Confirming the RNAi-mediated mechanism of action of siRNA-based cancer therapeutics in mice

Article (PDF Available)inThe Journal of clinical investigation 119(3):661-73 · March 2009with39 Reads
DOI: 10.1172/JCI37515 · Source: PubMed
Abstract
siRNAs that specifically silence the expression of cancer-related genes offer a therapeutic approach in oncology. However, it remains critical to determine the true mechanism of their therapeutic effects. Here, we describe the preclinical development of chemically modified siRNA targeting the essential cell-cycle proteins polo-like kinase 1 (PLK1) and kinesin spindle protein (KSP) in mice. siRNA formulated in stable nucleic acid lipid particles (SNALP) displayed potent antitumor efficacy in both hepatic and subcutaneous tumor models. This was correlated with target gene silencing following a single intravenous administration that was sufficient to cause extensive mitotic disruption and tumor cell apoptosis. Our siRNA formulations induced no measurable immune response, minimizing the potential for nonspecific effects. Additionally, RNAi-specific mRNA cleavage products were found in tumor cells, and their presence correlated with the duration of target mRNA silencing. Histological biomarkers confirmed that RNAi-mediated gene silencing effectively inhibited the target's biological activity. This report supports an RNAi-mediated mechanism of action for siRNA antitumor effects, suggesting a new methodology for targeting other key genes in cancer development with siRNA-based therapeutics.

Figures

Figure
Figure
Figure
Figure

Full-text (PDF)

Available from: Marjorie Robbins, Dec 02, 2014
Technical advance
The Journal of Clinical Investigation      http://www.jci.org      Volume 119      Number 3      March 2009  661
Confirming the RNAi-mediated
mechanism of action of siRNA-based
cancer therapeutics in mice
Adam D. Judge, Marjorie Robbins, Iran Tavakoli, Jasna Levi, Lina Hu,
Anna Fronda, Ellen Ambegia, Kevin McClintock, and Ian MacLachlan
Tekmira Pharmaceuticals Corp., Burnaby, British Columbia, Canada.
siRNAs that specifically silence the expression of cancer-related genes offer a therapeutic approach in oncol-
ogy. However, it remains critical to determine the true mechanism of their therapeutic effects. Here, we describe
the preclinical development of chemically modified siRNA targeting the essential cell-cycle proteins polo-like
kinase 1 (PLK1) and kinesin spindle protein (KSP) in mice. siRNA formulated in stable nucleic acid lipid par-
ticles (SNALP) displayed potent antitumor efficacy in both hepatic and subcutaneous tumor models. This
was correlated with target gene silencing following a single intravenous administration that was sufficient to
cause extensive mitotic disruption and tumor cell apoptosis. Our siRNA formulations induced no measurable
immune response, minimizing the potential for nonspecific effects. Additionally, RNAi-specific mRNA cleavage
products were found in tumor cells, and their presence correlated with the duration of target mRNA silencing.
Histological biomarkers confirmed that RNAi-mediated gene silencing effectively inhibited the target’s biologi-
cal activity. This report supports an RNAi-mediated mechanism of action for siRNA antitumor effects, suggest-
ing a new methodology for targeting other key genes in cancer development with siRNA-based therapeutics.
Introduction
siRNAs  are  target-specific  double-stranded  RNA  molecules 
designed to suppress gene expression through the endogenous cel-
lular process of RNAi (1). Since the characterization of this funda-
mental gene-silencing mechanism, tremendous progress has been 
made in developing siRNA as a potentially novel class of therapeu-
tic agent for a broad spectrum of diseases including cancer, viral 
infection, and metabolic disorders.
Many siRNA targets in oncology have been described in the lit-
erature, although direct evidence that their therapeutic effects in 
tumor models are mediated by RNAi is notably lacking. The inter-
pretation of antitumor activity attributable to siRNAs is problem-
atic due to the potential for off-target effects of the nucleic acids, 
including their propensity to activate immune responses through 
TLR-dependent (2–4) and TLR-independent mechanisms (5, 6). 
These types of response are known to elicit antitumor effects, pri-
marily through the actions of IFNs and inflammatory cytokines 
that exert  antiangiogenic, proapoptotic, and adjuvant effects 
that enhance cellular immunity (7, 8). Many of these mechanisms 
remain active in the immunodeficient mouse  strains typically 
used as hosts for human tumor xenografts, including SCID/beige 
mice, which lack functional lymphocyte and NK cell populations 
(9, 10). Induction of the innate immune response by nucleic acids 
can also have significant toxicologic consequences (reviewed in 
ref. 11). Clinical experience with certain recombinant cytokines 
and  TLR agonists (12, 13) including  liposomal plasmid  DNA 
(I. MacLachlan,  unpublished  observations)  has  shown  that 
human subjects can be exquisitely sensitive to the toxic effects of 
these agents when compared with preclinical models. Therefore 
additional caution is required if considering an immune stimula-
tory siRNA for clinical development (14, 15).
The incorporation of  modified  nucleotide  chemistries into 
siRNA has been widely utilized to improve their pharmacologic 
and nuclease-resistant properties (16). We first reported that exten-
sive chemical modification to siRNA molecules could provide the 
additional benefit of preventing their recognition by the mamma-
lian immune system (17). This has led to the rational design of 
2-O-methyl–modified (2OMe-modified) siRNA constructs that 
have inherently low immunostimulatory potential in vivo (18).
To establish proof that systemically administered siRNAs can 
elicit RNAi-mediated anticancer efficacy in the absence of mea-
surable immune activation, we selected the essential cell-cycle pro-
teins kinesin spindle protein (KSP, also referred to as Eg5) (19) 
and polo-like kinase 1 (PLK1) (20) as validated cancer targets with 
well-characterized mechanisms of direct tumor cell killing. KSP 
is a mitotic spindle motor protein that drives chromosome seg-
regation during mitosis. Inhibition of KSP blocks the formation 
of bipolar mitotic spindles, causing cell-cycle arrest, activation of 
the mitotic checkpoint, and induction of apoptosis (21). In mam-
malian cells, PLK1 acts to phosphorylate a number of cell-cycle 
proteins including  Cdc25C,  cyclin B, cohesin  subunit SCC-1, 
subunits of the anaphase promoting complex, mammalian kine-
sin-like protein 1, and other kinesin related proteins. This diverse 
array of substrates reflects the multiple roles of PLK1 in mitosis 
and cytokinesis (22). Overexpression of PLK1, observed in many 
human tumor types, is a negative prognosticator of patient out-
come (reviewed in ref. 20), while inhibition of PLK1 activity rapidly 
induces mitotic arrest and tumor cell apoptosis (23, 24). Depletion 
Conflict of interest: All authors are employees of Tekmira Pharmaceuticals Corp.
Nonstandard abbreviations used:AS, antisense; bDNA, branched DNA; hGAPDH, 
human GAPDH; hPLK1, human PLK1; IFIT1, IFN-induced protein with tetratri-
copeptide repeats 1; KSP, kinesin spindle protein; 2OMe, 2-O-methyl; 2OMe-G, 
2OMe-guanosine; 2OMe-U, 2OMe-uridine; PEG, poly(ethylene)glycol; PEG-cDMA, 
3-N-(-methoxy poly(ethylene glycol)2000)carbamoyl-1,2-dimyristyloxy-propylamine; 
PEG-cDSA, 3-N-(-methoxy poly(ethylene glycol)2000)carbamoyl-1,2-distearyloxy-
propylamine; PLK1, polo-like kinase 1; RACE, rapid amplification of cDNA ends; 
RISC, RNA-induced silencing complex; RLM, RNA ligase mediated; RLU, relative light 
unit[s]; SNALP, stable nucleic acid lipid particle(s).
Citation for this article:J. Clin. Invest.119:661–673 (2009). doi:10.1172/JCI37515.
Related Commentary, page 438
technical advance
662 The Journal of Clinical Investigation      http://www.jci.org      Volume 119      Number 3      March 2009
of PLK1 may also sensitize cancer cells to the proapoptotic activity 
of small-molecule drugs (25), likely due to the role of PLK1 in the 
DNA damage and spindle assembly checkpoints.
One of the primary barriers to realizing the potential of siRNA 
therapeutics is the requirement for drug-delivery vehicles to facilitate 
disease site targeting, cellular uptake, and cytoplasmic delivery of the 
siRNA (26–28). Common approaches to delivery include complex-
ing the siRNA with polycations such as polyethyleneimine (29, 30) 
and cyclodextrin polymers (31) as well as incorporation into cationic 
lipid–based carriers (17, 18, 26, 32). We have previously described the 
development of stable nucleic acid lipid particles (SNALP) as an effec-
tive systemic delivery vehicle for targeting siRNAs to the murine and 
nonhuman primate liver and have demonstrated therapeutic effects 
in silencing endogenous hepatocyte (18, 26) and viral gene transcripts 
(17). The accumulation of SNALP within tissues of clinical interest 
takes advantage of passive disease-site targeting (33, 34), whereby 
charge-neutral carriers of suitable size (around 100-nm diameter or 
smaller) can pass through the fenestrated epithelium of tumors, sites 
of inflammation, and the healthy liver. This avoids the requirement 
for active targeting moieties such as peptides, antibodies, and recep-
tor ligands that may otherwise be candidates for incorporation into 
siRNA-delivery vehicles to enhance target-cell selectivity (31, 35, 36).
In this report, we describe the preclinical development of SNALP-
formulated siRNAs as cancer therapeutics. Results demonstrate that 
rationally designed siRNAs targeting PLK1 or KSP, when delivered 
with an effective systemic delivery vehicle, are able to affect therapeu-
tic gene silencing in solid tumors. The specificity and mechanism of 
action is confirmed using a combination of methodologies that dem-
onstrate RNAi-mediated silencing of target mRNA causing mitotic 
disruption in tumor cells typical of target inhibition. This can be 
achieved in the complete absence of immune stimulation through 
the use of appropriately designed, chemically modified siRNAs.
Results
In vitro characterization of PLK1 siRNA activity.  PLK1  represents  a 
validated gene target in oncology whose inhibition is known to 
cause mitotic arrest and apoptosis in proliferating tumor-cell cul-
tures (20). We designed and screened a panel of PLK1 siRNA for 
antiproliferative activity in the human HT29 colon cancer cell line 
(Supplemental Figure 1; supplemental material available online 
with this article; doi:10.1172/JCI37515DS1). This screen identi-
fied PLK1424 as the most potent human siRNA and PLK773 as the 
most potent mouse, rat, and human cross-reactive siRNA based 
on PLK1 sequence homology. These lead siRNAs were formulated 
into a SNALP composition that has been shown to effectively tar-
get siRNA to the livers of rodents and nonhuman primates (26). 
Treatment of HT29 cells with formulated PLK1424 and PLK773 
siRNAs caused a dose-dependent decrease in cell viability that cor-
related with the degree of PLK1 mRNA silencing (Figure 1, A–C). 
PLK1424 siRNA displayed potent activity in a range  of human 
cancer cell lines, including LS174T colon carcinoma and HepG2 
and He3B hepatocellular carcinoma cell lines (Figure 1D), that 
was associated with the dose-dependent induction of apoptosis 
48 hours after siRNA transfection (Figure 1E).
Design of PLK1 and KSP siRNA for in vivoapplications. Prior to the in 
vivo assessment of synthetic siRNA, it is essential to anticipate the 
potential effects of immune stimulation on the biological system 
under consideration and take steps to mitigate this risk (11). We have 
previously reported that the selective introduction of 2OMe-guano-
sine (2OMe-G) or 2OMe-uridine (2OMe-U) residues into siRNA 
abrogates its capacity to activate an immune response (18, 37). This 
original strategy proposed restricting 2OMe modifications to the 
siRNA sense strand in order to minimize the potential of negatively 
impacting RNAi activity (18). While this approach remains broadly 
applicable for synthetic siRNA (37), we have found through exten-
sions to our original studies that certain siRNA sequences incorpo-
rating a 2OMe-modified sense strand, for example, the U(S)-ApoB1 
duplex (18), may retain low-grade immunostimulatory activity. This 
was only evidenced by the upregulation of IFN-induced protein with 
tetratricopeptide repeats 1 (IFIT1) mRNA in the liver and spleen fol-
lowing i.v. administration of SNALP-formulated U(S)-ApoB1 siRNA 
in mice, despite there being no measurable serum cytokine response 
(Supplemental Figure 2). This residual IFIT1 induction, however, 
could be fully abrogated by the selective introduction of 2OMe 
nucleotides to the antisense (AS) strand of the duplex (Supplemen-
tal Figure 2). These findings provided the rationale for our design 
and testing of 2OMe siRNA against oncology targets.
A similar approach to siRNA design was applied to PLK1424 and 
PLK773 to generate duplexes that possessed no measurable immune 
stimulatory effects yet retained full RNAi activity. We regarded this 
step as a prerequisite to conducting in vivo studies in order to con-
clude the  specificity of antitumor effects that  may be  observed. 
2OMe-U or 2OMe-G nucleotides were substituted into the native 
sense and AS oligonucleotides to form a panel of modified PLK1424 
and PLK773 duplexes (Table 1) that were then screened for the pres-
ervation of RNAi activity. 2OMe-PLK1424 duplexes containing the 
modified AS strand A or B displayed antiproliferative activity similar 
to that of the native PLK1424 sequence when paired with either of 
the modified sense strands, 1 or 2. In contrast, duplexes containing 
AS strand C lost significant activity, suggesting that this 2OMe-
modification pattern was poorly tolerated by the RNAi machinery 
(Figure 2A). The panel of 2OMe-PLK773 duplexes displayed modest 
differences in activity compared with the native PLK773 sequence 
(Figure 2B).  We selected PLK1424-2/A  and PLK773-1/B siRNA 
duplexes (comprising the designated 2OMe-modified sense/AS 
strands) for evaluation in an in vitro immune-stimulation model. 
As expected, native PLK1424 and PLK773 siRNAs and their con-
stituent single-stranded RNAs (ssRNAs) stimulated murine Flt3-
ligand–derived dendritic cells to produce high levels of both IFN-α
and IL-6 (Figure 2C), whereas this immune reactivity was completely 
abrogated in the PLK1424-2/A and PLK773-1/B duplexes.
To demonstrate the utility of this approach to siRNA design, we 
applied the same methodology to a published siRNA targeting KSP 
(38). The selected KSP siRNA (termed KSP2263 from its original 
description) has full sequence homology to mouse and human KSP 
mRNA and showed potent antiproliferative effects in both human 
and mouse cancer cell lines. As an example, treatment of mouse 
Neuro2a cells with SNALP-formulated KSP2263 induced dose-
dependent reductions in KSP mRNA 24 hours after transfection, 
correlating with a subsequent loss of cell viability at 72 hours (Fig-
ure 2D). A small panel of modified KSP2263 duplexes containing 
2OMe-U or 2OMe-G nucleotides (Table 1) was then screened in 
this assay. In this case, each combination of the 2 modified sense 
and AS  strands generated a duplex with  potency equivalent  to 
that of the native KSP2263 sequence, confirming preservation of 
RNAi activity (Figure 2E). We selected the 2OMe-modified variant 
KSP2263-U/U for further characterization.
Confirmation of the RNAi mechanism by 5 RACE-PCR. The detec-
tion of specific RNA cleavage products generated by RNA-induced 
silencing complex–mediated (RISC-mediated) hydrolysis of target 
technical advance
The Journal of Clinical Investigation      http://www.jci.org      Volume 119      Number 3      March 2009  663
mRNA is the definitive marker confirming RNAi as the mechanism 
of gene silencing (39, 40). Activated RISC cleaves target mRNA pre-
cisely between the nucleotides complementary to positions 10 and 
11 of the siRNA AS strand, generating an mRNA cleavage product 
that is unique to the siRNA sequence. This can be detected in cells 
using an appropriately designed 5 rapid amplification of cDNA 
ends–PCR method (RACE-PCR). We developed RACE-PCR assays 
to detect the PLK1424-specific cleavage product of human PLK1 
(hPLK1) mRNA and the KSP2263-specific cleavage  product of 
mouse KSP mRNA. Treatment of HT29 cells with PLK1424-2/A 
generated the predicted 476-bp 5 RACE-PCR product, and oli-
gonucleotide sequencing across the 5 ligation site confirmed its 
identity as the hPLK1 mRNA product cleaved at 5 position 1433 
(relative to ATG start site). Similarly, a predicted 102-bp RACE-
PCR product was  amplified  from  Neuro2a  cells treated with 
KSP2263-U/U siRNA that corresponded to mouse KSP  mRNA 
cleaved at position 2129. (Supplemental Figure 3).
Characterization of the immune response to 2OMe PLK1 and KSP
siRNA in vivo. To confirm the  abrogation of immune  stimula-
tion by 2OMe siRNA in vivo, BALB/c mice were treated i.v. with 
Figure 1
Activity of PLK1 siRNAs in vitro. Correlation between mRNA silencing and HT29 cell viability for (A) PLK1424 (P1424), (B) PLK773 (P773), and (C)
LUC siRNA treatments. PLK1 mRNA was determined by bDNA analysis at 24 hours. Duplicate plates were assessed for cell viability at 72 hours.
(D) PLK1424 siRNA causes dose-dependent reductions in viability of LS174T, HT29, Hep3B, and HepG2 cell cultures. Cells were treated for 72
hours with PLK1424 SNALP at increasing concentrations of 0.3, 0.6, 1.25, 2.5, and 5 nM siRNA (white bars to black bars, respectively). Values
in AD are expressed as percentage of viability or PLK1 mRNA relative to PBS control and reflect mean of 3 separate experiments (± SD) con-
ducted in triplicate cultures. (E) Decreased cell viability is associated with the induction of apoptosis. Caspase-3/7 activity in LS174T cells was
assessed 24 hours and 48 hours after treatment with SNALP-encapsulated PLK773, PLK1424, and LUC control siRNAs. Data represent fold
induction over PBS in triplicate cultures (mean ± SD triplicate cultures).
technical advance
664 The Journal of Clinical Investigation      http://www.jci.org      Volume 119      Number 3      March 2009
SNALP-formulated PLK1424-2/A, PLK773-1/B, KSP2263-U/U, 
or a control 2OMe  siRNA  targeting  LUC  (LUC-U/U). IFIT1 
mRNA and serum cytokines were assessed 4–6 hours after SNALP 
administration based on the approximate time of peak response 
for these markers (see Supplemental Figure 2). In these studies, 
we used the SNALP-formulated native LUC siRNA (Table 1) as a 
positive control for immune stimulation. Administration (i.v.) of 
this unmodified siRNA induced 83-fold and 247-fold increases in 
IFIT1 mRNA in the liver and spleen, respectively, compared with 
PBS-treated controls (Figure 3A). This was consistent with the 
detection of systemic IFN-α in these animals (Figure 3B). In con-
trast, the PLK1424-2/A, PLK773-1/B, KSP2263-U/U, or LUC-U/U 
siRNAs induced no measurable IFN-α or increase in IFIT1 mRNA 
in the liver or spleen relative to PBS-treated animals, confirming 
that these SNALP-formulated siRNAs caused no discernible IFN 
signaling in either the liver as primary target organ for this formu-
lation or in secondary lymphoid tissues (Figure 3). As previously 
reported (18), the administration of SNALP-formulated 2OMe 
siRNA induced no increase in other serum cytokines, including 
IL-6, IL-10, IL-12, TNF, and IFN-γ, and displayed a similar lack 
of immune reactivity in primary human immune cell cultures (A. 
Judge, unpublished observations).
We believe that this siRNA design and screening approach can be 
applied to any given sequence to rapidly identify siRNAs in which 
the chemical modifications are well tolerated with respect to RNAi 
activity and  predicted  to fully abrogate  immune stimulation. 
Unlike other chemical modification strategies for siRNAs, enhanc-
ing nuclease resistance was not a primary design consideration, 
since SNALP, the intended delivery vehicle for in vivo studies, is 
known to protect unmodified siRNA from nuclease degradation 
for more than 24 hours in serum (18). However, the 2OMe modi-
fication pattern can take into account the avoidance of (a) posi-
tion 9 in the sense strand based on the observation that efficient 
activation of RISC involves initial  cleavage of  the siRNA sense 
strand between positions 9 and 10 and this can be inhibited by the 
introduction of nuclease-resistant chemistries at this linkage (41, 
42); and (b) the 5 AS terminus where modified chemistries may 
interfere with effective RNA loading into RISC (43, 44).
Therapeutic inhibition of tumor growth by systemic siRNA administration. 
We established  orthotopic  liver tumor models to  examine  the 
pharmacodynamics and  therapeutic efficacy  of SNALP-formu-
lated PLK1424-2/A and KSP2263-U/U siRNA. These were a Hep3B 
xenograft in SCID/beige mice as a representative model of human 
hepatocellular carcinoma and a syngeneic Neuro2a tumor model in 
immune-competent A/J mice. Tumor cells were injected directly into 
the left lateral liver lobe to establish primary intrahepatic tumors 
(45). This procedure resulted in histologically distinct,  localized 
tumor nodules in more than 90% of mice in both models.
To evaluate the therapeutic efficacy of SNALP-formulated PLK1 
siRNA, mice bearing established Hep3B liver tumors were treated 
with 2 mg/kg PLK1424-2/A or LUC-U/U siRNA by i.v. adminis-
tration twice weekly for 3 weeks, until control groups displayed 
symptoms of extensive tumor burden. We have found progressive 
body weight loss to be a good indicator of hepatic tumor burden 
in the Hep3B-SCID/beige mouse model. Weight loss in LUC-U/U–
treated mice was evident 12–16 days after tumor implantation and 
proceeded throughout the remainder of the study (Figure 4A). In 
contrast, PLK1424-2/A SNALP–treated mice typically maintained 
body weight over the duration of treatment, indicating that the 
siRNA formulation was well tolerated and suggesting therapeutic 
benefit. A humane end point was defined according to daily clini-
cal scores that were an aggregate of weight loss, body condition, 
and abdominal distension. In this aggressive orthotopic model, 
the time until first euthanization in the LUC-U/U group was 28 
days after tumor seeding, with a median survival time of 32 days. 
By comparison, the times to first euthanization and median sur-
vival in the PLK1424-2/A SNALP–treated mice were significantly 
extended, to 44 days and 51 days, respectively (P< 0.05; Figure 4B). 
Similar extensions of survival times were observed in repeat studies 
utilizing athymic nu/nu mice as hosts (Supplemental Figure 4).
The extent of Hep3B liver tumor burden was then assessed at the 
completion of dosing with PLK1424-2/A on day 22 after tumor 
implantation (1 day after the fifth siRNA dose). At autopsy, only 2 
of 6 PLK1424-2/A–treated mice had visible tumors localized around 
the site of cell implantation into the liver lobe compared with exten-
sive macroscopic tumor burden in corresponding control animals 
(Supplemental  Figure 5). Species-specific  probe sets to human 
GAPDH (hGAPDH) mRNA detected low levels of this tumor-derived 
signal in 5 of 6 PLK1424-2/A–treated mice, ranging from 2- to 6-fold 
above the background signal from normal mouse liver (Figure 4C), 
indicating that tumor growth was significantly suppressed but not 
completely eradicated by this treatment regime.
To examine more closely the tolerability of systemic siRNA admin-
istration, we conducted multidose toxicity studies using the mouse 
surrogate PLK773-1/B. Repeat administration of SNALP-formulated 
PLK773-1/B at 2 mg/kg, twice weekly (mirroring the therapeutic dos-
ing regimen) caused no significant changes in serum liver enzyme 
levels, total wbc counts, lymphocyte and neutrophil counts, platelet 
numbers, or rbc parameters assessed after 15 and 29 days of continu-
Table 1
PLK1, KSP, and LUC siRNA sequences with 2OMe modification
patterns
Name Strand Sequence (5–3 21-mer)
PLK1424 S AGAUCACCCUCCUUAAAUAUU
PLK1424 AS UAUUUAAGGAGGGUGAUCUUU
PLK1424-1 S AGAUCACCCUCCUUAAAUAUU
PLK1424-2 S AGAUCACCCUCCUUAAAUAUU
PLK1424-A AS UAUUUAAGGAGGGUGAUCUUU
PLK1424-B AS UAUUUAAGGAGGGUGAUCUUU
PLK1424-C AS UAUUUAAGGAGGGUGAUCUUU
PLK773 S AGACCUACCUCCGGAUCAAUU
PLK773 AS UUGAUCCGGAGGUAGGUCUUU
PLK773-1 S AGACCUACCUCCGGAUCAAUU
PLK773-2 S AGACCUACCUCCGGAUCAAUU
PLK773-A AS UUGAUCCGGAGGUAGGUCUUU
PLK773-B AS UUGAUCCGGAGGUAGGUCUUU
PLK773-C AS UUGAUCCGGAGGUAGGUCUUU
KSP2263 S CUGAAGACCUGAAGACAAUdTdT
KSP2263 AS AUUGUCUUCAGGUCUUCAGdTdT
KSP2263-U S CUGAAGACCUGAAGACAAUdTdT
KSP2263-G S CUGAAGACCUGAAGACAAUdTdT
KSP2263-U AS AUUGUCUUCAGGUCUUCAGdTdT
KSP2263-G AS AUUGUCUUCAGGUCUUCAGdTdT
LUC S GAUUAUGUCCGGUUAUGUAUU
LUC AS UACAUAACCGGACAUAAUCUU
LUC-U S GAUUAUGUCCGGUUAUGUAUU
LUC-U AS UACAUAACCGGACAUAAUCUU
Underlines indicate 2OMe nucleotides.
technical advance
The Journal of Clinical Investigation      http://www.jci.org      Volume 119      Number 3      March 2009  665
ous treatment (Supplemental Figure 6). These results indicate that 
the therapeutic dosing regime established in the orthotopic tumor 
model caused minimal hepatocellular toxicity and no significant 
bone marrow dysfunction of the type frequently observed with the 
systemic administration of small-molecule antimitotic drugs.
We next evaluated the therapeutic effect of SNALP-formulated 
KSP2263-U/U siRNAs in syngeneic Neuro2a liver tumors. Median 
survival time of mice receiving LUC-U/U SNALP (4 mg/kg, Q3d ×5) 
was 20 days in this model compared with28 days in the KSP2263-U/U 
treatment group (Figure 4D), demonstrating therapeutic efficacy 
with SNALP-formulated siRNAs for a second oncology target.
Confirmation of RNAi-mediated tumor gene silencing in vivo. Despite 
demonstrating that the 2OMe siRNA did not induce a measur-
able immune response in mice, it remained critical to show that 
RNAi was the primary mechanism underlying the potent thera-
peutic  effects of these PLK1  and KSP  siRNA  formulations. A 
Figure 2
In vitro activity of unmodified versus 2OMe-modified PLK1 and KSP siRNA. Activity of the 2OMe-modified panels of (A) PLK1424 and (B)
PLK773 siRNA. Unmodified PLK1424 or PLK773 siRNA was compared in the Hep3B cell viability assay with the 2OMe-modified duplexes 1/A,
2/A, 1/B, 2/B, 1/C, and 2/C that comprise the respective 2OMe sense/AS oligonucleotides (see Table 1). Data show mean viability of triplicate
cultures relative to PBS-treated cells and represent 2 independent experiments using SNALP-formulated siRNAs. (C) Cytokine induction by
unmodified and 2OMe PLK1 siRNA in vitro. Murine Flt3L DCs were treated with 5 μg/ml (350 nM) unmodified PLK773 and PLK1424 siRNA
duplexes and their constituent sense (S) or AS oligonucleotides or the 2OMe siRNA duplexes PLK773-1/B (1/B) and PLK1424-2/A (2/A) for-
mulated in SNALP. IFN-α and IL-6 were assayed in culture supernatants at 24 hours. Values represent mean + SD of 3 separate experiments
conducted in triplicate cultures. (D and E) Activity of SNALP-formulated KSP2263 siRNA in murine Neuro2a cells. (D) Correlation between KSP
mRNA silencing and cell viability relative to PBS control. KSP mRNA was determined by bDNA analysis at 24 hours. Duplicate plates were
assessed for cell viability at 72 hours. (E) Activity screen comparing the unmodified KSP2263 siRNA to KSP2263-U/U (U/U), KSP2263-G/U
(G/U), and KS2263-G/G (G/G) siRNA duplexes that comprise the respective sense/AS 2OMe oligonucleotides (see Table 1). SNALP-formulated
KSP2263 siRNA were tested in the Neuro2a cell viability assay. Data represent mean ± SD triplicate cultures, relative to PBS treatment.
technical advance
666 The Journal of Clinical Investigation      http://www.jci.org      Volume 119      Number 3      March 2009
single i.v. administration of SNALP-formulated  PLK1424-2/A 
(2 mg/kg) caused a significant reduction in tumor-derived hPLK1 
mRNA in hepatic hep3B tumors 24 hours after administration 
(45% ±  6.8% of  hPLK1 mRNA levels in PBS-treated mice; Fig-
ure 5A). A similar reduction in mouse KSP mRNA expression 
was achieved using an equivalent dose of KSP2263-U/U in the 
hepatic Neuro2a tumor model (Figure 5B). In contrast to KSP 
and PLK1 expression in tumors, endogenous expression of both 
these genes in the surrounding nonproliferative liver was found 
to be very low, below the level of detection of the branched DNA 
(bDNA) assay employed in these studies (A. Judge, unpublished 
observations). Since  the expression  of cell-cycle genes such as 
PLK1 and KSP is typically downregulated as cells exit the cell 
cycle (22), any nonspecific, antiproliferative effects induced by 
siRNA or the delivery vehicle would cause a general decrease in 
their expression within tumors. We therefore confirmed RNAi 
as the mechanism responsible for mRNA silencing in vivo by the 
5 RACE PCR method. A PCR product of the predicted size was 
readily amplified from hepatic Hep3B tumor samples taken 24 
hours after administration of PLK1424-2/A SNALP (Figure 5C). 
Oligonucleotide sequencing of the 476-bp PCR product from 3 
individual mice confirmed its identity as the predicted 5 cut end 
of hPLK1 mRNA. This PCR product was not evident in tumors 
taken from LUC-U/U siRNA–treated mice or in liver samples from 
non–tumor bearing animals. RACE-PCR analysis also confirmed 
the specific induction of RNAi-mediated KSP mRNA cleavage 
within tumors of KSP2263-U/U–treated animals (Figure 5D).
5 RACE-PCR to monitor the duration of RNAi in tumors. To determine 
the duration of active RNAi within the tumor, we treated a cohort 
of Hep3B tumor–bearing mice with PLK1424-2/A SNALP (2 mg/kg 
by i.v. administration) and collected tumors 24 hours, 48 hours, 
96 hours, 7 days, and 10 days after administration for analysis by 5
RACE-PCR. Active PLK1 mRNA cleavage remained strong at 48 and 
96 hours and was still evident 7 days after a single siRNA admin-
istration. A weak signal was detected in PLK1424-treated animals 
on day 10 (Figure 6A). The duration of RNAi determined by RACE-
PCR closely correlated with the level of hPLK1 mRNA silencing in 
these liver tumors (Figure 6B), providing further confirmation that 
RNAi was the primary mechanism for reductions in PLK1 mRNA. 
Since the cleaved mRNA species are inherently unstable in the cell 
cytoplasm, it can be concluded that active RISC-mediated cleavage 
of the target mRNA persisted for 7–10 days after a single siRNA 
treatment. This suggests that active RNAi continued to occur either 
within a subset of tumor cells at subcytotoxic levels or within an 
initially nonproliferative population that subsequently entered cell 
cycle and reexpressed PLK1 mRNA.
RNAi-mediated antitumor activity assessed by histology. Many antimi-
totic drugs, including KSP (46) and PLK1 inhibitors (47, 48), induce 
distinct nuclear phenotypes that reflect their underlying mecha-
nism of action. We therefore used conventional histology as a bio-
marker to assess whether the degree of RNAi-mediated gene silenc-
ing in vivo was sufficient to induce the desired antimitotic effect in 
tumor cells. Inhibition of KSP prevents bipolar spindle formation 
and centrosome segregation, leading to the formation of charac-
teristic monoastral spindles. We first confirmed that the treatment 
of tumor  cells with  KSP2263-U/U siRNA induced the distinct 
monoastral nuclear phenotype in vitro (Supplemental Figure 7). 
Conventional histology on Neuro2a tumors from KSP2263-U/U–
treated mice revealed significant numbers of tumor cells with aber-
rant mitotic figures typical of monoastral and apoptotic cells (46) 
24 hours after SNALP administration (Figure 7, A and B). This 
dramatic pharmacodynamic response to KSP2263-U/U treatment 
was dose dependent, with maximal effects observed at 2 mg/kg 
siRNA, based on quantitative histology scores (Figure 7C). This 
analysis demonstrated that approximately 13% of total Neuro2a 
tumor cells displayed condensed chromatin structures at 24 hours 
after siRNA treatment compared with approximately 3% of cells 
displaying typical mitotic figures in control tumors.
Histological analysis of Hep3B liver tumors from PLK1424-2/A 
SNALP–treated mice also revealed abundant tumor cells with con-
densed chromatin structures and aberrant mitotic figures (Figure 
8). These phenotypic changes were consistent with the dysregulated 
chromosomal segregation and apoptosis that is induced by PLK1 
inhibition (47) and were in striking contrast to the typical mitotic 
figures evident in the tumor histology of control-treated animals.
These molecular and cellular pharmacodynamic studies con-
firmed that the degree of RNAi-mediated silencing achieved by a 
single i.v. administration of SNALP-formulated PLK or KSP siRNA 
Figure 3
2OMe-modified PLK1, KSP, and LUC siRNA induce no measurable IFN response in mice. SNALP-formulated LUC (unmodified) and 2OMe-
modified LUC-U/U, PLK1424-2/A, PLK773-1/B, and KSP2263-U/U (K2263 U/U) siRNA were administered at 2 mg/kg i.v. to BALB/c mice. (A)
IFIT1 relative to GAPDH mRNA in liver and spleen was assessed at 4 hours by bDNA analysis. (B). Serum IFN-α was assessed at 6 hours by
ELISA. SNALP-formulated 2OMe siRNAs induced no detectable increase in either IFN-α protein or IFIT1 mRNA relative to PBS vehicle. Values
represent mean + SD (n = 4).
technical advance
The Journal of Clinical Investigation      http://www.jci.org      Volume 119      Number 3      March 2009  667
was sufficient to cause mitotic dysfunction in a substantial pro-
portion of tumor cells. Histological assessments of drug activity 
in both models demonstrated that “affected” cells were distributed 
throughout established tumors, indicating good penetration of 
the lipidic delivery vehicle. Taken together, this battery of tests 
provided conclusive evidence that the potent therapeutic effects 
of these SNALP-formulated siRNAs in the absence of a measurable 
immune response are the result of RNAi.
Therapeutic activity of SNALP-formulated siRNA in s.c. tumors. To 
expand the  general utility of this technology  in oncology, we 
determined whether the performance of this liver-targeting 
SNALP formulation (26) could be further improved for deliver-
ing siRNA to tumors outside of the liver. For vehicles contain-
ing poly(ethylene)glycol-conjugated lipids (PEG-lipids) such as 
SNALP, increased blood  residency time and tumor accumula-
tion can be achieved by incorporating PEG-lipids with longer 
alkyl chains that associate more strongly with the lipid particle 
and  provide greater shielding in the blood compartment (49). 
Replacing  the  C14  PEG-lipid  (3-N-(-methoxy  poly(ethylene 
glycol)2000)carbamoyl-1,2-dimyrestyloxy-propylamine [PEG-
cDMA]) with  the  C18 analogue 3-N-(-methoxy  poly(ethylene 
glycol)2000)carbamoyl-1,2-distearyloxy-propylamine (PEG-cDSA) 
(50) had the predicted effect of significantly increasing the blood 
circulation time of PLK1424-2/A SNALP in mice without altering 
its therapeutic efficacy in hepatic tumors (Supplemental Figure 
8; median survival: PLK PEG-cDMA, 51 days; PLK PEG-cDSA, 53 
days versus LUC; PEG-cDMA, 33 days; P < 0.05).
Despite a relatively  short  blood-circulation  time and rapid 
distribution to  the liver, repeat administration  of PEG-cDMA 
SNALP containing PLK1424-2/A caused significant inhibition 
of s.c.  Hep3B tumor growth  compared with LUC-U/U  siRNA 
treatment controls (Figure 9A). PLK1424-2/A formulated in an 
equivalent PEG-cDSA SNALP exhibited more potent antitumor 
effects, inducing regression of established tumors (~7 mm diam-
eter) through the  dosing period (Figure 9A). This  difference in 
activity correlated with the degree of gene silencing induced by 
these PLK1424-2/A SNALP in s.c. tumors (Figure 9B). As in the 
hepatic tumor models, this was confirmed as being mediated by 
RNAi by both RACE-PCR and tumor histology (A. Judge, unpub-
lished observations). Finally, we established the therapeutic dose 
response of the PEG-cDSA PLK1424-2/A formulation in the s.c. 
model. Dose-dependent inhibition of tumor growth was evident 
Figure 4
Therapeutic activity of PLK1 and KSP siRNA in hepatic tumors. PLK1424-2/A treatment confers significant survival advantages in SCID/beige
mice bearing hepatic Hep3B tumors. Mice were administered SNALP-formulated PLK1424-2/A (n = 15) or LUC-U/U (n = 8) at 6 × 2 mg/kg i.v.
twice weekly (day 10 to day 28). (A) Body weights (mean + SD) over the dosing period expressed as percentage of initial weight on day 10. (B)
Kaplan-Meier plot of days to euthanization due to tumor burden. PLK1424-2/A treatment provided significant survival advantage over control treat-
ment. (P = 0.03, log-rank Cox-Mantel test). (C) Residual hepatic Hep3B tumor burden in mice 24 hours after final administration of PLK1424-2/A
siRNA (5 × 2 mg/kg siRNA on days 8, 11, 14, 18, and 21). Bars represent hGAPDH mRNA/mg liver of individual mice (mean ± SD of triplicate
analyses) determined by human-specific bDNA assay. No tumor, livers from non–tumor-seeded mice. See Supplemental Figure 6 for additional
data. (D) KSP2263-U/U treatment confers survival advantages in A/J mice bearing hepatic Neuro2a tumors. Mice were administered SNALP-
formulated KSP2263-U/U or LUC-U/U (n = 8) at 5 × 4 mg/kg i.v. (q3d ×5 from day 8 to day 21 after tumor seeding). Kaplan-Meier plot of days
to euthanization due to tumor burden. End points are based on clinical scores as a humane surrogate for survival. Mean SNALP particle sizes
were 83 (0.09 polydispersity), and 90 (0.12 polydispersity) nm for PLK1424-2/A and LUC-U/U formulations, respectively.
technical advance
668 The Journal of Clinical Investigation      http://www.jci.org      Volume 119      Number 3      March 2009
from 0.5 to 3.0 mg/kg PLK1424-2/A siRNA (Figure 9C). At the 
lowest dose level tested, this represented a total cumulative dose 
of 3 mg/kg siRNA over a 2-week period.
Discussion
Delineating the mechanism of action for nucleic acid–based drugs 
has historically been confounded by underlying immune stimu-
lation or other nonspecific  effects induced  by the nucleic acid 
(51, 52). This remains a valid concern for the burgeoning field of 
siRNA-based therapeutics (11). Assessment of target mRNA or 
protein downregulation is necessary but not sufficient to conclude 
that RNAi is the underlying mechanism, as these changes may 
also be symptomatic of the off-target effects induced by siRNA. 
In this report on the development of SNALP-formulated siRNA 
for oncology applications, we describe the methodology used to 
confirm both the specificity and mechanism of action underlying 
the potent siRNA-mediated antitumor efficacy in preclinical mod-
els. This involved a combination of approaches: first, the design 
of both active and control siRNA formulations with no apparent 
capacity to activate an immune response, therefore excluding as 
best as possible the potential for nonspecific efficacy; second, the 
selection of validated oncology targets (PLK1 and KSP) with direct 
antitumor effects and distinctive histological biomarkers of func-
tional target inhibition; third, the use of RACE-PCR to confirm 
induction of the RNAi-specific mRNA cleavage product in tumor 
cells; and fourth, the correlation of this active RNAi signature with 
the duration of target mRNA silencing in tumors. We believe that 
this is the first report describing antitumor effects of siRNA to 
formally demonstrate RNAi as the primary mechanism of action. 
Furthermore, this approach to preclinical study design can be 
generalized to other targets in oncology and readily adopted by 
researchers in the RNAi field.
To evaluate the therapeutic potential of gene silencing in tumors 
without the confounding effects of immune stimulation,  we 
designed 2OMe-modified siRNA that completely abolished the 
immunostimulatory activity of unmodified (native) RNA duplexes 
when administered in a delivery vehicle. It is well established that 
the large majority of native siRNA duplexes have the inherent capac-
Figure 5
Target mRNA silencing in hepatic tumors by the RNAi mechanism. (A and B) Target mRNA silencing and (C and D) detection of RNAi-specific
mRNA cleavage products in tumors following SNALP-formulated siRNA administration. SCID/beige mice with established intrahepatic Hep3B
tumors were administered a single 2 mg/kg dose of SNALP-formulated PLK1424-2/A or LUC-U/U siRNA, and RNAi activity was assessed by (A)
PLK1 mRNA in tumor lysates and (C) 5 RACE-PCR analysis. (A) Tumor (human) PLK1/GAPDH mRNA ratios 24 hours after siRNA administration
(mean ± SD of 4 animals). (C) RACE-PCR detects the specific 5 cleavage product of PLK1 mRNA from tumors analyzed in A. Lanes represent
PCR products derived from individual PBS (n = 2), LUC-U/U (n = 2), and PLK1424-2/A–treated mice (n = 3). (B) Mouse KSP mRNA and (D)
5 RACE-PCR analysis of resected hepatic Neuro2a tumors from mice treated with SNALP-formulated KSP2263-U/U siRNA. Data are presented as
in A and C. Positive control from in vitro Neuro2a cell lysates treated with KSP2263-U/U siRNA indicated by plus sign; no template control indicated
by minus sign. RACE-PCR detects the specific 5 cleavage product of mouse KSP mRNA from tumors. Identities of the predicted 476-bp PLK1
and 102-bp KSP PCR products (arrows) were confirmed by direct DNA sequencing. Mean SNALP particle sizes were 83 (0.09 polydispersity),
90 (0.12 polydispersity), and 88 (0.07 polydispersity) nm for PLK1424-2/A, LUC-U/U, and KSP2263-U/U formulations, respectively.
technical advance
The Journal of Clinical Investigation      http://www.jci.org      Volume 119      Number 3      March 2009  669
ity to activate the innate immune response through the endosomal 
TLR7 and/or TLR8 pathway, particularly when cellular uptake is 
facilitated by delivery vehicles (2, 3, 18, 53). Naked (nonformulat-
ed) siRNA duplexes of 21 bp or longer have also been reported to 
activate cell-surface TLR3 on endothelial cells, causing nonspecific 
antiangiogenic effects in models of choroidal neovascularization 
(4). The consequences of immune activation by siRNA in tumor 
models was recently illustrated by the potent antitumor effects elic-
ited by both active and nontargeting immune stimulatory siRNA 
constructs through the activation of immune effector functions 
(15). The 2OMe siRNAs developed in our studies induced no mea-
surable cytokine response in mice. There was also no induction of 
the IFN inducible gene IFIT1 either in the liver, representing the 
primary target organ for these delivery vehicles, or within second-
ary lymphoid tissues. IFIT1 expression is responsive to local IFN 
signaling within tissues and is also induced directly via dsRNA 
receptors, including TLR3, through an IFN-independent pathway 
(54–56). Its measure can therefore be considered more broadly 
indicative of siRNA-mediated immune activation compared with 
the induction of particular systemic cytokines. Taken together, our 
results indicate that the appropriate design of 2OMe siRNA can 
circumvent not only the activation of endosomal TLR7/8 (2, 3, 18, 
53) but also that of TLR3 (56). We believe that this likely reflects 
the fact that encapsulation of siRNA within delivery vehicles such 
as SNALP effectively shields the RNA from exposure to TLR3 on 
the cell surface. It is important that researchers confirm the full 
abrogation of an immune response to their selected siRNA in the 
context of their preferred delivery vehicle and animal model.
A number of strategies for chemically modifying siRNA have 
been proposed, primarily with the intent to produce nuclease-resis-
tant duplexes (16). From our findings, it is predicted that strategies 
incorporating 2OMe-G, 2OMe-U, or 2OMe-adenosine (2OMe-A) 
residues into both strands of the duplex will generate nonimmuno-
stimulatory siRNA. One such method for siRNA design employs 
alternating 2OMe nucleotides throughout both strands of the 
duplex (57). Santel and colleagues (58) have tested these 2OMe 
siRNAs against the angiogenic target CD31 in tumor models using 
a lipoplex formulation that transfects vascular endothelium. Anti-
tumor effects in these studies were correlated with specific reduc-
tions in CD31 expression and tumor vasculature in the apparent 
absence of overt immune stimulation. While the authors did not 
confirm the induction of RNAi in their models and only looked at 
systemic IFN-α 24 hours after siRNA administration, the report 
represents one of the very few published RNAi studies in oncol-
ogy to use chemically modified siRNA constructs predicted to have 
minimal immunostimulatory  capacity. It should be noted that 
this siRNA design is based on blunt-ended 19-mer duplexes that, 
as naked molecules, are predicted not to activate TLR3 (4). This 
assumption needs to be formally tested for these lipoplexed siRNAs 
to ensure that complexing of short siRNA does not enable their 
engagement of cell-surface TLR3 or other RNA receptors.
Target silencing by siRNA may offer several advantages over func-
tional inhibition by small-molecule drugs. By its nature, RNAi is 
highly specific and allows for the selective inhibition of closely related 
proteins compared with the relative promiscuity of kinase inhibitors. 
Current PLK1 inhibitors, for example, also inhibit PLK2 and PLK3 
kinase activity (23, 59), raising some concern that concomitant inhi-
bition of these family members may have opposing effects in control-
ling cell division (60). The biological response to protein depletion 
by RNAi can also differ from its functional inhibition by small mol-
ecules, for example, the loss of both kinase and polo-box functional-
ity upon PLK1 gene silencing (61). The duration of drug effect that 
can be achieved with siRNA is another attractive advantage. Once 
RNAi is established within mammalian cells, gene silencing can per-
sist for many days due to the relative stability of activated RISC in 
the presence of its complementary mRNA (26, 62). Therefore, the 
maintenance of drug activity for an siRNA therapeutic is uncoupled 
from the requirement to maintain an effective drug concentration 
Figure 6
Duration of RNAi activity within hepatic tumors.
(A) 5 RACE-PCR analysis of Hep3B liver
tumors 24 hours, 48 hours, 96 hours, 7 days,
and 10 days after a single i.v. administration
of SNALP-formulated PLK1424-2/A siRNA
(2 mg/kg). Specificity of the PLK1424-specific
RACE-PCR product (arrow) was confirmed by
sequencing at day 1 and day 7. (B) Correspond-
ing levels of PLK1 mRNA in isolated tumor RNA
analyzed in A. Duration of RNAi correlated with
duration of mRNA silencing compared with that
of LUC-U/U SNALP–treated mice. Data repre-
sent mean hPLK1/ hGAPDH mRNA ratio + SD
(n = 3 at each time point). Mean SNALP par-
ticle sizes were 83 (0.09 polydispersity) and 90
(0.12 polydispersity) nm for PLK1424-2/A and
LUC-U/U, respectively.
technical advance
670 The Journal of Clinical Investigation      http://www.jci.org      Volume 119      Number 3      March 2009
in the blood. We have found that active RNAi in our tumor models 
persisted for up to 10 days, based on detection of the specific mRNA 
cleavage product by RACE-PCR. Interestingly, this duration of effect 
was substantially shorter than that observed in comparable stud-
ies targeting ApoB expression in the healthy mouse liver in which 
silencing at the mRNA level slowly resolved between 14 and 28 days 
after siRNA administration (ref. 26 and I. MacLachlan, unpublished 
observations). We believe that the attenuation of RNAi in the tumor 
most likely results from the effective killing of affected tumor cells 
and from the dilution of activated RISC through the proliferation of 
cells receiving sublethal doses of PLK1 siRNA (62).
In conclusion,  in this report  we have  demonstrated that  sys-
temic administration  of SNALP-formulated siRNA can trigger 
RNAi-mediated cleavage of mRNA within solid tumors, silencing 
target expression at a magnitude sufficient to induce the mitotic 
disruption and apoptosis of tumor cells. We are able to reach this 
conclusion with the utmost confidence based on the fact that we 
have followed a clear and rigorous path that allows us to separate 
siRNA-mediated effects on gene expression from other off-target 
effects — hence, the importance of this report. Studies are now 
ongoing to evaluate the utility of using SNALP-formulated siRNA 
in combination with small-molecule drugs in hopes that this com-
bination may further enhance the efficacy of siRNA molecules in 
treating human malignancies.
Methods
siRNA. siRNA sequences targeting hPLK1 (GenBank accession number 
NM_005030) were selected using a standard siRNA design algorithm 
(40, 63). Target sequences of PLK1 siRNAs are listed in Supplemental 
Table 1. All siRNAs were synthesized as oligonucleotides by Integrated 
DNA Technologies and received as desalted, deprotected RNA. Integrity 
of annealed duplexes  was confirmed by 20% PAGE. siRNAs were for-
mulated into SNALP comprising synthetic cholesterol (Sigma-Aldrich), 
1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC; Avanti Polar Lipids 
Inc.), PEG-cDMA, and 1,2-dilinoleyloxy-3-(N,N-dimethyl)aminopropane 
(DLinDMA) as previously described (26). Formulations used for in vivo 
studies comprised a final lipid/siRNA mass ratio of 9:1. In the experi-
ments indicated, PEG-cDMA was substituted at equimolar concentra-
Figure 7
KSP2263-U/U induces distinct phenotypic changes typical of KSP inhi-
bition in hepatic tumor cells. Hepatic Neuro2a tumor histology 24 hours
after a single i.v. administration of (A) LUC-U/U or (B) KSP2263-U/U
siRNA formulated in SNALP (2 mg/kg siRNA). Images representative
of tumors from at least 6 individual mice. H&E staining reveals tumor
cells with aberrant nuclear figures typical of monoastral spindles or
apoptotic phenotypes in KSP2263-U/U–treated mice. Original magni-
fication, ×200. (C) Quantitative histology of H&E-stained tumor tissues
from mice treated with SNALP-formulated KSP2263-U/U at 4, 2, 1, or
0.5 mg/kg siRNA. Tumor cells with condensed chromatin structures
were scored as positive, and the number of such tumor cells was cal-
culated as a percentage of total tumor cells taken from 10 fields of
view. Positive cells included aberrant and typical mitotic and apop-
totic figures. Values are mean + SD of 3 mice. Mean SNALP particle
sizes were 88 (0.07 polydispersity) and 82 (0.08 polydispersity) nm for
KSP2263-U/U and LUC-U/U, respectively.
Figure 8
PLK1424-2A induces distinct phenotypic changes typical of PLK1
inhibition in hepatic tumor cells. H&E tumor histology 24 hours after
single i.v. administration of 2 mg/kg SNALP-formulated (A and C)
LUC-U/U or (B and D) PLK1424-2/A siRNA. Images are representa-
tive of tumors from at least 7 individual mice. Original magnification,
×200 (A and B); ×400 (C and D). Mean SNALP particle sizes were 72
(0.04 polydispersity) and 72 (0.02 polydispersity) nm for PLK1424-2/A
and LUC-U/U, respectively.
technical advance
The Journal of Clinical Investigation      http://www.jci.org      Volume 119      Number 3      March 2009  671
tions with the C18 analogue PEG-cDSA (50). All SNALP were dialyzed 
in PBS prior to use and were stable as a wet preparation stored at 4°C 
for greater than 6 months.
Cell cultures. The cell lines Hep3B, HepG2, HT29, LS174T, and Neuro2a 
were obtained from ATCC and cultured in the recommended basal medium 
with 10% heat-inactivated FBS and 1% penicillin-streptomycin. For in vivo 
tumor studies, Hep3B or Neuro2a cells were cultured in T175 f lasks, har-
vested, and washed once in PBS prior to implantation. For in vitro siRNA 
activity assays, cell lines were cultured in 96-well plates in the presence of 
SNALP-formulated siRNAs. Cell viability was assessed after 72 hours using 
the resazurin dye CellTiter-Blue (Promega). Corresponding PLK1 or KSP 
mRNA–silencing activity was assessed in replicate plates at 24 hours  by 
bDNA assay (Panomics). The level of caspase-3 and caspase-7 enzyme activ-
ity in siRNA-treated cells was assessed using the fluorescent caspase-3/7 
substrate (Z-DEVD)2-Rhodamine 110 reagent Apo-ONE (Promega).
In vitro immune stimulation assays. Mouse Flt3L dendritic cell cultures 
were generated as described previously (64). In brief, bone marrow from 
BALB/c mice was harvested in complete medium (RPMI 1640, 10% FBS, 
1% penicillin/streptomycin, 2 mM  l-glutamine, 1  mM sodium pyru-
vate, 25 mM HEPES, and 50 μM 2-mercaptoethanol), passed through a 
70-micron strainer, and resuspended at 2 × 106 cells/ml in complete medi-
um supplemented with 100 ng/ml murine Flt3L (PeproTech). Cells were 
seeded in 6-well plates, and 1 ml fresh Flt3L medium was added every 
3 days. On day 9 of culture, nonadherent cells were plated into 96-well 
plates at a concentration of 2 × 105 cells/well. Formulated siRNAs were 
diluted in PBS and added to the cells for 24 hours before supernatants 
were assayed for cytokines by ELISA.
In vivo immune stimulation assays. All animal studies were performed at 
Protiva Biotherapeutics in accordance with Canadian Council on Animal 
Care guidelines  and following protocols approval by  the Institutional 
Animal Care and Use Committee of Protiva Biotherapeutics. Six- to eight-
week-old BALB/c mice  were obtained  from Harlan  and subjected  to a 
2-week acclimation period prior to use. Mice were administered SNALP-
formulated siRNAs (2 mg/kg) in PBS via standard i.v. injection in the lat-
eral tail vein. Blood was collected by cardiac puncture and processed as 
plasma for cytokine analysis. Liver and spleen were collected into RNAlater
(Sigma-Aldrich) for IFIT1 mRNA analysis.
Intrahepatic tumor models. Liver tumors were established in mice by direct 
intrahepatic injection  of Hep3B or Neuro2a tumor cells (45). Female 
SCID/beige mice (Charles River) and male A/J mice (Jackson Laboratory) 
were used as hosts for the Hep3B and Neuro2a tumors, respectively. Ani-
mals received Anafen by s.c. injection immediately prior to surgery. Indi-
vidual mice were anesthetized by isoflurane gas inhalation and eye lube 
applied to prevent excessive eye drying. While mice were maintained under 
Figure 9
Therapeutic activity of PLK1 SNALP containing either C14 or C18 PEG-lipids in s.c. tumors. (A) Inhibition of s.c. tumor growth by alternate
PLK1424-2/A SNALP formulations. Mice were administered PLK1424-2/A SNALP comprising either PEG-cDMA or PEG-cDSA (6 × 2 mg/kg
i.v.) between day 10 and day 21 after Hep3B tumor seeding. Values show mean tumor volumes (mm3) ± SD (n = 5). Control was LUC-U/U
siRNA SNALP (PEG-cDMA). (B) Corresponding hPLK1/hGAPDH mRNA ratio in s.c. Hep3B tumors following single administration (2 mg/kg) of
PLK1424-2/A or LUC-U/U siRNA; mean + SD (n = 4). (C) Dose response of PLK1424-2/A PEG-cDSA SNALP in Hep3B tumors. Mice bearing
established (~100 mm3) tumors were administered PLK1424-2/A PEG-cDSA SNALP (6 × 3, 6 × 1, or 6 × 0.5 mg/kg), LUC PEG-cDSA SNALP
(6 × 3 mg/kg), or PBS vehicle every 2–3 days between days 18 and 29 after seeding. Values represent mean tumor volumes (mm3) (n = 5).
Mean SNALP particle sizes were 81 (0.10 polydispersity), 71 (0.03 polydispersity), 82 (0.12 polydispersity), and 74 (0.05 polydispersity) nm for
PLK1424-2/A PEG-cDMA, PEG-cDSA, LUC-U/U PEG-cDMA, and PEG-cDSA, respectively.
technical advance
672 The Journal of Clinical Investigation      http://www.jci.org      Volume 119      Number 3      March 2009
gas anesthesia, a single 1.5-cm incision across the midline was made below 
the sternum, and  the left lateral  hepatic lobe was  exteriorized. 1 × 106
Hep3B cells or 1 × 105 Neuro2a cells suspended in 25 μl PBS were injected 
slowly into the lobe at a shallow angle using a Hamilton syringe and a 
30-gauge needle. A swab was then applied to the puncture wound to stop 
any bleeding prior to suturing. Mice were allowed to recover from anes-
thesia in a sterile cage and monitored closely for 2–4 hours before being 
returned to conventional housing.
Eight to eleven days after tumor implantation, mice were randomized into 
treatment groups. siRNA SNALP formulations or PBS vehicle control was 
administered by standard i.v. injection via the lateral tail vein, calculated on a 
mg siRNAs/kg basis according to individual animal weights (10 ml/kg injec-
tion volume). Body weights were then monitored throughout the duration 
of the study as an indicator of developing tumor burden and treatment toler-
ability. For efficacy studies, defined humane end points were determined as a 
surrogate for survival. Assessments were made by qualified veterinary techni-
cians based on a combination of clinical signs, weight loss, and abdominal 
distension to define the day of euthanization due to tumor burden.
s.c. tumor models. Hep3B tumors were established in female SCID/beige 
mice by s.c. injection of 3 × 106 cells in 50 μl PBS into the left-hind f lank. 
Mice were randomized into treatment groups 10–17 days after seeding 
as tumors became palpable. siRNA SNALP formulations were adminis-
tered as described above. Tumors were measured in 2 dimensions (width ×
length) to assess tumor growth using digital calipers. Tumor volume was 
calculated using the equation a×b×b/2, where a = largest diameter and 
b = smallest diameter, and expressed as group mean ± SD.
Measurement of hPLK1 and GAPDH mRNA in tumor tissues. Tumors were har-
vested directly into RNAlater and stored at 4°C until processing. 100 mg 
tumor tissue was homogenized in tissue and lysis solution (EPICENTRE 
Biotechnologies) containing 50 mg/ml proteinase  K (EPICENTRE Bio-
technologies) in a  FastPrep tissue homogenizer followed by incubation 
in a 65°C water bath for 15 minutes and centrifugation to clarify lysates. 
mRNA analysis shown in Figure 5B was performed on purified RNA iso-
lated according to the 5 RACE-PCR protocol. hPLK1 and GAPDH mRNA 
were measured in tumor lystes by the QuantiGene bDNA assay (Panomics) 
per the manufacturer’s instructions (QuantiGene 1.0 manual). Human-
specific PLK1 (GenBank accession number NM_005030) and GAPDH 
(GenBank accession number  NM_002046) probe  sets were designed by 
Panomics and demonstrated to have minimal cross-reactivity to the mouse 
counterpart mRNA. Data were expressed as mean PLK1/GAPDH ratio ± SD 
of individual animals. Tumor burden was assessed by homogenizing the 
complete liver from tumor-bearing mice and measuring the total hGAPDH 
signal (relative light units [RLU]) within the liver. Values were expressed as 
hGAPDH RLU/mg total liver.
Measurement of IFIT1 mRNA in mouse tissues.  Murine liver and spleen 
were processed for bDNA assay to determine IFIT1 mRNA as described 
above. The IFIT1 probe set was specific to mouse IFIT1 mRNA (posi-
tions 4–499, GenBank accession number NM_008331), and the GAPDH 
probe set was specific to mouse GAPDH mRNA (positions 9–319, Gen-
Bank accession number NM_008084). Data are shown as the ratio of 
IFIT1 RLU to GAPDH RLU.
5 RLM RACE. Total RNA was isolated from in vitro–cultured cells by 
direct lysis in TRIzol (Invitrogen). For in vivo tumor samples, tissues were 
harvested into RNAlater (Sigma-Aldrich) and stored at 4°C for at least 
24 hours prior to processing. 30 mg tumor tissue was homogenized in 1 ml 
TRIzol, then processed to isolate total RNA. RNA quality was confirmed by 
gel electrophoresis (1% agarose in Tris-borate buffer). 5 RNA ligase–medi-
ated–RACE (5 RLM RACE) was  performed according to the  Invitrogen 
GeneRacer manual with modifications. Primers were designed using Primer3 
software, version 0.3.0  (http://frodo.wi.mit.edu/). 10 μg total  RNA was 
mixed with 1.3 ng GeneRacer RNA adaptor (5 CGACUGGAGCACGAG-
GACACUGACAUGGACUGAAGGAGUAGAAA  3),  heated to 65°C for 
5 minutes, and snap-cooled on ice prior to ligation. RNA ligation was per-
formed at 37°C for 1 hour in 1×ligase buffer, 30 U RNaseOut (Invitrogen), 
and 30 U RNA ligase (Ambion Inc.). Samples were then purified by diafil-
tration using Microcon 100 filters per the manufacturer’s instructions for 
nucleic acids (Millipore). 10 μl of the RNA ligation product was reverse 
transcribed using SuperScript III (Invitrogen) and a PLK1-specific primer 
(5-GGACAAGGCTGTAGAACCCACAC-3)  designed to hybridize to a 
target site 3 to the predicted PLK1424 siRNA–mediated mRNA cut site. 
Reverse transcription was  carried out at  55°C for 50  minutes followed 
by inactivation at 70°C for 15 minutes and snap-cooling on ice. 5 RLM 
RACE-PCR was performed using forward (GR5) and reverse (PLK1424rev) 
primers in the GeneRacer adaptor and the 3 end of PLK1 mRNA, respec-
tively, to span the predicted PLK1424 cut site. PCR primer sequences were 
GR5 5-CGACTGGAGCACGAGGACACTGA-3 and PLK1424rev 5-CCA-
GATGCAGGTGGGAGTGAGGA-3. PCR was performed using a Bio-Rad 
iCycler using touchdown PCR conditions of 94°C for 2 minutes (1 cycle), 
94°C for 30 seconds and 72°C for 1 minute (5 cycles), 94°C for 30 seconds 
and 70°C for 1 minute (5 cycles), 94°C for 30 seconds, 65°C for 30 seconds 
and 68°C for 1 minute (25 cycles), and 68°C for 10 minutes (1 cycle). PCR 
products were run on a 2% TBE Agarose 1000 (Invitrogen) gel and stained 
with 1 μg/ml ethidium bromide. The identity of PCR products was con-
firmed by direct sequencing of the gel-purified products using sequencing 
primers within the GeneRacer RNA adaptor (5-ACTGGAGCACGAGGA-
CAC-3) and 3PLK1 mRNA (5-GAGACGGGCAGGGATATAG-3). Similar 
assay conditions and primer design were employed to amplify the cleaved 
KSP mRNA product by KSP2263 siRNA using the following unique prim-
ers: KSP-specific cDNA primer 5-GCTGCTCTCGTGGTTCAGTTCTC-3, 
RACE primer KSPrev 5-GCCCAACTACTGCTTAACTGGCAAA-3,  and 
KSP sequencing primer 5-TGGGTTTCCTTTATTGTCTT-3.
Histology. Tumors were harvested from mice 24 hours after siRNA admin-
istration and fixed directly in 10% buffered formalin. Tissues were then pro-
cessed as paraffin-embedded tissue sections and stained with H&E using 
conventional histological techniques. Quantitative analysis of stained sec-
tions was performed by counting the number of mitotic/apoptotic cells 
displaying condensed chromatin structures as a percentage of total tumor 
cells. Values for each tumor were derived from means of 10 fields of view 
at ×400 magnification.
Cytokine ELISA. All cytokines were quantified using sandwich ELISA 
kits. These were mouse IFN-α (PBL) and human and mouse IL-6 (BD 
Biosciences).
Statistics. Comparisons of survival  times were performed on Kaplan-
Meier plots by the log-rank (Cox-Mantel) test. Differences were deemed 
significant at P < 0.05.
Acknowledgments
The authors would like to acknowledge Ed Yaworski, Lloyd Jeffs, 
Lina Huang, Felix Yuen, and James Heyes for siRNA formulation 
and lipid synthesis. I. Tavakoli, J. Levi, Lina Hu, and A. Fronda were 
supported by undergraduate research grants from the Natural Sci-
ences and Engineering Research Council of Canada.
Received for publication September 22, 2008, and accepted in 
revised form December 17, 2008.
Address correspondence to: Ian MacLachlan, Tekmira Pharmaceu-
ticals Corporation, 100-8900 Glenlyon Parkway, Burnaby, British 
Columbia V5J 5J8, Canada. Phone: (604)419-3205;Fax: (604)419-3201; 
E-mail: imaclachlan@tekmirapharm.com.
technical advance
The Journal of Clinical Investigation      http://www.jci.org      Volume 119      Number 3      March 2009  673
  1. Elbashir, S.M., et al. 2001. Duplexes of 21-nucleo-
tide RNAs mediate RNA  interference in cultured 
mammalian cells. Nature.411:494–498.
  2. Judge, A.D., et al. 2005. Sequence-dependent stimu-
lation of the mammalian innate immune response 
by synthetic siRNA. Nat. Biotechnol.23:457–462.
  3. Hornung, V., et al. 2005. Sequence-specific potent 
induction of IFN-alpha by short interfering RNA 
in plasmacytoid dendritic cells through TLR7. Nat.
Med.11:263–270.
  4. Kleinman, M.E., et al. 2008. Sequence and target-
independent angiogenesis suppression by siRNA 
via TLR3. Nature.452:591–597.
  5. Hornung, V., et al. 2006. 5-Triphosphate RNA is 
the ligand for RIG-I. Science.314:994–997.
  6. Marques, J.T., et al.  2006. A  structural basis  for 
discriminating between self and nonself double-
stranded RNAs in mammalian cells. Nat. Biotechnol.
24:559–565.
  7. Krieg, A.M. 2006.  Therapeutic potential of Toll-
like receptor 9 activation. Nat. Rev. Drug Discov.
5:471–484.
  8. von Marschall, Z., et al. 2003. Effects of interferon 
alpha on vascular endothelial growth factor gene 
transcription and tumor angiogenesis. J. Natl. Cancer
Inst.95:437–448.
  9. Lanuti, M., et  al.  2000. Cationic  lipid:bacterial 
DNA complexes elicit adaptive cellular immunity 
in murine intraperitoneal  tumor models. Cancer
Res.60:2955–2963.
  10. Buhtoi arov,  I.N. ,  Lum,  H.D. ,  Berke,  G. , S ondel , 
P.M., and Rakhmilevich, A.L. 2006. Synergistic acti-
vation of macrophages via CD40 and TLR9 results 
in T cell independent antitumor effects. J. Immunol.
176:309–318.
  11. Judge, A., and MacLachlan,  I. 2008. Overcoming 
the innate immune response to small interfering 
RNA. Hum. Gene Ther.19:111–124.
  12. Michie, H.R.,  et al. 1988.  Detection of  circulating 
tumor necrosis factor after endotoxin administration. 
N. Engl. J. Med.318:1481–1486.
  13. Stevenson, H.C., et al. 1985. A phase I evaluation of 
poly(I,C)-LC in cancer patients. J. Biol. Response Mod.
4:650–655.
14. Schlee, M.,  Barchet, W., Hornung,  V., and Hart-
mann, G. 2007. Beyond double-stranded RNA-type 
I IFN induction by 3pRNA and other viral nucleic 
acids. Curr. Top. Microbiol. Immunol.316:207–230.
  15. Poeck, H., et al. 2008. 5-triphosphate-siRNA: turn-
ing gene  silencing  and Rig-I  activation  against 
melanoma. Nat. Med.14:1256–1263.
  16. Manoharan, M. 2004. RNA interference and chemi-
cally modified small interfering RNAs. Curr. Opin.
Chem. Biol.8:570–579.
  17. Morrissey, D.V., et al. 2005. Potent and persistent 
in vivo anti-HBV activity  of chemically modified 
siRNAs. Nat. Biotechnol.23:1002–1007.
  18. Judge, A.D., Bola, G., Lee,  A.C., and MacLachlan, 
I. 2006.  Design of non-inflammatory synthetic 
siRNA mediating  potent gene  silencing in  vivo. 
Mol. Ther.13:494–505.
  19. Knight, S.D., and Parrish, C.A. 2008. Recent prog-
ress in the  identification and  clinical evaluation 
of inhibitors of the mitotic kinesin KSP. Curr. Top.
Med. Chem.8:888–904.
  20. Strebhardt, K., and Ullrich, A. 2006. Targeting polo-
like kinase 1  for cancer therapy. Nat. Rev. Cancer.
6:321–330.
  21. Tao, W., et al. 2005. Induction of  apoptosis by an 
inhibitor of the mitotic kinesin KSP requires both 
activation of the spindle assembly checkpoint and 
mitotic slippage. Cancer Cell.8:49–59.
  22. Barr, F.A., Sillje, H.H., and Nigg, E.A . 2004. Polo-
like kinases and the orchestration of cell division. 
Nat. Rev. Mol. Cell Biol.5:429–440.
  23. Steegmaier, M.,  et al. 2 007. BI 2536,  a potent an d 
selective inhibitor of  polo-like kinase 1,  inhibits 
tumor growth in vivo. Curr. Biol.17:316–322.
24. Liu, X.,  and Erikson, R.L.  2003. Polo-like kinase 
(Plk)1 depletion induces apoptosis in cancer cells. 
Proc. Natl. Acad. Sci. U. S. A.100:5789–5794.
  25. Spankuch, B., Kurunci-Csacsko, E., Kaufmann, M., 
and Strebhardt, K. 2007. Rational combinations of 
siRNAs targeting Plk1 with breast  cancer drugs. 
Oncogene.26:5793–5807.
26. Zimmermann, T.S., et  al. 2006. RNAi-mediated 
gene silencing  in non-human primates.  Nature.
441:111–114.
  27. de Fougerolles, A., Vornlocher, H.P., Maraganore, J., 
and Lieberman, J. 2007. Interfering with disease: a 
progress report on siRNA-based therapeutics. Nat.
Rev. Drug Discov.6:443–453.
  28. Behlke, M.A. 2006. Progress towards in vivo use of 
siRNAs. Mol. Ther. 13:644–670.
 29. Urban-Klein,  B.,  Werth,  S.,  Abuharbeid,  S.,
Czubayko, F., and Aigner, A. 2005. RNAi-mediated 
gene-targeting through  systemic application  of 
polyethylenimine (PEI)-complexed siRNA in vivo. 
Gene Ther.12:461–466.
30. Schiffelers, R.M., et al. 2004. Cancer siRNA thera-
py by tumor selective delivery with ligand-targeted 
sterically stabilized nanoparticle. Nucleic Acids Res.
32:e149.
  31. Heidel, J.D., et al.  2007. Administration in  non-
human primates of escalating intravenous doses 
of targeted nanoparticles containing ribonucleo-
tide reductase subunit M2 siRNA. Proc. Natl. Acad.
Sci. U. S. A.104:5715–5721.
  32. Santel, A., et al. 2006. A novel siRNA-lipoplex tech-
nology for RNA interference in the mouse vascular 
endothelium. Gene Ther.13:1222–1234.
  33. Mayer, L., Bally, M., Cullis, P., Wilson, S., and Emer-
man, J.  1990. Comparison of free and  liposome 
encapsulated doxorubicin tumor drug uptake and 
anti-tumor efficacy in the SC115 murine  mam-
mary tumor. Cancer Letters.53:183–190.
34. Seymour, L.W. 1992.  Passive tumor targeting of 
soluble macromolecules and drug conjugates. Crit.
Rev. Ther. Drug Carrier Syst.9:135–187.
  35. Chono, S., Li, S.D., Conwell, C.C.,  and Huang, L. 
2008. An  efficient and  low immunostimulatory 
nanoparticle formulation for systemic siRNA deliv-
ery to the tumor. J. Control Release.131:64–69.
  36. Peer, D., Park, E.J., Morishita, Y., Carman, C.V., and 
Shimaoka, M. 2008. Systemic leukocyte-directed 
siRNA delivery revealing  cyclin  D1 as  an  anti-
inflammatory target. Science.319:627–630.
  37. Robbins, M., et al. 2008. Misinterpreting the thera-
peutic effects of siRNA caused by immune stimula-
tion. Hum Gene Ther. Online publication ahead of 
print. doi:10.1089/hgt.2008.131.
  38. Weil, D., et al. 2002. Targeting the kinesin Eg5 to 
monitor siRNA transfection in mammalian  cells. 
Biotechniques.33:1244–1248.
  39. Soutschek, J., et al. 2004. Therapeutic silencing of 
an endogenous gene by systemic administration of 
modified siRNAs. Nature.432:173–178.
  40. Elbashir, S.M., Lendeckel, W., and Tuschl, T. 2001. 
RNA interference is mediated by 21- and 22-nucle-
otide RNAs. Genes Dev.15:188–200.
  41. Matranga, C.,  Tomari, Y.,  Shin, C.,  Bartel,  D.P., 
and Zamore, P.D. 2005. Passenger-strand cleavage 
facilitates assembly of siRNA into Ago2-containing 
RNAi enzyme complexes. Cell.123:607–620.
  42. Leuschner, P.J., Ameres, S.L., Kueng, S., and Mar-
tinez, J.  2006. Cleavage  of the  siRNA passenger 
strand  during  RISC  assembly  in  human  cells. 
EMBO Rep.7:314–320.
  43. Prakash, T., et al. 2005. Positional effect of chemical 
modifications on short interference RNA activity 
in mammalian cells. J. Med. Chem.48:4247–4253.
44. Chiu, Y., and  Rana, T. 2003. siRNA  function in 
RNAi: A chemical  modification  analysis.  RNA.
9:1034–1048.
  45. Yao, X., et al. 2003. A novel orthotopic tumor model 
to study growth factors and oncogenes in hepato-
carcinogenesis. Clin. Cancer Res.9:2719–2726.
  46. Sakowitz, R., et al. 2004. Antitumor activity of kine-
sin inhibitor. Cancer Res.64:3276–3280.
  47. Lenart, P., et al. 2007. The small-molecule inhibitor 
BI 2536 reveals novel insights into mitotic roles of 
polo-like kinase 1. Curr. Biol.17:304–315.
 48. Spankuch-Schmitt,  B.,  Bereiter-Hahn,  J.,
Kaufmann, M.,  and Strebhardt, K.  2002. Effect 
of RNA silencing of polo-like kinase-1  (PLK1) on 
apoptosis and spindle formation in human cancer 
cells. J. Natl. Cancer Inst.94:1863–1877.
  49. Ambegia, E., et al. 2005. Stabilized plasmid–lipid par-
ticles containing PEG-diacylglycerols exhibit extend-
ed circulation  lifetimes and  tumor selective  gene 
expression. Biochim. Biophys. Acta.1669:155–163.
  50. Heyes, J., Hall, K., Tailor, V., Lenz, R., and MacLach-
lan, I. 2006. Synthesis and characterisation of novel 
poly(ethylene glycol)-lipid conjugates suitable for 
use in drug delivery. J. Control. Release.112:280–290.
51. Krieg, A.M. 2002. CpG motifs in bacterial DNA 
and  th eir  imm une  ef fects.  Annu. Rev. Immunol.
20:709–760.
  52. Castro, J.E., et al. 2006. Thymidine-phosphorothio-
ate oligonucleotides induce activation and apop-
tosis of CLL cells independently of CpG motifs or 
BCL-2 gene interference. Leukemia.20:680–688.
 53. Diebold, S.S., et al.  2006. Nucleic acid agonists 
for Toll-like receptor 7 are  defined by the  pres-
ence of uridine ribonucleotides. Eur. J. Immunol.
36:3256–3267.
  54. Der, S.D., Zhou, A., Williams, B.R., and Silverman, 
R.H. 1998. Identification of genes differentially reg-
ulated by interferon alpha, beta,  or gamma using 
oligonucleotide arrays. Proc. Natl. Acad. Sci. U. S. A.
95:15623–15628.
 55. Geiss, G.,  et al.  2001. A  comprehensive view  of 
regulation of gene  expression by double-strand-
ed RNA-mediated cell  signaling.  J. Biol. Chem.
276:30178–30182.
  56. Sarkar, S.N., Smith, H.L., Rowe, T.M., and Sen, G.C. 
2003. Double-stranded RNA signaling by Toll-like 
receptor 3 requires specific tyrosine residues in its 
cytoplasmic domain. J. Biol. Chem.278:4393–4396.
  57. Czauderna, F., et  al. 2003.  Structural variations 
and stabilising modifications of synthetic siRNAs 
in mammalian cells. Nucl. Acids Res.31:2705–2716.
  58. Santel ,  A.,  et  a l.  2006 .  RNA  inte rfere nce  in  th e 
mouse vascular endothelium by systemic  admin-
istration of siRNA-lipoplexes for cancer therapy. 
Gene Ther.13:1360–1370.
  59. Johnson, E.F., Stewart, K.D., Woods, K.W., Giranda, 
V.L., and Luo, Y. 2007. Pharmacological and func-
tional comparison of the polo-like kinase family: 
insight into  inhibitor and  substrate specificity. 
Biochemistry.46:9551–9563.
  60. Malumbres, M., and Barbacid, M. 2007. Cell cycle 
kinases in cancer. Curr. Opin. Genet. Dev.17:60–65.
  61. McInnes, C.,  et al.  2006.  Inhibitors of  Polo-like 
kinase reveal roles  in spindle-pole  maintenance. 
Nat. Chem. Biol.2:608–617.
  62. Bartlett, D.W., and Davis, M.E. 2006. Insights into 
the kinetics of siRNA-mediated gene silencing from 
live-cell and live-animal  bioluminescent  imaging. 
Nucleic Acids Res.34:322–333.
 6 3. Schw arz,   D.S. ,  et  a l.  20 03.  A symm etr y  in  t he 
assembly  of  the  RNAi  enzyme  complex.  Cell.
115:199–208.
  64. Gilliet, M., et al. 2002. The development of murine 
plasmacytoid dendritic cell precursors is differen-
tially regulated by FLT3-ligand and granulocyte/
macrophage colony-stimulating factor. J. Exp. Med.
195:953–958.
    • "RNAi is considered as a promising regulatory process in which double-stranded RNA (dsRNA) induces specific degradation of its target mRNA [16]. A growing number of studies have used siRNAs/shRNAs as potential therapeutic agents for treating numerous diseases, including cancer and genetic or viral infections [17, 18]. In this study, therefore, we investigated the efficacy of gene silencing using chemically synthesized short hairpin RNA targeting TS (shTS) in suppressing the TS expression, and thereby enhancing the cell growth inhibitory effect of 5-FU on colorectal tumor cell line, DLD-1, in vitro. "
    [Show abstract] [Hide abstract] ABSTRACT: Metronomic chemotherapy is currently considered an emerging therapeutic option in clinical oncology. S-1, an oral formulation of Tegafur (TF), a prodrug of 5-fluorouracil (5-FU), is designed to improve the antitumor activity of 5-FU in tandem with reducing its toxicity. Clinically, metronomic S-1 dosing has been approved for the standard first- and second-line treatment of metastatic or advanced stage of colorectal (CRC). However, expression of intratumor thymidylate synthase (TS), a significant gene in cellular proliferation, is associated with poor outcome to 5-FU-based chemotherapeutic regimens. In this study, therefore, we examined the effect of a combination of TS silencing by an RNA interfering molecule, chemically synthesized short hairpin RNA against TS (shTS), and 5-FU on the growth of human colorectal cancer cell (DLD-1) both in vitro and in vivo. The combined treatment of both shTS with 5-FU substantially inhibited cell proliferation in vitro. For in vivo treatments, the combined treatment of metronomic S-1 dosing with intravenously injected polyethylene glycol (PEG)-coated shTS-lipoplex significantly suppressed tumor growth, compared to a single treatment of either S-1 or PEG-coated shTS-lipoplex. In addition, the combined treatment increased the proportion of apoptotic cells in the DLD-1 tumor tissue. Our results suggest that metronomic S-1 dosing combined with TS silencing might represent an emerging therapeutic strategy for the treatment of patients with advanced CRC.
    Full-text · Article · Nov 2016
    • "This phenomenon , called enhanced permeability and retention effect (EPR), has been taken advantage of for delivering pharmaceuticals to solid tumors following intravenous administration (Seymour, 1992). One of the first approaches designed to deliver siRNAs to tumors was by means of liposomes and LNPs (Judge et al., 2009; Lee et al., 2010). Using this approach Bisanz and coworkers (2005) showed that intratumorally administered liposome encapsulated siRNAs targeting ECM-integrin were able to significantly reduce the size of bone tumors in a mouse xenograft model. "
    [Show abstract] [Hide abstract] ABSTRACT: RNA interference is a cellular mechanism by which small molecules of double stranded RNA modulate gene ex-pression acting on the concentration and/or availability of a given messenger RNA. Almost 10 years after Fire and Mello received the Nobel Prize for the discovery of this mechanism in flat worms, RNA interference is on the edge of becoming a new class of therapeutics. With various phase III studies underway, the following years will determine whether RNAi-therapeutics can rise up to the challenge and become mainstream medicines. The present review gives a thorough overview of the current status of this technology focusing on the path to the clinic of this new class of compounds.
    Full-text · Article · Jun 2015
    • "During the recent past, there has been a remarkable progress in tumor-targeted delivery of RNAi agents (namely, small interfering RNA, or siRNA, molecules). Many lipid-and polymer-based delivery systems have shown great promise (Aleku et al., 2008; Bartlett et al., 2007; Jarvis, 2009; Judge et al., 2009; Li et al., 2008; Rozema et al., 2007; Yagi et al., 2009); among them, as of September 2013, ten cases have reached clinical trial stages in the US (ClinicalTrials.gov ID NCT00689065, 2008; ClinicalTrials.gov "
    [Show abstract] [Hide abstract] ABSTRACT: Tumor cells exhibit drug resistant phenotypes that decrease the efficacy of chemotherapeutic treatments. The drug resistance has a genetic basis that is caused by an abnormal gene expression. There are several types of drug resistance: efflux pumps reducing the cellular concentration of the drug, alterations in membrane lipids that reduce cellular uptake, increased or altered drug targets, metabolic alteration of the drug, inhibition of apoptosis, repair of the damaged DNA, and alteration of the cell cycle checkpoints (Gottesman et al. , 2002, Holohan et al. , 2013). siRNA is used to silence the drug resistant phenotype and prevent this drug resistance response. Of the listed types of drug resistance, pump-type resistance (e.g., high expression of ATP-binding cassette transporter proteins such as P-glycoproteins (Pgp; also known as multi-drug resistance protein 1 or MDR1)) and apoptosis inhibition (e.g., expression of anti-apoptotic proteins such as Bcl-2) are the most frequently targeted for gene silencing. The co-delivery of siRNA and chemotherapeutic drugs has a synergistic effect, but many of the current projects do not control the drug release from the nanocarrier. This means the drug payload is released before the drug resistance proteins have degraded and the drug resistance phenotype has been silenced. Current research focuses on cross-linking the carrier's polymers to prevent premature drug release, but these carriers still rely on environmental cues to release the drug payload, and the drug may be released too early. In this review, we studied the release kinetics of siRNA and chemotherapeutic drugs from a broad range of carriers. We also give examples of carriers used to co-deliver siRNA and drugs to drug-resistant tumor cells, and we examine how modifications to the carrier affect the delivery. Lastly, we give our recommendations for the future directions of the co-delivery of siRNA and chemotherapeutic drug treatments.
    Full-text · Article · Jun 2014
Show more