Content uploaded by Barry Ziola
Author content
All content in this area was uploaded by Barry Ziola on Sep 22, 2014
Content may be subject to copyright.
89
Rapid Screening for Gram-Negative and Gram-Positive
Beer-Spoilage Firmicutes Using a Real-Time Multiplex PCR
Vanessa Pittet, Monique Haakensen, and Barry Ziola,1 Department of Pathology and Laboratory Medicine,
University of Saskatchewan, Saskatoon, SK, Canada
ABSTRACT
J. Am. Soc. Brew. Chem. 68(2):89-95, 2010
Current methods for detection and identification of beer-spoilage bac-
teria can be time-consuming and may not encompass all beer-spoilage iso-
lates due to targeting of specific species. As such, a rapid method that targets a
broader spectrum of beer-spoilage bacteria is likely to be more efficient for
initial detection of contamination. Building on our previous real-time PCR
(rltPCR) that detects Firmicutes, we created a system that enables concur-
rent detection and differentiation of gram-negative and -positive brewery-
associated Firmicutes. Our two previously described rltPCR hydrolysis
probes, which are able to detect all bacteria and Firmicutes, were used in
combination with a newly developed probe (GmNeg) that detects only gram-
negative brewery-associated Firmicutes. In silico analysis performed to de-
termine the specificity of the GmNeg probe predicted that the probe would
detect all gram-negative brewery-associated Firmicutes. This was confirmed
by rltPCR analysis of brewery-associated bacteria, with the GmNeg probe
showing specificity for gram-negative Firmicutes but not for gram-positive
Firmicutes or any non-Firmicutes. The sensitivity of this rltPCR system
was 35 fg of DNA per reaction, corresponding to approx. 10–20 bacteria.
This multiplex rltPCR will enable brewery quality control laboratories to
rapidly screen for brewery-associated Firmicutes, with identification of a con-
taminant as either a gram-negative or -positive bacterium.
Keywords: Beer-spoilage organisms, Firmicutes, Gram-negative, Gram-
positive, Multiplex real-time PCR, Rapid screening
RESUMEN
Los métodos actuales de detección e identificación de bacterias de de-
terioro de cerveza puede ser mucho tiempo y no puede abarcar todos los
aislados de bacterias de deterioro de cerveza debido a la orientación de
determinadas especies. Como tal, un método rápido que se dirige a un am-
plio espectro de bacterias de deterioro de cerveza es probable que sea más
eficiente para la detección inicial de contaminación. Basándonos en nuestra
anterior en tiempo real PCR (rltPCR) que detecta Firmicutes, hemos creado
un sistema que permite la detección y la diferenciación simultánea de bacte-
rias gram-negativos y gram-positivos Firmicutes asociada con la cervece-
ría. Nuestros dos descritos anteriormente rltPCR sondas de hidrólisis, que
son capaces de detectar todas las bacterias y Firmicutes, se utiliza en com-
binación con una sonda de nuevo desarrollo (GmNeg) que detecta sólo gram-
negativos Firmicutes asociados con la cervecería. Análisis en silico realiza
para determinar la especificidad de la sonda GmNeg predijo que la sonda
detecta todos los gram-negativos Firmicutes asociados con la cervecería.
Esto fue confirmado por análisis rltPCR de las bacterias asociadas con la
cervecería, con la sonda GmNeg muestra especificidad por gram-negativos
Firmicutes pero no para gram-positivas Firmicutes o de otra índole Firmi-
cutes. La sensibilidad de este sistema de rltPCR fue de 35 fg de ADN por
reacción, que corresponde a aprox. 10–20 bacterias. Esta rltPCR múlti-
plex permitirá que los laboratorios de control de calidad de la cervecería a
rápidamente la pantalla para Firmicutes asociada con la cervecería, con la
identificación de un contaminante, ya sea como bacterias gram-negativos
o gram-positivos.
Palabras claves: Bacterias de deterioro de cerveza, Firmicutes, Gram-
negativas, Gram-positivas, PCR múltiplex en tiempo real, Rápida detección
The phylum Firmicutes contains a broad range of organisms,
some of which are positively used in production of dairy products,
vegetables, and meats (17). However, some Firmicutes can be very
problematic for alcoholic beverage-related industries, as well as
the fuel ethanol industry (12,13,16). Contamination in these indus-
tries can lead to major economic losses due to beverage spoilage
or a decrease in ethanol yield. As such, rapid detection and identi-
fication of Firmicutes in these settings are desired.
Currently, the most problematic bacteria for breweries can be
categorized into two main groups, i.e., gram-positive and gram-
negative Firmicutes. The most common gram-positive Firmicutes
are Lactobacillus and Pediococcus bacteria, whereas the gram-
negative Firmicutes encompass bacteria belonging to the genera
Megasphaera, Pectinatus, Selenomonas, and Zymophilus. Most of
these bacteria either have been directly associated with beer-spoil-
age or isolated in breweries and have the potential to spoil beer
(13,16). As such, rapid detection and identification of these con-
taminants in a brewery are necessary for appropriate quality con-
trol decisions to be made. However, the methods currently available
for detection and identification are time-consuming and usually
focus on speciation or prediction of beer-spoiling capability (6,
7,16). These narrow and specific approaches can be problematic,
particularly if novel beer-spoiling bacteria are present or if a beer-
spoilage gene is not targeted by the method used. Therefore, we
believe it is more beneficial to use a rapid and broad screening
method for initially determining whether a spoilage bacterium is
indeed present.
From this starting point, we previously developed a real-time PCR
(rltPCR) for detecting all Firmicutes (4). This rltPCR enabled de-
tection of all bacteria through use of a universal eubacterial probe
(357R), as well as all Firmicutes through use of a Firmicutes-spe-
cific probe. Building on this system, we have added a third probe
(GmNeg) that is able to specifically detect all gram-negative brew-
ery-associated Firmicutes. Our new multiplex rltPCR enables the
accurate and rapid detection of brewery-associated gram-negative
Firmicutes, as well as concurrent differentiation between gram-posi-
tive and -negative Firmicutes.
EXPERIMENTAL
Development of the Gram-Negative Probe GmNeg
The 16S rRNA gene sequences for each brewery-associated genus
were aligned and downloaded from the Ribosomal Database Proj-
ect (RDP) (2,3). Brewery-associated genera were defined by Priest
and Campbell (13) and Haakensen and Ziola (8). Good quality se-
quences from all type-strain isolates were downloaded for each ge-
nus. For genera that contained more than one species, a genus con-
sensus sequence was made using the “cons” program, with default
settings, from the European Molecular Biology Software Suite v6.0.1
(15). A multiple sequence alignment (MSA) of these 16S rRNA
gene consensus sequences was created using ClustalX 2.0 software
(10). A region conserved only in gram-negative Firmicutes was
then determined. Two more focused MSAs were then created. The
first MSA consisted of all gram-negative brewery-associated Fir-
micutes genera, which produced the consensus sequence used to
design the GmNeg probe (Fig. 1A). The second MSA consisted of
1 Corresponding author. E-mail: b.ziola@usask.ca; Phone: +1.306.966.4330; Fax:
+1.306.966.8049.
doi:10.1094 /ASBCJ-2010-0308-02
© 2010 American Society of Brewing Chemists, Inc.
90 / Pittet, V., Haakensen, M., and Ziola, B.
all other brewery-associated genera compared with the GmNeg con-
sensus sequence (Fig. 1B).
The GmNeg probe was designed to work with the previously de-
scribed eubacterial 357R and Firmicutes-specific hydrolysis probes
(4) and a set of universal eubacterial 16S rRNA gene primers (11,
14). The Firmicutes and GmNeg probes bind to the same DNA
strand, whereas the 357R probe binds to the opposite DNA strand
of the PCR-amplified 16S rRNA gene (Fig. 2). The sequences of
the probes and primers, as well as their 16S rRNA gene binding lo-
cations, are shown in Table I.
In Silico Testing
The specificity of the GmNeg probe was predicted by in silico
analysis, using the RDP Probe Match tool (2,3) (as of April 16,
2009) and the parameters that only bacterial type-strain isolates
with good-quality 16S rRNA gene sequences were searched and
that those with 2 mismatches with the GmNeg probe were re-
turned as output. All sequences fulfilling these criteria were cate-
gorized either as non-Firmicutes or Firmicu tes. Further, all brewery-
associated genera were classified as gram-positive or -negative
Firmicutes or non-Firmicutes (Figs. 3 and 4). It should be noted
that brewery-associated organisms are not necessarily beer-spoil-
age organisms, but all genera previously associated with breweries
were included because the beer-spoilage ability of each individual
isolate is not known (1,13).
rltPCR Parameters
The GmNeg probe was labeled with a 5 6-FAM (fluorescein) and
3 Iowa Black FQ molecule (Integrated DNA Technologies). A
universal eubacterial probe (357R) and a Firmicutes probe, which
we previously described (4), were also used. As before, the eubac-
terial 16S rRNA probe was labeled with a 5 Cy3 and 3 Black Hole
Quencher-2 molecule. To work in a multiplex rltPCR with the
GmNeg probe, the Firmicutes probe was labeled with a 5 Cy5 and
3 Iowa Black RQ molecule instead of a 5 6-FAM and 3 Black
Hole Quencher-1 molecule, as described previously (4). Finally,
the 16S rRNA gene target was amplified by PCR using primer set
8F and 534R (11,14).
Bacterial growth conditions and DNA extractions were performed
as previously described (4). Each PCR reaction contained 0.2 mM
each deoxynucleotide triphosphate, 1× PCR buffer (Invitrogen), 2 U
of Taq DNA Polymerase (Platinum, Invitrogen), 1.5 mM MgCl2,
0.4 µM each primer (8F and 534R), and 0.2 µM each probe (357R,
Firmicutes, and GmNeg). Template DNA (2.5 µL) was added, and
the reaction was brought to 25 µL with water. The rltPCR program
consisted of the following: 95°C for 5 min, followed by 45 cycles
of 95°C for 15 sec, 52°C for 30 sec, and 72°C for 30 sec. Amplifi-
Fig. 2. Binding locations of primers and probes on the 16S rRNA gene, with numbering according to the 16S rRNA gene of Pectinatus cerevisiiphilus
ATCC 29359T.
Fig. 1. Multiple sequence alignments of consensus sequences for brewery-
associated genera. A dot indicates a match with the GmNeg consensus se-
quence, whereas a discrepancy with the consensus sequence is shown as
a
nucleotide. A, Consensus sequence of brewery-associated gram-negative
Firm icute s genera used to design the GmNeg probe. B, Consensus sequence
(representing the GmNeg probe) compared with other brewery-associated
genera, with the number of species used to create or compared to the con-
sensus sequence indicated in parentheses.
TABLE I
Sequences and Gene Binding Locations
of Multiplex Real-Time PCR Primers and Probes
Probe or Primer Sequence Locationa
GmNeg probe ATGGGTCTGCGTCTGATTAGCT 232–254
357R probe CTGCTGCCTCCCGTAG 361–347
Firmicutes probe ACGCGGCGTTGCTCCATCAG 391–410
Primer 8F AGAGTTTGATCCTGGCTCAG 8–27
Primer 534R ATTACCGCGGCTGCTGG 540–524
aLocation is based on the 16S rRNA gene from Pectinatus cerevisiiphilus ATC C
29359T.
Multiplex PCR to Screen for Beer-Spoilage Firmicutes / 91
cations were performed in a thermal cycler (SmartCycler, Cepheid)
with cycle threshold (Ct) cut-off values of 30, 10, and 10 fluores-
cence units for FAM, Cy3, and Cy5, respectively. The binding speci-
ficity of the probes was analyzed for at least one species of most
brewery-associated genera. A summary of organisms tested is pro-
vided in Table II (a comprehensive list is provided in the Appendix).
TABLE II
Brewery-associated Bacteria Tested by Multiplex Real-Time PCR
Bacteria Brewery-associated Probe
Gram Positive/Negative Genus Species Testeda GmNeg Firmicutes 357R
Firmicutes
– Megasphaera 4 species + (all species)b + (all species) + (all species)
– Pectinatus 3 species + (all species) + (all species) + (all species)
– Selenomonas lacticifex + + +
– Zymophilus 2 species + (both species) + (both species) + (both species)
+ Bacillus subtilis – + +
+ Enterococcus faecalis – + +
+ Lactobacillus 22 species – (all species) + (all species) + (all species)
+ Leuconostoc mesenteroides – + +
+ Oenococcus oeni – + +
+ Pediococcus 6 species – (all species) + (all species) + (all species)
+ Staphylococcus epidermidis – + +
+ Streptococcus viridans – + +
Non-Firmicutes
– Acetobacter aceti – – +
– Acinetobacter calcoaceticus – – +
– Alcaligenes faecalis – – +
– Citrobacter freundii – – +
– Enterobacter agglomerans – – +
– Gluconobacter oxydans – – +
– Klebsiella pneumoniae – – +
– Obesumbacterium proteus – – +
– Proteus mirabilis – – +
– Pseudomonas aeruginosa – – +
– Zymomonas mobilis – – +
+ Micrococcus luteus – – +
a Details of species and isolates tested are provided in the Appendix.
b Megasphaera elsdenii was weakly positive.
Fig. 3. In silico predictions for binding of the GmNeg probe to the 16S rRN
A
genes of brewery-associated genera. All organisms having 2 mismatches
with the GmNeg probe were considered positive hits (the number of hits
per group are shown). All brewery-associated genera used to create this tree
are listed below the divisions.
Fig. 4. In silico predictions for binding of the GmNeg probe to the 16S rRN
A
genes of genera not associated with breweries. Included are all genera tha
t
were not part of Figure 3. The positive hits were subdivided into gram-posi-
tive and -negative Firmicutes and non-Firmicutes (the number of hits pe
r
group are shown). The most prominent genera showing reactivity with the
GmNeg probe are listed below the tree.
92 / Pittet, V., Haakensen, M., and Ziola, B.
rltPCR Standard Curve
Serial dilutions of DNA from Pectinatus cerevisiiphilus AT CC
29359T were used to produce a standard curve (Fig. 5). The opti-
cal density at 260 nm of a 1:4 dilution of the isolated DNA was
0.702, indicating a DNA concentration of 140.4 ng/µL. The DNA
was diluted in three different serial dilution series in 10-fold in-
crements to a final concentration of 1.4 fg/µL, and 2.5 µL of each
dilution was used as template. In total, five runs were performed:
two serial dilutions were each tested once, and the third serial di-
lution was tested three times. The average Ct of the five runs was
obtained and plotted against log10 femtograms of DNA per PCR
reaction. The standard curve was constructed, and the correlation
coefficient (R2) was calculated as described by Higuchi et al (9).
RESULTS AND DISCUSSION
In Silico Predictions
In this paper, we describe a new method for the rapid screening
of brewery-associated spoilage bacteria. Our approach was to ex-
pand our previously described multiplex rltPCR that used a universal
eubacterial probe (357R) to detect all bacteria and a Firmicutes-
specific probe to detect all Fir micutes (4). Through comparisons of
MSAs constructed using the 16S rRNA genes from brewery-as-
sociated Firmicutes genera, a conserved region specific to gram-
negative Firmicutes was identified (Fig. 1), and the new GmNeg
hydrolysis probe was designed (Table I). The properties of the
GmNeg probe allow it to work in combination with the earlier two
probes (Fig. 2).
An in silico analysis was performed to predict the binding speci-
ficity of the GmNeg probe. It was found that, for all brewery-asso-
ciated genera, only gram-negative Firmicutes had 2 mismatches
with the GmNeg probe, thus predicting specificity to only gram-
negative brewery-associated Firmicutes. As shown in Figure 3, 15
of 16 species belonging to brewery-associated gram-negative Fir-
micutes genera were predicted to react with the GmNeg probe. The
one species that had 3 mismatches with the probe, Megasphaera
elsdenii, has not been associated with breweries; however, this bac-
terium is within a genus that contains other bacteria that have been
found in breweries and, therefore, was included in our testing. Thus,
discounting M. elsdenii, specificity predicted for the probe was
for 100% of all brewery-associated gram-negative Firmicutes. Em-
phasizing this further, the MSA of all brewery-associated genera
indicated that all genera other than gram-negative Firmicutes had
4 mismatches with the GmNeg probe (Fig. 1B).
To determine the specificity of the GmNeg probe for organisms
not known to be associated with breweries, all hits for bacteria not
encompassed in the genera included in Figure 3 were analyzed
(Fig. 4). Of the 107 remaining hits, 38 were predicted for gram-
negative non-Firmicutes organisms, 36 were predicted for gram-posi-
tive Firmicutes, and 33 were predicted for gram-negative Firmi-
cutes. Thus, beyond brewery-associated bacteria, some gram-positive
Firmicutes may react with the GmNeg probe. In addition, our new
multiplex rltPCR provided a means for detecting bacteria belong-
ing to the 38 gram-negative non-Firmicutes genera by using three
probes and looking for positive results for the 357R and GmNeg
probes but not for the Firmicutes probe.
rltPCR
Seventy-two isolates (representing fifty-six species) of brewery-
associated bacteria were tested using our three-probe multiplexed
rltPCR (results are summarized in Table II, with detailed results
provided in the Appendix). This test showed that predictions made
by the in silico analyses were correct, with only gram-negative brew-
ery-associated Firmicutes reacting strongly with the GmNeg probe.
M. elsdenii was weakly positive, but to obtain a positive rltPCR re-
sult, a high concentration of bacterial DNA was required. This fits
with the in silico analysis prediction in which M. elsdenii has three,
rather than two mismatches with the GmNeg probe. Most impor-
tantly, the combination of the three probes accurately detected brew-
ery-associated gram-negative Firmicutes and all Firmicutes, en-
abling differentiation of non-Firmicutes from Firmicutes, as well as
gram-positive from gram-negative Firmicutes. Consequently, the
currently described multiplex rltPCR should find widespread appli-
cability as a rapid screening system for bacterial contamination in
breweries.
Sensitivity
In addition to providing rapid results, this multiplex rltPCR had
good sensitivity. Using three replicates of serial dilutions of P. cere-
visiiphilus DNA as a representative for gram-negative brewery-as-
sociated Firmicutes, five trials were run, and the averages were plot-
ted to produce standard curves (Fig. 5). When graphed, all three
probes had very similar sensitivity levels, with virtually identical
slopes and intercepts, confirming that these three probes can be
effectively used together in a multiplexed PCR system. All three
Fig. 5. Standard curve for real-time PCR detection of serially diluted Pec-
tinatus cerevisiiphilus ATCC 29359T DNA using the multiplexed GmNeg,
Firmicutes, and 357R probes. Averages from five trials were plotted (bars
indicate range).
Multiplex PCR to Screen for Beer-Spoilage Firmicutes / 93
probes were able to detect as little as 35 fg of DNA per reaction
(Fig. 5). Because the genome size of P. cerevisiiphilus is not known,
draft genome sequences of bacteria in the genera Selenomonas and
Mitsuokella were used (GenBank accession nos. ABWK02000000,
ACKT01000000, ACKP01000000, and ACLA01000000). Consid-
ering the genomic size range of these closely related gram-nega-
tive Firmicutes, we estimate that our multiplex rltPCR can detect
approx. 10–20 bacteria. Based on previous data, where testing was
done on DNA extracted from Firmicutes recovered from beer by
filtration and overnight culturing (4), this corresponds to approx.
30–60 bacteria per 341-mL bottle of beer.
CONCLUSIONS
Our multiplex rltPCR using the GmNeg, Firmicutes, and 357R
probes will allow breweries to rapidly screen for and identify bac-
terial contaminants to the level of gram-negative and -positive beer-
spoilage Firmicutes. This assay would be relatively inexpensive for
breweries that already have rltPCR technology available, with the
cost of consumables being US$1–3 per reaction, depending on the
rltPCR instrument and source of reaction reagents used. We be-
lieve that this assay will be attractive to breweries as a rapid screen-
ing method because detection with concurrent identification of a
bacterial contaminant as a gram-positive or -negative brewery-asso-
ciated Firmicutes can give a good indication of the beer-spoilage
ability of the contaminating organism. As designed, this assay avoids
the problem of missed bacterial contaminants that can occur with
species-specific, nucleic acid-based detection methods.
ACKNOWLEDGMENTS
We thank Harry Deneer for allowing us to use his rltPCR instrument and
for discussions regarding the multiplexing of rltPCR assays. Vanessa Pittet
was the holder of a graduate scholarship from the Natural Sciences and En-
gineering Research Council of Canada (NSERC). Monique Haakensen was
awarded Coors Brewing Company, Cargill Malt, and Miller Brewing Com-
pany scholarships from the American Society of Brewing Chemists Foun-
dation and was the recipient of graduate scholarships from the College of
Medicine, University of Saskatchewan. This research was supported by
NSERC Discovery Grant 24067-05.
LITERATURE CITED
1. Back, W. Bierschädliche Bakterien: Nachweis und Kultivierung bier-
schädlicher Bakterien im Betriebslabor. Brauwelt 120:1562-1569, 1980.
2. Cole, J. R., Chai, B., Farris, R. J., Wang, Q., Kulam-Syed-Mohideen,
A. S., McGarrell, D. M., Bandela, A. M., Cardenas, E., Garrity, G. M.,
and Tiedje, J. M. The Ribosomal Database Project (RDP-II): Introduc-
ing myRDP space and quality controlled public data. Nucleic Acids Res.
35:D169-D172, 2007.
3. Cole, J. R., Wang, Q., Cardenas, E., Fish, J., Chai, B., Farris, R. J.,
Kulam-Syed-Mohideen, A. S., McGarrell, D. M., Marsh, T., Garrity,
G. M., and Tiedje. J. M. The Ribosomal Database Project: Improved
alignments and new tools for rRNA analysis. Nucleic Acids Res. 37:
D141-D145, 2009.
4. Haakensen, M., Dobson, C. M., Deneer, H., and Ziola, B. Real-time
PCR detection of bacteria belonging to the Firmicutes phylum. Int. J.
Food Microbiol. 125:236-241, 2008.
5. Haakensen, M., Dobson, C. M., Hill, J. E., and Ziola, B. Reclassifica-
tion of Pediococcus dextrinicus (Coster and White 1964) Back 1978
(Approved Lists 1980) as Lactobacillus dextrinicus comb. nov., and
emended description of the genus Lactobacillus. Int. J. Syst. Evol. Mi-
crobiol. 59:615-621, 2009.
6. Haakensen, M., Pittet, V., Morrow, K., Schubert, A., Ferguson, J., and
Ziola, B. Ability of novel ATP-binding cassette multidrug resistance
genes to predict growth of Pediococcus isolates in beer. J. Am. Soc.
Brew. Chem. 67:170-176, 2009.
7. Haakensen, M., Schubert, A., and Ziola, B. Multiplex PCR for puta-
tive Lactobacillus and Pediococcus beer-spoilage genes and ability of
gene presence to predict growth in beer. J. Am. Soc. Brew. Chem. 66:
63-70, 2008.
8. Haakensen, M., and Ziola, B. Identification of novel horA-harbouring
bacteria capable of spoiling beer. Can. J. Microbiol. 54:321-325, 2008.
9. Higuchi, R., Fockler, C., Dollinger, G., and Watson, R. Kinetic PCR
analysis: Real-time monitoring of DNA amplification reactions. Bio-
technology 11:1026-1030, 1993.
10. Larkin, M. A., Blackshields, G., Brown, N. P., Chenna, R., McGettigan,
P. A., McWilliam, H., Valentin, F., Wallace, I. M., Wilm, A., Lopez, R.,
Thompson, J. D., Gibson, T. J., and Higgins, D. G. Clustal W and Clus-
tal X version 2.0. Bioinformatics 23:2947-2948, 2007.
11. Muyzer, G., de Waal, E. C., and Uitterlinden, A. G. Profiling of com-
plex microbial populations by denaturing gradient gel electrophoresis
analysis of polymerase chain reaction-amplified genes coding for 16S
rRNA. Appl. Environ. Microbiol. 59:695-700, 1993.
12. Narendranath, N. V., Hynes, S. H., Thomas, K. C., and Ingledew, W. M.
Effects of lactobacilli on yeast-catalyzed ethanol fermentations. Appl.
Environ. Microbiol. 63:4158-4163, 1997.
13. Priest, F. G., and Campbell, I. Brewing Microbiology, 3rd ed. F. G.
Priest and I. Campbell, eds. Kluwer Academic, New York, 2003.
14. Relman, D. A. Universal bacterial 16S rDNA amplification and se-
quencing. In: Diagnostic Molecular Microbiology: Principles and Ap-
plications. D. H. Persing, T. F. Smith, and F. C. Tenover, eds. Ameri-
can Society for Microbiology, Washington, DC. Pp. 489-495, 1993.
15. Rice, P., Longden, I., and Bleasby, A. EMBOSS: The European Mo-
lecular Biology Open Software Suite. Trends Genet. 16:276-277, 2000.
16. Sakamoto, K., and Konings, W. N. Beer spoilage bacteria and hop
resistance. Int. J. Food Microbiol. 89:105-124, 2003.
17. Salminen, S., von Wright, A., and Ouwehand, A. Lactic Acid Bacteria,
3rd ed. S. Salminen, A. von Wright, and A. Ouwehand, eds. Marcel
Dekker, Inc., New York, 2004.
94 / Pittet, V., Haakensen, M., and Ziola, B.
APPENDIX
Bacterial Isolates Tested
Isolatea Origin Firmicutesb Gramc Firmicutes Probed 357R Probee GmNeg Probef
Acetobacter aceti
BSO 7 Brewery – – – + –
BSO 8 Brewery – – – + –
Acinetobacter calcoaceticus
RUH 40 Human – – – + –
Alcaligenes faecalis
RUH 44 Human – – – + –
Bacillus subtilis
RUH 44 Human + + + + –
Citrobacter freundii
RUH 46 Human – – – + –
Enterobacter agglomerans
Ingledew I27g Brewery – – – + –
Enterococcus faecalis
RUH 39 Human + + + + –
Escherichia coli
DH5 – – – + –
Gluconobacter oxydans
ATCC 19357 Brewery – – – + –
Klebsiella pneumoniae
RUH 47 Human – – – + –
Lactobacillus acetotolerans
ATCC 43578T Rice vinegar + + + + –
Lactobacillus acidophilus
ATCC 4356T Human + + + + –
CCC B1209 Brewery + + + + –
Lactobacillus amylovorus
ATCC 33620T Corn silage + + + + –
Ingledew I2 Fuel alcohol + + + + –
Lactobacillus brevis
BSO 31h Brewery + + + + –
Lactobacillus casei
ATCC 25598 Milking machine + + + + –
Lactobacillus delbrueckii
ATCC 11842T Bulgarian yogurt + + + + –
CCC B1044 Brewery + + + + –
Lactobacillus dextrinicusi
ATCC 33087T Silage + + + + –
Lactobacillus ferintoshensis
ATCC 11307 Brewery + + + + –
Lactobacillus fermentum
ATCC 9338j Unknown + + + + –
ATCC 14931T Fermented beets + + + + –
Lactobacillus fructivorans
ATCC 8288T Unknown + + + + –
Lactobacillus helveticus
ATCC 15009T Cheese + + + + –
Lactobacillus hilgardii
ATCC 27306 Wine + + + + –
Lactobacillus homohiochii
ATCC 15434T Spoiled sake + + + + –
Lactobacillus jensenii
ATCC 25258T Human + + + + –
Lactobacillus kefiranofaciens
ATCC 43761T Kefir grains + + + + –
(continued on next page)
a Isolate identity as determined by C. M. Dobson (M.S. thesis, University of Saskatchewan, Saskatoon, SK, Canada, 2001), with type strains indicated. Lactobacillus casei
ATCC 25598 and Lactobacillus zeae ATCC 393 have been included separately, because they belong to distinct o
p
erational taxonomic
g
rou
p
s. ATCC = American T
yp
e
Culture Collection; BSO = beer spoilage organism; CCC = Coors Brewing Company; DSM = German Collection of Microorganisms and Cell Cultures; ETS = ETS Labo-
ratories (T. Arvik); Molson = Molson Breweries of Canada Limited; RUH = Royal University Hospital (Saskatoon, SK, Canada); and VTT = VTT Technical Research Centre o
f
Finland.
b Plus or minus indicates whether the isolate belongs to the phylum Firmicutes.
c Plus or minus indicates whether the isolate is gram positive or negative.
d Plus or minus indicates whether Cy5 fluorescence signal crossed threshold of 10 fluorescence units.
e Plus or minus indicates whether Cy3 fluorescence signal crossed threshold of 10 fluorescence units.
f Plus or minus indicates whether FAM fluorescence signal crossed threshold of 30 fluorescence units.
g W. M. Ingledew, College of Agriculture, University of Saskatchewan, Saskatoon, SK, Canada.
h B. Kirsop, Institute for Biotechnology, Cambridge, England.
i Haakensen et al (5).
j G. Reid, Lawson Research Institute, London, ON, Canada.
k Weakly positive, requires high concentrations of DNA to produce positive result.
l K. Fernandez, Gipuzko, Spain.
Multiplex PCR to Screen for Beer-Spoilage Firmicutes / 95
APPENDIX
(continued from preceding page)
Isolatea Origin Firmicutesb Gramc Firmicutes Probed 357R Probee GmNeg Probef
Lactobacillus kefirgranum
ATCC 51647T Kefir grains + + + + –
Lactobacillus kefiri
ATCC 35411T Kefir grains + + + + –
Lactobacillus paracollinoides
ATCC 8291 Brewery + + + + –
Lactobacillus plantarum
ATCC 8041 Corn silage + + + + –
BSO 92 Brewery + + + + –
Lactobacillus reuteri
ATCC 31282 Unknown + + + + –
ATCC 43200 Cucumbers + + + + –
Lactobacillus rhamnosus
ATCC 8530j Unknown + + + + –
ATCC 15820 Corn liquor + + + + –
Lactobacillus sakei
ATCC 15521T Moto + + + + –
Lactobacillus zeae
ATCC 393 Cheese + + + + –
Leuconostoc mesenteroides
CCC 98G3 Brewery + + + + –
Megasphaera cerevisiae
CCC B1027 Brewery + – + + +
Megasphaera elsdenii
DSM 20460T Rumen + – + + +/–k
Megasphaera paucivorans
DSM 16981T Brewery + – + + +
Megasphaera sueciensis
DSM 17042T Brewery + – + + +
Micrococcus luteus
RUH 41 Human – + – + –
Obesumbacterium proteus
ATCC 12841T Brewery – – – + –
Oenococcus oeni
ETS 10 Wine + + + + –
Pectinatus cerevisiiphilus
ATCC 29359T Brewery + – + + +
DSM 20466 Brewery + – + + +
VTT E-81132 Brewery + – + + +
Pectinatus frisingensis
ATCC 33332T Brewery + – + + +
DSM 20465 Brewery + – + + +
VTT E-80121 Brewery + – + + +
Pectinatus haikarae
DSM 16980T Brewery + – + + +
Pediococcus acidilactici
ATCC 8042 Brewery + + + + –
ATCC 12697 Unknown + + + + –
Pediococcus claussenii
Molson B71 Brewery + + + + –
Pediococcus damnosus
ATCC 11308 Brewery + + + + –
Molson B48 Brewery + + + + –
Pediococcus parvulus
ATCC 43013 Wine + + + + –
Spain 2.6NRl Cider + + + + –
Pediococcus pentosaceus
ATCC 11309 Unknown + + + + –
Proteus mirabilis
RUH 48 Human – – – + –
Pseudomonas aeruginosa
RUH 42 Human – – – + –
Selenomonas lacticifex
DSM 20757T Brewery + – + + +
Staphylococcus epidermidis
ATCC 27612 Apple juice + + + + –
Streptococcus viridans
RUH 45 Human + + + + –
Zymomonas mobilis
BSO 57 Brewery – – + + –
Zymophilus paucivorans
DSM 20756T Brewery + – + + +
Zymophilus raffinosivorans
DSM 20765T Brewery + – + + +
