No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
A new primer for discrimination of arbuscular mycorrhizal fungi with polymerase chain reaction-denature gradient gel electrophoresis
Abstract
Keywords:Arbuscular mycorrhizal fungi;PCR-DGGE;specific primer
... Preliminary visual assessment of roots at the field site showed co-occurrence of G-AMF and M-AMF, which provided an opportunity to compare the responses of these two groups of fungi to both crop variety and N-addition. To date, work investigating M-AMF community composition has used 18S rRNA primers designed by Sato et al. [54] which coamplify M-AMF and G-AMF, but provide poor coverage of putative M-AMF and short (220 bp) sequence lengths [3,4,33,41]. In the current study we modified the Sato forward primer to reduce bias against M-AMF, and designed new 18S rRNA Mucoromycotina specific primers which amplified longer sequences (440 bp), thus providing improved resolution of community composition and phylogeny. ...
... The first primer set (further referred to as AM-primers) targeted both Glomeromycotina and Mucoromycotina and was adapted from the primers published by Sato et al. [54] which amplify a 220 bp region of the 18S rRNA gene (Fig. S1). Alignment of Mucoromycotina and Glomeromycotina 18S rRNA sequences showed that the Sato et al. ...
... Comparative analysis of the sequencing performance of AMV4.5NF and AM-Sal-F primers in combination with the Sato et al. [54] AMDGR reverse primer was performed (Fig. S3). Roots were collected from 3 independent locations separated by 10 m, within the 2 ha Boddington Meadow Nature Reserve, Northamptonshire (52° 10′ 24″ N, 1° 16′ 44″ W), UK in August 2019. ...
Background
Arbuscular mycorrhizas (AM) are the most widespread terrestrial symbiosis and are both a key determinant of plant health and a major contributor to ecosystem processes through their role in biogeochemical cycling. Until recently, it was assumed that the fungi which form AM comprise the subphylum Glomeromycotina (G-AMF), and our understanding of the diversity and ecosystem roles of AM is based almost exclusively on this group. However recent evidence shows that fungi which form the distinctive 'fine root endophyte’ (FRE) AM morphotype are members of the subphylum Mucoromycotina (M-AMF), so that AM symbioses are actually formed by two distinct groups of fungi.
Results
We investigated the influence of nitrogen (N) addition and wheat variety on the assembly of AM communities under field conditions. Visual assessment of roots showed co-occurrence of G-AMF and M-AMF, providing an opportunity to compare the responses of these two groups. Existing ‘AM’ 18S rRNA primers which co-amplify G-AMF and M-AMF were modified to reduce bias against Mucoromycotina, and compared against a new ‘FRE’ primer set which selectively amplifies Mucoromycotina. Using the AM-primers, no significant effect of either N-addition or wheat variety on G-AMF or M-AMF diversity or community composition was detected. In contrast, using the FRE-primers, N-addition was shown to reduce M-AMF diversity and altered community composition. The ASV which responded to N-addition were closely related, demonstrating a clear phylogenetic signal which was identified only by the new FRE-primers. The most abundant Mucoromycotina sequences we detected belonged to the same Endogonales clades as dominant sequences associated with FRE morphology in Australia, indicating that closely related M-AMF may be globally distributed.
Conclusions
The results demonstrate the need to consider both G-AMF and M-AMF when investigating AM communities, and highlight the importance of primer choice when investigating AMF community dynamics.
... A primer pair, AMV 4.5NF-AMDGR (Sato et al., 2005), was used to amplify the DNA sequences of AMF extracted from onion and carrot roots. Both primers targeted the small subunit of the 18S RNA gene (18S rRNA) (Supplementary Figure S1). ...
... Both primers targeted the small subunit of the 18S RNA gene (18S rRNA) (Supplementary Figure S1). The primer pair AMV 4.5NF-AMDGR amplified a 577 bp to 834 bp region within the 18S rRNA (Supplementary Figure S1) and produced an amplicon of~280 bp (Sato et al., 2005). The primer pair was barcoded using Illumina adapters. ...
... Position of binding of the primer pair AMV4.5F -AMDGR (Sato et al., 2005) on the small subunit of the 18S ribosomal RNA gene. The lines represent the region of binding by the specific primers. ...
Arbuscular mycorrhizal fungi (AMF) are ancient and ecologically important symbionts that colonize plant roots. These symbionts assist in the uptake of water and nutrients, particularly phosphorus, from the soil. This important role has led to the development of AMF inoculants for use as biofertilizers in agriculture. Commercial mycorrhizal inoculants are increasingly popular to produce onion and carrot, but their specific effects on native mycorrhizal communities under field conditions are not known. Furthermore, adequate availability of nutrients in soils, specifically phosphorus, can reduce the diversity and abundance of AMF communities in the roots. The type of crop grown can also influence the composition of AMF communities colonizing the plant roots. This study aimed to investigate how AMF inoculants, soil phosphorus levels, and plant species influence the diversity of AMF communities that colonize the roots of onion and carrot plants. Field trials were conducted on high organic matter (muck) soil in the Holland Marsh, Ontario, Canada. The treatments included AMF-coated seeds (three to five propagules of Rhizophagus irregularis per seed) and non-treated onion and carrot seeds grown in soil with low (~46 ppm) and high (~78 ppm) phosphorus levels. The mycorrhizal communities colonizing the onion and carrot roots were identified by Illumina sequencing. Five genera, Diversispora, Claroideoglomus, Funneliformis, Rhizophagus, and Glomus, were identified in roots of both plant species. AMF communities colonizing carrot roots were more diverse and richer than those colonizing onion roots. Diversispora and Funneliformis had a 1.3-fold and 2.9-fold greater abundance, respectively, in onion roots compared to carrots. Claroideoglomus was 1.4-fold more abundant in carrot roots than in onions. Inoculation with R. irregularis increased the abundance and richness of Rhizophagus in AMF communities of onion roots but not in carrot roots. The soil phosphorus level had no effect on the richness and diversity of AMF in the roots of either crop. In summary, AMF inoculant and soil phosphorus levels influenced the composition of AMF communities colonizing the roots of onion and carrot plants, but the effects varied between plant species.
... 5'-AAGCTCGTAGTTGAATTTCG-3′ and AMDGR 5'-CCCAA CTATCCCTATTAATCAT-3′), 4 μL of DNA template. The following thermal profile was used: 95°C for 10 min; 94°C for 30 s, 55°C for 30s, 72°C for 1 min for 35 cycles; fnally 74°C for 9 min (Sato et al., 2005). ...
... Research has indicated that the long-term overapplication of chemical fertilizers severely threatens the health of soil ecosystems, alters soil nutrient dynamics, and consequently modifies microbial community structures, ultimately driving the soil ecosystem toward a pathological state . The accumulation of potassium (K), phosphorus (P), and nitrogen (particularly ammonium nitrogen, NH₄ + -N, and nitrate nitrogen, NO₃ − -N) can reduce microbial activity and diversity, disrupt nutrient absorption by microorganisms, and induce microbial cell apoptosis (Sahab et al., 2021;Shen et al., 2021;Yang et al., 2011). (1) The redundancy analysis results in this study revealed that the top five soil physicochemical properties influencing fungal community composition were, in descending order, available potassium (AK) > pH > available phosphorus (AP) > total nitrogen (TN) > organic matter (OM). ...
Introduction
The pomegranate (Punica granatum) is a significant economic tree species. In recent years, the root collar rot has severely affected pomegranates in the dry-hot valley regions of Yunnan Province, China. The rhizosphere microbiome plays a crucial role in plant growth, development, and disease resistance.
Methods
This study utilized Illumina MiSeq sequencing to analyze the fungal communities in the roots and rhizosphere soils of healthy and diseased pomegranates, focusing on the impact of root collar rot disease on the diversity and structural composition of these communities.
Results
The results indicated that in the unique fungal communities of healthy plant roots, the relative abundance of ectomycorrhizal and arbuscular mycorrhizal functional (AMF) groups was 53.77%, including genera such as Glomus and Septoglomus. After infection with root collar rot disease, the rhizosphere fungal communities became more monotonous, with increased differentiation within sample groups. Fungal groups associated with plant diseases and soil nutrient structures underwent significant changes. The disease altered the composition and functional group proportions of rhizosphere fungal communities, a process linked to soil nutrient structures. And the balance between plant-pathogen-related and saprotrophic functional groups in the rhizosphere was disrupted. Through Koch’s postulates verification, the pathogen was identified as Lauriomyces bellulus.
Discussion
This is the first report of collar rot of pomegranate caused by L. bellulus in China. Studying the differences in rhizosphere fungal community structures and quantities in response to new diseases aids in the rapid prediction of pathogens, effectively saving diagnostic time, and provides theoretical support for disease prediction, diagnosis, and control.
... Presently, all identified M-FRE are believed to belong to the Endogonales order, but the same order also contains fungi with saprophytic lifestyles (Albornoz et al. 2021). Currently, molecular identification is based on sequences of the small subunit gene of the ribosomal DNA (SSU rDNA) of amplicons generated with PCR primers published by Sato et al. (2005). These primers were originally designed to target G-AMF (with some bias towards the Glomeraceae family; van Geel et al. 2014), but they also recover M-FRE (Albornoz et al. 2021(Albornoz et al. , 2022Orchard et al. 2017). ...
... For concurrent analyses of the M-FRE and G-AMF communities with all 700 samples (we used G-AMF sequences obtained here only to compare their frequency with that of M-FRE sequences), a 280-bp PCR amplicon of SSU rDNA obtained with primers AMV4.5NF and AMDGR (Sato et al. 2005) was sequenced. Both, the forward and reverse primers were fused with sample-specific barcodes to discriminate samples in pool libraries and paired-end 2 × 250 bp Illumina sequenced by the SEQme company (Dobříš, Czech Republic). ...
The acquisition of P and N from soil and their exchange for fixed C are key functions of mycorrhizal fungi in their symbiotic relationship with host plants. Additional contribution to plant nutrition is possible when hyphae proliferate into soil space not directly accessible to plant roots or when they locate nutrient-rich patches more effectively than plant roots. We performed a field-based experiment in a seminatural grassland. Community composition, diversity, and root colonisation intensity of mycorrhizal fungi was compared across different types of substrate patches (enriched or not with inorganic N, P or both), between two exposure times, and with unmanipulated soil and patches enriched with plant biomass. Beside evaluating the response of the communities of arbuscular mycorrhizal fungi (G-AMF) and fine root endophytes (M-FRE), we estimated foraging speed and precision of multiple taxa within these two groups. We compared the relative abundance of both groups using molecular barcoding. While G-AMF responded in community composition and diversity to inorganic and organic N enrichment, M-FRE did not discriminate among diferentially nutrient-enriched patches. Individual taxa varied in foraging response, but G-AMF were slower and possibly more discriminatory than M-FRE in occupying patches differing in N and/or P-enrichment. Particularly two virtual taxa of the Rhizophagus irregularis morphospecies of the G-AMF grew preferentially into the N-enriched patches. We thus conclude that there exist important differences in the strategies of soil exploration for nutrients within both fungal groups.
... To evaluate whether some part of the dark diversity of putative AM fungi can be accounted for by primer bias as suggested for Glomeromycota (Kohout et al. 2014;van Geel et al. 2014;Seeliger et al. 2023), we tested the commonly used SSU, ITS and LSU primers for critical mismatches based on multiple sequence alignments. The AMV4.5NF (Sato et al. 2005) and AM-Sal-F (Seeliger et al. 2023) primers, proposed to cover both AM fungal groups, exhibited several (near-)terminal mismatches to many groups of Glomeromycota and one central and one near-terminal mismatch to many groups of Endogonomycetes. The FRE-F (Seeliger et al. 2023) primer had multiple mismatches to most target Endogonomycetes groups including a terminal mismatch to some groups. ...
... The FRE-F (Seeliger et al. 2023) primer had multiple mismatches to most target Endogonomycetes groups including a terminal mismatch to some groups. The reverse SSU primers AMDGR (Sato et al. 2005) and FRE-R (Seeliger et al. 2023) matched well with Glomeromycota, but had one or more (near)-terminal mismatches to several groups of Endogonomycetes. Regarding the ITS-LSU primers, ITS1F (Gardes and Bruns 1993), ITS1 (White et al. 1990), gITS7ngs and ITS4ngsUni (Tedersoo and Lindahl 2016) had single central mismatches to a few Glomeromycota and Endogonomycetes lineages, whereas ITS9munngs (Tedersoo and Lindahl 2016) had no mismatches. ...
Arbuscular mycorrhizal (AM) fungi - Glomeromycota and Endogonomycetes - comprise multiple species and higher-level taxa that have remained undescribed. We propose a mixed morphology- and DNA-based classification framework to promote taxonomic communication and shed light into the phylogenetic structure of these ecologically essential fungi. Based on eDNA samples and long reads as type materials, we describe 15 new species and corresponding genera (Pseudoentrophospora kesseensis, Hoforsa rebekkae, Kahvena rebeccae, Kelottijaervia shannonae, Kungsaengena shadiae, Langduoa dianae, Lehetua indrekii, Lokruma stenii, Moostea stephanieae, Nikkaluokta mahdiehiae, Parnigua craigii, Riederberga sylviae, Ruua coralieae, Tammsaarea vivikae and Unemaeea nathalieae), the genus Parvocarpum as well as 19 families (Pseudoentrophosporaceae, Hoforsaceae, Kahvenaceae, Kelottijaerviaceae, Kungsaengenaceae, Langduoaceae, Lehetuaceae, Lokrumaceae, Moosteaceae, Nikkaluoktaceae, Parniguaceae, Riederbergaceae, Ruuaceae, Tammsaareaceae, Unemaeeaceae, Bifigurataceae, Planticonsortiaceae, Jimgerdemanniaceae and Vinositunicaceae) and 17 orders (Hoforsales, Kahvenales, Kelottijaerviales, Kungsaengenales, Langduoales, Lehetuales, Lokrumales, Moosteales, Nikkaluoktales, Parniguales, Riederbergales, Ruuales, Tammsaareales, Unemaeeales, Bifiguratales and Densosporales), and propose six combinations (Diversispora bareae, Diversispora nevadensis, Fuscutata cerradensis, Fuscutata reticulata, Viscospora deserticola and Parvocarpum badium) based on phylogenetic evidence. We highlight further knowledge gaps in the phylogenetic structure of AM fungi and propose an alphanumeric coding system for preliminary communication and reference-based eDNA quality-filtering of the remaining undescribed genus- and family-level groups. Using AM fungi as examples, we hope to offer a sound, mixed framework for classification to boost research in the alpha taxonomy of fungi, especially the “dark matter fungi”.
... For the first PCR amplification of AM fungal DNA, the partial nuclear small subunit ribosomal RNA gene (SSU rDNA), approximately 260 bp in length, was amplified from the extracted DNA with the AM fungal-specific primers AMV4.5NF and AMDGR (Sato et al., 2005) linked with Nextera Transposase Adapter Reads 1 and 2 as described above. The PCR reaction mixture and the program were the same as those used for plant DNA, except that the number of cycles was 35. ...
The community of arbuscular mycorrhizal (AM) fungi was examined in Fukiage Garden Forest at the Imperial Palace in Tokyo, Japan. The AM fungal community was clearly distinguished from those of the previously studied Japanese temperate forests. Some of the dominant AM fungi in the Fukiage Garden Forest were species-described fungi, which contrasts with those in the Japanese temperate forests. Since AM fungal species have been described based on spore morphology, the present result suggests that the dominant AM fungi may have relatively higher spore productivity. The Imperial Palace had been the Edo Castle until the latter half of the 1800s, after which, through various vegetation, the Fukiage Garden Forest was developed. Accordingly, it is likely that the AM fungi with higher sporulation in past vegetation may have been retained in the current AM fungal community of the isolated forest.
... Subsequently, part of the small subunit (SSU) of the ribosomal RNA (rRNA) gene was amplified. The 18 S SSU rDNA region, a Glomeromycota (AMF) specific marker sequence, was amplified using the AMF-specific AMV4.5NF-AMDGR primer pair (Sato et al. 2005;Van Geel et al. 2014). This primer pair was selected because it consistently results in many sequences with high AMF specificity (Van Geel et al. 2014). ...
Robusta coffee, grown by 25 million farmers across more than 50 countries, plays an important role in smallholder farmers’ livelihoods and the economies of many low-income countries. Coffee establishes a mutualistic symbiosis with arbuscular mycorrhizal fungi (AMF); however, the impact of agricultural practices and soil characteristics on AMF diversity and community composition is not well understood. To address this, we characterised the AMF community composition of robusta coffee in part of its region of origin, the Democratic Republic of Congo. AMF diversity and community composition were compared between coffee monoculture, agroforestry systems and wild robusta in its native rainforest habitat. Using Illumina sequencing on 304 root samples, we identified 307 AMF operational taxonomic units (OTUs), dominated by the genera Glomus and Acaulospora. OTU richness did not vary across the three studied systems, yet large differences in community composition were found. Many unique OTUs were only observed in the coffee in the rainforest. In general, lower available soil phosphorus (P) and lower soil bulk density increased AMF diversity, yet higher available soil P and pH increased AMF diversity in the wild forest coffee. Shifts in AMF community composition across coffee systems were driven by canopy closure, soil pH, available soil P and soil bulk density. Our study is the first to characterise mycorrhizal communities in wild robusta coffee in its region of origin and shows that even low-input agricultural practices result in major AMF community shifts as compared to a natural baseline.
... Because morphological examination revealed features indicative of Glomeromycotina AM associations (e.g., coarse intracellular hyphal coils) in both species (Suetsugu and Ishida 2011;Suetsugu 2025), polymerase chain reaction (PCR) amplification was performed using the AMV4.5NF/ AMDGR primer set, optimized for Glomeromycotina fungi (Sato et al. 2005), with 3-6-mer Ns fused to the primers. PCR was carried out using the Q5 High-Fidelity DNA Polymerase kit (New England Biolabs, Ipswich, MA, USA) under the following conditions: an initial denaturation at 98 °C for 3 min, followed by 35 cycles at 98 °C for 10 s, 58 °C for 20 s, and 72 °C for 20 s, with a final extension at 72 °C for 10 min. ...
Mycoheterotrophic plants, which depend entirely on mycorrhizal fungi for carbon acquisition, often exhibit high specificity toward their fungal partners. Members of Thismiaceae are generally recognized for their extreme mycorrhizal specialization and rarity. In this study, we examined the mycorrhizal associations of Relictithismia, a recently discovered monotypic genus within Thismiaceae, and Thismia abei, a Thismia species with a similar distribution in southern Japan, by employing high‐throughput DNA sequencing of the 18S rRNA gene. Our analyses revealed that both R. kimotsukiensis and T. abei are predominantly associated with two specific virtual taxa (VTX00295 and VTX00106) of the genus Rhizophagus (Glomeraceae). These shared associations may reflect either phylogenetic niche conservatism, in which the common ancestor of R. kimotsukiensis and T. abei retained the same AM fungal partners, or convergent evolution, in which the AM fungal phylotypes were independently recruited due to their potential benefits for these mycoheterotrophic plants. Furthermore, BLAST searches demonstrated that VTX00295 and VTX00106 are widely distributed globally, suggesting that highly specialized mycorrhizal interactions are unlikely to be the primary drivers of the limited distribution and rarity of R. kimotsukiensis and T. abei. Overall, our findings enhance our understanding of high mycorrhizal specificity in Thismiaceae. However, broader investigations, combining extensive sampling of Thismiaceae species with ancestral state reconstruction, are needed to determine whether the shared associations detected here reflect phylogenetic niche conservatism or convergent evolution.
... The purity and concentration of DNA was checked by NanoDrop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). Partial fragments of the Small Subunit rRNA (SSU) were amplified using the primer pair AML1 and AML2 for the first round (Lee et al., 2008), while the primers AMV4.5NF and AMDGR were used for the second round (Sato et al., 2005). The PCR products were . ...
The effect of invasive plants is mediated by their interactions with microbial communities. However, it is still uncertain how Spartina alterniflora impacts the arbuscular mycorrhizal fungi (AMF) community within the native rhizosphere what the resulting AMF differences are associated with. Here, we investigated what kind of AMF communities are formed in the roots of S. alterniflora to distinguish it from native plants such as Suaeda salsa, Phragmites australis, and Tamarix chinensis by analyzing the AMF communities and the associations with selected environmental factors. The dynamics of AM fungal communities are linked to plant-soil systems. The AMF communities of S. alterniflora and native vegetation demonstrated notable differences in composition, diversity, and symbiotic networks. Significantly higher ω, Ec, AN, AP, and AK were observed in S. alterniflora-invaded soils. Although plant rhizosphere AMF responded to soil environmental factors, AN and AP were highly explanatory environmental factors driving AMF community characteristics during S. alterniflora expansion, while increased soil P and N availability may be involved in shaping AMF community characteristics in S. alterniflora. Our findings can provide complementary evidence-based solutions for defending against invasive plants and mitigating their impacts, as well as protecting coastal ecosystems.
... Total DNA was extracted from 0.05 g of freeze-dried fine roots using the Plant DNA Extraction Mini Kit B. PCR was conducted using the primers pairs AMV4.5NF (5 0 -AAGCTCGTAGTTGAATTTCG-3 0 ) and AMDGR (5'-CCCAACTATCCCTATTAATCAT-3 0 ) (Sato et al. 2005) which has been widely used for targeting the Glomeromycotina. ...
Both clonal plant capabilities for physiological integration and common mycorrhizal networks (CMNs) formed by arbuscular mycorrhizal fungi (AMF) can influence the distribution of nutrients and growth among interconnected individuals. Using a microcosm model system, we aimed to disentangle how CMNs interact with clonal integration to influence plant growth and development. We grew Sphagneticola trilobata clones with isolated root systems in individual, adjacent containers while preventing, disrupting, or allowing clonal integration aboveground via spacers and belowground CMNs to form. We assessed multiple metrics of plant development (e.g., growth, specific leaf area, soluble sugar content), ¹⁵ N transfer from donor (mother) to receiver (daughter) plants, and variation in AMF communities. We show that spacer formation between ramets and the capacity to form CMNs promoted and inhibited the growth of smaller daughter plants, respectively. In contrast to the independent effects of CMNs and spacers, CMNs, in combination with spacers, significantly weakened the promotion of daughter plants by clonal integration. AMF species richness was also negatively correlated with overall plant growth. Our results demonstrate that two common modes of plant interconnection interact in non‐additive ways to affect clonal plant integration and growth. These findings, based on Sphagneticola trilobata , question the underlying assumptions of the positive effects of both AMF CMNs and species richness in comparison to direct plant interconnections.
... The first set of primers used were GeoA2 (5′-CCA GTA GTC ATA TGC TTG TCT C-3′) (Schwarzott and Schüßler, 2001) and AML2 (5′-GAA CCC AAA CAC TTT GGT TTC C-3′) (Lee et al., 2008). The second set of primers included AMDGR (5′-CCC AAC TAT CCC TAT TAA TCA T-3′) (Sato et al., 2005) and NS31 (5′-TTG GAG GGC AAG TCT GGT GCC-3′) (Simon et al., 1992). A 12-base barcode sequence was added to the 5′ side of primer AMDGR for sample differentiation (Table S2). ...
Global change factors like atmospheric nitrogen (N) deposition and drought pose threats to forest ecosystem including soil microbial diversity. However, how arbuscular mycorrhizal (AM) fungi associated with tree respond to N deposition and drought remains largely unknown. Here root-and soil-inhabiting AM fungi were examined in a field experiment involving N addition and simulated drought (precipitation exclusion) in a Chinese fir (Cun-ninghamia lanceolata) plantation. The results showed that precipitation exclusion significantly reduced AM fungal intraradical colonization rate in summer, while N addition had no significant effect on AM fungal morphological traits of intraradical colonization rate, hyphal and spore densities. However, seasonal changes significantly affected AM fungal morphological traits, with higher values were observed in summer than in winter. Neither N addition nor drought significantly affected AM fungal diversity or community composition, but AM fungal communities exhibited pronounced seasonal differences. In winter, both root-and soil-associated AM fungal community composition significantly correlated with the ratio of microbial biomass carbon and phosphorus (MBC/MBP), while in summer AM fungal communities were primarily associated with MBP and DOC. These findings highlight the importance of accounting for interaction of N addition and drought, and seasonal response difference on AM fungi in subtropical forest ecosystems.
... Template DNA for the second round of PCR was obtained from the first-round PCR product, which was diluted 50 times. The primers AMV4.60NF (AAG CTC GTA GTT GAA TTT CG) and AMDGR (CCC AAC TAT CCC TAT TAA TCAT) were elected as the second round of PCR [51]; this was the same reaction system used in the first round. The PCR reaction cycle was as follows: initial denaturation at 94 °C for 3 min; 30 cycles of 94 °C for 45 s, 45 °C for 60 s, and 7 2 °C for 60 s, and a final elongation step at 72 °C for 10 min. ...
Background
Nutrient limitation is a universal phenomenon in terrestrial ecosystems. Root and mycorrhizal are critical to plant nutrient absorption in nutrient-limited ecosystems. However, how they are modified by N and P limitations with advancing vegetation successions in karst forests remains poorly understood. The present study compared the diversity indices, composition, and co-occurrence network of arbuscular mycorrhizal fungi (AMF) between grassland, shrubland, shrub-tree forest, and tree forest in subtropical karst forests, as well as soil nutrients and fine root functional traits (e.g., specific root length (SRL), specific root area (SRA), diameter, biomass, and N and P contents).
Results
The fine roots diameter, biomass, and N and P contents increased with advancing succession, whereas SRL and SRA decreased. Network complexity and Richness and Chao1 indices of AMF increased from grassland to shrub-tree forest but decreased in tree forest. The fine roots N and P contents were positively related to their diameter and biomass, soil nutrients, and AMF composition but were negatively correlated with SRL and SRA. Moreover, these two parameters increased with the increase of soil nutrients. The variations in fine roots N and P contents were mainly explained by soil nutrients and fine root functional traits in grassland and by the interactions of soil nutrients, fine root functional traits, and AMF in the other three stages. Additionally, the interactive explanation with AMF increased from shrubland to shrub-tree forest but decreased in tree forest.
Conclusions
Our results indicated that mycorrhizal strategy might be the main nutrient acquisition strategy under N and P co-limitation. In contrast, the root strategy is the main one when an individual is subject to limitations in N or P in karst ecosystems. Root and mycorrhizal nutrient acquisition strategies are generally mutualistic, mycorrhizal strategy enhances plant nutrient acquisition under N and P co-limitation.
... The 16S rRNA region of the fungus was amplified with the primers AMV4. [28]. The nifH gene was amplified with the primers PolyF (5′-TGCGAYCCSAARGCBGACTC-3′) and ...
To investigate the effects of row ratio configurations on intercropping advantages and related rhizosphere microbial communities, a field experiment involving five treatments of different rows of broomcorn millet, i.e., P1M1 (1 row of broomcorn millet intercropped with 1 row of alfalfa), P2M3, P1M2, P1M3 and broomcorn millet alone (SP), was conducted on the Loess Plateau of China. We analyzed the yield, nutritional content of broomcorn millet, the soil nutrient availability and the diversity and community composition of AMF (arbuscular mycorrhizal fungi) and diazotrophs in the rhizosphere of broomcorn millet. The results showed that compared with monocultures, alfalfa-millet intercropping system under different row ratio configurations significantly increased the yield of broomcorn millet and the absorption of PTP and PTK (total phosphorus and potassium of broomcorn millet). In addition, the broomcorn millet-alfalfa intercropping system also improved soil nutrition, with the decrease of the row ratio of broomcorn millet, the changes of TN, NH4⁺-N and microbial biomass in the rhizosphere of broomcorn millet were consistent, which was opposite to NO3⁻-N. Moreover, co-occurrence network and PLS-PM (partial least squares path modelling) analysis showed alfalfa-broomcorn millet intercropping system changed the community diversity and composition of soil microorganisms, increased the improvement of soil nutrition (TN, NH4⁺-N and microbial biomass), and promoted the absorption of different nutrients by plants (N, P and K) mainly through the negative regulation of AMF and the synergistic effect of AMF on diazotrophs, and finally increased crop yield. This shows that broomcorn millet-alfalfa intercropping can increase plant nutrient content by adjusting soil nutrients and soil microbial activities, thereby increasing yield. Furthermore, we found that 1P2M was the best ratio of alfalfa-millet intercropping system, which may provide reliable suggestions and selection basis for future agricultural production practices.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12870-024-06011-6.
... Given that our morphological investigation indicated AM associations in both gametophytes and sporophytes (see Results), PCR amplification was conducted using the primer set AMV4.5NF/AMDGR, designed primarily to amplify Glomeromycotina fungi (Sato et al., 2005), fused with 3-6-mer Ns. Additional PCR analyses were performed using the FRE-F/FRE-R primer set to detect potentially co-occurring Mucoromycotina fungi (Seeliger et al., 2024), but post-PCR electrophoresis confirmed no amplification with these primers. ...
Many plant species experience a prolonged subterranean phase during which they rely entirely on mycorrhizal fungi for carbon. While this mycoheterotrophic strategy spans liverworts, lycophytes, and ferns, most empirical research has centered on angiosperms.
This study explores the fungal associations of Sceptridium (Ophioglossaceae), an early‐diverging fern with mycoheterotrophic gametophytes. We analyzed germination patterns and fungal associations in Sceptridium gametophytes, comparing them to the distribution and mycorrhizal partners of photosynthetic sporophytes.
High‐throughput sequencing data reveal that mycoheterotrophic gametophytes consistently associate with a single Entrophospora fungus in the order Entrophosporales (Glomeromycotina), while photosynthetic sporophytes primarily partner with fungi from Glomeraceae (Glomerales, Glomeromycotina). Consequently, gametophytes exhibit spatial clustering without association with adult plants. This is the first documentation of an association between Entrophosporaceae (and the order Entrophosporales) and mycoheterotrophic plants.
The drastic shifts in Sceptridium mycorrhizal communities across life stages likely reflect changing physiological needs during development. Further research is essential to determine whether the association with Entrophosporaceae is widespread among mycoheterotrophic species and to elucidate the functional and physiological mechanisms underlying these mycorrhizal shifts.
... We used a nested PCR to amplify the 18S rDNA small subunit (SSU) regions using the primer pairs AML1/ AML2 (Lee et al., 2008) for the first amplification and AMV4.5NF/ AMDGR for the second amplification (Sato et al., 2005). We recovered the PCR products, purified and eluted them, and used electrophoresis for detection, which we then quantified. ...
Soil amendments, including various types of fertilizers, are often used to control the uptake of heavy metals such as cadmium in cropping fields. The influence of these amendments on other members of the agroecosystem, such as arbuscular mycorrhizal fungi (AMF), remains less well investigated. Here, we established an experiment with the application of woody peat organic fertilizer and phosphate rock powder to examine its effects on AMF communities in two cadmium-contaminated vegetable crop fields (cucumber and pepper). We found that the application of phosphate rock powder enhanced soil phosphorus content, while the application of woody peat organic fertilizer enhanced soil nitrogen content, but neither influenced AMF abundance. We also found little influence of either amendment on measures of AMF diversity, except in one case where the Shannon index of diversity was lower in pepper fields amended with phosphate rock powder. We did, however, find significant shifts in the community composition and relative abundances of AMF taxa in the two vegetable fields, primarily as a result of shifts in the soil pH and nitrogen content.
... To amplify the 18S rRNA gene, a two-step polymerase chain reaction (PCR) was performed using the NS31/AML2 primer pair (Simon et al., 1992;Lee et al., 2008) and AMDGR/AMV4.5NF (with 12-base barcode sequences) primer pair (Sato et al., 2005;Van et al., 2014), using the PCR protocol described by Dong et al. (2021). The PCR products were purified with an agarose gel DNA purification kit (AP-GX-250G; Axygen, Union City, CA, USA) and quantified using a NanoDrop 8000 (NanoDrop Technologies, Wilmington, DE, USA), then pooled together with the same molar amount (100 ng) from each sample and sequenced on the Illumina MiSeq PE250 platform at Chengdu Institute of Biology, Chinese Academy of Sciences, China. ...
The response of arbuscular mycorrhizal (AM) symbiosis to environmental fluctuations involves resource exchange between host plants and fungal partners, associations between different AM fungal taxa, and biomass allocation between AM fungal spore and hyphal structures; yet a systematic understanding of these responses to meadow degradation remains relatively unknown, particularly in Xizang alpine meadow.
Here, we approached this knowledge gap by labeling dual isotopes of air ¹³CO2 and soil ¹⁵NH4Cl, computing ecological networks of AM fungal communities, and quantifying AM fungal biomass allocation among spores, intra‐ and extraradical hyphae.
We found that the exchange ratio of photosynthate and nitrogen between plants and AM fungi increased with the increasing severity of meadow degradation, indicating greater dependence of host plants on this symbiosis for resource acquisition. Additionally, using 18S rRNA gene metabarcoding, we found that AM fungal co‐occurrence networks were more complex in more degraded meadows, supporting the stress gradient hypothesis. Meadow degradation also increased AM fungal biomass allocation toward traits associated with intra‐ and extraradical hyphae at the expense of spores.
Our findings suggest that an integrated consideration of resource exchange, ecological networks, and biomass allocation may be important for the restoration of degraded ecosystems.
... Plots were managed using Amplicon library and sequencing 172 The ITS2 rRNA amplicon library was generated using a nested PCR. Two primer pairs 173 were used: 1) pair rcAMDGR (5'-ATGATTAATAGGGATAGTTGGG-3') (Sato et al., 2005) 174 . CC-BY-NC 4.0 International license perpetuity. ...
In addition to environmental factors, plant genetics play a key role in shaping the root microbiota; however, the extent of this genetic control remains underexplored. Using a collection of 181 wheat lines derived from a genetically diverse population, we investigated the influence of wheat genotypes on the composition of the root endophytic mycobiota and explored the genetic determinants driving these relationships.
We first characterized the mycobiota associated with the roots of field-grown lines from the Evolutionary Prebreeding pOpulation (EPO) using Internal Transcribed Spacer 2 (ITS2) barcoding. Fungal diversity was then correlated with wheat genetics by quantitative methods, including heritability analysis and Genome Wide Association Studies (GWAS), to identify novel genetic determinants influencing the mycobiota composition.
Fungal species richness showed a positive correlation across most fungal clades, except between Mortierellomycotina and Glomeromycotina . Some specific fungal clades, such as Olpidiomycota or Chytridiomycota , underscored their potential as root endophytes. Additionally, we observed higher heritability in fungal clades ( i.e. at the phylum or subphylum rank) that exhibit a homogenous trophic mode, such as the biotrophic Arbuscular Mycorrhizal Fungi (AMF).
This study identifies 11 QTLs associated with mycobiota composition at the clade level. By shedding light on the genetic control of fungal diversity and uncovering key fungal associations, this work enhances our understanding of plant-microbiota interactions and highlights the potential for breeding strategies to optimize these relationships.
... ca. 260 bp of the 18S rRNA region) using the primers AMV4.5NF (5′-CGCCCGCCGCGCGCG GCGGGCGGGGCGGGGGCACGGGGGG[GCclamp]AAGCTCGTAGTT-GAATTTCG-3) and AMDGR (5′-CCCAACTATCCCTATTAATCAT-3′ (Sato et al., 2005). For both regions, polymerase chain reactions (PCR) were performed with 1 μL of DNA template, 0.5 μL of each primer and A. Manea et al. ...
... After diluting the isolated genomic DNA five times (to minimize the inhibiting effect of humic acids in the soil on the Polymerase Chain Reaction [PCR]), PCR amplification of the DNA extracts was performed with the sample-specific barcode-labeled versions of the primer pair AMV4.5NF/ AMDGR (Sato et al. 2005). This primer pair is well-suited to characterize AMF communities as it covers the region of the small subunit rRNA gene that contains the largest amount of variation (Van Geel et al. 2014). ...
Mowing is a crucial management strategy for conservation and restoration of semi-natural grasslands. In the past decades, dominant mowing methods have changed from manual to mechanical, using heavy machines causing soil compaction. Whereas the negative effects of compaction are well understood in agriculture and forestry, they have received little attention so far in nature management. This study aims to investigate the effects of compaction on soil quality, arbuscular mycorrhizal fungal communities, and survival of a target plant species. We subjected seven grasslands to three contrasting mowing types: manual mowing with a brush cutter, softtrack mowing-designed to minimize soil compaction-and tractor mowing. We compared compaction, soil properties, and arbuscular mycorrhizal communities among the types. Additionally, we experimentally subjected intact grassland sods containing Devil's bit scabious (Succisa pratensis Moench), a target species of grassland conservation , to compaction levels corresponding to the three mowing types. Subsequently, we assessed plant survival. We found that soil compaction, soil nutrient availability, and toxic soil elements were significantly higher in the softtrack-and tractor-mown parts of grassland sites compared to the manually mown parts. Also, the arbuscular mycorrhizal community composition differed significantly among mowing types, with the largest differences between "manual" and "tractor." Succisa pratensis survival significantly decreased by 43 and 71% on the short term and by 71 and 86% on the longer term with increasing compaction. Consequently, mowing-associated soil compaction compromises nature management targets via at least four mechanisms: nutrient enrichment, soil toxicity, changes in arbuscular mycorrhizal communities, and decreased survival of the target plant species.
... To assess AM fungal communities, the 18S rRNA gene fragment were nested polymerase chain reaction (PCR) amplified with the primer pair AML1 (5′-ATC AAC TTT CGATGG TAG GAT AGA-3′) and AML2 (5′-GAA CCC AAA CAC TTT GGT TTC C-3′) (Lee et al., 2008), and the second round primers were AMV4.5NF (5′-AAG CTC GTA GTT GAA TTT CG-3′) and AMDGRR (5′-CCC AAC TAT CCC TAT TAA TCA T-3′) (Sato et al., 2005). PCR results were further purified and paired-end sequencing was carried out using an Illumina MiSeq PE300 platform (Illumina, San Diego, CA, USA) in Majorbio Bio-Pharm Technology (Shanghai, China). ...
In the process of applying exotic plants to wetland ecological restoration, insufficiently evaluated alien species may exhibit strong competitiveness and fecundity. Once introduced, they can displace native flora, disrupt the original ecological balance, diminish biodiversity, and even induce ecosystem dysfunction. Furthermore, exotic plants have the potential to alter soil microbial community structure, including the composition and activity of beneficial symbiotic microorganisms such as arbuscular mycorrhizal fungi (AMF), thereby impacting soil nutrient cycling and interplant nutrient competition. Here, we conducted three consecutive years of sampling experiments to investigate the succession of AMF communities associated with the invasive plant Spartina alterniflora along an initial introduction chronosequence, and to identify the key environmental factors influencing its response to S. alterniflora invasion. Our findings reveal that early-stage invasion by S. alterniflora alters the composition of soil AMF communities with unclassified_c__Glomeromycetes and Glomus-viscosum-VTX00063 consistently dominating. Additionally, as the duration of introduction increases, the diversity of rhizosphere soil AMF significantly decreases, while its evenness remains relatively stable. It’s indicated that soil ω, AN, AK and N/P ratio were the main influencing factors of the integral AMF community. Notably, soil available phosphorus (AP) emerges as a positive influence on the important AMF taxa. The results confirm the mutual feedback effect between the invasion of the perennial herb S. alterniflora and AMF, in which specific AMF assist in nutrient absorption to promote S. alterniflora growth, potentially facilitating its rapid and successful invasion of new habitats. Given the likely differential effects of AMF communities on various plant species, our findings could contribute to anticipating future AMF-mediated effects during the introduction of alien plants.
... PCR amplification and sequencing were performed by the Australian Genome Research Facility. For each sample, 15 ng DNA were used to amplify the 18S rRNA gene using the AMF primer set AMV4.5NF and AMDGR (Sato et al., 2005). These primers accurately retrieve a wide range of AMF taxa, including both Glomeromycotina and Mucoromycotina subphyla (Albornoz et al., 2022;Orchard et al., 2017). ...
Arbuscular mycorrhizal fungi (AMF) facilitate ecosystem functioning through provision of plant hosts with phosphorus (P), especially where soil P is limiting. Changes in soil nutrient regimes are expected to impact AMF, but the direction of the impact may depend on context. We predicted that nitrogen (N)‐only enrichment promotes plant invasions and exacerbates their P limitation, increasing the utility of AMF and promoting AMF diversity. We expected that enrichment with N, P and other nutrients similarly promotes plant invasions, but decreases the benefit and diversity of AMF because P is readily available for both native and exotic plants.
We tested these hypotheses in eucalypt woodlands of south‐western Australia, that occur on soils naturally low in P. We evaluated AMF communities within three modified ground‐layer states representing different types of nutrient enrichment and associated plant invasions. We compared these modified states to near‐natural reference woodlands.
AMF richness varied across ground‐layer states. The moderately invaded/N‐enriched state showed the highest AMF richness, while the highly invaded/NP‐enriched state showed the lowest AMF richness. The reference state and the weakly invaded/enriched state were intermediate. AMF richness and colonisation were higher in roots of exotic than native plant species.
AMF community composition differed among ground‐layer states, with the highly invaded/NP‐enriched state being most distinct. Distinctions among states were often driven by family‐level patterns. Reference and moderately invaded/N‐enriched states each supported distinct groups of zero‐radius operational taxonomic units (zOTUs) in Acaulosporaceae, Gigasporaceae and Glomeraceae, whereas Gigasporaceae and Glomeraceae were nearly absent from the highly invaded/NP‐enriched state. Further, Diversisporaceae and Glomeraceae were most diverse in the moderately invaded/N‐enriched state.
Synthesis. Both the nature of soil nutrient enrichment and plant provenance matter for AMF. N‐only enrichment of low‐P soils increased AMF richness, likely due to the introduction of AMF‐dependent exotic plant species and exacerbation of their P limitation. In contrast, multi‐nutrient enrichment, decreased AMF richness potentially due to a decrease in host dependence on AMF, regardless of host provenance. The changes in AMF community composition with nutrient enrichment and plant invasion warrant further research into predicting the functional implications of these changes.
... Total DNA was extracted from mixed soil (0.5 g) using Fast DNA® Spin Kit for Soil. Then AM fungus-specific primers AML1 and AML2 were selected as the first round of primers (Lee et al., 2008), and AMV4.5NF (AAGCTCGTAGTTGAATTTCG) and AMDGR (CCCAACTATCCCTAT-TAATCAT) were selected as the second round of primers for amplification with the nested PCR amplification method (Sato et al., 2005). PCR was performed using TransGen AP221-02: TransStart Fastpfu DNA Polymerase, 20 ml reaction system. ...
With the development of agriculture and industry, the increase in nitrogen (N) deposition has caused widespread concern among scientists. Although emission reduction policies have slowed N releases in Europe and North America, the threat to biodiversity cannot be ignored. Arbuscular mycorrhizal (AM) fungi play an important role in the establishment and maintenance of plant communities in forest ecosystems, and both their distribution and diversity have vital ecological functions. Therefore, we analyzed the effects of long-term N addition on AM fungi and understory herbaceous plants in a Korean pine plantation in northern China. The soil properties, community structure, and diversity of AM fungi and understory herbaceous plants were detected at different concentrations of NH4NO3 (0, 20, 40, 80 kg N ha⁻¹ year⁻¹) after 7 years. The results showed that long-term N deposition decreased soil pH, increased soil ammonium content, and caused significant fluctuations in P elements. N deposition improved the stability of soil aggregates by increasing the content of glomalin-related soil protein (GRSP) and changed the AM fungal community composition. The Glomus genus was more adaptable to the acidic soil treated with the highest N concentration. The species of AM fungi, understory herbaceous plants, and the biomass of fine roots were decreased under long-term N deposition. The fine root biomass was reduced by 78.6% in the highest N concentration treatment. In summary, we concluded that long-term N deposition could alter soil pH, the distribution of N, P elements, and the soil aggregate fractions, and reduce AM fungal and understory herb diversity. The importance of AM fungi in maintaining forest ecosystem diversity was verified under long-term N deposition.
... Soil DNA was extracted from 10 g soil using the DNeasy Powermax Soil Kit (Qiagen, Germany) following the manufacturer's instructions. AM fungal-specific primers of AMV4.5NF (5′-AAGCTCGTAGTTGAATTTCG-3′) and AMD-GR (5′-CCCAACTATCCCTATTAATCAT-3′) were chosen for AMF community (Sato et al., 2005). High-throughput sequencing was performed using the Illumina MiSeq platform. ...
Community structure and composition of AMF shifted under different fertilization.
Soil physicochemical properties played important roles in contributing plant diversity and biomass.
Fertilization affected plant and AMF communities through changing soil abiotic properties.
Acaulospora and Diversispora were highly linked with plant communities.
Arbuscular mycorrhizal fungi (AMF) represent a crucial component of soil microorganisms, playing pivotal roles in promoting plant growth by enhancing nutrient availability. However, the responses of AMF communities to different fertilization regimes and their correlations with plant communities in the context of anthropogenic disturbances in alpine meadow ecosystems remain largely unexplored. In this study, we investigated the effects of nitrogen, phosphorus, and combined nitrogen-phosphorus fertilization on AMF communities and their interconnections with plant diversity and biomass based on a seven-year long-term experiment conducted on the Qinghai-Tibet Plateau. Our results showed significant shifts in AMF community structure and composition under different fertilization treatments, while the richness of AMF exhibited no remarkable alterations. Notably, soil pH decreased, and electrical conductivity increased with the increasing nitrogen fertilizer application, emerging as pivotal abiotic factors in predicting plant richness and biomass. Fascinatingly, Acaulospora exhibited a positive correlation with plant richness, serving as an important bioindicator of plant richness, while Diversispora emerged as the primary bioindicator of plant biomass. Our findings shed light on potential correlations between AMF community composition and both plant and soil abiotic factors, driven by nitrogen and phosphorus fertilization. We advocate for the critical significance of balanced fertilization in sustaining beneficial plant–soil–AMF interactions in natural ecosystems as well as agricultural soils.
... The most common primer pairs, used in direct PCR and/or nested PCR, are the following: NS31/AM1 [84]; AMV4.5NF/ AMDGR [85]; NS31/AM1, AM2, AM3 [86]; AML1/AML2 [87]; NS31/AML2 [88]; WANDA/AM1 [89]; AMADF/AMDGR [82] (Fig. 3.1). ...
Arbuscular mycorrhizal fungi (AMF) are known to be ubiquitous in many different agroecosystems where they are often considered to be critical for crop yield and agroecosystem sustainability. AM fungi exert a large ecological and economic impact by supporting plant nutrition, water supply, and resistance to pathogens. It is also known that AMF can improve soil structure and its fertility. Therefore, research on methods and primers to investigate and characterize presence, biodiversity, and distribution of AMF on a small and large scale is of great interest, especially in agroecosystems, whose management has been shown to exert different impacts on the diversity and structure of AMF communities. In this chapter, we report the most common DNA extraction methods and PCR primers, which can be used on both soil and root, for assessing AMF diversity and distribution in agroecosystems.
... The first amplification was conducted using the primers AML1F (ATCAACTTTCGATGGTAGGATAGA) and AML2R (GAACCCAAA-CACTTTGGTTTCC) (Lee et al., 2008). The second PCR was conducted using primers AMV4.5NF (AAGCTCGTAGTTGAATTTCG) and AMDGR (CCCAACTATCCCTATTAATCAT) (Sato et al., 2005). These primer pairs were selected in terms of reproducibility and precision to describe the AMF communities (Van Geel et al., 2014). ...
A R T I C L E I N F O Keywords: Indigenous arbuscular mycorrhizal fungi nutrition limitation mycorrhizal response threshold agricultural soil A B S T R A C T Arbuscular mycorrhizal fungi (AMF) play an important role in crop productivity, but their response to different fertilization regimes is variable. Understanding the mechanisms governing mycorrhizal responses under various fertilization regimes is key to maximizing the mycorrhizal contribution to ecosystem functioning. Indigenous AMF communities and soil were collected from long-term field experiments with various fertilization regimes. A greenhouse bioassay was carried out to identify the key regulators of the mycorrhizal response to inorganic and organic fertilization. Different fertilization regimes generated continuous gradients for most soil properties and a full spectrum of mycorrhizal phenotypes. Mycorrhizal growth response (MGR) in particular showed complex shifts from positive to neutral to negative, while mycorrhizal phosphorus (P) response was consistently positive and mycorrhizal nitrogen (N) response was consistently negative in fertilized treatments. Soil available P and available N to P (N:P) ratio appeared to be key soil predictors of the mycorrhizal response. Also, the nutrient status of non-mycorrhizal (NM) plants, namely shoot N concentration, shoot P concentration and shoot N:P ratio, were plant predictors of mycorrhizal response. A positive MGR occurred when NM plants were P-limited, and neutral and negative MGR occurred when NM plants were N-limited or co-limited by N and P. Further, the thresholds of soil available P (c. 13 mg kg-1), NM shoot N concentration (c. 14 g kg-1), NM shoot P concentration (c. 0.7 g kg-1) and NM shoot N:P ratio (c. 18), respectively, were estimated to predict mycorrhizal response. We conclude that the relative availability of N and P in soil and NM plants are good predictors of mycorrhizal response in different fertilization regimes. The existing nutrient thresholds combining soil and plant allowed more accurate prediction of mycorrhizal response and this has important implications for optimizing the mycorrhizal association in some important crops by managing soil nutrients.
... DNA extracts with high concentrations were diluted with TE buffer to 5 ng µL − 1 . For the first PCR amplification, the partial nuclear small subunit ribosomal RNA gene (SSU rDNA), approximately 260 bp in length including primers, was amplified from extracted DNA using the AM fungal-specific primers AMV4.5NF and AMDGR (Sato et al. 2005). This primer set favors amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae, and Paraglomeraceae sequences (Van Geel et al. 2014). ...
Due to the loss of photosynthetic ability during evolution, some plant species rely on mycorrhizal fungi for their carbon source, and this nutritional strategy is known as mycoheterotrophy. Mycoheterotrophic plants forming Paris-type arbuscular mycorrhizas (AM) exhibit two distinctive mycorrhizal features: degeneration of fungal materials and specialization towards particular fungal lineages. To explore the possibility that some understory AM plants show partial mycoheterotrophy, i.e., both photosynthetic and mycoheterotrophic nutritional strategies, we investigated 13 green herbaceous plant species collected from five Japanese temperate forests. Following microscopic observation, degenerated hyphal coils were observed in four species: two Colchicaceae species, Disporum sessile and Disporum smilacinum, and two Gentianaceae species, Gentiana scabra and Swertia japonica. Through amplicon sequencing, however, we found that all examined plant species exhibited no specificity toward AM fungi. Several AM fungi were consistently found across most sites and all plant species studied. Because previous studies reported the detection of these AM fungi from various tree species in Japanese temperate forests, our findings suggest the presence of ubiquitous AM fungi in forest ecosystems. If the understory plants showing fungal degeneration exhibit partial mycoheterotrophy, they may obtain carbon compounds indirectly from a wide range of surrounding plants utilizing such ubiquitous AM fungi.
... AM fungi were quantified using a similar protocol with the small subunit rRNA primers AMV4.5F and AM-DGR (saTo et al. 2005) and an annealing/extension step of 56.5 °C for 1 min. These primers target fungi within the phylum Glomeromycota and, of the AM fungal primers that yield products short enough for use with quantitative PCR methods, show the greatest specificity for this phylum (LuMini et al. 2010). ...
Although the use of under-trellis plants as weed control (living mulch) in vineyards has been gaining popularity, its effects on soil quality and especially soil biology have not been well studied. Due to functional trait differences, plants may differ in how they compete with vines, and may also change abiotic and biotic soil properties. A living mulch trial was established in the semi-arid Okanagan valley of British Columbia comparing vine growth as well as soil abiotic and biotic outcomes for four living mulch treatments: buffalo grass (Bouteloua dactyloides), Chewing's fescue (Festuca rubra ssp. com-mutata), birdsfoot trefoil (Lotus corniculatus), and shep-herd's purse (Capsella bursa-pastoris) with two industry standards: herbicide and cultivation. After two seasons, strong vine growth responses were seen that depended on living mulch identity, e.g., reduction in leaf N status with grasses, reduction in leaf water potential with the legume, birdsfoot trefoil. These effects were related to plant-induced changes to soil C:N ratio and soil moisture. Although treatments did not change abundance of the measured fungal guilds in bulk soil, abundance of ar-buscular mycorrhizal fungi in vine roots was lowest with birdsfoot trefoil as living mulch. This study may help growers to select living mulch species appropriate for the soil conditions and resource availability of their site. K e y w o r d s : cover crops; living mulch; vineyards; competition; soil properties; arbuscular mycorrhizal fungi; ento-mopathogenic fungi; soil borne pathogens.
... This involved the use of primers AML1 (ATCAACTTTCGATGGTAGGATAGA) and AML2 (GAACCCAAACACTTT-GGTTTCC) [29], as well as AMV4.5NF (AAGCTCGTAGTT-GAATTTCG) and AMDGR (CC-CAACTATCCCTATTAATCAT) [30] for the first and second rounds of amplification, respectively. The PCR reaction mixture comprised 10 µL of 2 × PCR ExTaq, 1 µL of a DNA template, and 0.50 µL of each primer, with sterile water added to achieve the desired final concentrations. ...
The crucial functional arbuscular mycorrhizal fungi (AMF) and diazotrophs play pivotal roles in nutrient cycling during vegetation restoration. However, the impact of managed vegetation restoration strategies on AMF and diazotroph communities remains unclear. In this study, we investigated the community structure and diversity of AMF and diazotrophs in a karst region undergoing managed vegetation restoration from cropland. Soil samples were collected from soils under three vegetation restoration strategies, plantation forest (PF), forage grass (FG), and a mixture of plantation forest and forage grass (FF), along with a control for cropland rotation (CR). The diversity of both AMF and diazotrophs was impacted by managed vegetation restoration. Specifically, the AMF Shannon index was higher in CR and PF compared to FF. Conversely, diazotroph richness was lower in CR, PF, and FG than in FF. Furthermore, both AMF and diazotroph community compositions differed between CR and FF. The relative abundance of AMF taxa, such as Glomus, was lower in FF compared to the other three land-use types, while Racocetra showed the opposite trend. Among diazotroph taxa, the relative abundance of Anabaena, Nostoc, and Rhizobium was higher in FF than in CR. Soil properties such as total potassium, available potassium, pH, and total nitrogen were identified as the main factors influencing AMF and diazotroph diversity. These findings suggest that AMF and diazotroph communities were more sensitive to FF rather than PF and FG after managed vegetation restoration from cropland, despite similar levels of soil nutrients among PF, FG, and FF. Consequently, the integration of diverse economic tree species and forage grasses in mixed plantations notably altered the diversity and species composition of AMF and diazotrophs, primarily through the promotion of biocrust formation and root establishment.
... For AMF amplicon libraries, a nested PCR approach targeted the 18S rRNA gene using the forward primer NS31 and the reverse primer AML2, generating a fragment size of 550 bp (Lee et al. 2008). In the second amplification step, the forward primer AMV4.5NF and the reverse primer AMDGR (Sato et al. 2005), were used. All primer sequences are shown in Supplementary Table 2. Libraries were built using a 600-cycle V3 Sequencing kit, then sequenced on a MiSeq Instrument (Illumina, San Diego, USA), paired-end 2 × 250 bp sequencing mode at NGS Soluções Genômicas, Piracicaba, Brazil. ...
Soil bacteria-fungi interactions are essential in the biogeochemical cycles of several nutrients, making these microbes major players in agroecosystems. While the impact of the farming system on microbial community composition has been extensively reported in the literature, whether sustainable farming approaches can promote associations between bacteria and fungi is still unclear. To study this, we employed 16S, ITS, and 18S DNA sequencing to uncover how microbial interactions were affected by conventional and organic farming systems on maize crops. The Bray–Curtis index revealed that bacterial, fungal, and arbuscular mycorrhizal fungi communities were significantly different between the two farming systems. Several taxa known to thrive in healthy soils, such as Nitrosophaerales, Orbiliales, and Glomus were more abundant in the organic farming system. Constrained ordination revealed that the organic farming system microbial community was significantly correlated with the β-glucosidase activity, whereas the conventional farming system microbial community significantly correlated with soil pH. Both conventional and organic co-occurrence interkingdom networks exhibited a parallel node count, however, the former had a higher number of edges, thus being denser than the latter. Despite the similar amount of fungal nodes in the co-occurrence networks, the organic farming system co-occurrence network exhibited more than 3-fold the proportion of fungal taxa as keystone nodes than the conventional co-occurrence network. The genera Bionectria, Cercophora, Geastrum, Penicillium, Preussia, Metarhizium, Myceliophthora, and Rhizophlyctis were among the fungal keystone nodes of the organic farming system network. Altogether, our results uncover that beyond differences in microbial community composition between the two farming systems, fungal keystone nodes are far more relevant in the organic farming system, thus suggesting that bacteria-fungi interactions are more frequent in organic farming systems, promoting a more functional microbial community.
... In the second round of PCR, the primers AMV4.5NF (5′-AAGCTCG-TAGTTGAATTTCG) and AMDGR (5′-CCCAACTATCCCTATTAATCAT) were utilized, with 6 barcode sequences added to the end of the primers (Sato et al., 2005). The reaction mixture (50 μL) consisted of 2.5 μL of DNA template, 1.25 μL of the primers AMV4.5NF and AMDGR (10 μM each), 25 μL of 2 × SYBR Premix Ex Taq (Takara, Japan), and 20 μL of sterile water. ...
... Total DNA in 0.5 g of frozen soil was extracted using FastDNA ® SPIN Kit for soil (MP Biomedicals, USA) and stored at − 30 °C until use. The nested PCR amplification of the 18S rRNA gene of AM fungi was performed according to Liu et al. (2021b) with GeoA2/ AML2 and thereby NS31/AMDGR (Sato et al. 2005;Lee et al. 2010). The PCR products were purified with QIAquick PCR Purification Kit (Qiagen, Germany), and their content was determined in NanoDrop ND-2000. ...
Purpose
Nanoscale zero-valent iron (nZVI) could degrade chlorinated pollutants like polychlorinated biphenyls (PCBs), but may be toxic to soil beneficial microbes such as arbuscular mycorrhizal (AM) fungi. The purpose of this work was to investigate the changes in community structure and diversity of AM fungi in PCBs-contaminated soils in response to input of nZVI, focusing on the balance between PCB dissipation and AM fungal conservation.
Materials and methods
Both PCBs-amended (10 mg/kg Aroclor 1242, a PCB mixture) and control soils with three nZVI input levels (0.1, 1, and 10 g/kg) were tested in this 8-week incubation experiments. Soil pH and available P and PCB concentrations were determined, and the nested PCR amplification of the 18S rRNA gene of AM fungi was performed and sequenced on the Illumina MiSeq™ platform. Differences in soil AM fungal community structure were compared using principal component analysis (PCA). The redundancy analysis (RDA) was used to reveal the relationship between PCBs, soil properties, and AM fungal communities under different treatments.
Results and discussion
Soil available P concentration significantly decreased as the nZVI input level increased, but only the high input level (10 g/kg) induced significantly higher soil pH and lower richness and Shannon and Simpson’s indices of AM fungal communities compared to the low input case (0.1 g/kg). The presence of PCBs only led to differentiation in AM fungal communities in the low nZVI input case. In the PCBs-amended soils, both moderate (1 g/kg) and high input of nZVI significantly decreased the concentrations of di-, tri-, tetra-, penta-chlorinated biphenyls and total PCBs compared to the low input case, while the high input level only further significantly increased the dissipation of hexachlorinated biphenyls compared with the moderate input case.
Conclusion
nZVI with high adsorption effects on soil available P had greater impacts on soil AM fungi than PCBs. However, the moderate nZVI input level (1 g/kg) had no significant effects on the richness and diversity indices of AM fungal community compared to the low input case (0.1 g/kg) and seemed to be more suitable for remediating of PCBs-contaminated soils, focusing on the limited inhibition on AM fungi.
... For each sample, DNA was extracted from 100 mg of frozen roots using a Plant DNA Extraction Kit (Tiangen Biotech, Beijing, China), and 10 ng of the extracted DNA was subjected to a nested PCR to amplify the partial 18S rRNA gene of AM fungi. The first primer pair was AML1-AML2 (Lee et al., 2008), and the second was AMV4.5NF-AMDGR (Sato et al., 2005) that were tagged with unique barcodes. All PCR conditions were the same as used in Peng et al. (2023). ...
It is well understood that agricultural management influences arbuscular mycorrhizal (AM) fungi, but there is controversy about whether farmers should manage for AM symbiosis.
We assessed AM fungal communities colonizing wheat roots for three consecutive years in a long‐term (> 14 yr) tillage and fertilization experiment. Relationships among mycorrhizas, crop performance, and soil ecosystem functions were quantified.
Tillage, fertilizers and continuous monoculture all reduced AM fungal richness and shifted community composition toward dominance of a few ruderal taxa. Rhizophagus and Dominikia were depressed by tillage and/or fertilization, and their abundances as well as AM fungal richness correlated positively with soil aggregate stability and nutrient cycling functions across all or no‐tilled samples. In the field, wheat yield was unrelated to AM fungal abundance and correlated negatively with AM fungal richness. In a complementary glasshouse study, wheat biomass was enhanced by soil inoculum from unfertilized, no‐till plots while neutral to depressed growth was observed in wheat inoculated with soils from fertilized and conventionally tilled plots.
This study demonstrates contrasting impacts of low‐input and conventional agricultural practices on AM symbiosis and highlights the importance of considering both crop yield and soil ecosystem functions when managing mycorrhizas for more sustainable agroecosystems.
... To fill this knowledge gap, we collected AMF-associated sequence data located in China that used the AMV4.5NF and AMDGR primers in DNA amplification (Sato et al., 2005). This choice of subject matter was based on extensive recent studies demonstrating that this primer set could accurately retrieve a wide range of taxa of G-AMF and Endogonales (and broader Mucoromycotinian) (Orchard et al., 2017a;Albornoz et al., 2021Albornoz et al., , 2022Mansfield et al., 2023), and public nucleotide databases (e.g., Sequence Read Archive) archived a huge number of AMF 18S rRNA environmental sequences obtained from China. ...
Arbuscular mycorrhizal (AM) fungi occur in the interface between soils and plants. Yet, the impacts of the plant community functional composition and soil properties on AM fungal communities remain poorly understood in the face of ongoing climate change. Here, we investigated the AM fungal community in alpine meadow habitats of the Tibetan Plateau by linking fungal species richness to plant community functional composition and soil parameters at three latitudinal sites. High-throughput sequencing of the AM fungal small subunit rRNA gene was performed to characterize fungal communities. We found that AM fungal diversity and plant functional diversity, as well as the contents of soil nutrients, were significantly higher in the southernmost site, Hongyuan (HY). Total soil nitrogen and soil-available phosphorus explained the variation in AM fungal diversity, while AM fungal biomass was best predicted by the plant community-weighed mean nitrogen:phosphorus ratio (CWM-N:P). Glomus species preferentially occurred in the northernmost site of Hezuo (HZ). Distance-based redundancy analysis (db-RDA) revealed that AM fungal community structure was influenced by not only CWM-N:P but also by plant community-weighed mean photosynthetic rate (CWM-Pn), soil total carbon, and plant community functional dispersion (FDis). We conclude that plant traits and soil properties are crucial for nutrient–carbon (C) exchange, as fungal symbionts may shape AM communities in this vast alpine meadow ecosystem. Our findings provide timely insight into AM fungal community assembly from the perspective of nutrient–C exchange dynamics in the Tibetan Plateau’s alpine meadow habitats.
Robusta coffee, grown by 25 million farmers across more than 50 countries, plays an important role in smallholder farmers' livelihoods and the economies of many low-income countries. Despite robusta coffee’s growing economic importance, currently accounting for 43% of global coffee production, its association with arbuscular mycorrhizal fungus (AMF) communities and how agricultural practices affect this association remains poorly understood. To address this, we characterised the AMF community composition of robusta coffee in part of its region of origin, the Democratic Republic of Congo. AMF diversity and community composition were compared between coffee monoculture, agroforestry systems and wild robusta in its native rainforest habitat. Using Illumina sequencing on 304 root samples, we identified 307 AMF operational taxonomic units (OTUs), dominated by the genera Glomus and Acaulospora . OTU richness did not vary across the three studied systems, yet large differences in community composition were found. Many unique OTUs were only observed in the coffee in the rainforest. In general, lower available soil phosphorus (P) and lower soil bulk density increased AMF diversity, yet higher available soil P and pH increased AMF diversity in the wild forest coffee. Shifts in AMF community composition across coffee systems were driven by canopy closure, soil pH, available soil P and soil bulk density. Our study is the first to characterise mycorrhizal communities in wild robusta coffee in its region of origin and shows that even low-input agricultural practices result in major AMF community shifts as compared to a natural baseline.
Communities of arbuscular mycorrhizal fungi (AMF) in soil are influenced by various agricultural managements, which in turn affects crop productivity. However, the impacts of straw returning on AMF communities are sparsely understood. Here, a 7-year field experiment including three sets of straw managements - returning methods (CK: no-tillage without straw; RT-SR: rotary tillage with straw; DB-SR: ditch-buried tillage with straw), burial amount, burial depth - were applied to evaluate the influences of straw managements on AMF composition. With full amounts of straw return, AMF diversity was similar between DB-SR and CK at a depth of 20 cm, whilst it was 13% higher than that under RT-SR. This could be explained by the increased rhizodeposition under DB-SR may counterbalance the negative effect of tillage under RT-SR on AMF hyphal growth. DB-SR changed AMF composition and enhanced the abundance of Glomeraceae, as well as the amount of glomalin-related protein, as a consequence increased plant P uptake by 68% than RT-SR. DB-SR remained stable plant P uptake and wheat biomass at a burial depth of 40 cm, but it decreased AMF diversity and the abundance of Glomeraceae as compared to DB-SR at a burial of 20 cm. This indicated DB-SR at a burial depth of 40 cm may be not beneficial to crop growth. Our results suggest that ditch-buried straw return with a depth of 20 cm and full amounts of straws is promising to improve soil health (via regulating AMF community diversity and composition) and promote crop production (via increasing plant P uptake).
The mutualistic association of arbuscular mycorrhizal fungi (AMF) is an important symbiotic association between the roots of plant and fungi that belongs to Glomeromycota order. The AM fungal isolation involves various techniques such as wet sieving and decanting and gradient centrifugation methods which are discussed here. For detection and quantification of AMF in roots, various histochemical staining and light microscopy-based techniques have been widely used. These techniques include trypan blue and DAB (3, 3′-diaminobenzidine) staining methods. The traditional system of identification of AM fungi mainly relied on morphological characterization of spore regarding color, size, and wall structure, etc. Molecular techniques for identification of AM fungi by SSU rDNA analysis give more accurate and scientific results and also used extensively in AMF taxonomic and diversity analysis. In this chapter, we reviewed the progress made in the traditional methods of mycorrhizal research and discussed recently developed techniques which are being utilized extensively in the field of AMF research. The chapter specifically focuses on the isolation and identification of AMF, providing a comprehensive summary of the diverse techniques employed throughout this process.
The BLAST programs are widely used tools for searching protein and DNA databases for sequence similarities. For protein comparisons, a variety of definitional, algorithmic, and statistical refinements permits the execution time of the BLAST programs to be decreased substantially while enhancing their sensitivity to weak similarities. A new criterion for triggering the extension of word hits, combined with a new heuristic for generating gapped alignments, yields a gapped BLAST program that runs at approximately three times the speed of the original. In addition, a method is described for automatically combining statistically significant alignments produced by BLAST into a position-specific score matrix, and searching the database using this matrix. The resulting Position Specific Iterated BLAST (PSLBLAST) program runs at approximately the same speed per iteration as gapped BLAST, but in many cases is much more sensitive to weak but biologically relevant sequence similarities.
The functioning and stability of terrestrial ecosystems are determined by plant biodiversity and species composition. However, the ecological mechanisms by which plant biodiversity and species composition are regulated and maintained are not well understood. These mechanisms need to be identified to ensure successful management for conservation and restoration of diverse natural ecosystems. Here we show, by using two independent, but complementary, ecological experiments, that below-ground diversity of arbuscular mycorrhizal fungi (AMF) is a major factor contributing to the maintenance of plant biodiversity and to ecosystem functioning. At low AMF diversity, the plant species composition and overall structure of microcosms that simulate European calcareous grassland fluctuate greatly when the AMF taxa that are present are changed. Plant biodiversity, nutrient capture and productivity in macrocosms that simulate North American old-fields increase significantly with increasing AMF-species richness. These results emphasize the need to protect AMF and to consider these fungi in future management practices in order to maintain diverse ecosystems. Our results also show that microbial interactions can drive ecosystem functions such as plant biodiversity, productivity and variability.
We describe a new molecular approach to analyzing the genetic diversity of complex microbial populations. This technique is based on the separation of polymerase chain reaction-amplified fragments of genes coding for 16S rRNA, all the same length, by denaturing gradient gel electrophoresis (DGGE). DGGE analysis of different microbial communities demonstrated the presence of up to 10 distinguishable bands in the separation pattern, which were most likely derived from as many different species constituting these populations, and thereby generated a DGGE profile of the populations. We showed that it is possible to identify constituents which represent only 1% of the total population. With an oligonucleotide probe specific for the V3 region of 16S rRNA of sulfate-reducing bacteria, particular DNA fragments from some of the microbial populations could be identified by hybridization analysis. Analysis of the genomic DNA from a bacterial biofilm grown under aerobic conditions suggests that sulfate-reducing bacteria, despite their anaerobicity, were present in this environment. The results we obtained demonstrate that this technique will contribute to our understanding of the genetic diversity of uncharacterized microbial populations.
The BLAST programs are widely used tools for searching protein and DNA databases for sequence similarities. For protein comparisons,
a variety of definitional, algorithmic and statistical refinements described here permits the execution time of the BLAST
programs to be decreased substantially while enhancing their sensitivity to weak similarities. A new criterion for triggering
the extension of word hits, combined with a new heuristic for generating gapped alignments, yields a gapped BLAST program
that runs at approximately three times the speed of the original. In addition, a method is introduced for automatically combining
statistically significant alignments produced by BLAST into a position-specific score matrix, and searching the database using
this matrix. The resulting Position-Specific Iterated BLAST (PSIBLAST) program runs at approximately the same speed per iteration
as gapped BLAST, but in many cases is much more sensitive to weak but biologically relevant sequence similarities. PSI-BLAST
is used to uncover several new and interesting members of the BRCT superfamily.
Despite the importance of arbuscular mycorrhizal fungi in the majority of terrestrial ecosystems, their ecology, genetics,
and evolution are poorly understood, partly due to difficulties associated with detecting and identifying species. We explored
the inter- and intraspecies variations of the 18S rRNA genes of the genus Gigaspora to assess the use of this marker for the discrimination of Gigaspora isolates and of Gigasporaceae populations from environmental samples. Screening of 48 Gigaspora isolates by PCR-denaturing gradient gel electrophoresis (DGGE) revealed that the V3-V4 region of the 18S rRNA gene contained
insufficient variation to discriminate between different Gigaspora species. In contrast, the patterns of 18S ribosomal DNA (rDNA) heterogeneity within the V9 region of this marker could be
used for reliable identification of all recognized species within this genus. PCR-DGGE patterns provided insight into some
putative misidentifications and could be used to differentiate geographic isolates of G. albida, G. gigantea, and G. margarita but not G. rosea. Two major clusters were apparent based upon PCR-DGGE ribotype patterns, one containing G. albida, G. candida, G. ramisporophora, and G. rosea and the other containing G. decipiens and G. margarita. Dissection of the DGGE patterns by cloning, DGGE screening, and sequencing confirmed these groupings and revealed that some
ribotypes were shared across species boundaries. Of the 48 isolates examined, only two displayed any spore-to-spore variation,
and these exceptions may be indicative of coisolation of more than one species or subspecies within these cultures. Two Brazilian
agricultural soils were also analyzed with a Gigasporaceae-specific nested PCR approach, revealing a dominance of G. margarita within this family.
The roots of most plants are colonized by symbiotic fungi to form mycorrhiza, which play a critical role in the capture of nutrients from the soil and therefore in plant nutrition. Mycorrhizal Symbiosis is recognized as the definitive work in this area. Since the last edition was published there have been major advances in the field, particularly in the area of molecular biology, and the new edition has been fully revised and updated to incorporate these exciting new developments. . Over 50% new material . Includes expanded color plate section . Covers all aspects of mycorrhiza . Presents new taxonomy . Discusses the impact of proteomics and genomics on research in this area.
summaryLittle information currently exists on species diversity in communities of arbuscular mycorrhizal fungi (AMF), mainly owing to difficulties in identification of field extracted spores on the basis of morphology. The possibility was explored to identify individual AMF spores from the field on the basis of a molecular marker, namely the nuclear ribosomal DNA encoding the highly conserved 5.8S rRNA with the two flanking internal transcribed spacers (ITS region), known to vary between species. A technique involving polymerase chain reaction followed by restriction fragment length polymorphism analysis (PCR–RFLP) was developed to amplify and characterize the ITS region from single AMF spores. PCR reactions with extracts from single spores of three AMF species, raised under glasshouse conditions, yielded reproducibly a single amplification product of the ITS region in sufficient amounts to allow cleavage with several restriction enzymes. The size of the ITS region, c. 600 base pairs, varied only slightly between species. Digestion of the PCR products with the restriction enzymes Hinfl and Taq I resulted in banding patterns that were reproducible for different individual spores of a given species, but showed clear differences between the three species tested. The sum of the fragment sizes was sometimes greater than the size of the original PCR product, e.g. in Glomus mosseae. Clones of the amplification product from a single spore of this fungus were obtained and sequenced. This yielded two closely related but different sequences, indicating that two different ITS regions co-existed in the spore. The RLFP pattern of the amplification product of the spore was a result of an amalgamation of these two sequences. The technique was applied to AMF spores collected from a species-rich grassland. Spores were sorted into morphological groups on the basis of their colour, size, and shape, and then subjected to PCR–RFLP analysis. In some morphological groups, a large percentage of spores failed to yield an amplification product, probably because they had lost their contents. A group of Glomus spores yielding amplification products in the majority of cases was further investigated: PCR RFLP analysis on 10 individual spores from the field produced 10 different patterns. Similar results were obtained with other groups of spores. The results suggest that the diversity in natural AMF communities and the genetic diversity within individual spores might he much greater than previously thought.
Archaeospora leptoticha, Archaeosporaceae, is a dimorphic arbuscular mycorrhizal fungus, We designed the PCR primers, ARCH2O8, specific to the 18S rRNA gene of Ar. leptoticha, and NS12, a counter primer for ARCH2O8, based on a conserved region of the 18S rRNA gene among glomalean fungi. ARCH2O8 and the taxons-pecific primers designed by Simon et al. (Appl. Environ. Microbiol., 59, 4211-4215, 1993) with N512 amplified partial segments, about 110 bp, of thel8S rRNA gene from spores and mycorrhizal roots of the corresponding fungal species. By using ARCH2O8, we observed that some plant roots collected in the field were colonized by Ar. leptoticha. The taxon..specific PCR could be used for surveys of arbuscular mycorrhizal fungal taxa in the field.
In a recent paper, Almeida (1989) wrote about the names and epithets used in the Endogonales sensu lato, commenting on their derivations, and providing a list of names he considered should be used in preference. Almost all of these changes were erroneous, and, with four exceptions, the original names should be retained. Two new corrections of orthographic errors are made.
DNA was amplified from individual fossil pollen grains of Abies spp. (Pinaceae), which have been detected from Pleistocene peaty deposits (at least 150,000 years old). To identify the species of the fossil pollen by DNA analysis, the region indicating the species-specific sequence was searched among extant Abies species and the spacer region between rrn5 and trnR in chloroplast DNA was sequenced for four grains of the fossil pollen. Three pollen samples produced the same sequence as extant Abies species. The sequence for the remaining sample differed from that of extant Abies by one substitution. This study showed not only a successful DNA analysis from a single grain of fossil pollen but also a new method to identify the species of fossil pollen for the pollen analysis field.
Roots of bluebell (Hyacinthoides nonscripta) were sampled from a woodland in Yorkshire, UK and spores of an arbuscular mycorrhizal fungus Scutellospora sp., were obtained from the surrounding soil. Partial small subunit (SSU) ribosomal RNA sequences were amplified from both roots and spores using either the universal forward primer SS38 or the Glomales-specific primer VANS1, with the reverse Gigasporaceae-specific primer VAGIGA. Amplified products were cloned and sequenced. Both spores and roots yielded sequences related to those known from fungi within the Glomales, with up to four distinct SSU sequences obtained from individual spores. The VANS1 primer-binding site varied considerably in sequence and only a subset of Scutellospora sequences were amplified when the VANS1 primer was used. In addition to glomalean sequences, a number of different sequences, apparently from ascomycetes, were obtained from both root and spore samples.
Using new and existing 18S rRNA sequence data, we show that at least five species of glomalean fungi lie outside the previously defined families and diverged very early in the evolution of that group. These five fungi would have been missed by many previous ecological studies because their sequences are not well matched to available taxon-specific primers and they do not stain well with the standard reagents used for morphological analysis. Based upon spore morphology, these species are currently assigned to Glomus and Acaulospora, and two of the species are dimorphic, exhibiting spore stages of both genera. This suggests that dimorphic spores are the ancestral state for the order and that one or the other morphology was lost in various lineages. Our analyses also show that Geosiphon pyriforme, a symbiont with cyanobacteria, is not necessarily a sister group of the Glomales; instead, it may be derived from mycorrhizal ancestors.
Ancient asexuals directly contradict the evolutionary theories that explain why organisms should evolve a sexual life history. The mutualistic, arbuscular mycorrhizal fungi are thought to have been asexual for approximately 400 million years. In the absence of sex, highly divergent descendants of formerly allelic nucleotide sequences are thought to evolve in a genome. In mycorrhizal fungi, where individual offspring receive hundreds of nuclei from the parent, it has been hypothesized that a population of genetically different nuclei should evolve within one individual. Here we use DNA-DNA fluorescent in situ hybridization to show that genetically different nuclei co-exist in individual arbuscular mycorrhizal fungi. We also show that the population genetics techniques used in other organisms are unsuitable for detecting recombination because the assumptions and underlying processes do not fit the fungal genomic structure shown here. Instead we used a phylogenetic approach to show that the within-individual genetic variation that occurs in arbuscular mycorrhizal fungi probably evolved through accumulation of mutations in an essentially clonal genome, with some infrequent recombination events. We conclude that mycorrhizal fungi have evolved to be multi-genomic.
A polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) approach for the detection and characterization of arbuscular mycorrhizal fungi (AMF) 18S ribosomal DNA (rDNA) was developed and applied to the study of AMF communities associated with the main sand-stabilizing plant species of the Dutch sand dunes, marram grass (Ammophila arenaria, L.). DNA was extracted directly from plant roots, soil or isolated AMF spores, and prominent bands resulting from AMF-specific DGGE profiles were excised for sequence analysis. This strategy provided a robust means of detecting and identifying AMF-like species without the use of trap plant cultivation methods. A number of Glomus-like and Scutellospora-like sequences was detected, including a putatively novel Glomus species, and differences were observed in the dominant AMF-like populations detected in healthy vs. degenerating stands of A. arenaria and in bulk sand dune soil. It has previously been suggested that plant pathogens, such as fungi and nematodes, may contribute to the decline of A. arenaria. Although no causal relationship can be drawn between the observed differences in the dominantly detected AMF-like populations and the vitality of plant growth, these results indicate that mutualistic interactions between this plant and AMF should not be overlooked when examining the role of soil-borne microorganisms in vegetation dynamics. In addition, there were discrepancies observed between the AMF-like groups detected in spore populations vs. direct 18S rDNA analysis of root material, corroborating previous suggestions that spore inspection alone may poorly represent actual AMF population structure.