Expression Profiling of Genes Involved in Collagen Turnover in Tendons from Cerebral Palsy Patients

Article (PDF Available)inConnective tissue research 50(3):203-8 · February 2009with50 Reads
DOI: 10.1080/03008200802613630 · Source: PubMed
Abstract
Cerebral palsy (CP) is a nonprogressive central nervous system lesion clinically characterized by impairment of voluntary movement related to spasticity, time of activation, and strength of skeletal muscle. Altered muscular control may act on tendon structure and influence extracellular matrix homeostasis, in particular, collagen. The effect of spasticity on collagen turnover in CP patients' tendons has not been described previously. We studied collagen turnover related genes in the gracilis and semitendinosus tendons of diplegic (n = 6) and quadriplegic (n = 15) patients, compared to normal subjects (n = 7). In particular, using real time RT-PCR, we analyzed the mRNA levels of the major extracellular matrix (ECM) components collagen type I (COL-I, alpha 2 chain COL1A2), the matrix metalloproteinase-1 (MMP-1) and the tissue inhibitor of MMP (TIMP-1), the enzyme responsible for collagen maturation lysyl hydroxylase 2b (LH2b), of the matricellular protein involved ECM remodelling (secreted protein acidic and rich in cysteine, SPARC), and the transforming growth factor-beta1 (TGF-beta1), a multipotent cytokine involved in collagen turnover. Our results show that gene expression profiles are quite different in CP samples compared to normal ones. In fact, spasticity induces relevant modifications of tendons at the molecular level, which modify their phenotypes to respond to the higher mechanical loading and increased functional demands. Interestingly, hypertonic quadriplegic subjects displayed the highest mRNA levels of COL1A2, LH2b, TGF-beta1, and SPARC, suggesting that their tendons undergo higher mechanical loading stimulation.
Connective Tissue Research, 50:203–208, 2009
Copyright
c
Informa Healthcare USA, Inc.
ISSN: 0300-8207 print / 1607-8438 online
DOI: 10.1080/03008200802613630
Expression Profiling of Genes Involved in Collagen Turnover
in Tendons from Cerebral Palsy Patients
Nicoletta Gagliano
Department of Human Morphology, Extracellular Matrix Laboratory, University of Milan, School of
Medicine, Milan, Italy
Francesco Pelillo
Department of Pediatric Orthopaedic Surgery, Istituto Clinico Humanitas, Rozzano, Milan, Italy
Maurizio Chiriva-Internati
Division of Hematology & Oncology, Texas Tech University Health Sciences Center and the Southwest
Cancer Treatment and Research Center, Lubbock, Texas, USA
Odoardo Picciolini, MD
NICU, Department of Neonatology, Fondazione IRCCS Policlinico, Mangiagalli e Regina Elena,
Milan, Italy
Francesco Costa
Department of Human Morphology, Extracellular Matrix Laboratory, University of Milan, School of
Medicine, Milan, Italy
Robert C. Schutt Jr, MD
Department of Orthopaedic Surgery and Rehabilitation, Texas Tech University Health Sciences Center,
Lubbock, Texas, USA
Magda Gioia, MD
Department of Human Morphology, Extracellular Matrix Laboratory, University of Milan, School of
Medicine, Milan, Italy
Nicola Portinaro, MD
Department of Pediatric Orthopaedic Surgery, Istituto Clinico Humanitas, Rozzano, Milan, Italy
Cerebral palsy (CP) is a nonprogressive central nervous
system lesion clinically characterized by impairment of voluntary
movement related to spasticity, time of activation, and strength
of scheletal muscle. Altered muscular control may act on tendon
Received 24 July 2008; Accepted 7 November 2008; Revised 27
October 2008.
Address correspondence to Nicoletta Gagliano, PhD, Department
of Human Morphology—LITA Segrate, Via Fratelli Cervi 9320090
Segrate—Milano, Italy. E-mail: nicoletta.gagliano@unimi.it
structure and influence extracellular matrix homeostasis, in partic-
ular, collagen. The effect of spasticity on collagen turnover in CP
patients’ tendons has not been described previously. We studied
collagen turnover related genes in the gracilis and semitendinosus
tendons of diplegic (n = 6) and quadriplegic (n = 15) patients,
compared to normal subjects (n = 7). In particular, using real time
RT-PCR, we analyzed the mRNA levels of the major extracellular
matrix (ECM) components collagen type I (COL-I, alpha 2 chain
COL1A2), the matrix metalloproteinase-1 (MMP-1) and the tissue
inhibitor of MMP (TIMP-1), the enzyme responsible for collagen
maturation lysyl hydroxylase 2b (LH2b), of the matricellular
protein involved ECM remodelling (secreted protein acidic and
rich in cysteine, SPARC), and the transforming growth factor-β1
(TGF-β1), a multipotent cytokine involved in collagen turnover.
203
204 N. GAGLIANO ET AL.
Our results show that gene expression profiles are quite different
in CP samples compared to normal ones. In fact, spasticity induces
relevant modifications of tendons at the molecular level, which
modify their phenotypes to respond to the higher mechanical
loading and increased functional demands. Interestingly, hyper-
tonic quadriplegic subjects displayed the highest mRNA levels
of COL1A2, LH2b, TGF-β1, and SPARC, suggesting that their
tendons undergo higher mechanical loading stimulation.
Keywords Tendons, Cerebral Palsy, Spasticity, Collagen Turnover,
Matrix Metalloproteinases, SPARC
INTRODUCTION
Cerebral palsy (CP) is a persistent nonprogressive motor
disorder due to an injury in the immature brain [1]. Impairment
of voluntary movement related to hypertonia and spasticity
produces a progressive alteration of the muscoloskeletal system,
with direct involvement of tendons. The exact mechanism by
which spasticity-induced overload affects tendon homeostasis
however is still poorly understood.
Tendons are force-conducting connective tissue organs
that mechanically relate muscle to bone. They are primarily
composed of cells, i.e., tenocytes, and extracellular matrix
(ECM), containing collagen fibers, proteoglycans, and water.
Among ECM proteins, the most represented component is
collagen arranged in parallel-packed bundles [2, 3], forming
a three-dimensional network of fibrils containing collagen type
I (COL-I), which represents almost 95% of the total collagen,
and small amounts of types III (COL-III), V (COL-V), and XI
(COL-XI) [4]. The fibrils are aligned along the axis of force,
supplemented by other noncollagenous proteins (such as elastin)
and proteoglycans.
The biomechanical properties of tendons depend on the
relative ratio of the components and their arrangement [5].
Tenocytes are arranged in longitudinal rows between the
fiber bundles. They are intimately cell to cell connected with
neighboring cells, both with the same cell row and with parallel
rows, containing gap junctions formed by connexins 32 and
43 [6]. Tenocytes are responsible for the initial production and
maintenance of the collagen fiber bundles, and one mechanism
known to regulate collagen homeostasis is the mechanical
loading of the tissue [7].
Studies in humans and animal experimental models have
shown that changes in matrix quantity and quality can be induced
by altering the mechanical strain experienced by the tendon
[8–11] and affecting the tendon’s functional properties.
This study is aimed at determining the relationship between
muscle spasticity and the expression of genes involved in
collagen turnover in tendons of CP patients, compared to normal
subjects. In particular, we analyzed the expression of the genes
related to collagen synthesis, maturation and degradation.
METHODS
Participants
All CP patients with hypertone were divided into two
experimental groups: diplegic subjects (lower limb Ashworth
2–3) (n = 6—3 males and 3 females, mean age 15:33 ±
2:42), and quadriplegic subjects (lower limb Ashworth 4–5)
(n = 15—7 males and 8 females, mean age 13:67 ± SD 3:60).
Tendon fragments from CP patients were obtained during tendon
lengthening procedures from the extra tendon removed after
their resuture. Normal samples were obtained from 7 healthy
participants (5 males and 2 females, mean age 17.29 ± SD
1.89) undergoing surgical procedures to treat anterior cruciate
ligament rupture and used as controls. The subjects enrolled in
the control group were not athletes. For the study, tendons of
semitendinosus and gracilis muscles were used, both for controls
and cerebral palsy subjects Samples were obtained according
to procedures approved by the local ethics committee. Tendon
fragments were immediately frozen in liquid nitrogen and stored
at –80
C until use.
Real-Time PCR
Tissue was cut into small fragments by a sterile scalpel and
homogenized by tissue lyzer (Qiagen, Milan, Italy). Total RNA
was isolated from 100 mg of frozen tendon by a modification
of the acid guanidinium thiocyanate-phenol-chloroform method
(Tri-Reagent, Sigma, Milan, Italy). Briefly, tissue samples were
homogenized in Tri-Reagent. After the addition of chloroform,
the homogenate was separated into aqueous and organic phases
by centrifugation. The RNA in the upper aqueous phase was
precipitated by the addition of isopropanol. The RNA was then
pelleted and washed with ethanol before being redissolved in
RNase-free water. RNA was run on 1% agarose gels to check
its integrity. Then 1 µg of total RNA was reverse-transcribed
ina20µL final volume of reaction mix according to
manufacturer’s instructions (iScript cDNA Synthesis Kit,
Biorad, Segrate-Milan, Italy). mRNA levels of collagen type
I (COL1A2), matrix metalloproteinase 1 (MMP-1), tissue
inhibitor of MMP-1 (TIMP-1), long lysil hydroxylase 2
(LH2b), transforming growth factor-β1(TGF-β1), and secreted
protein acidic and rich in cysteine (SPARC) were evaluated.
All the results were normalized to 2 housekeeping genes:
glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
and hypoxanthine-guanine phosphoribosyltransferase
(HPRT).
The primer sequences (Table 1) were designed by Beacon
Designer 6 software (BioRad, Segrate-Milan, Italy). Both the
GAPDH and HPRT genes were used as endogenous controls to
normalize for differences in the amount of total RNA in each
sample. The amplification efficiencies of both the reference and
the target genes were determined, and a relative quantification
was performed. Amplification reactions were conducted in a
96-well plate in a final volume of 20 µL per well containing
10 µLof1× SYBR Green Supermix (BioRad), 2 µLof
template, and 300 pmol of each primer, and each sample was
analyzed in triplicate. The iQ5 measured the cycle-cycle changes
in fluorescence in each sample and generated a kinetic profile
of amplification over the 40-cycle PCR.
GENES EXPRESSION PROFILING IN CP PATIENTS 205
TABLE 1
Primers sequences for real-time PCR
Gene Sequence
COL-I sense CGACCTGGTGAGAGAGGAGTTG
antisense AATCCATCCAGACCATTGTGTCC
LH2b sense CCGGAAACATTCCAAATGCTCAG
antisense GCCAGAGGTCATTGTTATAATGGG
MMP-1 sense CGGATACCCCAAGGACATCTACAG
antisense GCCAATTCCAGGAAAGTCATGTGC
TIMP-1 sense GGCTTCTGGCATCCTGTTGTTG
antisense AAGGTGGTCTGGTTGACTTCTGG
TGF-β1 sense GTGCGGCAGTGGTTGAGC
antisense GGTAGTGAACCCGTTGATGTCC
SPARC sense GCGAGCTGGATGAGAACAACAC
antisense GTGGCAAAGAAGTGGCAGGAAG
GAPDH sense CCCTTCATTGACCTCAACTACATG
antisense TGGGATTTCCATTGATGACAAGC
HPRT sense AGACTTTGCTTTCCTTGGTCAGG
antisenseGTCTGGCTTATATCCAACACTTCG
COL-I = collagen type I; LH2b = lysyl hydroxylase 2b; MMP-1
= matrix metalloproteinase-1; TIMP-1 = tissue inhibitor of MMP;
TGF-β1 = transforming growth factor-β1; SPARC = secreated
protein acidic and rich in cysteine; GAPDH = glyceraldehyde-3-
phosphate dehydrogenase; HPRT = hypoxanthine-guanine phospho-
ribosyltransferase
The cycle number (termed the cycle threshold [Ct]) at which
amplification entered the exponential phase was determined and
this number was used as an indicator of the amount of target
RNA in each sample. Gene expression levels relative to that of
both GAPDH and HPRT were calculated by the 2
Ct
method,
according to Livak and Schmittgen [12], using the gene study
module of the iQ5 software.
Statistical Analysis
All amplifications were run in triplicate. All analyses were
performed on the relative log-transformed gene expression
levels to normalize the distribution. Data were analyzed by
two-way ANOVA where one dimension was the experimental
group (normal or diplegic and quadriplegic tendons) and the
second dimension was the type of tendon (from GR or ST
muscles). The analysis was carried out by the GraphPad Prism
version 5 software package. p values less than 0.05 were
considered significant.
RESULTS
COL1A2 mRNA levels (Figure 1a) were highly expressed in
CP tendons compared to normal samples. In particular, COL1A2
gene expression tended to be upregulated in diplegic tendons
and was strongly upregulated in quadriplegic tendons (25-fold
increased compared to normal tendons, p [experimental group]
< 0.05, p [tendon type] = 0.266, p [interaction] = 0.981).
FIG. 1. Bar graphs show COL1A2 (a) and LH2b (b) mRNA levels expressed
as normalized fold expression. Data were normalized to GAPDH and HPRT
and are expressed as mean ± SEM. GR = gracilis muscle tendon; ST =
semitendinosus muscle tendon.
LH2b (Figure 1b) was differently expressed in normal and
CP tendons. In particular, there was evidence of a progressive
tendency of increased mRNA levels in diplegic and quadriplegic
tendons, compared to normal samples (p [experimental group]
< 0.05, p [tendon type] = 0.402, p [interaction] = 0.253).
MMP-1 (Figure 2a) was expressed in normal tendons with
very wide interindividual differences. For this reason it was not
possible to calculate any statistical differences comparing this
experimental group with diplegic and quadriplegic subjects. If
we consider CP patients, the interindividual differences were
less evident and MMP-1 tended to be downregulated in diplegic
compared to quadriplegic tendons.
A similar pattern of expression was observed for TIMP-1
mRNA levels, shown in Figure 2b. TIMP-1 gene expression
shows wide interindividual differences in normal subjects. In
the CP samples, it is similar in both diplegic and quadriplegic
patients.
SPARC mRNA levels (Figure 3a) were expressed at high
levels in tendons of diplegic and quadriplegic patients compared
to normal samples. However, in quadriplegic tendons, SPARC
gene expression was expressed at a higher extent (3- and 10-
fold increase in diplegic and quadriplegic tendons, respectively,
compared to normal subjects)(p [experimental group] < 0.05, p
[tendon type] = 0.457, p [interaction] = 0.862).
TGF-β1 mRNA levels (Figure 3b) tended to be upregulated
in CP samples compared to normal subjects (p [experimental
group] = 0.142, p [tendon type] = 0.180, p [interaction] =
0.578).
206 N. GAGLIANO ET AL.
FIG. 2. Bar graphs show MMP-1 (a) and TIMP-1 (b) mRNA levels expressed
as normalized fold expression, and MMP-1/TIMP-1 mRNA levels ratio (c).
Data, expressed as mean ± SEM, were normalized on GAPDH and HPRT. GR
= gracilis muscle tendon; ST = semitendinosus muscle tendon.
DISCUSSION
Mechanical loading may affect the homeostasis of the
connective tissue of tendons by modifying some of their
metabolic, morphologic, and biomechanical properties [13]. We
hypothesized that spasticity-induced stress on tendons of CP
patients may elicit a modification of tendon metabolism and
phenotype, in particular in relation to collagen turnover, since
collagen represents the main component of tendon ECM.
This is the first study to investigate mRNA expression
levels for genes involved in collagen turnover and remodeling
in tendons from CP patients compared with normal tendons.
Physiotherapy, orthosis, medical, and surgical procedures are
designed today to reduce spasticity and improve motor skills
or decrease pain and facilitate patient care; early surgical
intervention as tendon lengthening and transfers may prevent
joint contractures and bone deformities [14]. Understanding
spasticity-induced altered homeostasis and mechanical prop-
erties of tendons could become crucial for any surgical and
functional treatment strategies.
Collagen fibers in the form of fascicles are the major struc-
tural units found in tendons. COL1A2 is the main determinant of
FIG. 3. Bar graphs show SPARC (a) and TGF-β1 (b) mRNA levels expressed
as normalized fold expression. Data, normalized to GAPDH and HPRT, are mean
± SEM. GR = gracilis muscle tendon; ST = semitendinosus muscle tendon.
the tenocyte phenotype [15], forming 60% of the dry mass of
the tissue. It is organized into fibrils aligned axially to the tendon
length and providing the tissue with tensile strength. COL-I
expression is consistent with the tensile loading of tendons
[16]. Our data showed higher COL1A2 mRNA levels in CP
tendons compared to normals, suggesting that tendons of these
patients undergo higher tensile mechanical loading compared
to healthy subjects. In particular, the higher extent of COL1A2
gene expression in quadriplegic samples points to a higher
mechanical involvement of these tendons.
Collagen synthesis and degradation are the expression of
tendon adaptation to mechanical stress. In particular, collagen
turnover is a highly tuned, dynamic process depending on the
balance between its synthesis and degradation by MMPs [17]
and plays a key role also in determining tendon strength.
MMP-1 is necessary to begin collagen degradation pathways
since it can cleave the native triple helical region of interstitial
collagens into characteristic 3/4- and 1/4-collagen degradation
fragments, also known as gelatins [18], that can be further
degraded by less specific proteinases, leading to complete
digestion of the fibrillary collagen [17].
The expression of genes involved in collagen breakdown
show very high interindividual differences in normal subjects
and, as a consequence, it was impossible to analyze them at the
statistical level. Considered as a whole, however, we observed
a tendency to decreased MMP-1 and TIMP-1 mRNA levels in
both the quadriplegic and diplegic subjects compared to normal
tendons.
Although this finding should be confirmed by increasing
the number of normal subjects since we observed wide
interindividual differences, we can discuss this result on the
GENES EXPRESSION PROFILING IN CP PATIENTS 207
basis of previous studies showing that an inverse correlation
between MMP-1 gene/protein expression and tensile load occurs
[19, 20], playing a key role in determining tendon strength, as
demonstrated in tendon pathology [21]. Application of a tensile
load to tendons was reported to decrease in MMP-1 mRNA
expression to a more stable tendon structure and therefore was
less susceptible to damage [20]. Our results, therefore, may
suggest that spasticity may elicit a compensatory response in
tendons to provide a more resistant phenotype to the increased
functional demand.
Furthermore, since MMP-1 is stimulated in tendons by
inflammatory cytokines [22], we may hypothesize that the
observed MMP-1 downregulation in CP samples is consistent
with a noninflammatory adaptive response induced by spasticity.
TIMP-1 is the major inhibitor of MMP-1 [23]. Since our
data showed a concomitant decrease of both MMP-1 and
TIMP-1 gene expression in CP samples, we evaluated the
MMP-1/TIMP-1 ratio to enlighten a possible modification of
collagen degradation induced by spasticity. Interestingly, the
MMP-1/TIMP-1 ratio also tended to decrease in both CP
tendons, suggesting that spasticity may affect collagen turnover
balance to provide a more stable tendon structure in CP patients.
This is a hypothesis, since the analysis of the expression of
genes involved in collagen breakdown has some limitations in
this study.
In fact, healthy participants displayed very high interindi-
vidual variability in MMP-1 and TIMP-1 gene expression.
A possible explanation is that this experimental group was a
heterogeneous group of participants, varying widely in some
parameters such as physical activity. Moreover, we analyzed
only MMP-1 mRNA levels; since MMPs are finely tuned at
the level of transcription, synthesis, secretion, and activation, it
would be useful to investigate MMP-1 protein levels and activity
to confirm our hypothesis.
The ability of collagen molecules to assemble into cross-
linked fibrils is an important requirement for the development
of tissue strength, providing collagen fibrils stabilization and
increased tendon tensile strength. It has been shown that the
elastic properties of tendons are proportional to the fibril lengths
and that the molecular basis of elastic energy storage in tendons
seems to involve stretching of collagen triple elices within cross-
linked collagen fibrils [4].
LH2 is one of the key enzymes for collagen cross-linking
formation during collagen maturation. LH2 exists as two
alternately-spliced forms, the long (LH2b), the major form
expressed in all tissues, and the short (LH2a) ones [24].
Higher LH2b mRNA levels in CP tendons, compared to normal
subjects, suggest that the higher collagen cross-linking induced
by spasticity very likely provides the tendon with the ability to
respond to higher mechanical load and to resist to stretch.
SPARC is a matricellular glycoprotein that influences a
number of biological processes including cell differentiation,
migration, and proliferation and is generally overexpressed
during ECM remodeling in physiological and pathological
conditions [25–27]. SPARC’s counteradhesive properties also
modulate cell-matrix interactions [25–27]. Our results show
higher SPARC mRNA levels in quadriplegic CP tendons,
suggesting that CP-induced mechanical loading induces ECM
remodeling in CP tendons.
The overall balance of collagen turnover is controlled by
TGF-β1, a multifunctional cytokine known to be involved in
both healing and fibrogenic processes, capable of regulating
cell proliferation and differentiation as well as directly activating
gene expression for the synthesis of ECM components [28–30].
TGF-β1 tended to be upregulated in both CP quadriplegic and
diplegic patients, compared to normal subjects. This finding
is consistent with COL1A2 and MMP-1 gene expression in CP
tendons since this pluripotent cytokine is able to induce collagen
transcription and inhibit MMP-1 gene expression. This very
likely suggests that TGF-β1 may be induced by spasticity and
involved in the molecular mechanisms underlying spasticity-
induced tendon modification. This hypothesis is supported by
previous studies indicating that mechanical loading increases
the expression of several growth factors and cytokines, such as
TGF-β1 [31, 32].
CONCLUSION
Considered as a whole, these data on mRNA levels related to
collagen turnover in tendons from CP patients suggest that gene
expression profiles are quite different in CP samples compared
to normal ones. In fact, CP induces relevant modifications of
tendons at the molecular level, which modify their phenotypes
to respond to the increased mechanical loading and increased
functional demands. Interestingly, hypertonic quadriplegic sub-
jects displayed the highest mRNA levels of COL1A2, LH2b,
TGF-β1, and SPARC, suggesting that their tendons undergo
higher stress, as frequently observed in clinical practice.
Further interesting information provided by our results is that
tendons obtained both from gracilis and semitendinosus muscles
respond at the same extent to the increased mechanical loading
induced by spasticity. We think that the knowledge of ECM
remodeling in CP patients’ tendon components in relation to
mechanical stress is pivotal and may be helpful for monitoring
or planning treatment strategies
ACKNOWLEDGMENTS
We thank the Ariel Foundation for the financial support to
conduct this research study.
DECLARATION OF INTEREST
The authors report no conflicts of interest. The authors alone
are responsible for the content and writing of this article.
REFERENCES
1. Egger, J., Kendall, B.E., Erdohazi, M., Lake, B.D., Wilson, J., and Brett,
E.M. (1983). Involvement of the central nervous system in congenital
muscular dystrophies. Dev. Med. Child. Neurol., 25, 32–42.
208 N. GAGLIANO ET AL.
2. Benjamin, M., and Ralphs, J.R. (2000). The cell and developmental biology
of tendons and ligaments. In.t Rev. Cytol., 196, 85–130.
3. Kannus, P. (2000). Structure of the tendon connective tissue. Scand. J. Med.
Sci. Sports, 10, 312–320.
4. Silver, F.H., Christiansen, D., Snowhill, P.B., Chen, Y., and Landis, W.J.
(2000). The role of mineral in the storage of elastic energy in turkey tendons.
Biomacromolecules, 1, 180–185.
5. Silver, F.H., Freeman, J.W., and Seehra, G.P. (2003). Collagen self-
assembly and the development of tendon mechanical properties. J.
Biomechanics, 36, 1529–1553.
6. McNeilly, C.M., Banes, A.J., Benjamin, M., and Ralphs, J.R. (1996).
Tendon cells in vivo form a three dimensional network of cell processes
linked by gap junctions. J. Anat., 189, 593–600.
7. Chiquet, M. (1999). Regulation of extracellular matrix gene expression by
mechanical stress. Matrix Biol., 18, 417–426.
8. Gillard, G.C., Reilly, H.C., Bell-Booth, P.G., and Flint, M.H. (1979). The
influence of mechanical forces on the glycosaminoglycan content of the
rabbit flexor digitorum profundus tendon. Connect. Tissue Res., 7, 37–46.
9. Woo, S.L., Gomez, M.A., Amiel, D., Ritter, M.A., Gelberman, R.H., and
Akeson, W.H. (1981). The effects of exercise on the biomechanical and
biochemical properties of swine digital flexor tendons. J. Biomech. Eng.,
103, 51–56.
10. Woo, S.L., Gomez, M.A., Woo, Y.K., and Akeson, W.H. (1982). Mechanical
properties of tendons and ligaments. II. The relationships of immobilization
and exercise on tissue remodeling. Biorheology, 19, 397–408.
11. Tipton, C.M., Vailas, A.C., and Matthes, R.D. (1986). Experimental studies
on the influences of physical activity on ligaments, tendons and joints: a
brief review. Acta Med. Scand., Suppl.711, 157–168.
12. Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene
expression data using real-time quantitative PCR and the 2(- delta
deltaC(T)) method. Methods, 25, 402–408.
13. Jozsa, L., and Kannus, P. (1997). Effects of activity and inactivity on
tendons. In Human tendons. L. Jozsa and L. Kannus (eds.), pp. 127–160
(Human kinetics: Champaign, IL).
14. Koman, L.A., Smith, B.P., and Shilt, J.S. (2004). Cerebral palsy. Lancet,
363, 1619–1631.
15. Evans, C.E., and Trail, I.A. (1998). Fibroblast-like cells from tendons differ
from skin fibroblasts in their ability to form three-dimensional structures in
vitro. J. Hand Surg. [Br.], 23, 633–641.
16. Berglund, M., Wiig, M., Torstensson, M., Reno, C., and Hart, D.A. (2004).
Assessment of mRNA levels for matrix molecules and TGF- beta1 in rabbit
flexor and peroneus tendons reveals regional differences in steady-state
expression. J. Hand Surg. [Br.], 29, 165–169.
17. Woessner, F.J. (1991). Matrix metalloproteinases and their inhibitors in
connective tissue remodelling. FA SE B J., 5, 2145–2154.
18. Sakai, T., and Gross, J. (1967). Some properties of the products of reaction
of tadpole collagenase with collagen. Biochem., 6, 518–528.
19. Amiel, D., Woo, S.L., Harwood, F.L., and Akeson, W. (1982). The effect of
immobilization on collagen turnover in connective tissue: a biochemical-
biomechanical correlation. Acta Orthop. Scand., 53, 325–332.
20. Arnoczky, S.P., Tian, T., Lavagnino, M., and Gardner, K. (2004). Ex vivo
static tensile loading inhibits MMP-1 expression in rat tail tendon cells
through a cytoskeletally based mechanotransduction mechanism. J. Orthop.
Res., 22, 328–333.
21. Rley, G.P., Curry, V., DeGroot, J., van El, B., Verzijl, N., Hazleman,
B.L., and Bank, R.A. (2002). Matrix metalloproteinase activities and their
relationship with collagen remodelling in tendon pathology. Matrix Biol.,
21, 185–195.
22. Riley, G.P. (2005). Gene expression and matrix turnover in overused and
damaged tendons. Scand. J. Med. Sci. Sports, 15, 241–251.
23. Brew, K., Dinakarpandian, D., and Nagase, H. (2001). Tissue inhibitors
of metalloproteinases: evolution, structure and function. Biochim. Biophys.
Acta, 1477, 267–283.
24. van der Slot, A.J., Zuurmond, A., van der Bogaerdt, A.J., Ulrich, M.,
Middelkoop, E., Boers, W., Ronday, K., DeGroot, J., Huizinga, T., and Bank,
R.A. (2004). Increased formation of pyridoline cross-links due to highetr
telopeptide lysyl hydroxylase levels is a general fibrotic phenomenon.
Matrix Biol., 23, 251–257.
25. Bornstein, P., and Sage, E.H. (2002). Matricellular proteins: extracellular
modulators of cell function.
Curr. Opin. Cell. Biol., 14, 608–616.
26. Bradshaw, A.D., and Sage, E.H. (2001). SPARC: a matricellular protein
that functions in cellular differentiation and tissue response to injury. J.
Clin. Invest., 107, 1049–1054.
27. Brekken, R.A., and Sage, E.H. (2000). SPARC a matricellular protein:
at the crossroads of cell-matrix communication. Matrix Biol., 19, 569–
580.
28. Ignotz, R.A., and Massague, J. (1986). Transforming growth factor-beta1
stimulates the expression of fibronectin and collagen and their incorporation
into the extracellular matrix. J Biol. Chem., 261, 4337–4345.
29. Sporn, M.B., and Roberts, A.B. (1990). The transforming growth factor-βs:
past, present and future. Ann. NY Acad. Sci., 593, 1–6.
30. Border, W.A., and Ruoslahti, E. (1992). Transforming growth factor-β in
disease: the dark side of tissue repair. J. Clin. Invest., 90, 1–7.
31. Gutierrez, J.A., and Perr, H.A. (1999). Mechanical stretch modulates TGF-
beta1 and alpha1(I) collagen expression in fetal human intestinal smooth
muscle cells. Am.J.Physiol., 277, G1074–G1080.
32. Heinemeier, K., Langberg, H., Olesen, J.L., and Kjaer, M. (2003).
Role of TGF-beta1 in relation to exercise-induced type I collagen
synthesis in human tendinous tissue. J. Appl. Physiol., 95, 2390–
2397.
    • "[62,63] MMPs MMPs are a family of zinc-dependent proteinases involved in the degradation of the extracellular matrix. In the inflammatory reaction of central nervous system disease, MMPs has a striking toxic effect on neurons which can lead to degradation of the basal lamina and disruption of the blood-brain barrier, leading to vasogenic brain edema and hemorrhagic transformation.64656667686970717273 VEGF VEGF promotes vascular endothelial cells to proliferate, increases vascular permeability and accelerates neovascularization.7475767778798081 "
    Article · Jan 2016 · Journal of Hand Surgery (European Volume)
    • "This indicated that SWV is fast when spasticity is high. Many studies reported that the total amount of collagen content and expression of genes that are involved in the conversion of collagen from the tissue, such as LH2b and TGF- β1were increased in spastic muscle; and muscle fiber type transformation was observed in the post SCI patient group293031. Based on these studies, we could predict that the degree of stiffness was increased in spastic muscle and we can measure the spasticity by SWV with ARFI, indirectly. "
    [Show abstract] [Hide abstract] ABSTRACT: To investigate intrinsic viscoelastic changes using shear wave velocities (SWVs) of spastic lower extremity muscles in patients with early spinal cord injury (SCI) via acoustic radiation force impulse (ARFI) imaging and to evaluate correlation between the SWV values and spasticity. Eighteen patients with SCI within 3 months and 10 healthy adults participated. We applied the ARFI technique to measure SWV of gastrocnemius muscle (GCM) and long head of biceps femoris muscle. Spasticity of ankle and knee joint was assessed by original Ashworth Scale. Ten patients with SCI had spasticity. Patients with spasticity had significantly faster SWV for GCM and biceps femoris muscle than those without spasticity (Mann-Whitney U test, p=0.007 and p=0.008) and normal control (p=0.011 and p=0.037, respectively). The SWV values of GCM correlated with the ankle spasticity (Spearman rank teat, p=0.026). There was significant correlation between the SWV values for long head of biceps femoris muscle and knee spasticity (Spearman rank teat, p=0.022). ARFI demonstrated a difference in muscle stiffness in the GCM between patients with spastic SCI and those without spasticity. This finding suggested that stiffness of muscles increased in spastic lower extremity of early SCI patients. ARFI imaging is a valuable tool for noninvasive assessment of the stiffness of the spastic muscle and has the potential to identify pathomechanical changes of the tissue associated with SCI.
    Full-text · Article · Jun 2015
    • "Recently, altered gene expression in tendons of spastic muscle (Gagliano et al., 2009) as well as transcriptional upregulations have been hypothesized to alter, amongst other factors, extracellular matrix components (Smith et al., 2009). However, these transcriptional differences were found in both flexor and extensor muscles within the spastic arm. "
    [Show abstract] [Hide abstract] ABSTRACT: Patients with spastic cerebral palsy of the upper limb typically present with various problems including an impaired range of motion that affects the positioning of the upper extremity. This impaired range of motion often develops into contractures that further limit functioning of the spastic hand and arm. Understanding why these contractures develop in cerebral palsy will affect the selection of patients suitable for surgical treatment as well as the choice for specific surgical procedures. The generally accepted hypothesis in patients with spastic cerebral palsy is that the hyper-excitability of the stretch reflex combined with increased muscle tone result in extreme angles of the involved joints at rest. Ultimately, these extreme joint angles are thought to result in fixed joint postures. There is no consensus in the literature concerning the pathophysiology of this process. Several hypotheses associated with inactivity and overactivity have been tested by examining the secondary changes in spastic muscle and its surrounding tissue. All hypotheses implicate different secondary changes that consequently require different clinical approaches. In this review, the different hypotheses concerning the development of limited joint range of motion in cerebral palsy are discussed in relation to their secondary changes on the musculoskeletal system.
    Full-text · Article · Jan 2013
Show more

Recommended publications

Discover more