Content uploaded by Marieke Roskes
Author content
All content in this area was uploaded by Marieke Roskes on Sep 18, 2014
Content may be subject to copyright.
Oxytonergic circuitry sustains and enables creative
cognition in humans
Carsten K. W. De Dreu,
1
Matthijs Baas,
1
Marieke Roskes,
2
Daniel J. Sligte,
1
Richard P. Ebstein,
3
Soo Hong Chew,
4,5
Terry Tong,
6
Yushi Jiang,
4
Naama Mayseless,
7
and Simone G. Shamay-Tsoory
7
1
Department of Psychology, University of Amsterdam, Weesperplein 4, 1018 XA Amsterdam, The Netherlands,
2
Guilford Glazer Faculty of
Business and Management, Ben-Gurion University of the Negev, Beer Sheva 84105, Israel,
3
Psychology Department, National University of
Singapore, Singapore 117570, Singapore,
4
Economics and Finance Departments, National University of Singapore, Singapore 117570, Singapore,
5
Department of Obstetrics and Gynaecology, National University of Singapore, Singapore 119228, Singapore,
6
Economics Department,
National University of Singapore, Singapore 117570, and
7
Department of Psychology, University of Haifa, Mount Carmel, Haifa 31905, Israel
Creativity enables humans to adapt flexibly to changing circumstances, to manage complex social relations and to survive and prosper through social,
technological and medical innovations. In humans, chronic, trait-based as well as temporary, state-based approach orientation has been linked to
increased capacity for divergent rather than convergent thinking, to more global and holistic processing styles and to more original ideation and creative
problem solving. Here, we link creative cognition to oxytocin, a hypothalamic neuropeptide known to up-regulate approach orientation in both animals
and humans. Study 1 (N¼492) showed that plasma oxytocin predicts novelty-seeking temperament. Study 2 (N¼110) revealed that genotype differ-
ences in a polymorphism in the oxytocin receptor gene rs1042778 predicted creative ideation, with GG/GT-carriers being more original than TT-carriers.
Using double-blind placebo-controlled between-subjects designs, Studies 3–6(N¼191) finally showed that intranasal oxytocin (vs matching placebo)
reduced analytical reasoning, and increased holistic processing, divergent thinking and creative performance. We conclude that the oxytonergic circuitry
sustains and enables the day-to-day creativity humans need for survival and prosperity and discuss implications.
Keywords: neurohormones; creative cognition; oxytocin; polymorphism; divergent thinking
INTRODUCTION
Humans have a strong capacity for creative thought and innovation,
allowing them to adapt flexibly to changing circumstances, to manage
complex social relations and to survive and prosper through social,
technological and medical innovations. Indeed, the ability to generate
novel and potentially useful ideas and problem solutions (viz., creativ-
ity) has been proposed as a key driver of human evolution. Cultural
advances, including the inventions of agriculture, for example, may
have accumulated to a ‘tipping point’ that supported the great
human expansion out of Africa and into the Near East and Eurasia
(Wynn et al., 2009;Henn et al., 2012). In addition, throughout evo-
lution nothing would select more potently for increased social intelli-
gence than a within-species coalitionary arms race in which success
depended on effectiveness in social competition, and creative insights
and solutions may have provided exactly that competitive advantage
(Alexander and Borgia, 1978;Flinn et al., 2005). Today, creativity is
among the most valued and sought after competencies in contempor-
ary societies that struggle with complex problems and compete for
technological and economic supremacy (Runco, 2004).
Because creativity provides fitness functionality, it stands to reason
that (i) the human brain evolved to sustain and promote creative
thinking and (ii) we should be able to identify brain circuitries and
neurohormonal modulators of creative cognition and performance
(Flaherty, 2005;Dietrich and Kanso, 2010). Here we link human cre-
ativity to oxytocin, a hypothalamic neuropeptide pivotal in pair-bond
formation and pro-social approach (Donaldson and Young, 2008).
Functioning as hormone and neurotransmitter, oxytocin targets
the amygdala and hippocampus, interacts with the hypothal-
amic–pituitary–adrenal axis involved in the down-regulation of stress
and up-regulates the dopaminergic, reward processing circuitries in the
nucleus accumbens shell and in the ventral tegmental area (Skuse and
Gallagher, 2005;Carter et al., 2008;Donaldson and Young, 2008;Bartz
et al., 2011).
Direct linkages between oxytocin and creative cognition have here-
tofore not been reported. However, and largely due to its anxiolytic
effects, oxytocin up-regulates approach orientations in both human
and non-human animals (Kosfeld et al., 2005;Carter et al., 2008;
Striepens et al., 2012). Administering oxytocin to female rats leads to
more exploration of unfamiliar environments (Windle et al., 1997),
and compared with knock-out mice without forebrain oxytocin recep-
tors (OXTR), normal mice explore their novel cage mates to a greater
extent and display greater cognitive flexibility (Ferguson et al., 2000;
Sala et al., 2011). Furthermore, compared with low novelty-seeking
rats, rats exhibiting high novelty-seeking behaviors have elevated oxy-
tocin mRNA levels in the supraoptic nucleus of the hypothalamus
(Clinton et al., 2010). In humans, exogenous oxytocin promotes
both trust and cooperation (Kosfeld et al., 2005), and defensive aggres-
sion against threatening intruders (De Dreu et al., 2010,2011;Hahn-
Holbrook et al., 2011;Striepens et al., 2012).
The approach tendencies associated with oxytocin are pivotal in
creativity. Approach orientation increases global processing and re-
duces attention to detail (Fo
¨rster et al., 2004), and enhances cognitive
flexibility, original ideation and creative insight (Cretenet and Dru,
2009;Mehta and Zhu, 2009;Lichtenfeld et al., 2012). Accordingly,
the oxytonergic circuitry may be associated with creative cognition
and performance in humans. We examined this possibility by (i) link-
ing naturally fluctuating levels of oxytocin to novelty-seeking tenden-
cies (Study 1), (ii) examining the relationship between a targeted
polymorphism in OXTR gene and creative performance (Study 2)
and by (iii) testing the effects of intranasal administration of oxytocin
Received 8 February 2013; Accepted 4 June 2013
The authors thank Jolien van Breen and Inge Wolsink for their assistance in collecting data, and Marleen Kemper
for her support in the preparation of the trial medication. This work was supported by the Affect Regulation Grant
from the University of Amsterdam (to C.K.W.D.D.).
Correspondence should be addressed to Carsten K. W. De Dreu, Department of Psychology, University of
Amsterdam, Weesperplein 4, 1018 XA Amsterdam, The Netherlands. E-mail: c.k.w.dedreu@uva.nl
doi:10.1093/scan/nst094 SCAN (2013) 1 of 7
ßTheAuthor (2013).Published by Oxford University Press.For Permissions, pleaseemail: journals.permissions@oup.com
Social Cognitive and Affective Neuroscience Advance Access published July 16, 2013
at Universiteit van Amsterdam on July 17, 2013http://scan.oxfordjournals.org/Downloaded from
on holistic and flexible processing, divergent thinking and creative
ideation and problem solving (Studies 3–6).
STUDY 1: PLASMA OXYTOCIN AND NOVELTY-SEEKING
TEMPERAMENT
Study 1 was designed to examine the relationship between endogenous
oxytocin and individual differences in traits related to creativity. Work
by Cloninger et al. (1993,1994) identified four basic personality di-
mensions that are highly heritable and grounded in specific brain
circuitries that are activated in response to specific environmental
stimuli, such as danger, novelty and reward. ‘Novelty Seeking’ reflects
a heritable tendency to respond strongly to novel stimuli and cues for
reward, with frequent exploratory activity in pursuit of novelty, re-
wards or impulsive decision making. ‘Harm Avoidance’ reflects a her-
itable bias to respond strongly to aversive stimuli, leading to inhibition
of behavior. ‘Reward Dependence’ reflects a heritable tendency in the
maintenance or continuation of behaviors previously associated with
reward, which manifests itself as sentimentality and sociability.
‘Persistence’, finally, reflects a heritable tendency to persevere despite
goal frustration and fatigue.
Our main hypothesis was that novelty seeking, but not harm avoid-
ance, reward dependence and persistence, would be positively related
to naturally fluctuating, endogenous oxytocin. Evidence for this pre-
diction would fit research showing that in individuals diagnosed with
major depressive disorder, endogenous oxytocin levels positively pre-
dict novelty seeking and reward dependence (Bell et al., 2006). It would
also fit work showing that novelty-seeking temperament positively as-
sociates to approach and creativity, whereas harm avoidance, reward
dependency and persistence are not or negatively related to approach
and creativity (Cloninger et al., 1993;Cha
´vez-Eakle et al., 2006).
Method and materials
Study 1 was part of a larger research program on the biological basis of
human behavior and decision making in which Han Chinese under-
graduate students at the National University of Singapore participated
(total N¼1158; 584 females; mean age ¼21.2 years, s.d. ¼1.5). A
subset (N¼492; 228 males) was recruited through advertisement on
the Integrated Virtual Learning Environment (IVLE).
At the beginning of the study, participants completed an informed
consent form approved by the Institutional Review Board at National
University of Singapore. Thereafter, participants were administered the
Temperament and Character Index (TCI-R) personality questionnaire
(Cloninger et al., 1993,1994). Sample items of ‘Novelty Seeking’ in-
clude ‘I’m slow to get excited about new ideas’ (reverse scored) and
‘I do things spontaneously’. Sample items of ‘Harm Avoidance’ include
‘I get tense and worried in unfamiliar situations’ and ‘I avoid meeting
strangers’. Sample items of ‘Reward Dependence’ include ‘I’m strongly
moved by sentimental appeals’ and ‘Others think I am too independ-
ent’ (reverse scored). Items characteristic of the ‘Persistence’ scale
included ‘I often push myself to exhaustion’ and ‘I work long after
others give up’. Participants indicated their agreement with each state-
ment on a 5-point Likert scale ranging from 1 ¼definitively false to
5¼definitively true. The TCI-R has been validated in previous re-
search and shows good internal reliabilities ranging from 0.65 to
0.87 (Cloninger et al., 1993,1994).
Following TCI-R measurement, blood samples for oxytocin assay
were collected from the antecubital vein into pre-chilled 5-ml ethyle-
nediaminetetraacetic acid (EDTA) tubes with 250 KIU of apoprotinin
and refrigerated until processing. Plasma was isolated by centrifugation
at 1800g, 15 min, 48C and stored in aliquots at 708C. Oxytocin
immunoreactivity levels were quantified in duplicates using a commer-
cial oxytocin ELISA kit (Enzo Life Sciences, NY, USA, formerly Assays
Designs, MI, USA), as recommended in previous publications (Carter
et al., 2008). Thawed samples on ice were diluted 1:2 times in assay
buffer and assayed according to manufacturer’s instructions. The oxy-
tocin assay had a sensitivity of 11.7 pg/ml, and inter- and intra-assay
coefficient of variations <15%.
Results
In a first analysis, we computed the zero-order correlations between
each of the four TCI-R scales and (log-transformed) plasma oxytocin.
As predicted, we observed a positive correlation only among (log-
transformed) plasma oxytocin and TCI novelty seeking,
r(490) ¼0.121, P¼0.007 (Figure 1A), which survives correction for
multiple comparison testing (P¼0.028). Furthermore, the other cor-
relations were not significant; OT-Reward Dependence: r¼0.026;
OT-Persistence: r¼0.025; OT-Harm Avoidance: r¼0.018, all
Ps > 0.568.
We then computed ordinary least-squares regressions with gender
(0 ¼male, 1 ¼female) and age as covariates, log-transformed plasma
oxytocin as predictor and the four temperament scales as criterion.
Table 1 shows that controlling for gender and age did not change
the strength and direction of our resultsagain, only novelty-seeking
temperament was positively associated with (log transformed) plasma
oxytocin. These analyses also revealed higher scores on novelty seeking,
reward dependence and harm avoidance, and lower persistence scores
among female compared with male participants.
Fig. 1 (A) Study 1: endogenous oxytocin levels predict individual differences in novelty-seeking temperament (N¼492). (B) Study 2: GG/GT-carriers of the rs1042778 OXTR generate more ideas, are more
original and display greater flexibility than TT-carriers (displayed z-scores s.e.m.).
2of7 SCAN(2013) C. K.W. De Dreu et al.
at Universiteit van Amsterdam on July 17, 2013http://scan.oxfordjournals.org/Downloaded from
Taken together, these results are consistent with our hypothesis that
(endogenous) oxytocin associates with creativity, as evidenced here in
the positive correlation between plasma oxytocin and novelty-seeking
temperament. We note that the evidence is correlational and not in-
formative about causality (something we turn to in Studies 3–6). We
also note that while significant, the overall effect size is fairly small.
STUDY 2: POLYMORPHISM IN OXTR GENE AND CREATIVE
IDEATION
Study 2 focused on the possible link between creativity and poly-
morphism in the oxytocin receptor (OXTR) gene. The OXTR is a
389-amino-acid polypeptide located on chromosome 3p25, containing
three introns and four exons. Of the single-nucleotide OXTR poly-
morphisms (SNPs), the SNP rs1042778 at Exon 4-30-UTR is of specific
interest here because GG- and GT-carriers have higher plasma oxyto-
cin than TT-carriers (Feldman et al., 2012), and stronger approach
tendencies (Israel et al., 2009;Feldman et al., 2012).
In Study 2, we assessed creativity with an Alternative Uses Test, in
which individuals generate as many possible new uses for a particular
object (e.g. a tin can; Guilford, 1967). Uses generated by the partici-
pants were coded for total number of responses given (fluency),
number of semantic categories (flexibility) and originality (infre-
quency) (Mehta and Zu, 2009;Baas et al., 2011). Originality is gener-
ally considered the hallmark of creativity (Guilford, 1967), and we
predicted GG-and GT-carriers of the rs1042778 polymorphism to gen-
erate more original ideas than TT-carriers. We anticipated similar dif-
ferences with regard to flexibility and explored effects on fluency.
Methods and materials
Participants were 110 healthy students recruited from the University of
Haifa (43 men and 67 women) whose average age was 24.59 (men:
mean age ¼24.70 years, s.d. ¼1.87; women: mean age ¼24.52 years,
s.d. ¼1.89). All participants were Jewish and fluent in Hebrew.
Exclusion criteria were self-reported history of mental disorders,
neurological disorders, learning disabilities and traumatic brain
injury. Additionally, participants who reported taking chronic medi-
cation other than contraceptive pills were excluded. Women who were
pregnant, breastfeeding or had been pregnant in the past 12 months, as
well as men having children <6 months old, were excluded. All par-
ticipants gave informed written consent and the genetic study was
approved by the local University and Hospital Internal Review Board
and the Israeli Ministry of Health (Genetics Section).
Upon arrival, each participant provided two 20 ml of mouthwash
samples of DNA by rinsing their mouths vigorously for 60 s with 10 ml
of ‘Aquafresh’ mouthwash and expectorating into a sterile test tube.
DNA was extracted using the Master Pure Kit (Epicentre). Genotyping
of the OXTR rs1042778 SNP was performed using the SNaPshot
Method (Applied BioSystems, Foster City, CA, USA) as previously
described in our laboratory (Lerer et al., 2008). Amplification of the
OXTR was achieved using the following primers. First polymerase
chain reaction (PCR primers): F: GGGTTCAGGGTGGTAGAAG,
R: AGGCTGTGCTGGCATAAGTG; second PCR primer extensions:
(T)
12
TGAAGCCACCCCAAGGAG. PCR cycling conditions in the
SNaPshot Method were as follows: samples were initially heated at
948C for 5 min followed by 35 cycles of 948C (30 s), 558C (30 s) and
728C (90 s) and a final extension step of 728C for 5 min. After the first
PCR cycle, the PCR product was cleaned with ExoSAP for 378C for
30 min and then at 808C for 15 min. The conditions for the second
PCR were as follows: 968C (10 s), 508C (5 s) and 608C (30 s) for 25
cycles. The second PCR product was cleaned using shrimp alkaline
phosphatase (SAP) initially at 378C for 1 h followed by 728C for
15 min.
Following the collection of mouthwash samples, participants were
instructed about the Alternative Uses Task (Guilford, 1967;Mehta and
Zhu, 2009). Participants were presented with common objects (e.g.
button) and were asked to list as many alternate uses as possible for
the object. Scoring was carried out by two trained raters and only non-
redundant ideas that did not include the common use of the object
were included. Scoring was based on the total number of responses
given (fluency), number of categories (flexibility) and a measure of
infrequency (originality). The flexibility scores included the total
number of distinct semantic categories of each response (e.g. button:
‘body parts on a doll’, ‘play with’, ‘weapon’). Originality scores were
calculated using the relative infrequency of ideas based on norms col-
lected in healthy volunteers (N¼100, age 18–40 years). For each
object, a list was compiled consisting of all possible uses provided
across subjects. An originality score was given to each possible use
according to the percentage of subjects who provided the answer (a
score of 2 was given if <2% of subjects gave the answer, a score of 1 if
2–5% gave the answer and a score of 0 if >5% gave the answer). For
each participant in the current study, we averaged the infrequency
scores of his or her ideas as a measure of originality.
Results
Planned comparisons showed that compared with TT-carriers, GG/
GT-carriers produced more ideas, F(1,108) ¼11.449, P¼0.002 partial
!
2
¼0.086, more original ideas, F(1,108) ¼4.355, P¼0.047, partial
!
2
¼0.051, and displayed greater flexibility, F(1,108) ¼7.004,
P¼0.014, partial !
2
¼0.029 (Figure 1B). These results provide further
support to our general hypothesis that the oxytonergic circuitry sus-
tains and enables human creativity. We note that, as in Study 1, results
are correlational and do not permit conclusions about causality. We
further note that, again, although results are significant and as pre-
dicted, effect sizes are fairly small.
STUDIES 3–6: EXOGENOUS OXYTOCIN AND CREATIVE
COGNITION AND PERFORMANCE
Our first two studies provided initial evidence for possible linkages
between oxytocin and creative cognition and performance. However,
as mentioned, the evidence prohibits conclusions about causality, and
the effect sizes were small to medium. To further test our predictions,
and to further insight in the possible effects of oxytocin on creative
cognition and performance, we performed four double-blind, placebo-
controlled experiments in which individuals received intranasal oxyto-
cin or matching placebo prior to performing tasks gauged at measuring
creative cognition and creative performance. We predicted that indi-
viduals given oxytocin rather than placebo engage in more holistic
rather than detailed processing (Study 3), display divergent rather
Table 1 Ordinary least-squares regression of log-transformed OT on TCI temperaments
(unstandardized regression weights) controlling for gender and age (all covariates
reported)
TCI-NS TCI-RD TCI-PS TCI-HA
Log OT 4.864*** 1.800 2.055 1.905
Gender 3.222*** 5.092*** 5.578*** 7.045***
Age 0.110 0.244 0.269 0.291
Constant 92.743*** 94.104*** 120.314*** 92.070***
R
2
(%) 3.26 3.41 2.85 4.01
NS ¼novelty seeking; RD ¼reward dependence; PS ¼persistence; HA ¼harm avoidance.
***P< 0.001 (N¼492).
Oxytonergic circuitry promotes creativity SCAN (2013) 3 of 7
at Universiteit van Amsterdam on July 17, 2013http://scan.oxfordjournals.org/Downloaded from
than convergent thinking (Study 4), generate more original ideas
(Study 5) and perform better on creative insight tasks (Study 6).
Methods and materials
For Studies 3–6, a total of 191 male subjects (mean age ¼21.14 years,
s.d. ¼1.26) were recruited via an on-line system and offered E10
(USD 13) for participating in a study on medication and psycho-
logical testing. Exclusion criteria were significant medical or psychi-
atric illness, prescription-based medication, smoking more than five
cigarettes per day and drug or alcohol abuse. The experiments were
approved by the Psychology Ethics Committee of the University of
Amsterdam and complied with the Declaration of Helsinki.
Participants provided written informed consent prior to the
experiments.
Participants were instructed to refrain from smoking or drinking
(except water) for 2 h before the experiment and were randomly as-
signed to the oxytocin or placebo group (double-blind, placebo-con-
trolled study design). Participants self-administered a single intranasal
dose of 24 IU oxytocin (Syntocinon Spray, Novartis; three puffs per
nostril) or placebo. The placebo contained all the active ingredients
except for the neuropeptide, was prepared according to Good
Manufacturing Practice (GMP) and Good Clinical Practice (GCP)
and delivered in the same bottles as Syntocinon.
For each of the studies, participants were seated in individual cu-
bicles preventing them from seeing or communicating with others,
read and signed an informed consent form and self-administered the
medication under experimenter supervision. The experimenter left and
participants completed a series of unrelated questionnaires and tests
that were presented on their computer screen, using the keyboard and
computer mouse to answer questions.
Effects of intranasal oxytocin typically plateau 35 min after admin-
istration (Kirsch et al., 2005;Kosfeld et al., 2005;Baumgartner et al.,
2008;De Dreu et al., 2010;Striepens et al., 2012). Accordingly, the
computer switched to the main experimental tasks after 30 min ( De
Dreu et al., 2010,2011). In all four studies, experimental tasks lasted
between 7 and 15 min (i.e. between 35 and 50 min following self-ad-
ministration of the test medication). In Study 3, we counterbalanced
the order in which the two tasks (analytical reasoning and Navon task)
was given but because order did not interact with treatment this vari-
able is further ignored.
In the ‘Navon task’ used in Study 3 (Navon, 1977;Fo
¨rster, 2012),
participants are asked to respond as quickly as possible to a series of
letters that are randomly shown on screen. On the top left of their
screen, participants were shown a capital letter H in blue color, cor-
responding to a blue sticker on the letter A on their keyboard. On the
top right of the screen, a capital letter L was shown in red color,
corresponding to a red sticker on the letter L on their keyboard. For
each trial, participants were asked to focus on a fixation cross in the
center of the screen that was presented for 500 ms. Then, one of eight
target letters was shown until a participant gave a response. There were
eight trial types, and target letters were always an H or L. On 50 trials,
target letters were either a large (2.1 2.1 cm) H or L consisting of
small (0.4 0.4 cm) Fs or Ts. In the other 50 trials, target letters were
small Hs or Ls composing either a large F or T. The correct response
was in half of the trials the blue and thus left response, and in half of
the trials the red and thus right response. For each trial, participants
were asked to indicate as fast as possible if either the letter H or L was
shown in the center of the screen. Only correct trials were included in
the analyses (12.4% of trials were answered incorrectly). The average
reaction time in milliseconds on the large and small target letters was
computed. Trials on which the reaction time was smaller or larger than
3 s.d. from the mean of that individual were excluded from analyses
(Ratcliff, 1993). We subsequently computed a composite measure by
subtracting the reaction time on the large target letters from the small
target letters. A more positive score on this measure thus evidenced a
more global, holistic processing style (seeing the large letters faster than
the small ones; Fo
¨rster, 2012).
In the ‘Syllogistic Reasoning Task’ used in Study 3, participants were
presented with 16 syllogisms. Syllogisms are arguments about the
properties of entities and consist of two premises and a conclusion
(Alter et al., 2007;Khemlani and Johnson-Laird, 2012). There are four
‘types’ of premises and conclusions: All A are B, Some A are B, No A
are B and Some A are not B. The conclusion that follows the two
premises is true when this conclusion is true in every case in which
both premises are true. An example of a syllogism with a true conclu-
sion is (1) All A are B. (2) Some A are C. Therefore (3) Some C are B.
An example of a syllogism with an untrue conclusion is (1) No A is a B.
(2) No B is a C. Therefore (3) All As are Cs. Because performance
requires deductive reasoning and close analyzing of the associations
that are provided, this syllogism task is often used as indicator of
analytical reasoning (Khemlani and Johnson-Laird, 2012). For each
of the 16 syllogisms participants indicated whether the conclusion
provided was true or not. More correct answers indicate better analyt-
ical performance (range 0–16).
In the ‘Pasta-task’, used in Study 4, participants five primesnon-
existing pasta names all ending with an ‘i’ (e.g. maloveni, paragoni),
and asked to generate as many new pasta names as possible within
3 min (Troyer et al., 1997;Marsh et al., 1999;Dijksterhuis and Meurs,
2006). From their responses, we created indices for fluency (number of
names generated, duplicates removed), convergent thinking (number
of items ending with an ‘i,’ as in the primes), divergent thinking
(number of items not ending with an ‘i’), category repetitions
(number of times in which participants consecutively generated
pasta names with the same ending) and category switches (number
of times in which participants switched from one ending to another)
(Troyer et al., 1997). Specifically, two coders blind to hypotheses and
conditions counted number of names generated (duplicates removed;
fluency), assigned each pasta name to one of two categories: those
ending with an ‘i’ (converging items, as they are in line with the cue
given in the instructions) vs those not ending with an ‘i’ (diverging
items), category repetitions (number of times in which participants
consecutively generated pasta names with the same ending) and cat-
egory switches (number of times in which participants switched from
one ending, e.g. ‘i,’ to another ending, e.g. ‘a’) (Marsh et al., 1999;
Dijksterhuis and Meurs, 2006). Inter-coder agreement was 100%.
Category repetitions associated positively with convergent thinking
[r(60) ¼0.747, P¼0.001] and negatively with divergent thinking
[r(60) ¼0.267, P¼0.036]. Category switches negatively related to
convergent thinking [r(60) ¼0.350, P¼0.005] and positively to di-
vergent thinking [r(60) ¼0.667, P¼0.001].
The ‘Alternative Uses Task’ in Study 5 was a variant of the one in
Study 2 and used previously in Baas et al. (2011). Ideas generated were
coded by a trained rater who was blind to hypotheses and conditions.
She counted the number of non-redundant ideas per participant and
classified all non-redundant ideas to distinct semantic categories (e.g. a
brick to build something, as a musical instrument, as a weapon). A
second rater coded a random selection of 30% of the ideas to establish
inter-rater reliability, which proved excellent (Cohen’s ¼0.91; differ-
ences were solved through discussion). For each participant, the
number of distinct semantic categories that were accessed during
idea generation was used as a measure of flexibility (Guilford, 1967;
Baas et al., 2011). Because a reference group was unavailable, origin-
ality of ideas was based on the relative infrequency of ideas within the
study population (Guilford, 1967;De Dreu et al., 2008;Baas et al.,
2011). For each idea we assessed how often it was mentioned by the
4of7 SCAN(2013) C. K.W. De Dreu et al.
at Universiteit van Amsterdam on July 17, 2013http://scan.oxfordjournals.org/Downloaded from
participants in this experiment and assigned a percentage score to each
idea (e.g. if an idea was mentioned by 12.11% of the participants, it
received a percentage score of 12.11; if it was mentioned by 54.01%, it
received a score of 54.01). We subtracted percentage scores from 100 to
get an infrequency scorethe higher the number assigned to an idea,
the more original (i.e. less frequent) it is. For each participant, we
averaged the infrequency scores of his or her ideas as a measure of
originality.
The Remote Associates Test (RAT), used in Study 6, is a creative
insight task that asks participants to identify associations among words
that are not normally connected (Mednick, 1962). On a particular trial,
participants are given three words (e.g. car, swimming, cue) and have
to generate a word that associates with all of them (e.g. pool). The RAT
has previously been used in a number of studies on creative insight
(Mednick, 1962;Schooler et al., 1993;Smith and Kounios, 1996;
Harkins, 2006;Rowe et al., 2007;Kounios and Beeman, 2009;
Chermahini and Hommel, 2010). Because the initial or dominant re-
sponse to creative insight problems is likely to be incorrect, these
problems often require individuals to actively restructure the presented
problem material and approach the problem from multiple angles
(Mednick, 1962;Harkins, 2006;Kounios and Beeman, 2009). Once a
possible solution has been identified, participants check its appropri-
ateness through convergent analysis. However, to come up with pos-
sible solutions, divergent thinking is needed and shows up in brain
activity and processing styles that differentiates from that on analytical
tasks (Smith and Kounios, 1996;Kounios and Beeman, 2009). Here,
the RAT was introduced as a study on complex problem solving and
participants were shown, on their computer screen, a string of three
words and asked to provide a fourth word that connected the three
words given. Upon entering their answer, they were presented with a
new string of three words. In total, participants received 30 RATs.
Results
Study 3 (n¼49) showed that oxytocin produced holistic processing
and reduced analytical reasoning. Holistic processing was assessed with
the Navon task. Here, average reaction time in milliseconds on holistic
trials was subtracted from detailed trials so that a higher score reflects
more holistic processing (identifying large target letters faster than
small target letters). Analysis of variance (ANOVA) showed that, com-
pared with placebo, individuals given oxytocin engaged in more global
processing, F(1,47) ¼6.354, P¼0.015, partial
2
¼0.119 (Figure 2A).
In Study 3, analytical reasoning was assessed with the syllogistic
reasoning task. Analyses of the number of correctly solved items re-
vealed that oxytocin undermined performance on the syllogistic rea-
soning task, F(1,47) ¼5.165, P¼0.028, partial
2
¼0.099 (Figure 2B).
This result suggests that oxytocin up-regulates creative cognition (i.e.
holistic processing) specifically, and not performance in general.
Study 4 (n¼62) assessed convergent and divergent thinking using
the pasta task. A 2(Treatment) 2(Convergent/Divergent Thinking)
mixed model ANOVA showed no effect on fluency, F(1,60) ¼0.185,
P¼0.669, and significant effects for Thinking, F(1,60) ¼6.071,
P¼0.017, and the Thinking Treatment interaction,
F(1,60) ¼7.172, P¼0.016 (Figure 2C). Compared with placebo, oxy-
tocin reduced convergent and increased divergent thinking [directional
t(60) > 1.722, P< 0.05; partial
2
¼0.047 and 0.061, respectively].
Furthermore, oxytocin reduced repetitions, F(1,60) ¼6.443,
P¼0.014, partial
2
¼0.072, and increased switching among cognitive
categories, F(1,60) ¼4.668, P¼0.035, partial
2
¼0.097 (Figure 2D).
These findings corroborate those in Study 3, that oxytocin reduces
analytical reasoning (akin to convergent processing) yet stimulates cre-
ative thinking (i.e. divergent thinking).
Study 5 (N¼44) tested treatment effects on creative ideation, as
measured with the Alternative Uses Test (Study 2). ANOVA showed
that oxytocin, compared with placebo, did not affect fluency,
F(1,42) ¼2.477, P¼0.123 (partial
2
¼0.056), increased flexibility,
F(1,42) ¼4.608, P¼0.038 (partial
2
¼0.099; Figure 3A), and origin-
ality, F(1,42) ¼4.527, P¼0.039 (partial
2
¼0.097; Figure 3B).
Controlling for flexibility rendered the effect of Treatment on origin-
ality non-significant, F(1,41) ¼1.00, P¼0.324 (regression of flexibility
on originality is B¼29.776, t¼4.694, P¼0.001). It thus appears that
oxytocin increases original ideation because it enables cognitive flexi-
bility. This fits the results on holistic processing (Study 3) and on
divergent processing (Study 4), both of which are considered to be
pivotal to cognitive flexibility.
Study 6 (n¼36) examined divergent thinking and activation of
more remote informational links using the RAT. Consistent with find-
ings reported above, the number of correct RAT solutions (range 0–30)
was higher in the oxytocin compared with placebo condition,
F(1,34) ¼9.66, P¼0.004, partial
2
¼0.221 (Figure 3C). No effects
were found for misses or wrong answers, all F(1,34) < 2.838, all
P> 0.110.
Taken together, Studies 3–6 support the hypothesis that exogenous
oxytocin (vs placebo) increases global, divergent and flexible process-
ing of material. Furthermore, although oxytocin promotes original
ideation and betters creative insight, it reduces convergent thinking
and analytical performance.
DISCUSSION AND CONCLUSIONS
Creativity allows individuals and their groups to thrive and prosper.
Here we uncovered that creative cognition and performance is enabled
by the evolutionary ancient neuropeptide oxytocin. Endogenous oxy-
tocin positively associates with novelty-seeking temperament, poly-
morphism in the OXTR rs1042778 associates with cognitive
flexibility and original thinking, and intranasal administration of oxy-
tocin led to increased holistic processing, more flexible thinking, more
original ideas and better creative problem solving. Concurrently, ad-
ministering oxytocin reduced convergent processing and impeded ana-
lytical reasoning.
Predictions were grounded in the well-established finding that oxy-
tocin down-regulates anxiety and motivates social approach in humans
(Skuse and Gallagher, 2005;Carter et al., 2008;Donaldson and Young,
2008;Bartz et al., 2011), and that oxytocin is involved in exploration in
non-human animals (Windle et al., 1997;Ferguson et al., 2000;Sala
et al., 2011). One possible mechanism not investigated here is that
oxytocin-induced approach is, at least in non-human mammals,
mediated by up-regulated dopaminergic circuitry involved in reward
processing (Flaherty, 2005;Skuse and Gallagher, 2005). Indeed, in
humans, biomarkers of dopaminergic activation, such as eye-blink
rates, associate with increased divergent and decreased convergent
thinking (Dreisbach et al., 2005;Chermahini and Hommel, 2010).
Possibly, oxytocin impedes analytical reasoning yet simultaneously
stimulates a suite of processes conducive to creative performance be-
cause it up-regulates the dopaminergic circuitry and associated ap-
proach orientation.
Although significant, the relationships between endogenous oxyto-
cin and OXTR polymorphism on the one hand and novelty-seeking
temperament and original ideation on the other were relatively weak.
Stronger effects were observed in the administration studies. Possibly,
administration studies induce a peak in brain oxytocin that exceeds the
levels of endogenous oxytocin, and the path from OXTR polymorph-
ism to brain-level oxytocin remains largely unknown. New research is
needed to further substantiate current findings and to uncover when
and how intranasal administration of oxytocin mirrors naturally
Oxytonergic circuitry promotes creativity SCAN (2013) 5 of 7
at Universiteit van Amsterdam on July 17, 2013http://scan.oxfordjournals.org/Downloaded from
fluctuating levels of oxytocin and interacts with OXTR polymorphism
to up-regulate creative functioning in humans. The strong convergence
in findings presented here renders such new research both important
and promising.
We studied ‘small c’ creativitythe type of creativity humans display
in their day-to-day functioning, and cannot generalize to ‘big C’ cre-
ativitythe creative inventions and breakthroughs that lead to radical
and long-lasting changes in society. Furthermore, we considered the
relationship between oxytocin and creative functioning in individual
settings and ignored the social context. However, oxytocin is strongly
implicated in pair-bond formation (Carter et al., 2008), and positive
social bonds are important in creativity. Indeed, a principal feature of
creative art is exhibiting and it may be that associations between art
and courtship displaysexhibiting feathers, singing, performing court-
ship danceshave their neurobiological linkage in the oxytonergic cir-
cuitry (Zaidel, 2010). Second, oxytocin is a pivotal mediator in
cooperative exchange within groups (Kosfeld et al., 2005;De Dreu
et al., 2010), and cooperative groups are more creative than groups
dominated by competition (Bechtoldt et al., 2010; also see Farrell,
2001). New research is needed to test the hypothesis that cooperative
settings facilitate the release of oxytocin which, in turn, up-regulates
human creativity. Evidence for such a hypothesis would further sub-
stantiate the possibility that the evolutionary ancient neuropeptide
oxytocin functions to facilitate the divergent thinking and creative
problem solving needed to flexibly adapt to changing circumstances
and to protect and promote both oneself and one’s kin and kith.
AUTHOR CONTRIBUTIONS
R.P.E. and S.H.C. designed Study 1. T.T. supervised and designed the
plasma oxytocin assay in Study 1 and Y.J. analyzed the data. N.M. and
S.G.S.-T. designed Study 2 and analyzed the data. C.K.W.D.D., M.B.,
D.J.S. and M.R. designed Studies 3–6. M.B., D.J.S. and M.R. pro-
grammed Studies 3–6 and coordinated data collection. C.K.W.D.D.,
D.J.S. and M.B. analyzed the data. C.K.W.D.D., M.B. and S.G.S.T.
wrote the article.
0
10
20
30
40
50
60
70
80
90
100
Placebo Oxytocin
Response latencies (ms)
0
2
4
6
8
10
12
14
16
Placebo Ox
y
tocin
Analytical performance
0
2
4
6
8
10
12
14
16
Placebo Oxytocin Placebo Oxytocin
Convergent items Divergent items
Number of pasta names
0
1
2
3
4
5
6
7
8
9
Placebo Oxytocin Placebo Oxytocin
Category repetitions Category switches
Count
A
B
C
D
Fig. 2 (A) Study 3: response latencies for detailed vs holistic targets in the Navon task (higher score reflects more holistic processing; displayed s.e.m.). (B) Study 3: oxytocin reduces number of solved
syllogistic reasoning problems (ranging from 0 to 16, displayed s.e.m.). (C) Study 4: number of generated convergent and divergent pasta names as a function of oxytocin (displayed s.e.m.). (D) Study 4:
number of category repetitions and switches during the generation of pasta names as a function of oxytocin (displayed s.e.m.).
Fig. 3 (A) Study 5: oxytocin stimulates fluency, flexibility and originality in the generation of
alternate uses (displayed s.e.m.). (B) Study 6: oxytocin increases number of solved insight prob-
lems (RATs; ranging from 0 to 30, displayed s.e.m.).
6of7 SCAN(2013) C. K.W. De Dreu et al.
at Universiteit van Amsterdam on July 17, 2013http://scan.oxfordjournals.org/Downloaded from
FUNDING
These studies were financially supported by the Affect Regulation
Grant from the University of Amsterdam awarded to C.K.W.D.D.
Conflict of Interest
None declared.
REFERENCES
Alexander, R.D., Borgia, G. (1978). Group selection, altruism, and levels of organization.
Annual Review of Ecological Systematics,9, 449–74.
Alter, A.L., Oppenheimer, D.M., Epley, N., Eyre, R.N. (2007). Overcoming intuition: meta-
cognitive difficulty activates analytic reasoning. Journal of Experimental Psychology:
General,136, 569–76.
Baas, M., De Dreu, C.K.W., Nijstad, B.A. (2011). When prevention promotes creativity: the
role of mood, regulatory focus and regulatory closure. Journal of Personality and Social
Psychology,100, 794–809.
Bartz, J.A., Zaki, J., Bolger, N., Ochsner, K.N. (2011). Social effects of oxytocin in humans:
context and person matter. Trends in Cognitive Science,15, 301–9.
Baumgartner, T., Heinrichs, M., Vonlanthen, A., Fischbacher, U., Fehr, E. (2008). Oxytocin
shapes the neural circuitry of trust and trust adaption in humans. Neuron,58, 639–50.
Bechtoldt, M.N., De Dreu, C.K.W., Nijstad, B.A., Choi, H.S. (2010). Motivated information
processing, epistemic social tuning, and group creativity. Journal of Personality and
Social Psychology,99, 622–37.
Bell, C.J., Nicholson, H., Mulder, R.T., Luty, S.E., Joyce, P.R. (2006). Plasma oxytocin levels
in depression and their correlation with the temperament dimension of reward depend-
ence. Journal of Psychopharmacology,20, 656–60.
Carter, C.S., Grippo, A.J., Pournajafi-Nazarloo, H., Ruscio, M.G., Porges, S.W. (2008).
Oxytocin, vasopressin, and sociality. Progressive Brain Research,170, 331–6.
Cha
´vez-Eakle, R.A., Lara, M.C., Cruz-Fuentes, C. (2006). Personality: a possible bridge
between creativity and psychopathology? Creativity Research Journal,18,27–38.
Chermahini, S.A., Hommel, B. (2010). The (b)link between creativity and dopamine:
spontaneous eye blink rates predict and dissociate divergent and convergent thinking.
Cognition,115, 485–65.
Clinton, S.M., Bedrosian, T.A., Abraham, A.D., Watson, S.J., Akil, H. (2010). Neural and
environmental factors impacting maternal behavior differences in high versus low-nov-
elty seeking rats. Hormones and Behavior,57, 463–73.
Cloninger, C.R., Svrakic, D.M., Przybeck, T.R. (1993). A psychobiological model of tem-
perament and character. Archives of General Psychiatry,50, 97590.
Cloninger, C.R., Svrakic, D.M., Przybeck, T.R. (1994). The Temperament and Character
Inventory (TCI): A Guide to Its Development and Use. St. Louis, MO: Center for
Psychobiology of Personality, Washington University.
Cretenet, J., Dru, V. (2009). Influence of peripheral and motivational cues on rigid-flexible
functioning: perceptual, behavioral, and cognitive aspects. Journal of Experimental
Psychology: General,138, 201–17.
De Dreu, C.K.W., Baas, M., Nijstad, B.A. (2008). Hedonic tone and activation in the
mood–creativity link: towards a dual pathway to creativity model. Journal of
Personality and Social Psychology,94, 739–56.
De Dreu, C.K.W., Greer, L.L., Handgraaf, M.J.J., et al. (2010). The neuropeptide oxytocin
regulates parochial altruism in intergroup conflict among humans. Science,328,
1408–11.
De Dreu, C.K.W., Greer, L.L., Van Kleef, G.A., Shalvi, S., Handgraaf, M.J.J. (2011).
Oxytocin promotes human ethnocentrism. Proceedings of the National Academy of
Sciences of the United States of America,108, 1262–6.
Dietrich, A., Kanso, R. (2010). A review of EEG, ERP, and neuroimaging studies of cre-
ativity and insight. Psychological Bulletin,136, 822–48.
Dijksterhuis, A., Meurs, T. (2006). Where creativity resides: the generative power of un-
conscious thought. Consciousness and Cognition,15, 135–46.
Donaldson, Z.R., Young, L.J. (2008). Oxytocin, vasopressin, and the neurogenetics of so-
ciality. Science,322, 900–3.
Dreisbach, G., Mu
¨ller, J., Goschke, T., et al. (2005). Dopamine and cognitive control: the
influence of spontaneous eyeblink rate and dopamine gene polymorphisms on persev-
eration and distractibility. Behavioral Neuroscience,119, 483–90.
Farrell, M.P. (2001). Collaborative Circles: Friendship Dynamics and Creative Work.
Chicago, IL: University of Chicago Press.
Feldman, R., Zagoory-Sharon, O., Weisman, O., et al. (2012). Sensitive parenting is asso-
ciated with plasma oxytocin and polymorphisms in the OXTR and CD38 genes.
Biological Psychiatry,72, 175–81.
Ferguson, J.N., Young, L.J., Hearn, E.F., Matzuk, M.M., Insel, T.R., Winslow, J.T. (2000).
Social amnesia in mice lacking the oxytocin gene. Nature Genetics,25, 284–8.
Flaherty, A.W. (2005). Frontotemporal and dopaminergic control of idea generation and
creative drive. Journal of Computational Neurology,493, 147–53.
Flinn, M.V., Geary, D.C., Ward, C.V. (2005). Ecological dominance, social competition,
and coalitionary arms races: why humans evolved extraordinary intelligence. Evolution
and Human Behavior,26,10–46.
Fo
¨rster, J. (2012). GLOMOsys: the how and why of global and local processing. Current
Directions in Psychological Science,21,15–9.
Fo
¨rster, J., Friedman, R.S., Liberman, N. (2004). Temporal construal effects on abstract and
concrete thinking: consequences for insight and creative cognition. Journal of Personality
and Social Psychology,87, 177–89.
Guilford, J.P. (1967). The Nature of Human Intelligence. New York, NY: McGraw-Hill.
Hahn-Holbrook, J., Holt-Lundstad, J., Holbrook, C., Coyne, S.M., Lawson, E.T. (2011).
Maternal defense: breast-feeding increases aggression by reducing stress. Psychological
Science,22, 1288–95.
Harkins, G.S. (2006). Mere effort as the mediator of the evaluation-performance relation-
ship. Journal of Personality and Social Psychology,91,436–55.
Henn, B.M., Gavalli-Sforza, L.L., Feldman, M.W. (2012). The great human expansion.
Proceedings of the National Academy of Sciences of the United States of America,109,
17758–64.
Israel, S., Lerer, E., Shalev, I., et al. (2009). The oxytocin receptor (OXTR) contributes to
prosocial fund allocations in the dictator game and the social value orientations task.
PLoS One,4, e5535.
Khemlani, S., Johnson-Laird, P.N. (2012). Theories of the syllogism: a meta-analysis.
Psychological Bulletin,138, 427–57.
Kirsch, P., Esslinger, C., Chen, Q., et al. (2005). Oxytocin modulates neural circuitry for
social cognition and fear in humans. Journal of Neuroscience,25, 11489–93.
Kosfeld, M., Heinrichs, M., Zak, P.J., Fischbacher, U., Fehr, E. (2005). Oxytocin increases
trust in humans. Nature,435, 673–776.
Kounios, J., Beeman, M. (2009). The Aha! moment: the cognitive neuroscience of insight.
Current Directions in Psychological Science,18, 210–6.
Lerer, E., Levi, S., Salomon, S., Darvasi, A., Yirmiya, N., Ebstein, R.P. (2008). Association
between the oxytocin receptor (OXTR) gene and autism: relationship to Vineland
Adaptive Behavior Scales and cognition. Molecular Psychiatry,13,980–8.
Lichtenfeld, S., Elliot, A.J., Maier, M.A., Pekrun, R. (2012). Fertile green: green facilitates
creative performance. Personality and Social Psychology Bulletin,38, 784–97.
Marsh, R.L., Ward, T.B., Landau, J.D. (1999). The inadvertent use of prior knowledge in a
generative cognitive task. Memory and Cognition,27,94–105.
Mednick, S.A. (1962). The associative basis of the creative process. Psychological Review,69,
220–32.
Mehta, R., Zhu, R.J. (2009). Blue or red? Exploring the effect of color on cognitive task
performances. Science,323, 1226–9.
Navon, D. (1977). Forest before trees: the precedence of global features in visual percep-
tion. Cognitive Psychology,9, 353–83.
Ratcliff, R. (1993). Methods for dealing with reaction time outliers. Psychological Bulletin,
114, 510–32.
Rowe, G., Hirsh, J.B., Anderson, A.K. (2007). Positive affect increases the breadth of at-
tentional selection. Proceedings of the National Academy of Sciences of the United States of
America,104, 383–8.
Runco, M.A. (2004). Creativity. Annual Review of Psychology,55, 657–87.
Sala, M., Braida, D., Lentini, D., et al. (2011). Pharmacological rescue of impaired cognitive
flexibility, social deficits, increased aggression, and seizure susceptibility in oxytocin
receptor null mice: a neurobehavioral model of autism. Biological Psychiatry,69,875–82.
Schooler, J.W., Ohlsson, S., Brooks, K. (1993). Thoughts beyond words: when language
overshadows insight. Journal of Experimental Psychology: General,122,166–83.
Skuse, D.H., Gallagher, L. (2005). Dopaminergic-neuropeptide interactions in the social
brain. Trends in Cognitive Science,13,27–35.
Smith, R.W., Kounios, J. (1996). Sudden insight: all-or-none processing revealed by
speed–accuracy decomposition. Journal of Experimental Psychology: Learning, Memory,
and Cognition,22,1443–62.
Striepens, N., Scheele, D., Kendrick, K.M., et al. (2012). Oxytocin facilitates protective
responses to aversive social stimuli in males. Proceedings of the National Academy of
Sciences of the United States of America,109, 18144–9.
Troyer, A., Moscovitch, M., Winocur, G. (1997). Clustering and switching as two compo-
nents of verbal fluency: evidence from younger and older healthy adults.
Neuropsychologia,11, 138–46.
Windle, R.J., Shanks, N., Lightman, S.L., Ingram, C.D. (1997). Central oxytocin adminis-
tration reduces stress-induced corticosterone release and anxiety behavior in rats.
Endocrinology,138, 2829–34.
Wynn, T., Coolidge, F., Bright, M. (2009). Hohlenstein-Stadel and the evolution of human
conceptual thought. Cambridge Archaeological Journal,19,73–83.
Zaidel, D.W. (2010). Art and brain: insights from neuropsychology, biology and evolution.
Journal of Anatomy,216, 177–83.
Oxytonergic circuitry promotes creativity SCAN (2013) 7 of 7
at Universiteit van Amsterdam on July 17, 2013http://scan.oxfordjournals.org/Downloaded from
