Article

DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol

1] Broad Institute of MIT and Harvard, Cambridge, Massachusetts, USA. [2] McGovern Institute for Brain Research, Department of Brain and Cognitive Sciences, Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA. [3] Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts, USA. [4].
Nature Biotechnology (Impact Factor: 41.51). 07/2013; 31(9). DOI: 10.1038/nbt.2647
Source: PubMed

ABSTRACT

The Streptococcus pyogenes Cas9 (SpCas9) nuclease can be efficiently targeted to genomic loci by means of single-guide RNAs (sgRNAs) to enable genome editing. Here, we characterize SpCas9 targeting specificity in human cells to inform the selection of target sites and avoid off-target effects. Our study evaluates >700 guide RNA variants and SpCas9-induced indel mutation levels at >100 predicted genomic off-target loci in 293T and 293FT cells. We find that SpCas9 tolerates mismatches between guide RNA and target DNA at different positions in a sequence-dependent manner, sensitive to the number, position and distribution of mismatches. We also show that SpCas9-mediated cleavage is unaffected by DNA methylation and that the dosage of SpCas9 and sgRNA can be titrated to minimize off-target modification. To facilitate mammalian genome engineering applications, we provide a web-based software tool to guide the selection and validation of target sequences as well as off-target analyses.

Download full-text

Full-text

Available from: Thomas James Cradick, Mar 27, 2014
    • "In addition, to avoid off-target effects, the crRNAs were optimized using the http://crispr.mit.edu/ site and aligning sequences to the zebrafish genome (Hsu et al. 2013). Cell culture, DNA transfection and establishment of stable cell lines "
    [Show abstract] [Hide abstract]
    ABSTRACT: Objectives The potential of CRISPR/Cas9 gene editing to repress CyHV-3 was tested in vitro. Results By targeting two basic target genes necessary for the early transcription of CyHV-3, we show that virus transcription and particle release were significantly decreased by CRISPR/Cas9, as measured by quantitative real-time PCR and virus titration experiments, respectively. Conclusions (A) The effectiveness is confirmed of the CRISPR/Cas9 system at repressing exogenous genes, including large viral genomic DNA, by introducing site-specific mutations in vitro. (B) The CyHV-3 virus replicates poorly in Cas9-positive cells. (C) The inhibition of thymidine kinase alone cannot block viral particle release.
    No preview · Article · Dec 2015 · Biotechnology Letters
    • "Successful dsDNA targeting by type II CRISPR-Cas systems requires not only crRNA/ps complementarity, but also the presence of a PAM. SpyCas9 requires a NGG PAM in both bacterial and eukaryotic cells, although the less optimal NAG variant could also function (Hsu et al., 2013; Jiang et al., 2013; Zhang et al., 2014). Here we confirm that NmeCas9 has a strong preference for G at the first position of the GATT PAM, both in its native cellular environment and in vitro, corroborating findings from an earlier study in E. coli (Esvelt et al., 2013). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Type II CRISPR systems defend against invasive DNA by using Cas9 as an RNA-guided nuclease that creates double-stranded DNA breaks. Dual RNAs (CRISPR RNA [crRNA] and tracrRNA) are required for Cas9's targeting activities observed to date. Targeting requires a protospacer adjacent motif (PAM) and crRNA-DNA complementarity. Cas9 orthologs (including Neisseria meningitidis Cas9 [NmeCas9]) have also been adopted for genome engineering. Here we examine the DNA cleavage activities and substrate requirements of NmeCas9, including a set of unusually complex PAM recognition patterns. Unexpectedly, NmeCas9 cleaves single-stranded DNAs in a manner that is RNA guided but PAM and tracrRNA independent. Beyond the need for guide-target pairing, this "DNase H" activity has no apparent sequence requirements, and the cleavage sites are measured from the 5' end of the DNA substrate's RNA-paired region. These results indicate that tracrRNA is not strictly required for NmeCas9 enzymatic activation, and expand the list of targeting activities of Cas9 endonucleases.
    No preview · Article · Oct 2015 · Molecular cell
  • Source
    • "CRISPR/Cas9 Targeting of e926/Playrr The following guide RNAs were designed (http://crispr.mit.edu/; Hsu et al., 2013) and cloned into BbsI cut pX330: Playrr, TAGACGCAGCTGTGCTTA GAAGG; e926 proximal, GTGGCGGACTCATGTTAAAAAGG; e926 distal, GTGATTCCCACCACGCTTTGAGG. For Playrr targeting, the 156-bp singlestranded oligodeoxynucleotide (ssODN) used as a repair template carries a 3-bp change to disrupt the 5 0 splice site of Playrr exon 1 and introduce an EcoRI restriction site for genotyping (see Figure 3). "
    [Show abstract] [Hide abstract]
    ABSTRACT: Expression of Pitx2 on the left side of the embryo patterns left-right (LR) organs including the dorsal mesentery (DM), whose asymmetric cell behavior directs gut looping. Despite the importance of organ laterality, chromatin-level regulation of Pitx2 remains undefined. Here, we show that genes immediately neighboring Pitx2 in chicken and mouse, including a long noncoding RNA (Pitx2 locus-asymmetric regulated RNA or Playrr), are expressed on the right side and repressed by Pitx2. CRISPR/Cas9 genome editing of Playrr, 3D fluorescent in situ hybridization (FISH), and variations of chromatin conformation capture (3C) demonstrate that mutual antagonism between Pitx2 and Playrr is coordinated by asymmetric chromatin interactions dependent on Pitx2 and CTCF. We demonstrate that transcriptional and morphological asymmetries driving gut looping are mirrored by chromatin architectural asymmetries at the Pitx2 locus. We propose a model whereby Pitx2 auto-regulation directs chromatin topology to coordinate LR transcription of this locus essential for LR organogenesis.
    Full-text · Article · Oct 2015 · Cell Reports
Show more

Questions & Answers about this publication