table 1) (Chen et al., 2012).
Other factors that are implicated in salt stress as well
as biotic stress are the pathogenesis-related -(PR)
proteins (Campos et al., 2007). Hence, transcriptional
activation of PR genes plays an important role in the
expression of resistance (Jalali et al., 2006). PR-1 and
PLANT DEFENSIN1.2 (PDF1.2, PR12) gene activities
are known to correlate with broomrape, pathogenic
microorganisms or elicitors as part of the systemic
acquired resistance (SAR) response in plants (Table 1)
(Joel & Portinoy, 1998; Vieira Dos Santos et al., 2003b).
Many studies have been carried out to clarify the
interaction between broomrapes and their hosts. In
cultivated field crops infected by broomrape species,
several abiotic stress conditions could co-exist, such as
drought and salt stress. However, there is limited infor-
mation on how other abiotic stress conditions, such as
salinity, could affect this interaction. The objectives of
this study were to (i) evaluate the effect of different
salt concentrations on P. ramosa seed germination in
the presence or absence of A. thaliana plants, (ii) inves-
tigate the effect of salt on P. ramosa attachment to
A. thaliana roots and (iii) monitor the effect of salt on
relative gene expression of some genes during A. thali-
ana and P. ramosa interaction.
Table 1 List of genes used in this study and their attributes
Name Protein encoded Response Reference
COR78 78-kD hydrophilic polypeptide ABA, Salt, Cold, Drought Horvath et al. (1993);
Rekarte-Cowie et al. (2008)
COR6.6 6,6-kD polypeptide ABA, Salt, Cold, Drought Thomashow (1999)
RD29B Hydrophilic polypeptide ABA, Salt, Drought Thomashow (1999)
PR1 Antifungal Marker of SAR Bowling et al. (1994); Vieira Dos
Santos et al. (2003b)
PDF1.2 Defensin JA, Bacteria, Fungi Infection Vieira Dos Santos et al. (2003b);
Penninckx et al. (1998)
GST1 50 kD polypeptide, Subunit of GST Salt, Bacteria, Oxidative Stress Chen et al. (2012); Vieira Dos
Santos et al. (2003b)
©2013 European Weed Research Society 53, 452–460
Salinity, Arabidopsis thaliana and Phelipanche ramosa interaction 453
Materials and methods
Plant materials and seed sterilisation
Arabidopsis thaliana ecotype Wassilewskija (Ws2) was
used as a host. Phelipanche ramosa seeds were collected
from an infested tomato field in C
ßanakkale (Turkey) in
2008. Arabidopsis thaliana seeds were sterilised in 20%
sodium hypochlorite (NaOCl) for 5 min and then
rinsed three times with distilled sterile water and stored
for 3 days in dark and at 4
°
C for stratification. Pheli-
panche ramosa seeds were sterilised in 70% ethanol for
2 min, two times in 5% NaOCl for 10 min and then
rinsed three times with distilled sterile water.
Plant growth and salt treatment
To evaluate the effect of A. thaliana seedlings on
P. ramosa seed germination, A. thaliana ecotype Ws2
and P. ramosa seeds were sown in Gamborg B5 medium
containing 1% sucrose (Gamborg et al., 1968) and sup-
plemented with 0, 50, 75 and 100 mMNaCl. For control,
P. ramosa seeds were sown in 9 cm diameter Petri dish
without A. thaliana seeds. One week after sowing,
200 μL of 1 mg L
1
GR24 (a synthetic analogue
of strigolactones) was used to induce germination
of P. ramosa seeds. After that P. ramosa seeds and
A. thaliana roots were monitored until P. ramosa attach-
ment to A. thaliana roots. Five replications were used
per treatment. The percentage of P. ramosa germination
was determined under a stereo microscope by counting
the number of seeds having an emerged radicle.
For the P. ramosa attachment assay, fifty A. thali-
ana seedlings were grown in 9 cm diameter Petri dish
containing Gamborg B5 medium supplemented with
1% sucrose and 50 mMNaCl for ten days. Five mg of
P. ramosa seeds was sown in a separate Petri dish con-
taining Gamborg B5 medium with 1% sucrose for the
same period. On the tenth day, P. ramosa seeds were
induced by 200 μL of 1 mg L
1
GR24. Immediately
after treatment, A. thaliana seedlings were transferred
onto P. ramosa seeds. Then, A. thaliana roots were
monitored until P. ramosa attachment, nineteen days
after GR24 treatment, using Samsung Digimax 370
camera attached to the stereo microscope (Olympus
SD30). Any germinated and touched seed to A. thali-
ana roots was accepted as attached, and its percentage
was recorded in the total number of the seeds
(Fig. 1AB).
For the gene expression experiments, 5 mg P. ramo-
sa seeds and fifty A. thaliana seeds were sowed on
Gamborg B5 medium supplemented with 1% sucrose
(Fig. 1A). Seedlings were grown in a plant growth
room at 22
°
C with 16 h photoperiod, relative humidity
70% and photosynthetic flux density of approximately
100 μmol m
2
s
1
.
Eighteen days after sowing, P. ramosa attachment
to A. thaliana roots occurred (Fig. 1B). In this time,
0 and 100 mMNaCl were applied to A. thaliana seed-
lings with or without P. ramosa infection by soaking
their roots into salt solution for 0, 3 and 6 h. After
this period, ten seedlings for each treatment were har-
vested and frozen in liquid nitrogen.
RNA extraction and gene expression analysis
Total RNA from A. thaliana seedlings was isolated
using the Nucleospin RNA Plant kit (Macherey
Nagel). The expression levels of specific mRNAs were
assayed using reverse transcription (RT) followed by
quantitative PCR (qPCR) using gene-specific primers
(Table 2). RT reactions were carried out using
A
B
Fig. 1 Growth condition of Arabidopsis thaliana and Phelipanche
ramosa plants (eighteen days after sowing) grown in a Petri dish
(A). Phelipanche ramosa attachment to A. thaliana roots illus-
trated by an arrow at the P. ramosa attachment point (B).
©2013 European Weed Research Society 53, 452–460
454 S Demirbas et al.
0.252μg of DNAse-treated RNA and the Access
RT-PCR system (Promega) from two independent bio-
logical replicates. As a template, 0.252μg of DNAse-
treated RNA was used. The final reaction volume was
40 lL. After the reaction, the samples were diluted five
times in nuclease-free water. Quantitative RT-PCR
was carried out in reactions using 1Χbuffer containing
LightCycler
â
480 SYBR Green I Master (Roche). In
each 10 μL reactions, 2 μL of the RT product was
used. Absolute quantification was applied to qPCR
products using At4 g26410 as a reference gene. The
values were expressed as reference gene-normalised
levels of the target genes.
Statistical analysis
The experiments were repeated two times indepen-
dently, and each data point was the mean of five repli-
cates (n=10). The compiled data were submitted to
ANOVA, and the differences between the means were
compared by Tukey’s HSD test investigating the effect
of different salt concentrations on P. ramosa seed ger-
mination in the presence or absence of A. thaliana
plants. The comparisons with P0.05 were taken as
significantly different. In the investigation of the effect
of salt on P. ramosa attachment to A. thaliana roots,
the differences between the means were compared by
t-test and the comparisons with P0.01 were taken as
significantly different. Student’s t-test was used to
compare the expression of the target genes to determine
whether the differences were significant at P0.05.
All data were analysed using Statistical Package for
the Social Sciences (SPSS) 17.0 for Windows.
Results
We examined the effect of different salt concentrations
on P. ramosa seed germination, P. ramosa attachment
to A. thaliana roots and stress-related gene expression
profile during A. thaliana and P. ramosa interaction.
P. ramosa seeds do not germinate without a stimulant
(Joel, 2000). Therefore, we treated P. ramosa seeds
with GR24, and seed germination occurred 3 days
after the treatment. To evaluate the effect of salt stress
on P. ramosa seed germination, P. ramosa -induced
seeds were treated with different concentrations of
NaCl. High concentration of salt resulted in 80% ger-
mination decrease in P. ramosa seeds. Moreover, salt
stress delayed P. ramosa seed germination in the pres-
ence of GR24, because only 50% of the seed germi-
nated twelve days after sowing (Fig. 2A; Fig. 3AB).
In the presence of A. thaliana seedlings, the seed ger-
mination was approximately 60% seventeen days after
the salt treatment in all treatments, except 100 mM
NaCl (Fig. 2B). In both treatments, increasing the salt
concentration delayed the P. ramosa seed germination
rate (Fig. 2AB), suggesting that salt stress negatively
Table 2 Nucleotide sequences of primers used
Gene Primer sequence
PDF1.2 F5-TCATGGCTAAGTTTGCTTCC
R5-AATACACACGATTTAGCACC
COR78 F5- GAAAGGAGGAGGAGGAATGG
R5- AACCAGCCAGATGATTTTGG
PR1 F5-GTAGGTGCTCTTGTTCTTCC
R5-CACATAATTCCCACGAGGATC
RD29B F5-GTGAAGATGACTATCTCGGTGGTC
R5-GAATCAAAAGCTGGGATGGA
GST1 F5-CAGCCACTAGAAGAGTTCTCAT
R5-CTTGAAGTCTCCATCTTCAAAGG
COR6.6 F5- CTGGCAAAGCTGAGGAGAAG
R5- ACTGCCGCATCCGATATACT
AT4G26410 F5-GAGCTGAAGTGGCTTCCATGAC
R5-GGTCCGACATACCCATGATCC
A
B
0
25
50
75
100
010 12 14 17
P. ramosa seed germination (%)
Time (days after sowing)
Control
50 mM
75 mM
100 mM
0
25
50
75
100
0 10121417
P. ramosa seed germination (%)
Time (days after sowing)
Control
50 mM
75 mM
100 mM
b
ab
aa
e
de
b-d
bc
eee
c-e
eee
e
b
aaa
e-gd-g
d
c
de
fg
e-g
d-f
e-ge-ge-g
g
Fig. 2 The effect of NaCl on Phelipanche ramosa seed germina-
tion. (A) GR24-treated seeds in the absence of Arabidopsis thali-
ana seedling. GR24 was added to P. ramosa seeds 7 days after
sowing. (B) In the presence of A. thaliana seedlings only. Values
are given as means (n=10). Vertical bars indicate SE. The
data were submitted to ANOVA, and the differences between the
means were compared using Tukey’s HSD post hoc tests. Differ-
ent letters indicate statistical differences at the level P0.05.
©2013 European Weed Research Society 53, 452–460
Salinity, Arabidopsis thaliana and Phelipanche ramosa interaction 455
affects P. ramosa seed germination in the presence of
the host plant. Specifically, the effect of salt stress was
more pronounced in the early stages of P. ramosa seed
germination rate (Fig. 2AB). Nevertheless, the seed
germination of P. ramosa recovered seventeen days
after the salt treatment. For GR24-treated seeds, 34%
reduction occurred twelve days after the treatment
under 100 mMNaCl condition in comparison with the
control plants (Fig. 2A), whereas 40% reduction
occurred in the presence of A. thaliana seedlings for
the same condition (Fig. 2B).
The effect of salt stress on the ability of P. ramosa
to attach to A. thaliana roots was also investigated.
For this experiment, a mild stress of 50 mMNaCl was
used to evaluate the attachment ability of P. ramosa to
A. thaliana roots. Phelipanche ramosa attachment onto
A. thaliana roots occurred ten days after GR24 treat-
ment. The salt-treated A. thaliana seedlings were more
sensitive to P. ramosa attachment in comparison with
the untreated plants, ranging from 50% to 25%
respectively. Consequently, modest salt treatment of
A. thaliana seedlings caused an increase in the ability
of P. ramosa to infect and attach to A. thaliana roots.
We next examined the effect of salt stress and P.
ramosa infection on salt-induced gene expression in
A. thaliana seedlings. In this study, quantitative tran-
script expression levels of three COR genes, COR6.6,
COR78 and RD29B, were investigated during the inter-
action between A. thaliana and P. ramosa under salt
stress. Quantitative PCR results were normalised using
At4g26410 as a reference gene, and the results obtained
by 0 h and 0 mMNaCl were arbitrarily set as the con-
trol to which the levels of gene expression of the other
treatments were compared. The expression of COR6.6,
as expected, was increased 3 h after salt treatment and
remained high at 6 h of stress (Fig. 4A). COR6.6 was
not induced during P. ramosa infection. However, the
expression of COR6.6 was more pronounced when
both stresses were presented (Fig. 4A), suggesting a
synergistic effect of both stresses. COR78 expression
level also increased rapidly upon salt stress (Fig. 4B).
After 6 h of P. ramosa infection, an increase in
COR78 expression was observed, suggesting that this
gene is not only induced by salt stress but also by
P. ramosa infection (Fig. 4B). When both stresses were
present, the expression profile of COR78 was similar
to that observed during salt stress, except at 6 h
(Fig. 4B). Upon salt stress, RD29B expression was rap-
idly increased 3 h after the start of treatment and
decreased after 6 h. Similar to COR6.6 expression,
RD29B is not expressed upon P. ramosa infection.
However, when both stresses were present, a transient
profile was observed, characterised by a rapid induc-
tion 3 h after both salt treatment and P. ramosa infec-
tion, followed by a decrease in the expression after 6 h
(Fig. 4C). The data suggest that at least two indepen-
dent signalling pathways are induced to regulate the
expression of RD29B in the presence of both stresses.
The expression level of the marker of oxidative stress
GST1 gene was elevated upon salt stress (Fig. 4D).
This gene is also induced upon P. ramosa infection,
suggesting that in both stresses, oxidative stress occurs.
Moreover, GST1 expression profile in both stresses
was similar to that observed in salt stress (Fig. 4D).
To determine whether PR genes are expressed during
P. ramosa infection of A. thaliana seedlings, we evalu-
ated the expression of the PR1 gene upon salt stress,
P. ramosa infection and the combination of both stresses.
As expected, the PR1 gene was not expressed upon salt
stress, whereas a rapid induction after P. ramosa infec-
tion was observed (Fig. 4E). In the presence of
both salt stress and P. ramosa infection, the level of
PR1 expression was similar to that observed during
P. ramosa infection (Fig. 4E). Therefore, we have con-
cluded that the SAR pathway was induced during
A
B
Fig. 3 The effect of NaCl on Phelipanche ramosa seed germina-
tion after GR24 treatment. (A) 0 mMNaCl; (B) 75 mMNaCl,
both twelve days after sowing.
©2013 European Weed Research Society 53, 452–460
456 S Demirbas et al.
P. ramosa infection of A. thaliana seedlings. Another
gene marker that is involved in biotic stress responses
is the PDF1.2, which is also induced by ethylene and
jasmonic acid. In our experiments, PDF1.2 expression
was induced upon salt stress, as well as P. ramosa
infection (Fig. 4F).
Discussion
Defensive mechanisms of host plants to broomrapes
are still not well understood, although some selected
cultivars have been developed that display resistance to
broomrapes, such as in sunflower (Labrousse et al.,
0.0
2.0
4.0
6.0
036
COR6.6/At4g26410 expression
Stress duration (h)
NaCl
P.ramosa
NaCl & P.ramosa
0.0
10.0
20.0
30.0
036
COR78/At4g26410 expression
Stress duration (h)
NaCl
P.ramosa
NaCl & P.ramosa
0.0
2.0
4.0
6.0
036
RD29B/At4g26410 expression
Stress duration (h)
NaCl
P.ramosa
NaCl & P.ramosa
c
bc
a
b
ab
bc
c
a
ab
c
d
b
e
e
ab
a
b
c
ab
d
d
0.0
2.0
4.0
6.0
036
GST1/At4g26410 expression
Stress duration (h)
NaCl
P.ramosa
NaCl & P.ramosa
0.0
1.5
3.0
4.5
036
PR1/At4g26410 expression
Stress duration (h)
NaCl
P.ramosa
NaCl & P.ramosa
0.0
6.0
12.0
18.0
036
PDF1.2/At4g26410 expression
Stress duration (h)
NaCl
P.ramosa
NaCl & P.ramosa
cc
ab
c
b
ab
a
a
ab
a
c
d
a
a
ab
bc
ab
bc
d
a
A
B
C
D
E
F
Fig. 4 Quantitative transcript expression levels of COR6.6 (A), COR78 (B), RD29B (C), GST1 (D), PR1 (E) and PDF1.2 (F) genes dur-
ing Arabidopsis thalianaPhelipanche ramosasalt interaction. Values are given as means (n=10). ‘0 time’ indicates control point. Verti-
cal bars indicate SE. Student’s t-test was used to compare the expression of the target genes to determine whether the differences
were significant at P0.05. Different letters indicate statistical differences.
©2013 European Weed Research Society 53, 452–460
Salinity, Arabidopsis thaliana and Phelipanche ramosa interaction 457
2004; Letousey et al., 2007; Demirbas & Acar, 2008),
pea (Rubiales et al., 2005; Castillejo et al., 2012), faba
bean (Abdelhamid et al., 2010) and clover (Castillejo
et al., 2009). Most often during broomrape infection
on host plants, other abiotic stresses may also be
involved, such as salt, drought and heat stress. In the
present study, we explored the effect of salt stress on
the interaction between A. thaliana and P. ramosa at
physiological and molecular levels.
First, we asked whether salt stress affects seed ger-
mination of P. ramosa. Our data suggest that salt
stress could inhibit P. ramosa seed germination more
effectively at the early stage of germination. Although
germination of P. ramosa was inhibited for a short
time by salt stress, P. ramosa seeds were able to germi-
nate. Our results support those of Hassan et al. (2010)
who found that salt stress inhibited O. ramosa seed
germination and significantly reduced O. minor seed
germination.
Phelipanche ramosa attachment to A. thaliana roots
increased approximately twofold in plants grown under
50 mMNaCl compared with the control plants. After
salt treatment, A. thaliana, a glycophytic plant, dis-
played a reduced tolerance to parasite haustorium
attachment, suggesting that salt stress affects P. ramo-
sa infestation of the host plant. Likewise, Abdelhamid
et al. (2010) indicated that there was evidence on the
positive relationship between salt tolerance and O. cre-
nata tolerance for faba beans cultivars under O. cre-
nata infestation.
Many genes have been demonstrated to respond to
drought, high salinity and cold stress, and the pro-
teins encoded by some of these genes are considered
to function in protecting cells from these stresses.
To further study the interaction between salt and
P. ramosa in A. thaliana seedlings, we monitored
expression of the genes that are regulated by salt or
biotic stress. Therefore, we monitored the expression
of COR6.6,COR78 and RD29B under salt stress and
P. ramosa infection. These genes have been widely
used to monitor abiotic stress response pathways in
plants. For example, COR genes in A. thaliana plants
are inducible with high salinity (Thomashow, 1999;
Kaldis et al., 2011). COR78,COR6.6 and RD29B are
responsive to ABA, drought, cold acclimation and
salinity (Horvath et al., 1993; Thomashow, 1999).
Alteration in expression of these genes caused by salt
treatment during the interaction between A. thaliana
and P. ramosa is reported for the first time in this study.
We found that the expression of these genes could be
regulated by P. ramosa infestation. Moreover, a syner-
gistic effect of the two stresses on gene expression profile
was observed, suggesting that at least two signalling
pathways are stimulated either by salt and/or P. ramosa
infection to affect the transcription of genes induced by
abiotic stress.
We also examined the expression of genes involved
in biotic stress including PR1 and PDF1.2. PR proteins
are defined as proteins encoded by host plants that are
induced in pathological or related situations and repre-
sent major quantitative alterations in soluble protein
during the defence response (Campos et al., 2007).
PR1 gene expression is used as a molecular marker for
SAR. Although little is known about the signalling
pathway that leads to systemic resistance and the
expression of PR genes, the importance of SA as a sig-
nal molecule for SAR is well documented (Bowling
et al., 1994). In our study, PR1 expression was induced
by P. ramosa infestation rather than by salt stress.
Moreover, salt stress had no effect on the induction of
PR1 expression by P. ramosa, suggesting that only the
SAR pathway is stimulated by P. ramosa. In contrast,
Griffitts et al. (2004) reported that the promoter of
PR1a in tobacco plants was not induced by parasitism
of P. aegyptiaca, suggesting for differential expression
of PR genes during specific interaction between broom-
rapes and the hosts. Dita et al. (2009) characterised
the legume transcriptome under O. crenata parasitism
where the PR1 gene was expressed in SA4087, a late
resistant variety. PDF1.2 is often used as a marker for
the interactions between the ethylene and jasmonic
acid signal pathways for the induction of defence
response (Penninckx et al., 1998). In our study,
PDF1.2 gene expression was induced by salt as well as
by P. ramosa infestation. Vieira Dos Santos et al.
(2003b) also reported similar increasing of this gene
expression with P. ramosa.
GSTs are induced by various environmental stimuli,
with increased GST levels used to maintain cell redox
homeostasis and protect organisms against oxidative
stress. To test whether oxidative stress is involved dur-
ing salt and P. ramosa interaction in A. thaliana seed-
lings, we evaluated the expression level of GST1,
which is used in many studies as an oxidative stress
indicator (Vieira Dos Santos et al., 2003a,b). We found
that oxidative stress occurred during both salt and
P. ramosa infestation of A. thaliana seedlings, as moni-
tored by high expression of GST1 gene. Similarly,
Vieira Dos Santos et al. (2003a,b) have also observed
a rapid but transient expression of GST1 during
A. thaliana-P. ramosa interaction.
Conclusions
In the present study, we investigated the effect of salt
stress during A. thalianaP. ramosa interaction. We
found that salt-treated A. thaliana seedlings were more
sensitive to P. ramosa attachment in comparison with
©2013 European Weed Research Society 53, 452–460
458 S Demirbas et al.
the untreated plants and also that the high concentra-
tion of salt delayed P. ramosa seed germination. At
the molecular level, when both salt and P. ramosa
stresses were applied to Arabidopsis plants, a synergetic
effect of both stresses on the gene expression profile
was observed.
Acknowledgements
We would like to thank Stylianos Poulios (AUTh) for
his technical assistance. Sefer Demirbas was funded by
an Erasmus exchange program between AUTh and
COMU.
References
ABDELHAMID MT, SHOKR MB & BEKHETA MA (2010)
Effects of induced salinity on four Vicia faba cultivars
differing in their broomrape tolerance. In: Proceedings
of Fourteenth International Water Technology
Conference (IWTC 14 2010) (21–23 March, Cairo, Egypt).
421427.
AGARWAL PK, AGARWAL P, REDDY MK & SOPORY SK (2006)
Role of DREB transcription factors in abiotic and biotic
stress tolerance in plants. Plant Cell Reports 25, 1263
1274.
BOWLING SA, GUO A, CAO H, GORDON S, KLESSIG DF &
DONG X (1994) A mutation in Arabidopsis that leads to
constitutive expression of systemic acquired resistance. The
Plant Cell 6, 18451857.
CAMPOS MA, ROSA DD, TEIXEIRA J
EC et al. (2007) PR gene
families of citrus: their organ specific-biotic and abiotic
inducible expression profiles based on ESTs approach.
Genetics and Molecular Biology 30, 917930.
CASTILLEJO MA, MALDONADO AM, DUMAS-GAUDOT Eet al.
(2009) Differential expression proteomics to investigate
responses and resistance to Orobanche crenata in Medicago
truncatula.BMC Genomics 10, 294.
CASTILLEJO MA, FERN
ANDEZ-APARICIO M&RUBIALES D
(2012) Proteomic analysis by two-dimensional differential
in gel electrophoresis (2D DIGE) of the early response of
Pisum sativum to Orobanche crenata.Journal of
Experimental Botany 63, 107119.
CHEN JH, JIANG HW, HSIEH EJ et al. (2012) Drought and
salt stress tolerance of an Arabidopsis glutathione
s-transferase u17 knockout mutant are attributed to the
combined effect of glutathione and abscisic acid. Plant
Physiology 158, 340351.
DEMIRBAS S&ACAR O (2008) Superoxide dismutase and
peroxidase activities from antioxidative enzymes in
Helianthus annuus L. roots during Orobanche cumana
Wallr. penetration. Fresenius Environmental Bulletin 17,
10381044.
DIE JV, DITA MA, KRAJINSKI Fet al. (2007) Identification by
suppression subtractive hybridization and expression
analysis of Medicago truncatula putative defence genes in
response to Orobanche crenata parasitization. Physiological
& Molecular Plant Pathology 70,4959.
DITA MA, DIE JV, ROM
AN Bet al. (2009) Gene expression
profiling of Medicago truncatula roots in response to the
parasitic plant Orobanche crenata.Weed Research 49,
6680.
GAMBORG OL, MILLER RA & OJIMA K (1968) Nutrient
requirements of suspension cultures of soybean root cells.
Experiment Cell Research 50, 151158.
GOLDWASSER Y, WESTWOOD JH & YODER JI (2002) The use of
Arabidopsis to study interactions between parasitic
angiosperms and their plant hosts. In: The Arabidopsis
Book, Vol. 1(eds CR SOMERVILLE &EMMEYEROWITZ),
e0035. American Society of Plant Biologists, Rockville,
MD, USA. doi:10.1199/tab.0035. Available at: http://www.
bioone.org/doi/abs/10.1199/tab.0035.
GRIFFITTS AA, CRAMER CL & WESTWOOD JH (2004) Host
gene expression in response to Egyptian broomrape
(Orobanche aegyptiaca). Weed Science 52, 697703.
HASSAN MM, SUGMUTO Y, BABIKER AGE, YAMAUCHI Y,
OSMAN MGE & YAGOUB SO (2010) Effect of NaCl on
Orobanche spp. and Striga hermonthica seeds germination
during and after conditioning. Bioscience Research 7,2631.
HORVATH DP, MCLARNEY BK & THOMASHOW MF (1993)
Regulation of Arabidopsis thaliana L. (Heyn) cor78 in
response to low temperature. Plant Physiology 103,
10471053.
JALALI BL, BHARGAVA S&KAMBLE A (2006) Signal
transduction and transcriptional regulation of plant defence
responses. Journal of Phytopathology 154,6574.
JOEL DM (2000) The long-term approach to parasitic weeds
control: manipulation of specific developmental
mechanisms of the parasite. Crop Protection 19, 753758.
JOEL DM & PORTINOY VH (1998) The angiospermous root
parasite Orobanche L. (Orobanchaceae) induces expression
of a pathogenesis related (PR) gene insusceptible tobacco
roots. Annals of Botany 81, 779781.
KALDIS A, TSEMENTZI D, TANRIVERDI O&VLACHONASIOS KE
(2011) Arabidopsis thaliana transcriptional co-activators
ADA2b and SGF29a are implicated in salt stress
responses. Planta 233, 749762.
LABROUSSE P, ARNAUD MC, GRIVEAU Y, FER A&
THALOUARN P (2004) Analysis of resistance criteria of
sunflower recombined inbred lines against Orobanche
cumana Wallr. Crop Protection 23, 407413.
LETOUSEY P, DEZELICOURT A, VIEIRA DOS SANTOS Cet al.
(2007) Molecular analysis of resistance mechanisms to
Orobanche cumana in sunflower. Plant Pathology 56,
536546.
MUNNS R (2002) Comparative physiology of salt and water
stress. Plant, Cell and Environment 25, 239250.
PARKER C (2009) Observations on the current status of
Orobanche and Striga problems worldwide. Pest
Management Science 65, 453459.
PENNINCKX IAMA, THOMMA BPHJ, BUCHALA A, M
ETRAUX JP
&B
ROEKAERT WF (1998) Concomitant activation of
jasmonate and ethylene response pathways is required for
induction of a plant defensin gene in Arabidopsis.Plant
Cell 10, 21032113.
REKARTE-COWIE I, EBSHISH OS, MOHAMED KS & PEARCE RS
(2008) Sucrose helps regulate cold acclimation of
Arabidopsis thaliana.Journal of Experimental Botany 59,
42054217.
©2013 European Weed Research Society 53, 452–460
Salinity, Arabidopsis thaliana and Phelipanche ramosa interaction 459
RISPAIL N, DITA MA, GONZALEZ-VERDEJO Cet al. (2007)
Plant resistance to parasitic plants: molecular approaches
to an old foe. New Phytology 173, 703712.
RUBIALES D, MORENO MT & SILLERO JC (2005) Search for
resistance to crenate broomrape (Orobanche crenata) in pea
germplasm. Genetic Resources and Crop Evolution 52,
853861.
SWARBRICK PJ, HUANG K, LIU G, SLATE J, PRESS MC &
SCHOLES JD (2008) Global patterns of gene expression in
rice cultivars undergoing a susceptible or resistant
interaction with the parasitic plant Striga hermonthica.
New Phytologist 179, 515529.
THOMASHOW MF (1999) Plant cold acclimation: freezing
tolerance genes and regulatory mechanisms. Annual Review
of Plant Physiology and Plant Molecular Biology 50,
571599.
TURKAN I&DEMIRAL T (2009) Recent developments in
understanding salinity tolerance. Environmental and
Experimental Botany 67,29.
VIEIRA DOS SANTOS C, DELAVAULT P, LETOUSEY P&
THALOUARN P (2003a) Identification by suppression
subtractive hybridization and expression analysis of
Arabidopsis thaliana putative defence genes during
Orobanche ramosa infection. Physiological and Molecular
Plant Pathology 62, 297303.
VIEIRA DOS SANTOS C, LETOUSEY P, DELAVAULT P&
THALOUARN P (2003b) Defense gene expression analysis of
Arabidopsis thaliana parasitized by Orobanche ramosa.
Phytopathology 93, 451457.
VURRO M, BOARI A, EVIDENTE A, ANDOLFI A&ZERMANE N
(2009) Natural metabolites for parasitic weed management.
Pest Management Science 65, 566571.
WESTWOOD JH (2000) Characterization of the Orobanche
Arabidopsis system for studying parasitehost interactions.
Weed Science 48, 742748.
©2013 European Weed Research Society 53, 452–460
460 S Demirbas et al.
... It is also poorly studied if parasitic plants grow well on salt-stressed hosts. Demirbas reported increased susceptibility of Arabidopsis to Orobanche ramosa infection at 50 mM NaCl [82]. In contrast, Al-Khateeb [83] reported significantly reduced infection of Lycopersicon esculentum plants by Orobanche cernua at 50 mM and completely absent infection at 75 mM NaCl. ...
... Arabidopsis is susceptible to many Orobanche spp. [82,[124][125][126][127][128] and Cuscuta spp. [129,130] and could be used to study interactions between parasitic plants and their hosts regarding germination stimulants, haustoria-inducing factors and host response to parasitism [131]. ...
Article
Full-text available
Parasitic angiosperms, comprising a diverse group of flowering plants, are partially or fully dependent on their hosts to acquire water, mineral nutrients and organic compounds. Some have detrimental effects on agriculturally important crop plants. They are also intriguing model systems to study adaptive mechanisms required for the transition from an autotrophic to a heterotrophic metabolism. No less than any other plant, parasitic plants are affected by abiotic stress factors such as drought and changes in temperature, saline soils or contamination with metals or herbicides. These effects may be attributed to the direct influence of the stress, but also to diminished host availability and suitability. Although several studies on abiotic stress response of parasitic plants are available, still little is known about how abiotic factors affect host preferences, defense mechanisms of both hosts and parasites and the effects of combinations of abiotic and biotic stress experienced by the host plants. The latter effects are of specific interest as parasitic plants pose additional pressure on contemporary agriculture in times of climate change. This review summarizes the existing literature on abiotic stress response of parasitic plants, highlighting knowledge gaps and discussing perspectives for future research and potential agricultural applications.
... This study was set up following the experimental protocol of Demirbas et al. [10] which is described below. However, our present study differs from theirs in that the determination of changes in antioxidant defense system enzymes, plant growth, and pigment content in A. thaliana was conducted under the P. ramosa infection and salt stress. ...
... ramosa interaction and that the GST1 gene was induced during the first 8 h after P. ramosa contact with the A. thaliana callus [26,27]. Furthermore, oxidative stress occurred during both salt and P. ramosa infestation of A. thaliana seedlings, as monitored by high expression of the GST1 gene [10]. ...
Article
Full-text available
The effects of salinity stress on growth parameters and the activities of antioxidant enzymes (superoxide dismutase (SOD), peroxidase (POX), catalase (CAT), glutathione reductase (GR), and ascorbate peroxidase (APX)) were investigated in Arabidopsis thaliana during Phelipanche ramosa mediated biotic stress. The experiment was conducted using 100 mM NaCl on infected 18-day-old A. thaliana plants in Gamborg B5 medium. P. ramosa infection reduced root length and shoot dry weight (DW) in A. thaliana. After salt stress treatment shoot fresh weight (FW) decreased in A. thaliana plants infected with P. ramosa. Salt stress treatment produced a significant reduction in carotenoid and total chlorophyll content while it did not change the chl a/b ratio of infected plants. POX and APX activities increased during P. ramosa infection in A. thaliana. Additional NaCl treatment decreased the level of lipid peroxidation accompanied by an increment in SOD, POX, GR, CAT and APX activities, while chl a/b ratio and total chl content decreased. These results, presented for the first time, demonstrated induction of the antioxidant defense system against P. ramosa infection by NaCl treatment in A. thaliana.
Article
Full-text available
Broomrape parasitic plants (Orobanche cumana Wallr.) lack the ability of photosynthesis to cause severe yield losses due to infection level in sunflower (Helianthus annuus L.) production areas. In this study, it was tried to determine the extent to which broomrape resistant (LG5582) and sensitive (Özdemirbey) sunflower varieties were affected by broomrape infection collected from some fields of sunflower production in Tekirdağ, Kırklareli and Edirne provinces between 2003 and 2016. Firstly, germination ability of the collected broomrape seeds was determined in vitro condition. Then, the level of the broomrape infection and root/shoot length, fresh root/shoot weight, dry root/shoot weight, specific leaf area (SLA) was determined by the sampling of sunflower plants on the day of the broomrape seedlings' emerging the soil surface in vivo condition. According to the results, it was determined that the highest damage in sensitive sunflower variety was from the seeds of broomrape collected in 2016; the seeds collected in 2003 were still germinated and could cause infection in sensitive sunflower; the increase in infection level caused an increase in the root length and shoot weight/dry weight and a decrease in SLA level when the growth of sunflower plants were examined. And also, it was determined that changes in shoot length and root fresh/dry weight of sunflower seedlings could not be related to infection.
Article
The parasite Phelipanche aegyptiaca infests tomato, a crop plant that is commonly cultivated in semi-arid environments, where tomato may be subject to salt stress. Since the relationship between the two stresses – salinity and parasitism – has been poorly investigated in tomato, the effects of P. aegyptiaca parasitism on tomato growing under moderate salinity were examined. Tomatoes were grown with regular or saline water irrigation (3 and 45 mM Cl⁻, respectively) in soils infested with P. aegyptiaca. The infested plants accumulated higher levels of sodium and chloride ions in the roots, shoots and leaves (old and young) under both salinity levels vs non-infected plants. There was a positive linear correlation between P. aegyptiaca biomass and salt accumulation in young tomato leaves, and a negative linear correlation between parasite biomass and the osmotic potential of young tomato leaves. Concentrations of the osmoprotectants proline, myoinositol and sucrose were reduced in infected tomato plants, which impaired the host's osmotic adjustment ability. The sensitivity of P. aegyptiaca to salt stress was manifested as a decrease in biomass. In conclusion, P. aegyptiaca parasitism reduced the salt tolerance of tomato plants by promoting the accumulation of salts from the rhizosphere and impairing the host's osmotic adjustment ability.
Presentation
Full-text available
The aim of this study was to investigate the effects of P. aegyptiaca and salt stress on lipid peroxidation and antioxidant enzyme activities (SOD, POX) in two tomato varieties which are cultivated in Çanakkale, Turkey (Lycopersicon esculentum cv. Rio Grande and Troy F1).
Article
Full-text available
The influence of the holoparasite branched broomrape on the vegetative growth, leaf chlorophyll content, photosynthetic rate, and chlorophyll fluorescence of tomato was studied over two growing seasons on plants grown in a commercial greenhouse. The presence of the parasite strongly reduced the aerial biomass by acting as a competing sink for assimilate, but more importantly, by compromising the efficiency of carbon assimilation via a reduction in leaf chlorophyll content and photosynthetic rate. The chlorophyll fluorescence parameters F0, Fm, Fv, and Fv/Fm were all altered in parasitized plants, indicating that branched broomrape–infected plants are more susceptible to photoinhibition. The degree of damage to the host was not dependent on either the number or the biomass of parasitic plants per host plant. We suggest that the ability to maintain a high photosynthetic rate, leaf chlorophyll content, or both and the ability to minimize photoinhibition can be developed as indirect assays for improved tolerance to branched broomrape. --- Nomenclature: Branched broomrape, Orobanche ramosa L. ORARM; tomato, Solanum lycopersicum L. ‘Ikram’. Keywords: Parasitic plant, host development, chlorophyll content, chlorophyll fluorescence --- [http://www.bioone.org/doi/abs/10.1614/WS-07-147.1]
Article
Full-text available
Parasitic weeds pose severe constraint on major agricultural crops. Varying levels of resistance have been identified and exploited in the breeding programmes of several crops. However, the level of protection achieved to date is either incomplete or ephemeral. Resistance is mainly determined by the coexistence of several mechanisms controlled by multigenic and quantitative systems. Efficient control of the parasite requires a better understanding of the interaction and their associated resistance mechanisms at the histological, genetic and molecular levels. Application of postgenomic technologies and the use of model plants should improve the understanding of the plant-parasitic plant interaction and drive not only breeding programmes through either marker-assisted selection (MAS) or transgenesis but also the development of alternative methods to control the parasite. This review presents the current approaches targeting the characterization of resistance mechanisms and explores their potentiality to control parasitic plants.
Article
Full-text available
The parasitic plants Orobanche and Striga spp. are holo- and hemi-parasites respectively, which largely depend on a host plant to obtain their nutrients and water. The objective of this study was to investigate the effect of NaCl on Orobanche and Striga seed germination under laboratory condition. Seeds of Orobanche minor were exposed to 50, 75, 100 and 150 mM NaCl solutions during or after conditioning period (for 7 days) and induced to germinate by a synthetic germination stimulant GR24. As a result, seed germination was decreased significantly with the increase in salt solution concentration during conditioning. Significant reduction in O. minor seed germination was observed at highest NaCl level (150 mM). It reduced germination by 92% as compared to the corresponding control. On the other hands, germination response of O. minor seeds conditioned in water and then treated with mixture of GR24 and NaCl 1:1 (v/v) was studied, and results displayed that germination of O. minor seeds was inhibited with increasing NaCl concentrations. Seeds treated with 150 mM, exhibited reduced germination by 77% as compared with control. With respect to O. crenata and Striga, results showed that all concentrations of NaCl decrease seeds germination. Of all NaCl concentration tested, 100 mM displayed the most inhibitory effect. Osmotic potential may significantly affect germination and radicle elongation of parasitic weeds.
Article
Full-text available
Hydrogen peroxide (H2O2), an important relatively stable non-radical reactive oxygen species (ROS) is produced by normal aerobic metabolism in plants. At low concentrations, H2O2 acts as a signal molecule involved in the regulation of specific biological/physiological processes (photosynthetic functions, cell cycle, growth and development, plant responses to biotic and abiotic stresses). Oxidative stress and eventual cell death in plants can be caused by excess H2O2 accumulation. Since stress factors provoke enhanced production of H2O2 in plants, severe damage to biomolecules can be possible due to elevated and non-metabolized cellular H2O2. Plants are endowed with H2O2-metabolizing enzymes such as catalases (CAT), ascorbate peroxidases (APX), some peroxiredoxins, glutathione/thioredoxin peroxidases, and glutathione sulfo-transferases. However, the most notably distinguished enzymes are CAT and APX since the former mainly occurs in peroxisomes and does not require a reductant for catalyzing a dismutation reaction. In particular, APX has a higher affinity for H2O2 and reduces it to H2O in chloroplasts, cytosol, mitochondria and peroxisomes, as well as in the apoplastic space, utilizing ascorbate as specific electron donor. Based on recent reports, this review highlights the role of H2O2 in plants experiencing water deficit and salinity and synthesizes major outcomes of studies on CAT and APX activity and genetic regulation in drought- and salt-stressed plants.
Article
Full-text available
Salt stress, considered as one of the major factors, decreases crop productivity world-wide and hence, investigations are being made to understand the cellular basis of salt tolerance in plants. In our earlier studies, maintenance of redox homeostasis and energetics were found as key determinants of salt tolerance in a halophyte Sesuvium portulacastrum (high salt accumulator). The redox homeostasis is defined as integrated ratio of different redox couples present inside the cell. In recent years, it has also been proposed as general stress response regulator in plants, bacteria as well as animals. In view of this, present study was performed to compare responses of redox state and energetics of S. portulacastrum with a glycophyte Brassica juncea (low salt accumulator). The data revealed activation of antioxidant defense in S. portulacastrum which either avoided or delayed the accumulation of different reactive oxygen species (ROS). In contrast, due to the lack of co-ordination, although the non-enzymatic antioxidants were increased, significant oxidative damage was seen in B. juncea. Further, the decreased NADPH oxidase activity suggested that basal redox signaling was also affected in B. juncea. In order to correlate these changes with chloroplastic and mitochondrial electron transport chain, NADP/NADPH and NAD/NADH ratios were measured. The NADP/NADPH ratio suggested that the process of photosynthesis was minimally affected in S. portulacastrum which might have contributed to its lower level of ROS under salt stress. The comparatively lower NAD/NADH and ATP/ADP ratios in S. portulacastrum as compared to B. juncea indicated the active and better utilization of energy generated to support different processes associated with salt tolerance. Thus, the findings suggest that co-ordinated regulation of antioxidant defense to avoid oxidative damage and proper utilization of energy are the key determinants of salt-tolerance in plants.