ArticlePDF Available

Molecular analysis of microbial community structure in the chicken ileum following organic acid supplementation

Authors:

Abstract and Figures

To compensate for possible decreases in animal production due to restrictions on the use of antibiotics as growth promoters, several non-antibiotic alternatives have been investigated. Organic acid supplementation (OAS) of feed or water has shown some promising results for affecting intestinal microbiota and reducing pathogenic bacteria in the gastrointestinal (GI) tract. However, few studies have explored the effects of OAS on microbial communities using objective molecular-based techniques. The aim of the present study was to characterize via 16S rRNA gene-based approaches responses of the intestinal microbiota after OAS in chicks. Newborn chicks were randomly divided in four treatments: (a) control (no antibiotic, no OAS); (b) antibiotic administration (bacitracin MD); (c) organic acid blend dl-2-hydroxy-4(methylthio) butanoic acid [HMTBA]; lactic, and phosphoric acid (HLP); and (d) organic acid blend HMTBA, formic, and propionic acid (HFP). Ileal contents and mucosal scrapings from 7 chicks/treatment/day were taken at 15, 22, and 29 days of age, and genomic DNA was isolated for the molecular analysis of the intestinal microbiota. The data demonstrate that HFP blend treatment for 29 consecutive days affected ileal microbial populations as indicated by community fingerprinting analysis (16S rRNA PCR-DGGE). In parallel, total bacterial and lactobacilli populations were increased by the HFP blend treatment as demonstrated by targeted qPCR analysis of 16S rRNA. In summary, the present data demonstrate that OAS, HFP blend treatment in particular, shifts intestinal microbiota, generates more homogenous and distinct populations, and increases Lactobacillus spp. colonization of the chick ileum.
Content may be subject to copyright.
Molecular analysis of microbial community structure in the chicken
ileum following organic acid supplementation
Gerardo M. Nava
a,b,d,
*, Matias S. Attene-Ramos
a,d
, H. Rex Gaskins
a,b,c,d
, James D. Richards
e
a
Laboratory of Mucosal Biology, Department of Animal Sciences, University of Illinois at Urbana-Champaign, United States
b
Division of Nutritional Sciences, University of Illinois at Urbana-Champaign, United States
c
Department of Pathobiology, University of Illinois at Urbana-Champaign, United States
d
Institute for Genomic Biology, University of Illinois at Urbana-Champaign, United States
e
Novus International, Inc., United States
1. Introduction
The use of antibiotics as growth promoters has been
restricted or forbidden in many countries due to safety
concerns regarding their potential contribution to the
spread of antibiotic resistance among microbial pathogens
(Verstegen and Williams, 2002). To compensate for the
possible decrease in animal growth performance, several
non-antibiotic alternatives have been investigated.
Organic acid supplementation (OAS) of feed or water has
generated promising results for reducing pathogenic
bacteria in the gastrointestinal (GI) tract and improving
the digestibility of proteins and the absorption of minerals
(Dibner and Buttin, 2002; Partanen, 2000; Van Immerseel
et al., 2006). Organic acid supplementation might influence
the GI microbiota by killing acid sensitive species, and by
altering physical conditions of the intestinal lumen, such
that they are less appropriate for the growth of pathogenic
Veterinary Microbiology 137 (2009) 345–353
ARTICLE INFO
Article history:
Received 8 February 2008
Received in revised form 22 January 2009
Accepted 26 January 2009
Keywords:
Intestinal microbiota
Lactobacillus
Chicken
Organic acids
ABSTRACT
To compensate for possible decreases in animal production due to restrictions on the use
of antibiotics as growth promoters, several non-antibiotic alternatives have been
investigated. Organic acid supplementation (OAS) of feed or water has shown some
promising results for affecting intestinal microbiota and reducing pathogenic bacteria in
the gastrointestinal (GI) tract. However, few studies have explored the effects of OAS on
microbial communities using objective molecular-based techniques. The aim of the
present study was to characterize via 16S rRNA gene-based approaches responses of the
intestinal microbiota after OAS in chicks. Newborn chicks were randomly divided in four
treatments: (a) control (no antibiotic, no OAS); (b) antibiotic administration (bacitracin
MD); (c) organic acid blend
DL
-2-hydroxy-4(methylthio) butanoic acid [HMTBA]; lactic,
and phosphoric acid (HLP); and (d) organic acid blend HMTBA, formic, and propionic acid
(HFP). Ileal contents and mucosal scrapings from 7 chicks/treatment/day were taken at 15,
22, and 29 days of age, and genomic DNA was isolated for the molecular analysis of the
intestinal microbiota. The data demonstrate that HFP blend treatment for 29 consecutive
days affected ileal microbial populations as indicated by community fingerprinting
analysis (16S rRNA PCR-DGGE). In parallel, total bacterial and lactobacilli populations
were increased by the HFP blend treatment as demonstrated by targeted qPCR analysis of
16S rRNA. In summary, the present data demonstrate that OAS, HFP blend treatment in
particular, shifts intestinal microbiota, generates more homogenous and distinct
populations, and increases Lactobacillus spp. colonization of the chick ileum.
ß2009 Elsevier B.V. All rights reserved.
* Corresponding author at: University of Illinois at Urbana-Champaign,
1207 W. Gregory Drive, Urbana, IL 61801, United States.
Tel.: +1 217 244 3163; fax: +1 217 333 8286.
E-mail address: gnavamo2@uiuc.edu (G.M. Nava).
Contents lists available at ScienceDirect
Veterinary Microbiology
journal homepage: www.elsevier.com/locate/vetmic
0378-1135/$ – see front matter ß2009 Elsevier B.V. All rights reserved.
doi:10.1016/j.vetmic.2009.01.037
species (Dibner and Buttin, 2002; Verstegen and Williams,
2002). Preliminary results with pigs and chickens have
demonstrated that OAS of blends containing
DL
-2-hydroxy-
4(methylthio) butanoic acid (HMTBA), lactic, phosphoric,
formic, and propionic acids improve animal performance
and reduce GI infections by pathogenic bacteria (Knight
et al., 2006; Zhao et al., 2007). Although, OAS is now a
common practice in animal production, the precise
mechanisms of action are still unknown.
Some evidence suggests that one possible mechanism
of action of OAS is by changing and selecting microbial
populations in the GI tract. Culture-based microbiological
studies in pigs and chickens have revealed changes in
enterobacteria and lactic acid bacteria (Canibe et al., 2005;
Kluge et al., 2006; Overland et al., 2000). However, few
studies have explored the effects of OAS on the intestinal
microbiota profile through culture-independent (PCR-
based) methods. The aim of the present study was to
examine through PCR-based approaches the response of
the ileal microbiota to different OAS in broiler chicks. The
data demonstrate that OAS treatment for 29 consecutive
days affected ileal microbial community structure as well
as the density of Lactobacillus populations.
2. Materials and methods
2.1. Diet composition and preparation
Birds were fed commercial-type corn-soy starter diets
(3050 kcal/kg, 21.81% CP) from day 0–15, followed by
corn-soy grower diets (3120 kcal/kg, 19.59% CP) from days
16–36. All diets were formulated to meet or exceed
National Research Council (1994) estimated nutrient
recommendations. Diets were formulated without anti-
biotics (except treatment 2) or coccidiostats. All diets were
identical across treatments with the exception that
treatment 2 diets included bacitracin MD (BMD) in the
feed at 25 ppm (see description of treatments below). OAS
(treatments 3 and 4) was provided through the drinking
water.
2.2. Experimental design and animals
Two hundred fifty-two newborn chicks (Cobb males)
were maintained in electrically heated cages. Temperature
at day 0 was 32 8C, and then decreased 1 8C every other day
until the minimum temperature of 23 8C was reached.
Fluorescent lighting was provided under the following
schedule: day 0–2: 23 h light and 1 h dark, days 3–11: 18 h
light and 6 h dark; day 12-end: 16 h light and 8 h dark.
Chicks were allowed to consume feed and water ad libitum
during the entire time of experiment. At arrival, chicks
were randomly divided in four treatments (7 replications
per treatment, and 9 birds per replicate): (a) Control (no
antibiotic, no OAS); (b) Antibiotic administration (baci-
tracin MD at 25 ppm in the feed); (c) HLP blend (OAS at
0.0525% in drinking water); and (d) HFP blend (OAS at
0.0525% in drinking water). The HLP and HFP blends are
commercially available (Novus International, St. Louis,
MO) OAS products. The doses employed were based on
manufacturer’s recommendations, and similar doses have
been proven effective in other trials (Dibner, 2007; Knight
et al., 2006; Quiroz et al., 2007). The chemical composition
of HLP blend is HMTBA, lactic and phosphoric acid whereas
HFP is HMTBA, formic and propionic acid. The experiments
were performed according to the law and the animal
protocol for this research was in accordance with the
standard operating procedure of Novus International Inc.
and approved by an internal safety committee.
At days 0, 16, 22, 30, and 36 of age body weight, feed
consumption, and water consumption were recorded.
Period and cumulative body weight gain, feed intake,
water intake and feed conversion corrected for mortality
were recorded for each cage at each time point. Treatment
effects were subjected to analysis of variance using the
GLM procedure of SAS (SAS-Institute 2003; SAS Institute,
Cary, NC.) Differences among treatment LS Means were
established using the Pairwise Comparison function of SAS.
A probability of P0.05 was considered statistically
significant.
Battery cages represent an essentially ideal environ-
ment for animal growth (as evidenced by typical high gains
and low feed:gain ratios) and hence are not optimal for
evaluating the effects of exogenous agents on productive
parameters (Hernandez et al., 2006). Consequently, the
primary objective of the present study was to assess the
effects of OAS on ileal microbiota. This study focused on
microbial ecology of the ileum because this anatomical
section harbors important intestinal bacterial species as
well as the predominant bacterial communities found in
the ceca of young chickens (Amit-Romach et al., 2004;
Gong et al., 2002; Lu et al., 2003; Olsen et al., 2008).
Furthermore, this intestinal section is influenced by
bacterial fermentation products produced in distal regions
of the intestinal tract and refluxed via antiperistaltic
movements (Duke, 1986; Duke et al., 1975; Noy and Sklan,
1998; Ohmori et al., 2003). Two independent PCR-based
methods were used to examine the effect of OAS. First,
PCR-denaturing gradient gel electrophoresis (DGGE) was
used to determine changes in the ileal microbial profile
after OAS. Second, based on previous findings of culture-
based microbiological studies, real-time quantitative PCR
(qPCR) was used to determine the effect of OAS on
Lactobacillus spp. and Clostridium perfringens populations,
two microbial groups that play an important role in the
health of chickens (Collier et al., 2003b; Tannock, 2004).
2.3. Genomic DNA extractions
Ileal contents and mucosal scrapings from 7 chickens/
treatment/day were taken at 15, 22, and 29 days of age for
the molecularanalysis of the intestinal microbiota. Genomic
DNA was isolated from 200 mg of intestinal luminal
contents using a commercial kit (QIAamp DNA Stool Mini
Kit, Valencia, CA). An external DNA amplification standard,
GFP gene, for the assessment of the efficiency of DNA
recovery and PCR amplification (EDRA) was estimated for
each intestinalsample (Nava et al., in preparation).The main
purpose of the EDRA approachis to estimate the efficiency of
the overall extraction process and the effect of inhibitory
substances on PCR amplification. Briefly, all intestinal
samples were spiked with a known number of Escherichia
G.M. Nava et al. / Veterinary Microbiology 137 (2009) 345–353
346
coli K12 GFP gene-transformed bacteria and DNA extrac-
tions and PCR amplifications were performed. EDRA was
calculated by comparing the copy number of spiked GFP
gene with the number of copies amplified. Copies of GFP
gene in each sample were estimated via qPCR using SYBR
Green PCR technology.Each 10
m
l qPCR mixture consistedof
5
m
lof2SYBR Green Master Mix (Applied Biosystems),
1
m
l of BSA (100
m
g/ml), 0.2
m
l of each prime r (25
m
M), GFP-
Forward (TGTTCCATGGCCAACACTTGTCAC) and GFP-
Reverse (AGGGCAGATTGTGTCGACAGGTAA), 1
m
lof
extracted genomic DNA, 2.6
m
l PCR-grade water. PCR was
performed by initial denaturation at 94 8Cfor2min,
followed by 35 cycles of denaturation at 94 8C for 30 s,
primer annealing at 65 8C for 30 s, and extension at72 8C for
30 s, with a final extension at 72 8C for 15 min. The standard
curve was constructed with known amounts of GFP gene
plasmid clones amplified at the same time, and used for the
absolute quantification following the mathematical model
described elsewhere (Rutledge and Cote, 2003). PCR
amplifications were performed in triplicate.
2.4. PCR-DGGE microbial profiling
PCR-DGGE analysis of total Bacteria was performed to
examine the effect of the different treatments on the
composition of the intestinal microbiota. Each DNA sample
was amplified using primers specific for conserved
sequences flanking the variable V3 region of 16S rRNA
(341F + 5
0
-GC clamp and 534R), as described previously
(Muyzer et al., 1998). After visual confirmation of the PCR
products with agarose gel electrophoresis, DGGE was
performed using the Bio-Rad D-code system (Hercules, CA)
as described previously (Simpson et al., 1999). To separate
PCR fragments, 35–60% linear DNA-denaturing gradients
(100% denaturant is equivalent to 7 mol/l urea and 40%
deionized formamide) were formed in 8% polyacrylamide
gels using a Bio-Rad Gradient Former. Bacterial V3 16S PCR
products were loaded in each lane and electrophoresis
performed at 60 8C at 150 V for 2 h and then for 1 h at
200 V. Additionally, bacterial DNA reference ladders were
loaded to allow standardization of band migration and gel
curvature among different gels (Simpson et al., 1999). After
electrophoresis, gels were silver-stained and scanned
using a GS-710 calibrated imagining densitometer
(BioRad). Each individual amplicon was then visualized
as a distinct band representing at least one bacterial
species on the gel. To avoid gel performance biases in the
PCR-DGGE analysis, two different gels were used because
the number of samples per day exceeded the number of
lanes available on one DGGE gel. Samples were split and
the same number of samples per treatment was loaded on
each gel.
2.5. Estimates of microbial diversity
Diversity Database (Version 2.1) of the ‘‘Discovery
Series’’ (BioRad) was used to analyze PCR-DGGE banding
patterns by measuring migration distance of the bands
within each lane of a gel. This information was then used to
analyze banding patterns via measurement of community
diversity parameters, including band number, Sorenson’s
pairwise similarity coefficient, and Ward’s algorithm
(Collier et al., 2003a).
2.6. Analysis of intestinal microbiota by real-time
quantitative PCR
The colonization of total Bacteria,lactobacilli, and C.
perfringens in ileal luminal samples was analyzed by qPCR.
Genomic DNA from ileal samples was used as templates for
PCR amplification using SYBR Green PCR technology
(Applied Biosystems, Foster City, CA) and an ABI 7900
real time PCR machine (Applied Biosystems). Absolute
quantification was achieved by using standard curves
constructed by amplification of known amounts of target
DNA and following the mathematical model described
elsewhere (Rutledge and Cote, 2003). Bacterial DNA for
standard curves was extracted from known concentrations
of bacterial cells. The total number of cells was inter-
polated from the averaged standard curve. Protocols for
the qPCR analysis (Collier et al., 2003a,b) and specific-
species 16S rRNA primers for lactobacilli, C. perfringens,
total Bacteria are described elsewhere (Collier et al.,
2003a,b).
2.7. Statistical analysis
Comparisons were performed using SAS software
(Statview, Version 5.0.1; SAS Institute, Cary, NC). ANOVA
and Fisher’s protected least significant difference test were
used to compare differences with an assigned P-value of
0.05.
3. Results
3.1. Productive parameters
Performance was evaluated on days 16, 22, 30, and 36
days of age. Body weight, period and cumulative body
weight gain, feed intake, feed conversion, and water intake
were measured. There were no significant differences
between treatments in any of these parameters at any time
point. Cumulative day 36 performance data for all
treatments can be summarized as follows: body weight,
2.2
0.1 kg; weight gain, 2.1 0.1 kg; feed intake,
3.4 0.1 kg; feed conversion, 1.6 0.04 kg/kg; water intake,
7.4 0.6 kg.
3.2. Efficiency of DNA recovery and PCR amplification (EDRA)
The EDRA analyses were performed to compare, in each
sample, variations in DNA recovery and DNA amplification
efficacy due to differences in matrix composition and the
presence of inhibitory substances, respectively. EDRA was
estimated by comparing the recovered qPCR signal of the
GFP gene amplified in each sample. As shown in Fig. 1,
statistically significant differences in EDRA were not
observed among treatments. These data indicate that
possible variations in DNA concentration and quality were
distributed randomly among all treatments and that
differences in bacterial populations per treatment are
not due to DNA quality.
G.M. Nava et al. / Veterinary Microbiology 137 (2009) 345–353
347
3.3. PCR-DGGE and microbial diversity
Ileal samples collected from individual birds on days 15,
22, and 29 of experimental treatment (lanes: control = a,
antibiotic = b, HLP blend = c, and HFP blend = d) were used
for PCR-DGGE analysis of the V3 region of 16S rRNA.
Results from days 15, 22, and 29 are presented in Figs. 2–4,
respectively. Diversity database software was used to
compare PCR-DGGE banding patterns of 16S rRNA PCR-
DGGE amplicons (bands) in each sample. By day 15 (Fig. 2A
and B) all ileal samples were distributed within four major
clusters (I–IV). At day 22 (Fig. 3A and B), ileal samples were
distributed within five major clusters (I–V). These results
indicate significant interindividual variation of the PCR-
DGGE banding patterns between samples from the same
treatments (i. e., no clustering by treatment). By day 29
(Fig. 4A and B), ileal 16S rRNA banding patterns of HFP
blend-supplemented birds were more homogeneously
distributed than those of the other treatments and
clustered as major cluster II. The other ileal samples were
distributed among other major clusters. Cluster I was
comprised of three samples (c4, c5, c7) of treatment HLP
blend, and 11 out of 14 OAS samples (c4–c7 and d1–d7)
comprised clusters I and II. For the control treatment, 4 out
of 7 samples were distributed in major cluster III (Fig. 4A
and B). For the antibiotic treatment, samples clustered
equally between major clusters III and IV. Results at day 29
indicate that PCR-DGGE banding patterns became more
homogenous in older animals and that HFP blend
treatment homogenizes the ileal microbiota relative to
the other treatments.
3.4. Quantification of total Bacteria, Lactobacillus spp. and C.
perfringens in ileal contents
A qPCR-based method was used to specifically measure
total Bacteria, total Lactobacillus, and total C. perfringens
concentrations in the intestinal lumen. All species-specific
primers yielded one band of the correct size, respectively,
220 bp for Bacteria-specific amplicons, 356 bp for Lacto-
bacillus spp.amplicons, and 279 bp for C. perfringens
amplicons when visualized on an agarose gel (data not
shown). At day 15, the density of total Bacteria was similar
among treatments (Fig. 5). By days 22 and 29, Bacteria
populations were increased (P0.05) in HFP-treated
chicks relative to control- and antibiotic-treated birds
(Fig. 5). The density of ileal Bacteria populations was
similar between HLP and HFP blend at 29 days of age
(Fig. 5).
At day 15, total Lactobacillus spp. numbers were similar
among treatments (Fig. 6). Total Lactobacillus spp. numbers
were greater (P0.05) in HFP blend treated chickens at
days 22 and 29 relative to control and antibiotic
treatments (Fig. 6). No differences between HLP and HFP
blend were observed for total Lactobacillus species at day
22 (Fig. 6). C. perfringens was not detected for any of the
intestinal samples regardless of treatment. Bacterial cell-
number standards and positive controls were adequately
amplified indicating that C. perfringens, if present, was
below the detection limit (10 cells/
m
l DNA) in the ileum
of these chicks (data not shown).
4. Discussion
The present study demonstrates that HFP blend
treatment for 29 consecutive days affected microbial
community structure as well as the density of some
bacterial populations in the chick ileum. The molecular
ecological data indicate that bacterial populations of HFP
blend treated birds were more homogeneous than and
distinct from those of birds not treated with HFP blend. In
addition, the majority of the OAS samples (11 out of 14)
exhibited closer similarity indices of bacterial composition
than non-OAS samples and segregated into different
clusters than antibiotic samples. Furthermore, the ileal
lumen of HFP blend-treated birds harbored greater
numbers of total Bacteria and in particular, greater
numbers of lactobacilli. A similar but non-significant shift
in bacterial populations was observed for animals treated
with HLP blend.
Organic acid supplementation of feed or water is a
promising non-antibiotic alternative for the modulation of
the intestinal microbiota, including the reduction of
pathogenic bacteria in the GI tract (Dibner and Buttin,
2002; Partanen, 2000; Van Immerseel et al., 2006;
Verstegen and Williams, 2002). In vitro studies revealed
that the organic acid blends used in the present study have
antimicrobial activity at low pH levels (Dibner and Buttin,
2002). At low pH, organic acids are found predominantly in
the undissociated (protonated) form. Undissociated
organic acids are lipophilic and can diffuse across bacterial
cell membranes. Once inside the bacterial cell, the organic
Fig. 1. Efficiency of DNA recovery and PCR amplification (EDRA) at 15, 22, and 29 days of age. Green fluorescent protein (GFP) gene recovery and
amplification efficiency were estimated via qPCR using GFP-specific gene primers. Bars in figure represent mean values
S.E. Treatment comparisons were
made using ANOVA and Fisher’s protected least significant difference test with an assigned P-value of 0.05. These results demonstrate no significant differences
in EDRA among treatments.
G.M. Nava et al. / Veterinary Microbiology 137 (2009) 345–353
348
acids will dissociate and decrease the cytoplasmic pH,
disrupting enzymatic reactions, cellular growth and/or
inducing cell death in a variety of bacterial species (Dibner
and Buttin, 2002; Partanen, 2000; Russell and Diez-
Gonzalez, 1998; Van Immerseel et al., 2006). Certain
microbes are more or less tolerant to decreases in
intracellular pH levels. For example, some enterobacterial
species such as Escherichia coli are generally more
susceptible to organic acid-induced toxicity whereas,
other species (i.e. lactobacilli and streptococci) allow their
intracellular pH levels to drop, and are often less
susceptible (Russell and Diez-Gonzalez, 1998; Van Immer-
seel et al., 2006). Indeed, many Lactobacillus spp. isolated
from chicken intestinal tract are resistant to low pH
environments (Jin et al., 1998). These observations could
explain the increase in Lactobacillus populations in the
Fig. 2. (A) PCR-DGGE fingerprinting profile of chicken ileal bacterial populations at 15 days of age. Lanes are marked across the top according to
administration of control (a); antibiotic (b); HLP blend (c); HFP blend (d); and reference ladder (L). Numbers following the letter correspond to chicken
number (e.g. a1, b1, c1, d1). For the PCR-DGGE analysis, two different gels were used because the number of samples per day exceeded the number of lanes
available on one gel. Samples were split and same number of samples per treatment were loaded on each gel. Bacterial DNA reference ladders on each gel
were loaded to standardize band migration and gel curvature among different gels. (A) Reflects cropping and merging both of the gels to group samples per
treatment. (B) Dendrogram depicting organic acid administration-associated effects on PCR-DGGE banding patterns. The dendrogram was constructed
using Ward’s algorithm and Diversity Database software. Major clusters are boxed.
G.M. Nava et al. / Veterinary Microbiology 137 (2009) 345–353
349
intestine of animals under OAS as revealed by the present
study. Because organic acids are antimicrobial at the low
pH levels found in the upper GI tract, it is believed that OAS
may reduce the numbers of acid-susceptible bacterial
species in the upper GI tract, thereby reducing their
colonization in the lower GI tract (Dibner and Buttin,
2002). This would also have the effect of enhancing
colonization of acid-tolerant bacteria in the lower GI tract,
as demonstrated in this study with the HFP blend.
Intestinal concentrations of bacterial-derived organic
acids also play an important role in the subsequent
development and establishment of intestinal and cecal
microbial populations. Negative correlations were
reported between numbers of Enterobacteriaceae and
concentrations of acetate, propionate, and butyrate in
the ceca. Nevertheless, such an effect was not observed
between enterococci and lactobacilli (van Der Wielen et al.,
2000).
Fig. 3. (A) PCR-DGGE fingerprinting profile of chicken ileal bacterial populations at 22 days of age. Lanes are marked across the top according to
administration of control (a); antibiotic (b); HLP blend (c); HFP blend (d); and reference ladder (L). Numbers following the letter correspond to chick number
(e.g. a1, b1, c1, d1). See Fig. 2A legend for gel presentation details. (B) Dendrogram depicting organic acid administration-associated effects on PCR-DGGE
banding patterns. The dendrogram was constructed using Ward’s algorithm and Diversity Database software. Major clusters are boxed.
G.M. Nava et al. / Veterinary Microbiology 137 (2009) 345–353
350
The diversity and density of ileal microbial popula-
tionswasincreasedasthebirdsagedinthepresent
study. However, OAS, particularly the HFP blend,
produced the most significant changes in microbial
communities. The qPCR analysis indicated that total
bacterial and lactobacilli populations were increased by
day 22 after OAS treatment, relative to the control and
antibiotic treatments. These results coincide with the
PCR-DGGE microbial profiling showing that interindivi-
dual variation in bacterial diversity was reduced after 29
days under HFP organic acid blend treatment (Fig. 4). It
has been proposed that one mechanism of action of
antibiotics as both promoting growth and growth
uniformity is by inducing homogenization of the ileal
microbiota (Collier et al., 2003a). The results of the
present study indicate that OAS might have a mechanism
of action similar in this respect to antibiotics. However,
the data presented here demonstrate that the bacterial
Fig. 4. (A) PCR-DGGE fingerprinting profile of chicken ileal bacterial populations at 29 days of age. Lanes are marked across the top according to
administration of control (a); antibiotic (b); HLP blend (c); HFP blend (d); and reference ladder (L). Number following the letter correspond to chicken
number (e.g. a1, b1, c1, d1). See Fig. 2A legend for gel presentation details. (B) Dendrogram depicting organic acid administration-associated effects of PCR-
DGGE banding patterns. The dendrogram was constructed using Ward’s algorithm and Diversity Database software. Major clusters are boxed.
G.M. Nava et al. / Veterinary Microbiology 137 (2009) 345–353
351
populations selected by OAS can be different than the
populations selected by antibiotics.
It is generally accepted that increased colonization by
lactobacilli across the GI tract is beneficial for animal
performance (Fuller and Brooker, 1974; Tannock, 2004;
Walter, 2008). In the present study, the HFP blend
increased both total bacterial and lactobacilli populations
in the ileum to a greater extent than the HLP blend.
Interestingly, the exposure of chickens to a litter acidified
with a blend containing formic and propionic acids but not
HMTBA, decreased counts of Lactobacillus spp. in the ileum
but increased counts of Lactobacillus spp. in ceca (Garrido
et al., 2004). In pigs, formic acid supplementation has also
reduced Lactobacillus spp. counts in the small intestine
(Øverlanda et al., 2008). The apparent selection of
lactobacilli by HFP blend is of particular interest due to
evidence that lactobacilli exhibit favorable probiotic
properties. For example, oral supplementation of chickens
with various lactobacilli strains reduced Salmonella cecal
colonization (Zhang et al., 2007) and enhanced animal
performance (Timmerman et al., 2006). Thus, the combi-
nation of HMTBA, formic, and propionic acids could be a
potential alternative for increasing lactobacilli populations
and reducing bacterial infections in the GI tract. In fact,
preliminary results have revealed that OAS of the HFP
blend reduced the horizontal transmission of Salmonella in
broiler chickens (Knight et al., 2006), and OAS of both
blends reduced detrimental effects on animal performance
and/or intestinal lesions caused by experimental infection
with C. perfringens (Dibner, 2007; Quiroz et al., 2007). The
quantification of C. perfringens was attempted in the
present study; however, levels of this bacterial group, if
present, were below the limit of detection among the
experimental groups. Further analyses are warranted to
examine the effect of these organic acid blends on the
colonization of other intestinal pathogens.
In summary, the present study demonstrates that OAS,
with the HFP blend in particular, shifts intestinal
microbiota, generates more homogenous and distinct
populations, and increases colonization of Lactobacillus
spp. in the chick ileum. These modifications of the
intestinal microbiota and the increase in lactobacilli
populations are consistent with OAS being useful as a
non-antibiotic alternative to reduce pathogenic bacteria
in the GI tract.
Acknowledgments
The experiment was financially supported by Novus
International, Inc. (St. Louis, MO). The authors thank J.
Dibner, M. Va
´zquez-An
˜o
´n, C. Schasteen and C. Knight for
valuable insights and discussions, G.F. Yi for diets, M. Trehy
for OAS preparation, C. Atwell for assistance with sample
collection, and M. Wehmeyer, C. Wuelling and T. Hampton
for animal care.
References
Amit-Romach, E., Sklan, D., Uni, Z., 2004. Microflora ecology of the chicken
intestine using 16S ribosomal DNA primers. Poult. Sci. 83, 1093–1098.
Canibe, N., Hojberg, O., Hojsgaard, S., Jensen, B.B., 2005. Feed physical
form and formic acid addition to the feed affect the gastrointestinal
ecology and growth performance of growing pigs. J. Anim. Sci. 83,
1287–1302.
Collier, C.T., Smiricky-Tjardes, M.R., Albin, D.M., Wubben, J.E., Gabert,
V.M., Deplancke, B., Bane, D., Anderson, D.B., Gaskins, H.R., 2003a.
Molecular ecological analysis of porcine ileal microbiota responses to
antimicrobial growth promoters. J. Anim. Sci. 81, 3035–3045.
Fig. 5. Total ileal bacterial populations at 15, 22, and 29 days of age. Bars in figure represent mean values
S.E. (n= 27). Treatment comparisons were made
using ANOVA and Fisher’s protected least significant difference test (data in tables) with as assigned P-value of 0.05.
Fig. 6. Total ileal lactobacilli populations at 15, 22, and 29 days of age. Bars in figure represent mean values
S.E. (n= 27). Treatment comparisons were made
using ANOVA and Fisher’s protected least significant difference test (data in tables) with an assigned P-value of 0.05.
G.M. Nava et al. / Veterinary Microbiology 137 (2009) 345–353
352
Collier, C.T., van der Klis, J.D., Deplancke, B., Anderson, D.B., Gaskins, H.R.,
2003b. Effects of tylosin on bacterial mucolysis, Clostridium perfrin-
gens colonization, and intestinal barrier function in a chick model of
necrotic enteritis. Antimicrob. Agents Chemother. 47, 3311–3317.
Dibner, J., 2007. Managing gastrointestinal health and cellulitis. In:
Annual Carolina Poultry Nutrtion Conference. pp. 70–77.
Dibner, J.J., Buttin, P., 2002. Use of organic acids as a model to study the
impact of gut microflora on nutrition and metabolism. J. Appl. Poult.
Res. 11, 453–463.
Duke, G.E., 1986. Alimentary canal: anatomy, regulation of feeding, and
motility. In: Sturkie, P.D. (Ed.), Avian Physiology. Springer-Verlag,
Heidelberg, Berlin, pp. 269–288.
Duke, G.E., Kostuch, T.E., Evanson, O.A., 1975. Electrical activity and
intraluminal pressures in the lower small intestine of turkeys. Am.
J. Dig. Dis. 20, 1040–1046.
Fuller, R., Brooker, B.E., 1974. Lactobacilli which attach to the crop
epithelium of the fowl. Am. J. Clin. Nutr. 27, 1305–1312.
Garrido, M.N., Skjervheim, M., Oppegaard, H., Sorum, H., 2004. Acidified
litter benefits the intestinal flora balance of broiler chickens. Appl.
Environ. Microbiol. 70, 5208–5213.
Gong, J., Forster, R.J., Yu, H., Chambers, J.R., Sabour, P.M., Wheatcroft, R.,
Chen, S., 2002. Diversity and phylogenetic analysis of bacteria in the
mucosa of chicken ceca and comparison with bacteria in the cecal
lumen. FEMS Microbiol. Lett. 208, 1–7.
Hernandez, F., Garcia, V., Madrid, J., Orengo, J., Catala, P., Megias, M.D.,
2006. Effect of formic acid on performance, digestibility, intestinal
histomorphology and plasma metabolite levels of broiler chickens. Br.
Poult. Sci. 47, 50–56.
Jin, L.Z., Ho, Y.W., Abdullah, N., Jalaludin, S., 1998. Acid and bile tolerance
of Lactobacillus isolated from chicken intestine. Lett. Appl. Microbiol.
27, 183–185.
Kluge, H., Broz, J., Eder, K., 2006. Effect of benzoic acid on growth
performance, nutrient digestibility, nitrogen balance, gastrointestinal
microflora and parameters of microbial metabolism in piglets. J.
Anim. Physiol. Anim. Nutr. (Berl.) 90, 316–324.
Knight, C., Hofacre, C., Mathis, G., Quiroz, M., Dibner, J., 2006. Organic acid
water treatment reduced Salmonella horizontal transmission in broi-
ler chickens. Poult. Sci. 85 (Suppl.), 132 (Abstract).
Lu, J., Idris, U., Harmon, B., Hofacre, C., Maurer, J.J., Lee, M.D., 2003.
Diversity and succession of the intestinal bacterial community of
the maturing broiler chicken. Appl. Environ. Microbiol. 69, 6816–
6824.
Muyzer, G., Brinkhoff, T., Nu
¨bel, U., Santegoeds, C., Scha
¨fer, H., Wawer, C.,
1998. Denaturant Gradient Gel Electrophoresis in Microbial Ecology,
vol. 3.4.4. Kluwer Academic Publishers, 1–27 pp.
National Research Council, 1994. Nutrient Requirements of Poultry, 9th
Rev. Ed. Natl. Acad. Press, Washington, DC.
Noy, Y., Sklan, D., 1998. Yolk utilisation in the newly hatched poult. Br.
Poult. Sci. 39, 446–451.
Ohmori, Y., Suzuki, M., Fukuta, K., 2003. Anatomical relationship between
enkephalin-containing neurones and caecum-projecting neurones in
the chicken intestinal nerve. Anat. Histol. Embryol. 32, 179–182.
Olsen, K.N., Henriksen, M., Bisgaard, M., Nielsen, O.L., Christensen, H.,
2008. Investigation of chicken intestinal bacterial communities by
16S rRNA targeted fluorescence in situ hybridization. Antonie van
Leeuwenhoek 94, 423–437.
Overland, M., Granli, T., Kjos, N.P., Fjetland, O., Steien, S.H., Stokstad, M.,
2000. Effect of dietary formates on growth performance, carcass
traits, sensory quality, intestinal microflora, and stomach alterations
in growing-finishing pigs. J. Anim. Sci. 78, 1875–1884.
Øverlanda, M., Kjosb, N.P., Borgc, M., Skjervec, E., Sørumc, H., 2008.
Organic acids in diets for entire male pigs: effect on skatole level,
microbiota in digesta, and growth performance. Livest. Sci. 115, 169–
178.
Partanen, K., 2000. Organic acids—their efficacy and modes of action in
pigs. In: Piva, A., Bach Knudsen, K.E., Lindberg, J.E. (Eds.), Gut Envir-
onment of Pigs. Nottingham University Press, Nottingham, UK, pp.
201–218.
Quiroz, M., Hofacre, C., Dibner, J., York, T., Knight, C., Gonzales, R., Parker,
D.S., 2007. Effects of ACTIVATE
TM
WD on Clostridium perfringens colo-
nization and broiler performance using a necrotic enteritis model in
broiler chickens (http://www.animalscience.com/uploads/additio-
nalFiles/WPSABalatonfured/397-398Quiroz.pdf).
Russell, J.B., Diez-Gonzalez, F., 1998. The effects of fermentation acids on
bacterial growth. Adv. Microb. Physiol. 39, 205–234.
Rutledge, R.G., Cote, C., 2003. Mathematics of quantitative kinetic PCR and
the application of standard curves. Nucleic Acids Res. 31, e93.
Simpson, J.M., McCracken, V.J., White, B.A., Gaskins, H.R., Mackie, R.I.,
1999. Application of denaturant gradient gel electrophoresis for the
analysis of the porcine gastrointestinal microbiota. J. Microbiol.
Methods 36, 167–179.
Tannock, G.W., 2004. A special fondness for lactobacilli. Appl. Environ.
Microbiol. 70, 3189–3194.
Timmerman, H.M., Veldman, A., van den Elsen, E., Rombouts, F.M., Bey-
nen, A.C., 2006. Mortality and growth performance of broilers given
drinking water supplemented with chicken-specific probiotics. Poult.
Sci. 85, 1383–1388.
van Der Wielen, P.W., Biesterveld, S., Notermans, S., Hofstra, H., Urlings,
B.A., van Knapen, F., 2000. Role of volatile fatty acids in development
of the cecal microflora in broiler chickens during growth. Appl.
Environ. Microbiol. 66, 2536–2540.
Van Immerseel, F., Russell, J.B., Flythe, M.D., Gantois, I., Timbermont, L.,
Pasmans, F., Haesebrouck, F., Ducatelle, R., 2006. The use of organic
acids to combat Salmonella in poultry: a mechanistic explanation of
the efficacy. Avian Pathol. 35, 182–188.
Verstegen, M.W., Williams, B.A., 2002. Alternatives to the use of anti-
biotics as growth promoters for monogastric animals. Anim. Biotech-
nol. 13, 113–127.
Walter, J., 2008. Ecological role of lactobacilli in the gastrointestinal tract:
implications for fundamental and biomedical research. Appl. Environ.
Microbiol. 74, 4985–4996.
Zhang, G., Ma, L., Doyle, M.P., 2007. Salmonellae reduction in poultry by
competitive exclusion bacteria Lactobacillus salivarius and Streptococ-
cus cristatus. J. Food Protect. 70, 874–878.
Zhao, J., Harrell, R.J., Hinson, B.R., Allee, G.L., Navarro, F., Knight, C.D., 2007.
Effects of a dry organic acid blend on growth performance and carcass
parameters in growing-finishing pigs. Poult. Sci. 86 (Suppl.), 439
(Abstract).
G.M. Nava et al. / Veterinary Microbiology 137 (2009) 345–353
353
... Organic acids can inhibit the microbial growth by disrupting bacterial enzymatic reactions and decreasing the transport of acidic compounds by nonionic diffusion through the membrane [89]. It has been reported that adding organic acids to feed may improve the growth, feed conversion rate, and feed utilization of broilers [90][91][92]. While drinking water is a risk factor for spreading campylobacter infection in broilers, Chaveerach et al. demonstrated that organic acid-treated drinking water can potentially prevent campylobacter infection in broiler flocks without any damage to gut epithelial cells [93]. ...
... Blends of formic and propionic acids in drinking water for chickens can generate homogeneous and distinct populations in the intestinal microbiota and increase Lactobacillus spp. colonization in the ileum [91], which can be a substitute for antibiotics used to reduce pathogenic bacteria in the gastrointestinal tract (GIT). These changes in the intestinal microbiota and increased Lactobacillus populations suggest that organic acids can substitute for antibiotics such as bacitracin to reduce pathogenic bacteria in the GIT [91]. ...
... colonization in the ileum [91], which can be a substitute for antibiotics used to reduce pathogenic bacteria in the gastrointestinal tract (GIT). These changes in the intestinal microbiota and increased Lactobacillus populations suggest that organic acids can substitute for antibiotics such as bacitracin to reduce pathogenic bacteria in the GIT [91]. Additionally, organic acids have the potential to inhibit E. coli infection [94], and a supplementation with 2% citric acid can improve the gut health [95]. ...
Article
Full-text available
Simple Summary: Chickens are raised with the assistance of the regular use of antibiotics, not only for the prevention and treatment of diseases but, also, for body growth. Overuse and misuse of antibiotics in animals are contributing to the rising threat of antibiotic resistance. Therefore, antibiotic-free broiler meat production is becoming increasingly popular worldwide to meet consumer demand. However, numerous challenges need to be overcome in producing antibiotic-free broiler meat by adopting suitable strategies regarding food safety and chicken welfare issues. This review focuses on the current scenario of antibiotic use, prospects, and challenges in sustainable antibiotic-free broiler meat production. We also discuss the needs and challenges of antibiotic alternatives and provide a future perspective on antibiotic-free broiler meat production. Abstract: Antibiotic-free broiler meat production is becoming increasingly popular worldwide due to consumer perception that it is superior to conventional broiler meat. Globally, broiler farming impacts the income generation of low-income households, helping to alleviate poverty and secure food in the countryside and in semi-municipal societies. For decades, antibiotics have been utilized in the poultry industry to prevent and treat diseases and promote growth. This practice contributes to the development of drug-resistant bacteria in livestock, including poultry, and humans through the food chain, posing a global public health threat. Additionally, consumer demand for antibiotic-free broiler meat is increasing. However, there are many challenges that need to be overcome by adopting suitable strategies to produce antibiotic-free broiler meat with regards to food safety and chicken welfare issues. Herein, we focus on the importance and current scenario of antibiotic use, prospects, and challenges in the production of sustainable antibiotic-free broiler meat, emphasizing broiler farming in the context of Bangladesh. Moreover, we also discuss the need for and challenges of antibiotic alternatives and provide a future outlook for antibiotic-free broiler meat production.
... Organic acids can inhibit the microbial growth by disrupting bacterial enzymatic reactions and decreasing the transport of acidic compounds by nonionic diffusion through the membrane [89]. It has been reported that adding organic acids to feed may improve the growth, feed conversion rate, and feed utilization of broilers [90][91][92]. While drinking water is a risk factor for spreading campylobacter infection in broilers, Chaveerach et al. demonstrated that organic acid-treated drinking water can potentially prevent campylobacter infection in broiler flocks without any damage to gut epithelial cells [93]. ...
... Blends of formic and propionic acids in drinking water for chickens can generate homogeneous and distinct populations in the intestinal microbiota and increase Lactobacillus spp. colonization in the ileum [91], which can be a substitute for antibiotics used to reduce pathogenic bacteria in the gastrointestinal tract (GIT). These changes in the intestinal microbiota and increased Lactobacillus populations suggest that organic acids can substitute for antibiotics such as bacitracin to reduce pathogenic bacteria in the GIT [91]. ...
... colonization in the ileum [91], which can be a substitute for antibiotics used to reduce pathogenic bacteria in the gastrointestinal tract (GIT). These changes in the intestinal microbiota and increased Lactobacillus populations suggest that organic acids can substitute for antibiotics such as bacitracin to reduce pathogenic bacteria in the GIT [91]. Additionally, organic acids have the potential to inhibit E. coli infection [94], and a supplementation with 2% citric acid can improve the gut health [95]. ...
Article
Full-text available
Antibiotic-free broiler meat production is becoming increasingly popular worldwide due to consumer perception that it is superior to conventional broiler meat. Globally, broiler farming impacts the income generation of low-income households, helping to alleviate poverty and secure food in the countryside and in semi-municipal societies. For decades, antibiotics have been utilized in the poultry industry to prevent and treat diseases and promote growth. This practice contributes to the development of drug-resistant bacteria in livestock, including poultry, and humans through the food chain, posing a global public health threat. Additionally, consumer demand for antibiotic-free broiler meat is increasing. However, there are many challenges that need to be overcome by adopting suitable strategies to produce antibiotic-free broiler meat with regards to food safety and chicken welfare issues. Herein, we focus on the importance and current scenario of antibiotic use, prospects, and challenges in the production of sustainable antibiotic-free broiler meat, emphasizing broiler farming in the context of Bangladesh. Moreover, we also discuss the need for and challenges of antibiotic alternatives and provide a future outlook for antibiotic-free broiler meat production.
... Organic acids can inhibit the microbial growth by disrupting bacterial enzymatic reactions and decreasing the transport of acidic compounds by nonionic diffusion through the membrane [89]. It has been reported that adding organic acids to feed may improve the growth, feed conversion rate, and feed utilization of broilers [90][91][92]. While drinking water is a risk factor for spreading campylobacter infection in broilers, Chaveerach et al. demonstrated that organic acid-treated drinking water can potentially prevent campylobacter infection in broiler flocks without any damage to gut epithelial cells [93]. ...
... Blends of formic and propionic acids in drinking water for chickens can generate homogeneous and distinct populations in the intestinal microbiota and increase Lactobacillus spp. colonization in the ileum [91], which can be a substitute for antibiotics used to reduce pathogenic bacteria in the gastrointestinal tract (GIT). These changes in the intestinal microbiota and increased Lactobacillus populations suggest that organic acids can substitute for antibiotics such as bacitracin to reduce pathogenic bacteria in the GIT [91]. ...
... colonization in the ileum [91], which can be a substitute for antibiotics used to reduce pathogenic bacteria in the gastrointestinal tract (GIT). These changes in the intestinal microbiota and increased Lactobacillus populations suggest that organic acids can substitute for antibiotics such as bacitracin to reduce pathogenic bacteria in the GIT [91]. Additionally, organic acids have the potential to inhibit E. coli infection [94], and a supplementation with 2% citric acid can improve the gut health [95]. ...
Article
Full-text available
Antibiotic-free broiler meat production is becoming increasingly popular worldwide due to consumer perception that it is superior to conventional broiler meat. Globally, broiler farming impacts the income generation of low-income households, helping to alleviate poverty and secure food in the countryside and in semi-municipal societies. For decades, antibiotics have been utilized in the poultry industry to prevent and treat diseases and promote growth. This practice contributes to the development of drug-resistant bacteria in livestock, including poultry, and humans through the food chain, posing a global public health threat. Additionally, consumer demand for antibiotic-free broiler meat is increasing. However, there are many challenges that need to be overcome by adopting suitable strategies to produce antibiotic-free broiler meat with regards to food safety and chicken welfare issues. Herein, we focus on the importance and current scenario of antibiotic use, prospects, and challenges in the production of sustainable antibiotic-free broiler meat, emphasizing broiler farming in the context of Bangladesh. Moreover, we also discuss the need for and challenges of antibiotic alternatives and provide a future outlook for antibiotic-free broiler meat production.
... Bacillus subtilis (BS) PB6 strain (BS PB6) is capable of stimulating growth of beneficial intestinal bacteria, such as Lactobacillus species and improved weight gain and feed efficiency of broilers (Teo and Tan, 2006). Lauric acid is a fatty acid with a chain length of 12 carbon atoms, which have antibacterial function similar to short chain fatty acids (Dibner and Buttin, 2002;Skrivanova et al., 2006;Nava et al., 2009). Even though the beneficial effects of both BSPB6 and lauric acid have been documented, there is a scarcity of data on the efficacy of combining lauric acids and BSPB6. ...
... The complimentary effect of organic acid and probiotic on feed conversion ratio observed in this present study might be due to high antibacterial activity of Means bearing different superscripts within a column are significantly (P<0.05) different; # AB, 0.05% antibiotics; LA, 0.05% lauric acid; BSPB6, 0.1% Bacillus subtilis PB6; LA+BSPB6, 0.05% lauric acid + 0.1% Bacillus subtilis PB6 organic acids reducing the enteropathogens, and supporting the proliferation of probiotic organisms and other beneficial acid-tolerant bacteria in the gut (Nava et al., 2009). The probiotics produce short chain acids like lactic, acetic and other organic acids, which are responsible for a reduction in the intestinal pH (Varalakshmi et al., 2013) that facilitates the growth of beneficial microbiota in the gut. ...
Article
Full-text available
The objective of the present study was to determine the synergistic effect of lauric acid and probiotic on the performance of broiler chicken. A total of 250-day-old male broiler chicks were randomly distributed into five dietary treatment groups each having ten replicates with five chicks in each and were raised for a period of 42 days. Diets contained T 1-control diet, T 2-0.05% antibiotic (AB), T 3-0.05% lauric acid (LA), T 4-0.1% probiotic in the form of Bacillus subtilis PB6 (BS), and T 5-0.05% organic acid +0.1% probiotic. The results revealed significantly (P<0.05) higher body weight gain, feed consumption and better feed conversion in LA+BS combination group followed by LA and BS alone compared to antibiotic (AB) and control diet at 42 d. The percent breast yield and thymus weights were increased (P<0.05) in LA and BS as compared to control diets. Humoral immune response (NDV titers) was higher (P<0.05) in LA+BS group followed by BS compared to control and AB. Further, no significant ((P>0.05) effect was observed on cutaneous basophilic hypersensitivity response among different treatments. Therefore, it can be concluded that supplementation of lauric acid (0.05%) + probiotic (0.1%) combination could be safely included as an alternative to antibiotic growth promoter in broilers.
... The OA and their blends inhibit the growth of potential gut pathogens like Escherichia coli, Salmonella spp., and Campylobacter spp. (Engberg et al. 2000;Ricke, 2003;Dibner and Richards 2005;Garcia et al. 2007) and favour the growth of Lactobacillus (Nava et al. 2009) resulting in improved performance. A synergistic effect of EO and OA is expected when they are used together in a feeding regime owing to the overlapping effects they elicit when added individually (Cerisuelo et al. 2014;Thibodeau et al. 2014). ...
... A similar effect is expected with OA (Nava et al. 2009) although a positive effect on small intestinal microbiology may not always translate to enhanced performance owing possibly to the absence of real enteric challenges. Performance of the birds in this study indicated that the diets were adequate in nutrients and there was no dietary "stress' per se that could compromise the defence mechanisms of the birds. ...
Article
Full-text available
The objective of the present study was to investigate the effects of supplementation of a combination of a microencapsulated essential oil-organic acid (EO-OA) blend in diets of broiler chickens in absence or presence of an exogenous protease on performance and serum biomarker concentrations indicating small intestinal mucosal integrity. In a 42-days feeding trial, 800 male Cobb broiler chickens were divided into 8 treatments (10 replicates/treatment, n = 10 per replicate). The dietary treatments, formulated by supplementing the EO-OA and the protease enzyme to the basal diet, were, therefore, control(C), EO-OA 150 mg/kg diet (T1), EO-OA 300 mg/kg diet (T2), EO-OA 300 mg/kg diet up to 28 d followed by 3000 mg/kg diet till harvest (T3), C + protease 125 mg/kg diet (T4), T1 + protease 125 mg/kg diet (T5), T2 + protease 125 mg/kg diet(T6), T3 + protease 125 mg/kg diet (T7). The objective of adding the EO-OA at 3000 mg/kg diet in the T3 and T7 groups during the finishing stage was to ascertain if at a plethoric level of supplementation, the EO-OA could provide additional benefits when broiler chickens are exposed to several environmental and physiological stressor stimuli. EO-OA and protease had insignificant effect on body weight and feed conversion ratio. Protease alone increased carcass fat accretion during 14 - 42 d (P = 0.05). Serum D-lactate decreased when EO-OA in diet increased (P = 0.017) at 14 d. Irrespective of the dietary EO-OA level, serum D-lactate at 42 d decreased in the birds fed with the protease supplemented diets (main effect protease P = 0.025). Clostridium perfringens in caecal digesta at 42 d decreased due to protease supplementation (P = 0.049). Numbers of both Escherichia coli and Campylobacter jejuni in cecal digesta decreased by dietary EO-OA (P = 0.0001). Protease supplementation tended to decreased numbers of E. coli (P = 0.053) while significantly decreasing that of C. jejuni (P = 0.043). In this study EO-OA, with or without the protease, showed several beneficial effects which included reduction of potential pathogens in caeca, and a better nutrient accretion. The findings also revealed the possibility of modulating the intestinal microbiota through application of exogenous protease. The EO-OA and protease combinations may, therefore, be explored as an effective tool for growth promotion of broiler chickens in the post-antibiotic era.
... Improved FPD scores in birds receiving organic acids have also been reported by other authors [51][52][53]. Previous research has confirmed that organic acids had a beneficial influence on gut health in poultry [12,13,54,55], but the effect of BA on FPD scores has not been investigated to date. ...
Article
Full-text available
The aim of this study was to compare the efficacy of butyric acid glycerides (BAG), sodium butyrate (SB) and coated sodium butyrate (CSB) in turkey nutrition based on the growth performance of birds, carcass yield, meat quality, the dry matter (DM) content of faeces, the incidence of footpad dermatitis (FPD), and economic efficiency. A 105-day experiment was conducted on 400 BIG 6 female turkeys (4 treatments, 5 replications, 20 birds per replication). The addition of CSB and BAG to turkey diets improved the feed conversion ratio (FCR, p ≤ 0.05) and increased the values of the European Efficiency Index (EEI, p ≤ 0.01). The analysed forms of BA in turkey diets increased the concentration of DM in faeces (p ≤ 0.01) and decreased FPD incidence (p ≤ 0.01), which may suggest that all forms of butyrate improved litter quality and inhibit the risk for diarrhoea. The results of this study indicate that all forms of butyric acid can be valuable feed additives in turkey nutrition.
... Organic acids can alter the composition of the ileal and cecal microbiota when added in either feed or drinking water [49]. The level of Lactobacilli was increased significantly following administration of a combination of formic and propionic acids adherent to a silica-based carrier. ...
Article
Since introduction in the late 1940s, the role of antibiotics in animal production has changed. Originally a means of combating illnesses and maintaining the health of flocks and herds, it was soon recognized that antibiotics could drastically increase productivity and financial return through enhanced and expedited weight gain. Since then criticism has been leveled at the use of antibiotics at sub - therapeutic levels to promote growth and feed conversion efficiency. Although the recent demonstration that plasmid genes encoding for resistance are present in the environ ment and feces of swine and in carcasses there has been little evidence other than point - of - sale surveys that livestock are contributing to emerging drug resistance among bacterial pathogens affecting humans. Irrespective of the lack of firm scientific evi dence that the use of antibiotics in intensive livestock production is directly contributing to drug resistance in hospital and community settings there is a wide perception among consumers that lax regulation over sub - therapeutic administration to food an imals is deleterious to public health. Accordingly use of antibiotics for performance enhancement was banned in the EU in 2006 and in the US effective January 2017. Administration of antibiotics for therapy or prophylaxis is now strictly regulated in the E U and the U.S and subject to veterinary prescription applying Prudent Use Principles. Multiple stakeholders must be considered as food production responds to new legislation and rules to limit antibiotic use by farmers, producers, consumers, the medical pr ofession and veterinarians. This paper identifies possible replacement modalities that are acceptable to consumers and the food industry without detrimental effects on animal health and performance. The five criteria producers should consider before adopti ng alternatives to antibiotics are reviewed. Alternatives include but are not limited to probiotics, prebiotics, short and medium chain fatty ac ids, enzyme feed supplements, essential oils and botanicals. The paper stresses that no single additive will rep lace the declining benefits of sub - therapeutic administration of antibiotics. It will be necessary in the future to create programs with a holistic approach to replacement of antibiotics in conformity with EU and U.S. restrictions. Accordingly greater atte ntion should be applied to management, control of immunosuppressive viruses and protozoal parasites, nutrition and the selection of suitable genetic strains to achieve sustainable and safe production of livestock.
... It is widely accepted that AGP boost animal growth mainly through reducing pathogenic bacteria and modulating gastrointestinal microbiota (Diarra and Malouin, 2014;Gadde et al., 2017). Similarly, antibacterial properties of OA against poultry pathogens have also been found using conventional molecular ecology techniques such as the cultures and denaturing gradient gel electrophoresis fingerprints in previous studies (Nava et al., 2009;Liu et al., 2017;Palamidi and Mountzouris, 2018). Nevertheless, they showed some inconsistent effects on the abundance of some designated intestinal bacteria (e.g., Lactobacillus) (Liu et al., 2017;Li et al., 2018;Palamidi and Mountzouris, 2018;Hu et al., 2019), which might be caused by the differences in the sensitivities and specificities of detection techniques besides the composition and concentrations of OA used. ...
Article
Full-text available
The present study aimed to investigate the effects of organic acids (OA) as alternatives for antibiotic growth promoters (AGP) on growth performance, intestinal structure, as well as intestinal microbial composition and short-chain fatty acids (SCFAs) profiles in broilers. A total of 336 newly hatched male Arbor Acres broiler chicks were randomly allocated into 3 dietary treatments including the basal diet [negative control (NC)], the basal diet supplemented with 5 mg/kg flavomycin, and the basal diet supplemented with OA feed additives. Each treatment had eight replicates with 14 birds each. The results showed that AGP and OA promoted growth during day 22–42 compared with the NC group ( P < 0.05). OA significantly increased the jejunal goblet cell density and ileal villus height on day 42 compared with the NC group ( P < 0.05). Meanwhile, OA up-regulated the mRNA expression of jejunal barrier genes (Claudin-3 and ZO-1) relative to the NC group ( P < 0.05). Significant changes of microbiota induced by the OA were also found on day 42 ( P < 0.05). Several SCFAs-producing bacteria like Ruminococcaceae, Christensenellaceae, and Peptococcaceae affiliated to the order Clostridiales were identified as biomarkers of the OA group. Higher concentrations of SCFAs including formic acid and butyric acid were observed in the cecum of OA group ( P < 0.05). Simultaneously, the abundance of family Ruminococcaceae showed highly positive correlations with the body weight and mRNA level of ZO-1 on day 42 ( P < 0.05). However, AGP supplementation had the higher mRNA expression of Claudin-2, lower goblet cell density of jejunum, and decreased Firmicutes to Bacteroidetes ratio, suggesting that AGP might have a negative impact on intestinal immune and microbiota homeostasis. In conclusion, the OA improved growth performance, intestinal morphology and barrier function in broilers, which might be attributed to the changes of intestinal microbiota, particularly the enrichment of SCFAs-producing bacteria, providing a more homeostatic and healthy intestinal microecology.
... Organic acids alter the gut microflora by directly killing through cell-wall penetration and reducing the numbers of pathogenic bacteria, thus increasing acid tolerant beneficial species such as Lactobacilllus spp. and reducing competition for nutrients by the altered microbes (Nava et al.,2009;Czerwinski et al., 2010;Boroojeni et al.,2014). Efficacy can be enhanced using them as blends rather than a single acid (Gadde et. ...
Article
Full-text available
Use of antibiotics as growth promoter is still prevalent in poultry and livestock feeding, where we would and have been facing challenges of Antimicrobial resistance. Eubiotics, referring to an optimal balance of microflora in GI tract, will certainly be alternatives for Antibiotics as growth promoters.
Chapter
Preventive measures and health programmes should help significantly to keep animals healthy. If animal welfare principles and good animal husbandry practices are also followed, minimal or no use of antimicrobials can be, with high probability, achieved. Setting priorities in biosecurity, which fits exact conditions of farm/husbandry is vital. Thorough mechanic cleaning, rational use of disinfection, disinsection and deratisation, proper ventilation and keeping the proper temperature and humidity contribute to keep good environment both in old stables and hi-tech husbandries. Health programmes, including vaccination tailored for local conditions, animal species and technologies used in the respective husbandry should be defined by educated veterinarians, specialised not only on treatment, but also on preventive medicine, use of alternatives to antimicrobials and management. Close cooperation of vets, farmers and people taking immediate care of animals and facilities is the basic prerequisite of the effectivity of such system. Therefore, tools for motivation and socio-economical aspects also belong among the key elements for effective preventive measures, which finally can help to minimise or skip the use of antimicrobials and help to combat antimicrobial resistance.
Article
Full-text available
Both clinical and sub-clinical necrotic enteritis (NE) is common throughout the poultry growing areas of the world and it is estimated that the cost to the poultry industry globally is nearly $2 billion (Anonymous, 2000). In terms of loss of performance the sub-clinical form of the disease may be the most important as it has been shown to reduce FCR in broilers (Stutz and Lawton, 1984). It has been suggested that treatment of feed or water with blends of organic acids may help to reduce the incidence of NE in broiler flocks. In this experiment ACTIVATE™ WD, a blend of organic acids added to the water supply, was compared to use of bacitracin methylene disalicylate (BMD) in a NE broiler model. The results showed that treatment of the water with the organic acid blend had a positive effect on broiler performance when challenged with Clostridium perfringens.
Article
Full-text available
Approvals for the use of nontherapeutic antibiotics in animal feed are fast disappearing worldwide. The primary effect of antibiotics is antimicrobial; all of the digestibility and performance effects can by explained by their impact on the gastrointestinal microflora. Among the candidate replacements for antibiotics are organic acids, both individual acids and blends of several acids. Like antibiotics, short-chain organic acids also have a specific antimicrobial activity. Unlike antibiotics, the antimicrobial activity of organic acids is pH dependent. Organic acids have a clear and significant benefit in weanling piglets and have been observed to benefit poultry performance. Organic acids have antimicrobial activity; however, there appear to be effects of organic acids beyond those attributed to antimicrobial activity. Reductions in bacteria are associated with feeding organic acids, which are particularly effective against acid-intolerant species such as E. coli, Salmonella and Campylobacter. Both antibiotics and organic acids improve protein and energy digestibilities by reducing microbial competition with the host for nutrients and endogenous nitrogen losses, by lowering the incidence of subclinical infections and secretion of immune mediators, and by reducing production of ammonia and other growth-depressing microbial metabolites. Organic acids have several additional effects that go beyond those of antibiotics. These include reduction in digesta pH, increased pancreatic secretion, and trophic effects on the gastrointestinal mucosa. Much more is known about these effects in swine than in poultry. There appears to be more variability in detecting an organic acid benefit in comparison to that observed with antibiotics. Lack of consistency in demonstrating an organic acid benefit is related to uncontrolled variables such as buffering capacity of dietary ingredients, presence of other antimicrobial compounds, cleanliness of the production environment, and heterogeneity of gut microbiota. Additional research can clarify the role of these factors and how to minimize their impact.
Article
Alkaline earth metal Sr, Mg and transition metal Fe-doped lanthanum gallate based ABO3-type oxide La0.8Sr0.2 Ga0.75Mg0.20Fe0.05O0.8 (LSGMF202005) were prepared by solid state reaction. The Forming process of complex oxide LS-GMF202005 was analyzed via TG/DTA. The conductivity of I.SGMF202005 sample has been measured by DC four-probe technique in 400-850°C. The composition, crystal structure and microstructure of LSGMF202005 sample were investigated by using EDS, XRD and SEM The experimental results show that the formation of perovskite phase begins at about 1100 °C, and peaks of second phases have not been observed in XRD pattern and single phase material of the orthorhombic perovskite-type structure are obtained after sintering in air at 1400°C. Electrical measurement results indicate that LS-GMF202005 is oxygen ion conductor according to the fact that temperature dependence of the conductivity conforms to the Arrhenius equation in 400-850°C, and activation energy Ea = 0.5743 eV(<1 eV). Complex oxide LSGMF202005 doped with Sr, Mg and Fe exhibits higher ionic conductivity than LSGM doped with Sr and Mg under same temperature. Doping with small amount of transition metal Fe is effective for improving the oxide ion conductivity.
Article
As do other avian systems, the digestive system shows adaptations for flight (Farner, 1960). In the mouth area, the teeth and heavy jaw bones and muscles of reptiles and mammals have been replaced by a much lighter beak, jaw bones, and jaw muscles in birds. Since birds do not chew food, the esophagus is large in diameter to accommodate larger food items. The heavy muscular gizzard, or muscular stomach (for mechanical digestion), and the proventriculus, or glandular stomach (Figure 11–1), are located within the main mass of the bird’s body. Less modification is evident in the avian small intestine and rectum; however, a cloaca is present as in reptiles.
Article
The effect of different organic acids in diets of entire male pigs on the concentration of skatole in colon, plasma, and adipose tissue and on the composition of the microbiota in the gastrointestinal tract was evaluated. Entire male pigs (n=60) of sows inseminated with boars disposition for high skatole levels (31.7 and 113.2 kg initial and final body weight, respectively) were fed either control, 1.0% formic acid, 0.85 % benzoic acid, 0.85% sorbic acid, 1.2% fat coated Ca-butyrate, or 1.5% fat and inulin coated Ca-butyrate diets. All levels of organic acids corresponded to 0.85% of pure acid. Digesta samples from colon descendens were analyzed for skatole, indole, and organic acids. Digesta samples for microbiological examinations were taken from proximal jejunum, colon descendens, and rectum. There were no differences in levels of skatole, indole, or organic acid levels in colon descendens among pigs fed organic acid supplemented diets and control diet. Plasma skatole levels were significantly reduced in pigs fed diets containing formic acid or benzoic acid compared with the control, but supplementing diets with organic acids did not affect skatole levels in adipose tissue. Pigs fed organic acids had significantly lower levels of coliforms, enterococci, and lactic acid producing bacteria (LAB) in all sampling sites of the gastro-intestinal tract. Pigs fed 1.5% fat and inulin coated Ca-butyrate had less reduction in the number of coliforms and LAB in the small intestine compared with pigs fed formic, benzoic and sorbic acid. Formic acid had a stronger antibacterial effect on coliforms than benzoic or sorbic acids in the small intestine. Pigs fed diets containing formic acid, benzoic acid, or sorbic acid had significantly higher average daily gain and better feed conversion ratio (FCR) than the control pigs during the grower phase, and tended to improve FCR during the overall period. The inclusion of fat coated Ca-butyrate or fat and inulin coated Ca-butyrate had no effect on growth performance of the pigs. In conclusion, supplementing diets with different organic acids reduced number of coliforms, enterococci, and LAB in the gastrointestinal tract, but did not affect skatole levels in colon or adipose tissue of entire male pigs.
Article
The purpose of the present study was to determine whether an organic acid water treatment could reduce the spread of Salmonella (SAL) to naïve birds when infected birds were part of the population. A total of one thousand eighty (1080), day-old Cobb X Cobb male chicks were allocated 60/pen to each of 18 pens by blocks and divided into three treatment groups: T1, unmedicated control; T2 , 0.04%; and T3, 0.08% of an organic acid blend (OAB; ACTIVATE® WD). The OAB was added to water from 0-14 days and 42-49 days. Half of the birds in each pen were orally dosed with Naladixic acid resistant-S. heidelberg on Day 0 (tagged) and housed with the remaining uninfected birds (not tagged). Salmonella status of ceca and crops (Day 49 only) was evaluated by random selection of 5 tagged and 5 untagged birds/pen on days 0, 14 and 49. Dragswabs of pens were also obtained on the same days as was mortality, weight gain, feed consumption and feed conversion. On day 49, 22% of T1 untagged birds were SAL+ compared to only 7% of T2 and T3 untagged birds. Similar results were obtained with untagged birds for % SAL+ dragswabs and crops on Day 49. There was no effect of OAB on % SAL+ for tagged birds. Feed conversion was significantly improved by OAB at 42 days of age (1.80 vs 1.77 and 1.77) and at 49 days similar trends were apparent (1.95 vs 1.90 and 1.91) but not different. These results demonstrated that the OAB treatment significantly reduced horizontal spread of SAL to uninfected birds and reduced environmental SAL contamination.