Content uploaded by Rodney E. Rohde
Author content
All content in this area was uploaded by Rodney E. Rohde on Dec 18, 2014
Content may be subject to copyright.
VOL 22, NO 1 WINTER 2009 CLINICAL LABORATORY SCIENCE 9
e peer-reviewed Clinical Practice Section seeks to publish case stud-
ies, reports, and articles that are immediately useful, are of a practical
nature, or contain information that could lead to improvement in the
quality of the clinical laboratory’s contribution to patient care, includ-
ing brief reviews of books, computer programs, audiovisual materials,
or other materials of interest to readers. Direct all inquiries to Berna-
dette Rodak MS CLS(NCA), Clin Lab Sci Clinical Practice Editor,
Clinical Laboratory Science Program, Indiana University, Clarian
Pathology Laboratory, 350 West 11th Street, 6002F, Indianapolis IN
46202. brodak@iupui.edu
CLINICAL PRACTICE
Molecular Diagnostics Clinical Laboratory Science
Course Design: Making It Real
RODNEY E ROHDE, DAVID M FALLEUR, PHIL KOSTROUN
e ability of a clinical laboratory scientist (CLS) to
perform molecular diagnostic testing has become critical to
the profession. Knowledge of methodology associated with
detection of pathogens and inherited genetic disorders is
imperative for the current and future CLS. CLS programs
in the US teach human genetics and molecular diagnostics
in various components and formats. Integrating these
sometimes expensive methods into the curriculum can
be challenging. is article provides a commentary with
specific details associated with our experience in designing
a dedicated CLS molecular diagnostics course. It offers a
flexible template for incorporating a lecture and laboratory
course to address theoretical and practical knowledge in this
dynamic area of the laboratory.
ABBREVIATIONS: ACMG = American College
of Medical Genetics; ASCLS = American Society
for Clinical Laboratory Science; CAP = College of
American Pathology; CLIA = Clinical Laboratory
Improvement Amendment; CLSI (formerly NCCLS)
= Clinical and Laboratory Standards Institute; CLS =
clinical laboratory science; MD = molecular diagnostics;
NAACLS = National Accrediting Agency for Clinical
Laboratory Science; PCR = polymerase chain reaction;
QA = quality assurance; QC = quality control.
INDEX TERMS: clinical laboratory science; education
methods; molecular diagnostics; teaching techniques.
Clin Lab Sci 2009;22(1):3
Rodney E Rohde MS, SV, SM, MP (ASCP)CM is associate
professor; David M Falleur MEd MT(ASCP) CLS(NCA) is
associate professor and chair; and Phil Kostroun MED MT
(ASCP) is associate professor (retired); Clinical Laboratory
Science Program, Texas State University – San Marcos, San
Marcos TX.
Address for correspondence: Rodney E Rohde MS, SV, SM,
MP (ASCP)CM, associate professor, Clinical Laboratory Science
Program, Texas State University – San Marcos, HPB 361, 601
University Drive, San Marcos TX 78666-4616. (512) 245-
2562, (512) 245-7860 (fax). rrohde@txstate.edu.
ACKNOWLEDGEMENTS: e authors would like to thank
Sam Sutton (President, Embark Scientific, Austin TX) and Lisa
Sutton (Vice President, Embark Scientific) for their collaborative
support in the development of the laboratory component of this
molecular diagnostics course and for assisting in the development
of this article. We also thank them for sharing their expertise
in clinical molecular diagnostics (http://www.embarkscientific.
com/) with our former, current, and future CLS students.
Personnel in clinical laboratories around the world are be-
ing asked to provide rapid identification of emerging and
reemerging disease-causing agents associated with both “com-
mon” disorders and bioterrorism preparedness activities. e
clinical laboratory has always been an evolving environment
in which personnel are constantly challenged to implement
new diagnostic tests designed to provide more sensitive and
specific tests for detecting and monitoring disease.1 Clinical
laboratory scientists (CLS) are being challenged yet again by
the introduction of complex molecular diagnostic techniques
that were formerly performed only in research settings. His-
torically, the prevention, control, and treatment of infectious
diseases are improved by early and accurate identification
of the causative pathogenic organism. Many detection
procedures require the pathogen to be grown in culture, fol-
lowed by analytical testing in differential media for proper
identification. ese tests, although usually effective, can be
slow and costly. Further, the organisms (especially bacteria
and parasites) can be fastidious or cannot be cultivated at
all, leading to severe limitations in pathogen detection, and
ultimately, delayed patient treatment. To overcome these
10 VOL 22, NO 1 WINTER 2009 CLINICAL LABORATORY SCIENCE
CLINICAL PRACTICE
major constraints, molecular diagnostic (MD) techniques
are being developed and introduced into routine laboratory
practice.2 For a MD approach to succeed in a clinical setting,
it is critical that CLS, residents, and clinicians be well trained
in performing, troubleshooting, and interpreting the assays.
ey must understand the limitations (e.g., false positives,
false negatives, cross-reactivity, contamination issues, and
inhibition of amplification) of both the technology and the
results produced from MD tests.1
MD testing has shifted dramatically in the past decade from the
research arena to the clinical arena. e success of the Human
Genome Project, forensic applications, genetic identification
of various disease-causing microbes, establishment of the
Laboratory Response Network (LRN) for detection of bioter-
rorism agents,3 and expanded public health epidemiology and
surveillance activities have all contributed to the incorporation
of MD into the routine practices of medical and public health
laboratories at a rapid pace.4 CLS programs in the US have
been asked to educate the future laboratory professional with
the goal of being knowledgeable in the basic principles and uses
of MD technology.5 An informal telephone survey in 1992 of
CLS program directors6 and a formal survey in 19937 indicated
that only 8% to 16% of the responding programs required a
genetics course as part of their curriculum or as a prerequisite.
A more recent survey in 2002 of 263 CLS programs indicated
that over 92% of programs teach human genetics and MD in
varied formats. Briefly, this survey found that more programs
teach theory than hands-on wet laboratories. Importantly,
there was noted dissatisfaction in the education provided in
the MD area with respect to time issues, lack of knowledgeable
faculty, associated costs, and implementation.5
e following is a review of how the CLS program at Texas
State University – San Marcos introduced a dedicated MD
course (lecture/laboratory) in the spring of 2002. is over-
view focuses on the dynamic nature of the course resources
that are used to teach the concepts of MD and prepare CLS
students for entry level skills. Students are required to take
a prerequisite genetics course prior to the CLS MD course.
During the spring semester of the senior CLS academic year,
the students receive dedicated MD didactic lectures and
laboratory exercises to achieve active learning. MD topics
are also intermittently discussed throughout the two year
curriculum with specific topics (e.g., Gen Probe assays in
microbiology, Factor V Leiden deficiency in hematology,
viral load and genotyping for HIV in immunology, etc.).
e evolution of lecture and laboratory components of this
dedicated course will also be discussed.
RESOURCES FOR MOLECULAR DIAGNOSTICS
INFORMATION
With the lack of specific guidelines for molecular testing
in the Clinical Laboratory Improvement Amendments
(CLIA) final rule, one must turn to the recommendations
of the National Accrediting Agency for Clinical Laboratory
Science (NAACLS),8 American College of Medical Genet-
ics (ACMG), Clinical and Laboratory Standards Institute
(CLSI) and College of American Pathology (CAP).9 NAA-
CLS describes the programmatic accreditation process for the
institution of the diagnostic molecular scientist by providing
competencies and requirements for this professional. CLIA
defines many of the basic quality systems required for labo-
ratories, but lack specific guidelines pertaining to molecular
genetic testing.10 ese standards and practice guidelines can
be applied to many areas of molecular testing regardless of the
field of study. e ACMG Standards and Guidelines cover
cytogenetics, biochemical genetics, and molecular genetics.11
In addition, the ACMG has developed disease-specific guide-
lines to address specific technical problems frequently seen
in complex assays. Together, these guidelines cover general
laboratory practices, assay validation, and method-specific
and disease-specific technical issues.
e Clinical and Laboratory Standards Institute (CLSI),
formerly known as National Committee on Clinical Labo-
ratory Standards (NCCLS), used field-specific experts to
develop a number of guidelines for molecular diagnostics,
including molecular genetic testing,12 molecular hematopa-
thology,13 DNA sequencing,14 diagnostic microarrays,15 and
proficiency testing.16 e College of American Pathologists
(CAP) is the main accrediting organization for molecular
laboratories. e inspection checklists for General Laboratory
and Molecular Pathology are good references for the type of
quality systems and procedures that should be operating in
a molecular laboratory.17 ese documents provide expert
opinions on standard practices in a molecular laboratory.
ey offer guidance on specific techniques and appropriate
controls. Furthermore, molecular testing is becoming more
complex as an increasing number of analytes are now be-
ing measured on microarray platforms. In addition to the
CLSI guidelines for microarrays, the ACMG is working on
guidelines for genomic microarrays. ese guidelines will
continue to be developed and updated as more applications
of microarrays move into clinical practice. Importantly, the
position of ASCLS is that “the profession (of a CLS) includes
generalists as well as individuals qualified in a number of
specialized areas of expertise” including MD.18
VOL 22, NO 1 WINTER 2009 CLINICAL LABORATORY SCIENCE 11
CLINICAL PRACTICE
IMPLEMENTATION OF MD IN THE CLS
CURRICULUM
Didactic lectures
While some have integrated MD topics and laboratories
in different CLS courses throughout the curriculum, a
dedicated MD lecture/laboratory course in was introduced
at Texas State University in 2002. e faculty at Texas State
University takes advantage of the opportunity to present
appropriate MD clinical applications in other courses
(e.g., viral load and genotyping for HIV in immunology);
however, an immersion in a dedicated course is critical to
allow for deeper learning and understanding of the content.
A variety of textbooks has been utilized for this course and
is listed in Table 1. Regardless of the textbook, the topics
selected in the lecture have remained fairly stable and are
listed in Table 2.
e course begins with a review of molecular biology
“basics” (central dogma) surrounding DNA, RNA, and
proteins. e lecture topics follow with extraction/isolation
techniques, amplification techniques such as polymerase
chain reaction (PCR), and mutation events. e latter topics
introduce post-analytic techniques (e.g., sequencing) and
detection (inherited disorders, infectious disease, oncology),
and conclude with quality assurance and control (QC/QA)
in MD. e lectures are supplemented with case studies
associated with MD data sets (gel images, dendograms) and
problem sets requiring student calculations (concentration,
purity, primer design). Students are evaluated on the material
based on their answers to problem sets, case studies, and
several unit exams.
A special assignment for course credit involves student
groups conducting a literature review of a MD technology
as it applies to a “real world” CLS case. is assignment
coincides with our College of Health Profession Faculty –
Student Research Forum. Students are required to submit an
abstract detailing their topics with a final poster presentation
Table 1. Textbook resources for MD course
1. Buckingham L, Flaws ML, editors. Molecular
diagnostics: fundamentals, methods, & clinical
applications. Philadelphia: FA Davis ; 2007.
2. Coleman WB, Tsongalis GJ, editors. Molecular
diagnostics for the clinical laboratorian, 2nd
edition. Totowa NJ: Humana Press; 2006.
3. Debra GB, Leonard MD, editors. Diagnostic
molecular pathology, Volume 41. Philadelphia:
Saunders (Elsevier Science); 2003.
4. Henry JB, editor. Clinical diagnosis and man-
agement by laboratory methods, 21th edition.
Philadelphia: W.B. Saunders Company; 2007.
5. Coleman WB, Tsongalis GJ, editors. Molecu-
lar diagnostics for the clinical laboratorian.
Totowa NJ: Humana Press; 1997.
6. Coleman WB, Tsongalis GJ, editors. Molecular
diagnostics: a training and study guide.
Washington DC: AACC Press; 2002.
7. Glick BR, Pasternak JJ, editors. Molecular
biotechnology: principles and applications of
recombinant DNA. Washington DC: ASM
Press; 1998.
8. Farkas DH. DNA from A to Z, 3rd edition.
Washington DC: AACC Press; 2004.
9. Bruns DE, Lo YMD, Wittwer CT, editors.
Molecular testing in laboratory medicine.
Washington DC: AACC Press; 2002.
Table 2. Topics for molecular diagnostic (MD)
lectures
Unit number and topics
1. DNA: An Overview
2. RNA & Proteins: An Overview
3. Nucleic Acid Extraction Methods
4. Resolution, Detection, & Analysis
5. MD Amplification
• PCR
• qPCR
• Reverse-transcriptase PCR
6. Chromosomal Structure & Mutations
7. Gene Mutations
8. DNA Sequencing
9. DNA Polymorphisms & Human Identity
10. Detection & Identity of Microbes
11. Detection of Inherited Diseases
12. Molecular Oncology
13. QA & QC
• Agency oversight
• Regulations
• FDA approved testing
12 VOL 22, NO 1 WINTER 2009 CLINICAL LABORATORY SCIENCE
(in class and at the research forum) of their findings. For
example, a recent topic chosen from the literature, “Real-
time PCR for Chlamydia pneumoniae Utilizing the Roche
Lightcycler and a 16s rRNA Gene Target”, was awarded the
2008 Outstanding Student Educational Poster. e student
groups are evaluated on content, meeting guidelines/
deadlines, presentation, and professionalism.
e major limitation of the lecture format is that students
are at different stages of understanding basic genetic
concepts. Due to this concern, the Texas State University
CLS program now includes a prerequisite genetics course.
However, students still can be at different “levels” of
understanding due to the prerequisite being satisfied at
different institutions and by different instructors. For
example, some instructors focus on classic genetics with
brief topics on current clinical applications while other
courses are lecture-based only without offering the student
any laboratory experience. Another limitation is in the area
of calculations associated with MD. Some students struggle
with calculations due to differences in their backgrounds
and cognitive skills in math and statistics. is is especially
noticeable with students who have not taken these types of
courses recently. Texas State University, like others, has also
seen this issue with our clinical research course that requires
method validation and correlation cognitive skills.19 To
help the students master the material with respect to these
issues, the instructor (and other CLS faculty) will meet
with students independently or in small groups to review or
practice these topics.
Laboratory component
e laboratory component of the MD course is taught
concurrently with the didactic component. Concurrent
lecture and laboratory sessions allow the student to be
involved in the actual generation of data using clinically
relevant MD tools and techniques. Senior students are also
beginning their clinical rotations in various community
laboratories during this semester which permits possible
observation and experience with MD equipment and
methods in the hospital and reference laboratory setting.
Finally, the concurrent MD laboratory helps reduce the
problem of lecture topics becoming abstract or distant
before the student has an opportunity to “practice” what’s
being covered in the didactic lecture.
During the initiation of the course, the laboratory
component was a mixture of online “virtual” experiences
from a variety of websites (e.g., DNA from the Beginning
at http://www.dnaftb.org/dnaftb/, Cold Spring Harbor
Laboratory Dolan DNA Learning Center at http://www.
dnalc.org/ddnalc/about/) or training CDs from the Roche
Education Program (e.g., Genetics, Hepatitis C, MRSA/
VRE, Regulatory and Molecular Technology). ese virtual
laboratory experiences were followed by selected molecular
kits (available from a variety of suppliers) covering areas such
as (1) isolating the student’s DNA from cheek cells with
PCR of particular genes, (2) mock crime scene investigation
with PCR and restriction fragment analysis, and (3) PCR of
known controls. Each of these modules incorporated the
use of typical extraction kits, PCR thermocyclers, and post
PCR work via gel electrophoresis and analysis of products.
In 2008 we collaborated with a local biotechnology company
(Embark Scientific, Austin TX) to incorporate a “beginning
to ending” real world application of clinical MD in our
laboratory component. e specific exercise was planned to
integrate the application over the entire semester between
student clinical rotations. e assay design process was
discussed broadly with the students with respect to mecA and
femA genes in Methicillin-resistant Staphyloccoccus aureus
(MRSA) and for the iroB gene in Salmonella enterica. e
iroB gene was chosen for the laboratory exercise because it
has been extensively documented in the literature. Sequence
data for the iroB gene was obtained at the National Center
for Biotechnology (NCBI) website (http://www.ncbi.nlm.
nih.gov/) and publication21 for utilization of specific primers
and for student exercises in primer design techniques.
Each student was provided an overnight culture of
Salmonella enterica (Central Texas Medical Center, San
Marcos TX) for total DNA isolation/purification using
the DNeasy Blood and Tissue kit (Qiagen Inc., Valencia
CA). PCR design and troubleshooting was reviewed and
each student performed PCR amplification of iroB utilizing
primer iroB F1: TGGACTGCTATACCCTGTGC and
primer iroB R1: GCAGTATGCTCATGCTGGGC which
yields a 493bp PCR fragment. Primers (Integrated DNA
Technologies, Inc., Coralville IA) were resuspended at
100µM. e DNA template (3µL) was added to a PCR
mixture (Promega, Madison WI) with a total volume
of 50µL and a final MgCl2 concentration of 2mM. PCR
cycling was performed as recommended by Embark
Scientific. PCR products and DNA markers (Amresco Inc.,
Solon OH) were separated by agarose gel electrophoresis
(Amresco Inc., Solon OH) to confirm correct iroB gene size
(493bp) with photodocumention (Figure 1).
CLINICAL PRACTICE
VOL 22, NO 1 WINTER 2009 CLINICAL LABORATORY SCIENCE 13
PCR products were treated with ExoSAP-IT (USB
Corporation, Cleveland OH) to provide clean template for
DNA sequencing. Sequencing reactions were prepared by
adding 5.0µL of each sample or positive control (pUC19),
2.0uL sequencing primers (1.6uM), 8.0uL DTCS Quick
Start Master Mix and ddH2O for a total volume of 20µL
(Beckman Coulter, Inc., Fullerton CA). Sequencing
reaction amplification was performed with 30 cycles of one
minute at 94°C, 20 seconds at 96°C, 20 seconds at 50°C
and four minutes at 60°C. Sequencing reaction cleanup by
ETOH precipitation was performed on final products.
DNA sequencing was performed using a capillary array
instrument (Beckman Coulter Genomic Analyzer acquired
by R Rohde via an Education/Research Grant from Beckman
Coulter and matching grant from Texas State University).
Students were instructed on how to create databases and
project folders to manage the sequencing data and to enter
necessary sample information into the instrument software
program. Instrument startup and shut down procedures
were performed including: installing, removing or replacing
Capillary Arrays, installing Gel Cartridges, priming the
system (Manifold Purge, Gel Capillary Fill and Optical
Alignment), installing gel waste bottle, preparing plates for
run, loading Wetting Tray, Sample Plate and Buffer Plate
and system cleanup. Students exported sequencing data of
their samples (Figure 2) and analyzed it utilizing typical
sequencing analysis software.
is laboratory component is critical to the students’
understanding of mathematical operations (calculating
DNA concentrations, PCR master mix) and interpretation
of data (troubleshooting gels, controls). Students are
evaluated on technique by the instructor (pipetting, gel
loading, maintenance of equipment, QA/QC) during the
entire semester and are given a concluding final exam. e
final exam includes theory of basic concepts and synthesis/
critical problem solving of data interpretation (Table 3).
Clinical practicum
Due to the limitation of MD applications in the clinical
laboratories in our geographic location, the students may
spend time only in some laboratories doing MD assays and
QC/QA of equipment associated with molecular techniques.
Table 3. Topics for molecular diagnostic (MD)
laboratory
1. Assay Design: An Overview
• Define/obtain target sequence
• Primer design
2. DNA Isolation/Purification Methods
3. PCR Method: An Overview
• Assay design
• Reaction component interactions
• Troubleshooting
• PCR amplification
4. PCR Analysis
• Agarose gel electophoresis
• Photodocumentation
5. PCR Cleanup Method
6. DNA Sequencing: An Overview
• DNA sequencing reaction setup &
amplification
• DNA sequencing reaction cleanup
procedure
• Instrument setup & reaction run
procedures
• Instrument startup & shut down
procedures
• Data Management
7. DNA Sequence Analysis
• Review analyzed data
• Export data
• Data analysis
CLINICAL PRACTICE
Figure 1. Agarose gel of student PCR iroB gene
amplicons (493bp)
DNA markers are shown on the far left and right lane and student
samples (capital letters depict student samples) are between the
DNA markers.
14 VOL 22, NO 1 WINTER 2009 CLINICAL LABORATORY SCIENCE
e clinical practicum is an area that we feel can be nurtured
and grown with our area affiliate laboratories as they
incorporate MD into their testing menus. It is important
to mention that hospitals, upon finding out about our
dedicated MD course, actively recruit our students to “help
set up” that type of testing as future employees.
SUMMARY
Molecular diagnostics is the fastest growing area of
clinical medicine. Current CLS students and working
CLS professionals need to be proficient in this area of the
laboratory. MD often allows for faster turnaround times
with increased sensitivity and specificity. However, this
testing must be integrated with strict QC/QA with respect
to the types of controls, standards, and limits.16
By including a dedicated MD course in the CLS curriculum,
we are preparing our students with the knowledge and
background they need to be competent in applying this
skill set in the workforce. e course has strengthened our
students’ “job attractiveness” in clinical, reference, research,
and public health laboratories. e future of CLS students
in MD has arrived and they need the strong background
in this exploding diagnostic area of the medical world to
effectively and accurately perform the growing number
of FDA approved clinical testing platforms (e.g., cystic
fibrosis, Factor V, and non-culturable microbes). Having a
course in MD and gaining work experience in molecular
techniques post-CLS degree also allows CLS professionals
who meet the proper requirements to obtain certification
from a variety of organizations, for example technologist in
molecular pathology (MP) from ASCP.20
It is important to mention the challenges associated with
the endeavor of pursing this type of course in the CLS
curriculum. e major obstacles that we encountered were
(1) dedicated space (clean area outside of typical routine
CLS teaching laboratories), (2) faculty expertise, (3) time of
placement within CLS curriculum, (4) student preparation
for course rigor (prerequisites), (5) reagent and equipment
cost, and (6) a MD clinical experience for the student.
ese obstacles were addressed in a variety of ways. As we
acquired funding and gained recognition within our College
of Health Professions and university about the importance
of this course, additional dedicated laboratory space was
provided to support this course and the research expertise of
the faculty member. Faculty expertise was met in the initial
year (2002) of the course implementation by employing
a new faculty member with MD skills. Subsequently, the
faculty member augmented the laboratory component of the
course by collaborating with a local biotechnology company
(Embark Scientific) to assist in the course development
from a real world perspective. e placement of the MD
course in the curriculum and student preparation will be
different for each CLS program. In our experience, the
course was best placed in the senior year so that students
would have the opportunity to finish prerequisites and
build their skills in critical areas (pipetting, calculations,
etc.). e financial costs associated with the course can be
problematic. However, a program can reduce this issue by
using home-brew assays, utilizing molecular equipment
that is available in other departments on their respective
campus (or laboratories with clinical affiliations), and using
expired or donated kits from companies. Acquiring a MD
clinical practicum or rotation for students is an ongoing
challenge for our program. However, by reaching out
to local biotechnology companies, research laboratories,
and hospitals, we are finding more possible sites to place
students for experience in molecular techniques.
A dedicated course in MD provides CLS programs with
the unique opportunity to become flexible in the face of a
growing clinical need. While molecular biology theory and
general laboratory work is taught in a variety of university
and college departments (biology, biochemistry, forensics),
CLS programs can become the leader in preparing clinically
competent CLS professionals by providing them with
training in MD.
Clin Lab Sci encourages readers to respond with thoughts,
questions, or comments regarding this article. Email responses
to brodak@iupui.edu. In the subject line, please type “CLIN
CLINICAL PRACTICE
Figure 2. A sample student iroB gene sequence iden-
tified by capillary electrophoresis on the Beckman
Coulter Genomics Analyzer
e shaded areas indicate the forward primer and reverse
primer areas.
VOL 22, NO 1 WINTER 2009 CLINICAL LABORATORY SCIENCE 15
LAB SCI 22(1) CP ROHDE”. Selected responses will appear
in the Dialogue and Discussion section in a future issue. Re-
sponses may be edited for length and clarity. We look forward
to hearing from you.
REFERENCES
1. Coleman WB, Tsongalis GJ. A historical perspective on the clini-
cal diagnostic laboratory. In: Molecular diagnostics for the clinical
laboratorian. Totowa, NJ: Humana Press; 1997:1-12.
2. Glick BR, Pasternak JJ. Molecular diagnostics. In: Molecular bio-
technology, principles and applications of recombinant DNA, 2nd
ed. Washington, DC: ASM Press; 1998:199-225.
3. Barden LS. Training laboratory personnel to identify the agents of
bioterrorism. Lab Med 2002;33:699-703.
4. Rohde RE., Mulawski KM., Oates M. National Laboratory
Training Network public health series course: Molecular
diagnostic techniques for the public health laboratory. Lab Med
2004;35(8):10-4.
5. Miller LE, Abbate S. Genetics and molecular diagnostics in
the clinical laboratory science curriculum. Clin Lab Sci 2002
Summer;15(3):160-6.
6. Miller LE, Rolen-Mark HB. A step toward curriculum reform:
incorporating a human genetics course into a medical technology
program. Lab Med 1995;26:603-6.
7. Kasper LM, Rodak BR, Snyder JR, and others. A national study of
prerequisite coursework for professional medical technology cur-
ricula. Lab Med 1993;24(7):441-444.
8. National Accrediting Agency for Clinical Laboratory Science. 2007.
Guide to accreditation for diagnostic molecular science programs.
Available from: http://www.naacls.org/PDFviewer.asp?mainUrl=/
docs/guide_dms.pdf. Accessed 2008 May 27.
9. Bellissimo DB. Practice guidelines and proficiency testing for mo-
lecular assays. Transfusion 2007;47:79-84.
10. US Department of Health and Human Services H. Clinical Labora-
tory Improvement Amendments of 1988 (CLIA); Final Rule. Fed
Regist 1992;42:7139-86, CFR Sec. 493.801- 494.51.
CLINICAL PRACTICE
11. American College of Medical Genetics. Standards and guidelines
for clinical genetics laboratories. American College of Medical
Genetics, 2006. Available from: http://www.acmg.net. Accessed
2008 August 27.
12. Clinical and Laboratory Standards Institute (CLSI). Molecular
diagnostic methods for genetic diseases: approved guidelines, 2nd
edition. Wayne, PA: CLSI, 2006.
13. Clinical and Laboratory Standards Institute (CLSI). Nucleic acid
amplification assays for molecular hemotopathology; approved
guidelines, 1st edition. Wayne, PA: CLSI, 2003.
14. Clinical and Laboratory Standards Institute (CLSI). Nucleic acid
sequencing methods in diagnostic laboratory medicine; approved
guideline, 1st edition. Wayne, PA: CLSI, 2004.
15. Clinical and Laboratory Standards Institute (CLSI). Diagnostic
nucleic acid microarrays: approved guidelines, 1st edition. Wayne,
PA: CLSI, 2006.
16. Clinical and Laboratory Standards Institute (CLSI). Proficiency test-
ing (external quality assessment) for molecular methods; approved
guidelines, 1st edition. Wayne, PA: CLSI, 2005.
17. College of American Pathologists. Checklist for molecular pathology.
Chicago, IL: College of American Pathologists, 2006 [cited 2007 Jan
31]. Available from: http://www.caps.org/apps/docs/laboratory_ac-
creditation/checklists. Accessed 2008 August 27.
18. American Society for Clinical Laboratory Science. 2001 Scope of
practice, position paper. Available from http://www.ascls.org/posi-
tion/scope_of_practice.asp. Accessed 2008 Jun 1.
19. Moon, TC, Legrys VA. Teaching method validation in the
clinical laboratory science curriculum. Clin Lab Sci 2008
Winter;21(1):19-24.
20. Killeen, AA, Leung, WC and others. Special Article: Certification in
molecular pathology in the United States (Training and Education
Committee, the Association for Molecular Pathology). J Molec
Diag November 2002;4(4):181-4.
21. Bäumler, AJ, Heffron, F and Reissbrodt R. Rapid detection of
Salmonella enterica with primers specific for iroB. J Clin Microbiol
1997 May;35(5):1224-30.
