Kindlin-1 Regulates Integrin Dynamics and Adhesion Turnover

Abstract

Loss-of-function mutations in the gene encoding the integrin co-activator kindlin-1 cause Kindler syndrome. We report a novel kindlin-1-deficient keratinocyte cell line derived from a Kindler syndrome patient. Despite the expression of kindlin-2, the patient's cells display several hallmarks related to reduced function of β1 integrins, including abnormal cell morphology, cell adhesion, cell spreading, focal adhesion assembly, and cell migration. Defective cell adhesion was aggravated by kindlin-2 depletion, indicating that kindlin-2 can compensate to a certain extent for the loss of kindlin-1. Intriguingly, β1 at the cell-surface was aberrantly glycosylated in the patient's cells, and its expression was considerably reduced, both in cells in vitro and in the patient's epidermis. Reconstitution with wild-type kindlin-1 but not with a β1-binding defective mutant restored the aberrant β1 expression and glycosylation, and normalized cell morphology, adhesion, spreading, and migration. Furthermore, the expression of wild-type kindlin-1, but not of the integrin-binding-defective mutant, increased the stability of integrin-mediated cell-matrix adhesions and enhanced the redistribution of internalized integrins to the cell surface. Thus, these data uncover a role for kindlin-1 in the regulation of integrin trafficking and adhesion turnover.

Full text

Kindlin-1 Regulates Integrin Dynamics and Adhesion
Turnover
Coert Margadant
1
, Maaike Kreft
1
, Giovanna Zambruno
2
, Arnoud Sonnenberg
1
*
1Division of Cell Biology, The Netherlands Cancer Institute, Amsterdam, The Netherlands, 2Laboratory of Molecular and Cell Biology, IDI-IRCCS, Rome, Italy
Abstract
Loss-of-function mutations in the gene encoding the integrin co-activator kindlin-1 cause Kindler syndrome. We report a
novel kindlin-1-deficient keratinocyte cell line derived from a Kindler syndrome patient. Despite the expression of kindlin-2,
the patient’s cells display several hallmarks related to reduced function of b1 integrins, including abnormal cell morphology,
cell adhesion, cell spreading, focal adhesion assembly, and cell migration. Defective cell adhesion was aggravated by
kindlin-2 depletion, indicating that kindlin-2 can compensate to a certain extent for the loss of kindlin-1. Intriguingly, b1at
the cell-surface was aberrantly glycosylated in the patient’s cells, and its expression was considerably reduced, both in cells
in vitro and in the patient’s epidermis. Reconstitution with wild-type kindlin-1 but not with a b1-binding defective mutant
restored the aberrant b1 expression and glycosylation, and normalized cell morphology, adhesion, spreading, and
migration. Furthermore, the expression of wild-type kindlin-1, but not of the integrin-binding-defective mutant, increased
the stability of integrin-mediated cell-matrix adhesions and enhanced the redistribution of internalized integrins to the cell
surface. Thus, these data uncover a role for kindlin-1 in the regulation of integrin trafficking and adhesion turnover.
Citation: Margadant C, Kreft M, Zambruno G, Sonnenberg A (2013) Kindlin-1 Regulates Integrin Dynamics and Adhesion Turnover. PLoS ONE 8(6): e65341.
doi:10.1371/journal.pone.0065341
Editor: Mirjam M. Zegers, NCMLS, Radboud University Nijmegen Medical Center, The Netherlands
Received March 12, 2013; Accepted April 25, 2013; Published June 11, 2013
Copyright: ß2013 Margadant et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: The work was supported by a grant from DEBRA UK. The funders had no role in study design, data collection and analysis, decision to publish, or
preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: a.sonnenberg@nki.nl
Introduction
Integrins are ab heterodimeric transmembrane glycoproteins
that link the extracellular matrix to the cytoskeleton. Integrin-
ligand binding triggers the recruitment of a variety of adaptor,
structural, and signalling proteins, and the formation of adhesion
complexes such as focal adhesions (FAs) [1,2]. Cell adhesion to the
extracellular matrix is crucial for the integrity of tissues, in
particular for those that encounter great mechanical stress. In the
skin, integrins provide for the attachment of the epidermis to the
underlying basement membrane (BM). The main epidermal
integrin is the laminin (Ln)-binding integrin a6b4, which is
localized in hemidesmosomes and connects to intermediate
filaments [3]. In addition, b1-integrins such as the collagen
(Col)-binding a2b1, Ln-binding a3b1, and the RGD-binding
a9b1 integrins, which connect to the actin cytoskeleton, are
expressed in basal keratinocytes [4,5].
Many integrins can tune their affinity for ligand by conforma-
tional changes, and the switch from the low- to the high-affinity
conformation is called integrin activation [6]. Integrin activation is
promoted by the binding of talin-1 or talin-2 and any of the 3
kindlin isoforms to the cytoplasmic tail of the b-subunit [6–8]. The
kindlins consist of an F0–F3 four-point-one/ezrin/radixin/moesin
(FERM) domain, that contains the integrin-binding site in F3, and
a pleckstrin homology (PH) domain inserted into F2. Kindlin-1 is
expressed at high levels in epithelia, in particular in the epidermis
and the gastro-intestinal tract, and loss-of-function mutations in
KIND1, the gene encoding kindlin-1, cause Kindler syndrome
(KS), a congenital bullous disorder of the epidermolysis bullosa-
type [9–11].
KS is characterized by skin fragility and blistering, photosen-
sitivity and poikiloderma, while some patients also suffer from
colitis [12–17]. Hemidesmosomes appear unaffected in KS
patients and the defects result from compromised function of b1-
integrins. Indeed, the defects are reminiscent of the abnormalities
in mice lacking the a3 or the b1 subunit in the epidermis, as well
as of patients carrying mutations in the ITGA3 gene encoding a3
[12–22]. In vitro, keratinocytes isolated from KS patients or
keratinocytes in which kindlin-1 expression is suppressed, display
several abnormalities related to defects in b1 integrin function,
including reduced cell adhesion, cell spreading, and polarity [23–
25].
In this paper, we describe a novel kindlin-1-deficient keratino-
cyte cell line derived from an Italian KS patient, which expresses
kindlin-2 but not kindlin-1. We investigated functional redundancy
between the kindlins, and identified a role for kindlin-1 in the
regulation of adhesion turnover and integrin trafficking.
Results and Discussion
Defects in b1 Integrin Function in Kindler Syndrome Cells
that Express Kindlin-2 but not Kindlin-1
We isolated kindlin-1-deficient keratinocytes from a previously
described male KS patient from Italy [26]. This patient is
homozygous for the mutation c.1161delA within exon 10 (Fig. 1A).
We first investigated kindlin-1 protein expression by Western
blotting, using an antibody directed against an epitope in the F1
domain [24]. Full-length kindlin-1 was clearly detected at the
expected size (,75 kDa) in lysates of normal human keratinocytes
PLOS ONE | www.plosone.org 1 June 2013 | Volume 8 | Issue 6 | e65341

(NHK) isolated from a healthy individual [27], but not KS cells
(Fig. 1B). In contrast, kindlin-2 expression was detected in both
NHK and KS keratinocytes (Fig. 1B). The morphology of the KS
cells was highly abnormal, as compared to that of NHK (Fig. 1C).
In addition, cell growth was compromised and large numbers of
dead cells were regularly observed in KS, but not in NHK cultures
(Fig. 1C and unpublished data). To establish whether the observed
abnormalities were due to defects in integrin-mediated adhesion,
we measured cell adhesion to Col-1, a ligand for integrin a2b1,
and to a Rac-11P cell-derived matrix rich in Ln-332, a ligand for
integrin a3b1 [21]. Adhesion of KS cells to these ligands was
indeed significantly impaired, and only a fraction of the adherent
cells spread properly over the substratum (Figs. 1D,E). Consistent
with reduced integrin-mediated adhesion, cell motility was
significantly enhanced (Figs. 1F,G). We and other groups have
previously observed a similar increase in keratinocyte migration
upon loss of a3b1, both in cultured keratinocytes and in the
epidermis [21,28–30]. However, it should be noted that conflicting
results have been reported with regard to keratinocyte migration
in the absence of kindlin-1 [24,31]. Similarly, either impaired or
increased migration have been described for keratinocytes isolated
from epidermolysis bullosa patients that lack Ln-332 [32–36].
Discrepancies in cell migration between different cell lines may
derive from the integrin repertoire expressed on the cell-surface,
the relative abundance of a particular integrin, and the density of
available ligand. Indeed, as migrating cells must be able to attach
and exert traction, but also to detach from the substratum, the
velocity of migration is a biphasic function of adhesion strength
[37]. Finally, we studied the organization of the actin cytoskeleton
and the presence of FAs, using phalloidin and an antibody against
phosphotyrosines P(Y). P(Y)-staining was generally weak in KS
keratinocytes, and actin filaments appeared abnormal (Figure 1H).
In contrast, the synthesis and deposition of Ln-332 in KS cells was
not impaired, although the pattern of deposition seemed different
from that of NHK cells (Fig. S1). However, because patterns of
Ln-332 deposition can differ considerably between cell lines,
which often reflects differences in cell motility [21,29,38], it is
uncertain whether the differences observed here are a direct
consequence of kindlin-1 loss. In summary, we have isolated a
kindlin-1-deficient keratinocyte cell line that displays defects in b1
integrin function, despite the presence of kindlin-2.
Kindlin-1 and Kindlin-2 are Partially Redundant, and b1
Expression is Decreased in Kindlin-1-deficient
Keratinocytes and Epidermis
We next investigated the cell-surface expression and activation
status of b1-integrins in KS and NHK cells by flow cytometry.
Interestingly, b1 cell-surface expression was significantly reduced
(about two-fold), whereas the activation status, as judged by the
ratio of 9EG7 staining over total b1 staining, was slightly (but not
significantly) increased (Fig. 2A). The reduction of b1 levels at the
cell surface was accompanied by reduced expression of associated
a2 and a3-subunits, while b4 levels were normal (Fig. S2).
Decreased expression of b1 in KS cells was further confirmed by
Western blotting (Fig. 2B). We then analysed skin biopsies of the
same patient. Ln-332 staining revealed BM abnormalities and
detachment of keratinocytes in the patient’s epidermis (Fig. 2C;
indicated by arrows), typical of KS [24,39], and the expression of
b1 was strikingly decreased (Fig. 2C). Thus, whereas there is a
clear reduction in b1 expression, both in vivo and in vitro,b1
activation in the KS cells is not impaired. The latter finding is
reminiscent of keratinocytes derived from the kindlin-1 knockout
mice, in which integrin-mediated cell adhesion and cell spreading
were compromised whereas there was no significant reduction in
integrin activation, due to the presence of kindlin-2 [40]. We
therefore introduced shRNAs directed against kindlin-2 into KS
cells by lentiviral transduction. Depletion of kindlin-2 caused
massive detachment of KS cells (Fig. 2D). Previous studies have
reported both overlapping and distinct functions of kindlin-1 and
kindlin-2 in keratinocytes [41,42]. Our results are in line with these
findings as kindlin-2 can apparently partially rescue cell adhesion
in the absence of kindlin-1, but considerable defects in cell
adhesion and spreading remain. In vivo, kindlin-2 cannot
completely compensate for the loss of kindlin-1, either in the
epidermis of KS patients, or in the colon of kindlin-1(2/2) mice
[40,43], which is probably due to differences in subcellular
localization [11]. We therefore investigated kindlin-2 distribution
in vivo. Consistent with its expression in NHK and KS cells,
kindlin-2 was detected both in the patient’s epidermis and in the
epidermis of a normal individual. In basal keratinocytes kindlin-2
localization was exclusively lateral, while kindlin-1 distribution in
normal epidermis was predominantly basal, in line with previous
observations (Fig. 2E) [11,43]. Interestingly, kindlin-2 staining at
the lateral membranes was weak and occasionally completely
absent from the basal keratinocyte layer of the patient (Fig. 2E;
indicated by arrows), which most likely reflects defects in cell-cell
contacts as we described previously [44].
Together, these data show that b1 expression is reduced in KS
cells and epidermis, and that kindlin-2 compensates only partially
for reduced cell adhesion in the absence of kindlin-1.
Stable Re-expression of Kindlin-1 in KS Cells Restores the
Defects in Integrin Function
The previous sections have shown that in the absence of kindlin-
1, integrin-dependent events are disturbed despite the presence of
kindlin-2. To investigate whether the observed defects in KS cells
are a direct consequence of the loss of kindlin-1, kindlin-1
expression was restored in KS cells by retroviral delivery of eGFP-
conjugated kindlin-1 followed by FACS sorting, creating a stable
cell line that we designated KSK. Expression of eGFP-kindlin-1
was confirmed by Western blotting (Fig. 3A). Kindlin-1 restored
the aberrant morphology of KS cells to normal keratinocyte
morphology (Fig. 3B, compare to Fig. 1C), and significantly
enhanced cell proliferation (Fig. 3C). Kindlin-1 was diffusely
distributed in the cytoplasm, while some enrichment in P(Y)-
positive FAs was observed. In addition, a re-organization of the
actin cytoskeleton into stress fibers and/or circumferential actin
bundles was observed in KSK cells (Fig. 3D). Re-expression of
kindlin-1 reversed the two-fold decrease in cell adhesion as
compared to NHK cells, both to Col-1 and to Ln-332-containing
matrix (Figs. 3E, 1D). Moreover, the decrease in the number of
spread cells was similarly reversed (Figs. 3F, 1E), and the average
surface area of KSK cells was about two-fold greater than that of
KS cells (Figure 3G). Finally, the enhanced migration of KS cells
was decreased by re-introduction of kindlin-1 (Figs. 3H,I and
Figs. 1F,G). To investigate whether the re-expression of kindlin-1
also normalized integrin expression on the cell-surface, we
analyzed b1 cell-surface levels by flow cytometry. Expression of
b1 on the plasma membrane was up to two-fold higher in KSK
cells than in KS (comparable to those in NHK) (Figs. 3J, 2A). The
promoting effect of kindlin-1 on integrin cell-surface levels is in line
with several previous studies [45–47], and was further supported
by the observation that overexpression of kindlin-1 also enhanced
b1 cell-surface expression in NHK cells, which was accompanied
by increased cell spreading (Fig. S3).
Together, these data show that kindlin-1 expression in KS cells
rescues the defects in b1 integrin function, and restores the KS
phenotype to that of normal keratinocytes.
Kindlin-1 Regulates Integrin Dynamics
PLOS ONE | www.plosone.org 2 June 2013 | Volume 8 | Issue 6 | e65341

Regulation of b1 Expression and Function by Kindlin-1
Requires the F3 Domain
We next investigated whether the effects of kindlin-1 depend on
a direct interaction with the integrin b1-tail. The integrin-binding
site in kindlin-1 resides in the C-terminal F3 domain, and a
mutation that causes the expression of a protein lacking the F3 and
part of the F2 has been identified in a KS patient, demonstrating
the vital importance of this region [48]. In addition, we have
recently isolated a zebrafish mutant with KS-like epidermal
defects, which expresses a truncated kindlin-1 protein lacking the
F3 domain [44]. To delete the integrin-binding site, we truncated
the F3 region after residue 581, and stably expressed eGFP-
kindlin-1
del581
into KS cells, creating a cell line designated
KSK
del581
(Fig. 4A). Western blotting revealed a band of the
expected size of ,95 kDa in KSK
del581
cells (Fig. 4B). Intriguingly,
increased expression of mature b1, but not precursor b1, was
observed in KSK cells but not in KSK
del581
, suggesting that a
direct interaction is required for the stimulation of b1 cell-surface
expression by kindlin-1. Furthermore, the mobility of mature b1in
gel electrophoresis was reduced in lysates of KS and KSK
del581
as
compared to that of KSK cells (Fig. 4C). This phenomenon was
abolished by treatment of immuno-precipitated b1 with neur-
aminidase, indicating that kindlin-1 regulates b1 sialylation in a
manner dependent on the F3 domain (Fig. 4D). Flow cytometry
analysis confirmed that whereas the full-length kindlin-1 increased
b1 cell-surface expression to wild-type levels (i.e. as in NHK),
mutant kindlin-1 did not (Fig. 4E). Furthermore, expression of full-
length kindlin-1 enhanced cell spreading about two-fold (compa-
rable to that of NHK), but eGFP-kindlin-1
del581
did not promote
cell spreading (Fig. 4F). Consistently, FAs seemed less pronounced
in KSK
del581
than in KSK cells, and the subcellular distribution of
mutant kindlin-1 was different from that of full-length kindlin-1;
kindlin-1
del581
localization seemed predominantly cytoplasmic,
with no clear enrichment in adhesions (Fig. 4G). These results are
in line with the observation that wild-type kindlin-1, when
overexpressed in fibroblasts, is targeted to FAs and increases
cell-surface expression of a5b1, whereas kindlin-1 mutants that do
not interact with the b1-tail are unable to do so [45].
Together, these data suggest that a direct interaction between
kindlin-1 and b1 is required for the targeting of kindlin-1 to cell-
Figure 1. Abnormalities in KS cells. A) Schematic representation of the KIND1 gene (top), indicating the position of the c.1161delA mutation, and
kindlin-1 protein (bottom). Exons are represented by boxes, introns are not to scale. B) Western blot showing the expression of kindlin-1 and kindlin-2
in NHK and KS cells. C) Phase/contrast images of NHK and KS cells. Bar, 20 mm. D) Adhesion of KS cells to Col-1 and Ln-332, expressed relative to that
of NHK. Shown are the averages 6SEM from 3 independent experiments. E) Cell spreading of NHK and KS cells on Col-1. Shown are the averages
6SEM from 3 independent experiments. F) Rose-plots depicting migration tracks of NHK and KS cells. G) Quantification of the velocity of cell
migration (Bars represent averages 6SEM from ,250 cells out of 3 experiments). H) Confocal images of FAs, visualized using an antibody against P(Y)
(green), and F-actin (red). Scale bar, 10 mm.
doi:10.1371/journal.pone.0065341.g001
Kindlin-1 Regulates Integrin Dynamics
PLOS ONE | www.plosone.org 3 June 2013 | Volume 8 | Issue 6 | e65341

matrix adhesions, and for the effects of kindlin-1 on b1 cell-surface
expression and glycosylation.
Targeting of Kindlin-1 to Adhesions and Adhesion
Dynamics Depend on the F3 Domain
We next addressed the relationship between kindlin-1 targeting
to adhesions and adhesion dynamics in living cells. To this end, we
introduced the FA marker vinculin, fused to mCherry, into KS,
KSK, and KSK
del581
cells by lentiviral transduction. The
dynamics of eGFP-kindlin-1 and mCherry-vinculin were then
monitored by total internal reflection (TIRF) microscopy. Consis-
tent with the results of the cell migration assays, KS cells were very
motile and displayed many rapid shape changes. Imaging of
vinculin revealed few FAs that had a high turnover rate (Movie S1
and Fig. 5A). In contrast, KSK cells were considerably more static,
in line with the reduced migration speed, and their adhesions were
much more stable than those in KS cells (Movie S2 and Fig. 5B).
Interestingly, eGFP-kindlin-1 was clearly enriched in adhesions,
some of which were surprisingly large, but many of these clusters
did not contain mCherry-vinculin, suggesting that kindlin-1 and
vinculin can reside in distinct pools of adhesions (Movie S2 and
Fig. 5B). Furthermore, kindlin-1 was strongly concentrated in
retraction fibers, consistent with the role of kindlin-1 in delaying
cell migration. In KSK
del581
cells, we also observed a rapid
turnover of mCherry-vinculin-containing adhesions, as well as fast
shape changes. Consistent with the images acquired by confocal
microscopy, there was some diffuse localization of eGFP-kindlin-
1
del581
at the basal cell-surface, but clearly no enrichment in
adhesions or retraction fibers (Movie S3 and Fig. 5C).
Thus, kindlin-1 controls the dynamics of integrin-mediated cell-
matrix adhesions, which is dependent on an intact F3 region.
Figure 2. Decreased integrin expression in the absence of kindlin-1. A) FACS histograms (top) and quantification (bottom; average 6SEM
from 3 independent experiments) of NHK and KS cells showing cell-surface expression of b1 (left) and active b1 (right), as measured by 9EG7 staining.
AU, arbitrary units. B) Western blot showing the precursor b1 (110 kDa) and the mature form of b1 (130 kDa) in NHK and KS cells. C) Expression of b1
(green) and Ln-332 (red) in the skin of an unaffected individual (normal) and the KS patient. The upper border of the epidermis is indicated with a
white line. Bar, 50 mm. d; dermis, e; epidermis. D) Depletion of kindlin-2 causes detachment of KS cells. The numbers above the blot indicate the
normalized kindlin-2 expression in the remaining (attached) cells, relative to that in untreated cells. Bar, 20 mm. E) Expression of kindlin-1 (top) and
kindlin-2 (bottom) in the skin. Bar, 50 mm. d; dermis, e; epidermis.
doi:10.1371/journal.pone.0065341.g002
Kindlin-1 Regulates Integrin Dynamics
PLOS ONE | www.plosone.org 4 June 2013 | Volume 8 | Issue 6 | e65341

Kindlin-1 Interaction with b1 Regulates Integrin Traffic
We next investigated whether integrin trafficking plays a role in
the regulation of cell-matrix adhesion dynamics and b1 surface
expression by kindlin-1. Integrins undergo continuous internali-
zation, and the recycling of internalized integrins is important for
integrin-mediated processes such as cell spreading [49,50].
Internalization and recycling were determined according to a
well-established protocol [51]. First, we labeled cell-surface b1
with the antibody K20, conjugated to DyLight 649 (10 mg/ml),
which clearly revealed localisation of b1 integrins at the
membrane in KS, KSK, and KS cells (Fig. 6, top). The cells
were then transferred to serum-free medium at 37uC, which allows
internalization but not recycling of internalized integrins. The
labeled cell-surface pool underwent internalization in all cell lines,
with no apparent differences that can be ascribed to kindlin-1
(Fig. 6, middle panel). Recycling of internalized integrins was
subsequently induced by stimulation with 20% FCS, which in the
majority of KSK cells (77%) triggered the rapid return of b1
integrins to the plasma membrane and their delivery to peripheral
adhesions (Fig. 6, bottom). In contrast, redistribution of the
internal integrin pool to the plasma membrane was observed only
in a small fraction of KS cells (20%) or KS cells expressing
truncated kindlin-1 (29%), indicating that kindlin-1 regulates the
redistribution of internalized integrins, which is dependent on the
F3 domain. A role for kindlin-2 and kindlin-3 in integrin
trafficking has been suggested in previous studies, but the
mechanism remains to be elucidated [47,52]. We did not detect
kindlin-1 in vesicles, in line with similar observations for kindlin-2
[46,53]. Therefore, kindlin-1 probably regulates integrin routing
indirectly, i.e. by sorting integrins at the plasma membrane to a
specific internalization and recycling pathway. This is conceivable
as the kindlin-binding site in b1 is largely defined by the
membrane-distal NPxY motif, which is also a canonical signal
for clathrin-mediated endocytosis.
In summary, the results presented here suggest that kindlin-1
regulates the redistribution of internalized integrins, which
requires a direct kindlin-integrin interaction.
Materials and Methods
Antibodies, Plasmids and other Materials
Plasmids encoding eGFP-kindlin-1 or mCherry-Vinculin were
generously donated by Dr. Reinhard Fassler and Dr. Johan de
Rooij, respectively. Antibodies used in this study were directed
Figure 3. Re-expression of kindlin-1 in KS cells. A) Western blot showing expression of eGFP-kindlin-1 in KS and KSK cells. B) Morphology of KS
and KSK cells. Bar, 20 mm. C) Proliferation of KS and KSK cells. Shown are the averages 6SEM from 3 independent experiments. D) eGFP-kindlin-1
(green), FAs (blue) and F-actin (red) in KSK cells. Bar, 5 mm. E) Cell adhesion to Col-1 and Ln-332 in KS and KSK cells. Bars represent averages 6SEM of
3 independent experiments. AU, arbitrary units. F) Number of KS and KSK cells spread on Ln-332 and Col-1. Shown are the average values 6SEM from
,500 cells out of a representative experiment. G) Surface area of KS and KSK cells on Ln-332 and Col-1. Shown are the averages 6SEM from ,500
cells of a representative experiment. H) Rose-plots depicting migration tracks of KS and KSK cells generated by time-lapse video microscopy. I)
Quantification of the velocity of cell migration (average 6SEM from ,300 cells out of 3 experiments). J) FACS histograms of NHK and KS cells
showing b1 cell-surface expression (left) and quantification (average 6SEM from 3 independent experiments) (right). AU, arbitrary units.
doi:10.1371/journal.pone.0065341.g003
Kindlin-1 Regulates Integrin Dynamics
PLOS ONE | www.plosone.org 5 June 2013 | Volume 8 | Issue 6 | e65341

against actin (clone C4; Chemicon), a-tubulin (clone B5-1-2;
Sigma-Aldrich), GFP (Covance), the integrin a6-subunit (GoH3),
the integrin b1-subunit (clone TS2/16; Developmental Studies
Hybridoma Bank, clone 9EG7; a kind gift from Dr. Dietmar
Vestweber, clone K-20; a kind gift from Dr. Andre van Agthoven;
and clone 18 from BD Transduction laboratories), the integrin a2-
subunit (10G11), the integrin a3-subunit (J143), the integrin a5-
subunit (SAM-1), the integrin b4-subunit (439-9B), kindlin-1 (KS-
4; a kind gift from Dr. Cristina Has), kindlin-2 (Sigma-Aldrich),
kindlin-2 (a kind gift from Dr. Reinhard Fassler), Ln-332 (a kind
gift from Dr. Takako Sasaki), plectin (a kind gift from Dr. Katsushi
Owaribe), and P(Y) (clone 4G10; a kind gift from Dr. Kevin
Wilhelmsen). Neuraminidase, puromycin and zeocin were from
Sigma-Aldrich. TRITC-, FITC-, and Cy5-conjugated secondary
antibodies, phalloidin, and DAPI were purchased from Molecular
Probes (Eugene, OR), HRP-conjugated secondary antibodies were
from Amersham, and Col-I was from Vitrogen (Nutacon,
Leimuiden, The Netherlands). K-20 was conjugated to DyLight
649 (Thermo Scientific) at the NKI.
Patient Material, Cell Culture, Cloning, Retroviral and
Lentiviral Transductions
The use of skin biopsies and keratinocytes from KS patients for
research purposes has been approved by the Local Ethics
Committee of the Istituto Dermopatico dell’Immacolata (03/07/
2007; study: ‘‘Epithelial adhesion disorders: molecular mecha-
nisms, development and validation of diagnostic procedures’’).
Skin biopsies and primary KS keratinocytes were obtained after
written informed consent for use in research from a previously
described patient [26], and immortalized by SV40 infection. NHK
cells were isolated from human foreskin of a healthy individual,
and immortalized by transfection with full-length HPV 16 DNA as
Figure 4. Regulation of b1 expression and cell spreading by kindlin-1 require the F3 domain. A) Schematic representation of full-length
kindlin-1 (top) and kindlin-1
del581
(bottom). B) Expression of full-length eGFP-kindlin-1 and eGFP-kindlin-1
del581
in KSK and KSK
del581
cells. C)
Expression of precursor b1 (110 kDa) and mature b1 (130 kDa) in KS, KSK, and KSK
del581
cells. Expression of mature b1 was quantified by
densitometry, normalized to actin, and expressed relative to the expression in KSK cells. Shown are the values acquired from a representative blot. D)
Immunoprecipitated b1 was treated with neuraminidase (NANase) and analyzed by Western blotting. E) FACS histograms (left) and averages 6SEM
quantified from 3 independent experiments (right) of b1 cell-surface expression in KS, KSK, KSK
del581
, and NHK, expressed relative to that in KS. F)
Phase-contrast images of KS, KSK, KSK
del581
and NHK on Col-1 (left), and average surface area 6SEM of KS, KSK, KSK
del581
and NHK cells (quantified
from ,250 cells from a representative experiment) (right). Bar, 10 mm. G) Subcellular distribution of eGFP-kindlin-1 and eGFP-kindlin-1
del581
(green).
FAs (blue), F-actin (red). Bar, 5 mm.
doi:10.1371/journal.pone.0065341.g004
Kindlin-1 Regulates Integrin Dynamics
PLOS ONE | www.plosone.org 6 June 2013 | Volume 8 | Issue 6 | e65341

described previously [27]. NHK and KS cells were routinely
cultured on Col-1 (3 mg/ml) in standard keratinocyte medium
(Gibco BRL), supplemented with 50 mg/ml bovine pituitary
extract, 5 ng/ml EGF, 100 U/ml penicillin and 100 U/ml
streptomycin. Rac-11P cells were cultured in DMEM supple-
mented with 10% FCS, 100 U/ml penicillin and 100 U/ml
streptomycin. All cells were maintained at 37uC and 5% CO
2
.
eGFP-kindlin-1
del581
was generated using eGFP-kindlin-1 in C1.
Full-length or truncated kindlin-1 were recloned into LZRS-IRES-
zeo, and transfected into Phoenix packaging cells using the
Calcium Phosphate method. Virus-containing supernatant was
isolated 48 hrs later and stable expression in KS cells was achieved
by retroviral transduction, followed by selection with zeocin and
cell sorting. Expression of mCherry-vinculin was established by
lentiviral transduction of the pLV-CMV-mCherry-Vinculin-Ires-
Puro-construct, followed by selection with 5 mg/ml puromycin.
Knockdown of Kindlin-2 in KS Cells
Short hairpins against human kindlin-2 (target sequence
CGACTGATATAACTCCTGAAT), cloned into pLKO.1, were
obtained from the TRC shRNA Open Biosystems library and
transfected into HEK 293 FT cells together with the Virapower
TM
Packaging mix (Invitrogen), using Lipofectamine 2000 according
to the manufacturers’ instructions. Viral supernatant was harvest-
ed 48 hrs later, transduced into KS cells, and positive cells were
selected with puromycin.
Figure 5. Kindlin-1 targeting to adhesions and adhesion stability depend on the F3 domain. A) Stills from a TIRF movie, showing the
dynamics of mCherry-vinculin in KS cells. B) Dynamics of mCherry-vinculin (top), and eGFP-kindlin-1 (bottom) in KSK cells. C) Dynamics of mCherry-
vinculin (top), and eGFP-kindlin-1 (bottom) in KSK
del581
cells. Look-up table ‘fire’ was used to enhance visibility of adhesions. Shown are images at 0,
7.5, 15, 22.5, and 30 min. Boxed regions are enlarged. Arrows indicate retraction fibers. Bar, 10 mm.
doi:10.1371/journal.pone.0065341.g005
Kindlin-1 Regulates Integrin Dynamics
PLOS ONE | www.plosone.org 7 June 2013 | Volume 8 | Issue 6 | e65341

Flow Cytometry and Cell Sorting
For flow cytometry and cell sorting, cultured cells were
trypsinized, washed twice in PBS containing 2% FCS, and
incubated with primary antibodies for 45 min at 4uC. Cells were
then washed twice in 2% FCS/PBS, incubated with appropriate
secondary antibodies for 45 min at 4uC, washed twice in 2%
FCS/PBS, and analyzed on a FACS Calibur (BD Biosciences).
Alternatively, the cells were sorted on a MoFlo High Speed Cell
Sorter (Beckman Coulter).
Immunoprecipitations and Western Blotting
Cells were washed in ice-cold PBS and lysed on ice in RIPA
buffer (25 mM Tris/HCl pH 7.6, 150 mM NaCl, 1% NP-40,
0.5% sodium deoxycholate, 0.1% SDS), supplemented with
protease inhibitor cocktail (Sigma). Immunoprecipitation of b1
was performed essentially as described earlier [21], using TS2/16.
For Western blotting of whole-cell extracts, cell lysates were
cleared by centrifugation at 13,0006g, heated at 95uC in SDS
sample buffer (50 mM Tris-HCl pH 6.8, 2% SDS, 10% glycerol,
1% b-mercaptoethanol, 12.5 mM EDTA, 0.02% bromophenol
blue), and proteins were resolved by SDS-PAGE, after which they
were transferred to polyvinylidene difluoride membranes (Milli-
pore) and analyzed by Western blotting followed by ECL using the
SuperSignal system (Pierce Chemical Co.).
Microscopy
Phase-contrast images were acquired on a Zeiss microscope
(Axiovert 25) at 106(NA 0.25) or 206(NA 0.3) magnification,
using a Zeiss CCD camera (Axiocam MRC) and Zeiss Mr. Grab
1.0 software. For confocal microscopy, cryosections of human skin
or cells cultured on coverslips were prepared as previously
described [21], and images were acquired on an inverted confocal
Figure 6. Kindlin-1 interaction with b1 regulates integrin trafficking. Cell-surface b1 integrins on KS, KSK, and KSK
del581
cells were labelled
with DyLight 649-conjugated K-20 at 4uC (top panel), after which they were allowed to internalize in serum-free medium at 37uC for 2 hrs (middle
panel). Recycling of the internal pool was induced with 20% FCS for 7.5 min (bottom panel). Cells were then fixed and processed for confocal
microscopy. b1 is pseudo-colored green, nuclei were counterstained with DAPI (pseudocolored red). Arrows indicate delivery of recycled b1to
adhesions. Percentages of cells with recycled integrins are shown (from ,120 cells out of 3 independent experiments). Bar, 10 mm.
doi:10.1371/journal.pone.0065341.g006
Kindlin-1 Regulates Integrin Dynamics
PLOS ONE | www.plosone.org 8 June 2013 | Volume 8 | Issue 6 | e65341

microscope (Leica AOBS) using 206(NA 0.7) dry, 406(NA 1.25)
oil, and 636(NA 1.32) oil objectives (Leica). For TIRF
microscopy, cells were seeded on glass coverslips and videos were
acquired using Leica application suite software on a Leica
DMI600B system with a 636objective (NA 1.47), at 37uCinan
atmosphere containing 5% CO
2
. Images and videos were
processed using Photoshop 7.0 and ImageJ 1.44.
Adhesion, Migration, Cell Spreading, and Proliferation
Assays
For adhesion assays, 96-well plates were coated with 2% BSA or
3mg/ml Col-1 for 1 hr at 37uC. Ln-332-containing matrix was
prepared by growing Rac-11P cells to confluency, prior to
overnight detachment with 10 mM EDTA at 4uC. The plates
were then washed twice with PBS, blocked with 2% BSA for 1 hr
at 37uC, and washed twice with PBS before use. Subconfluent cells
were trypsinized and seeded at a density of 3610
4
cells per well.
After 30 min at 37uC, nonadherent cells were removed by
washing with PBS. The adherent cells were fixed in 4% PFA,
washed with H2O, stained for 10 min with crystal violet, washed
with H2O, and then lysed in 2% SDS. Absorbance was measured
at 490 nm on a microplate reader. Background values (binding to
BSA) were subtracted from all other values.
To determine cell spreading, cells were seeded in 12-well plates
coated with Col-1 or Rac-11P matrix. Cells were photographed on
a Widefield CCD system using 106and 206dry lens objectives
(Carl Zeiss MicroImaging, Inc.). The number of spread cells was
counted and expressed as a percentage of the total number of cells.
Alternatively, the surface area was determined using ImageJ.
Values shown represent the averages of 3 experiments. In each
experiment, approximately 500 cells were analyzed for each
condition.
For single-cell migration assays, cells were seeded sparsely on
3mg/ml Col-1, and phase-contrast images were captured every
15 min at 37uC and 5% CO
2
on a Widefield CCD system using a
106dry lens objective (Carl Zeiss MicroImaging). Migration
tracks were generated using ImageJ 1.44, and the average velocity
was calculated from approximately 250 cells out of 3 independent
experiments.
Proliferation was investigated by seeding cells in 6-well plates,
coated with 3 mg/ml Col-1, at a density of 5610
4
cells per well,
whereafter they were trypsinized and counted every day. Values
shown represent the averages of 3 experiments.
Integrin Internalization and Recycling Assays
Integrin internalization and recycling was investigated essen-
tially as described earlier with some modifications [51]. Briefly,
cells on glass coverslips were incubated for 2 hrs at 37uC in serum-
free medium, after which they were washed twice in the same
medium at 4uC. Cell-surface b1 was then labeled with DyLight
649-conjugated K-20 (10 mg/ml) for 1 hr at 4uC. Immediately
after labeling, some coverslips were fixed, and the rest was
transferred to 37uC to undergo endocytosis. After 2 hrs, some
coverslips were fixed, and the rest was stimulated with 20% FCS
for 7.5 min to stimulate recycling of internalized integrins. The
cells were fixed, permeabilized with 0.5% Triton and 0.01%
saponin, and then processed for confocal microscopy as described
above. The number of cells with recycled integrins was scored
from confocal images (,120 cells out of 3 independent experi-
ments).
Supporting Information
Figure S1 Ln-332 deposition is not impaired in KS cells.
Ln-332 deposition (green) in NHK and KS cells. Keratinocytes
derived from a Junctional Epidermolysis Bullosa (JEB) patient,
carying a mutation in the LAMC2 gene encoding the c2 chain of
Ln-332, were included as a negative control. F-actin, red. Bar,
20 mm.
(TIF)
Figure S2 Integrin expression in NHK and KS cells. Cell-
surface expression of a3, a2, a5, and b4 subunits on NHK and KS
cells was measured by flow cytometry.
(TIF)
Figure S3 Overexpression of kindlin-1 in NHK cells
promotes b1 cell-surface expression and cell spreading.
A) Western blot showing overexpression of eGFP-kindlin-1 in
NHK cells (NHK
kind-1
). B) FACS histogram showing b1 cell-
surface expression on NHK and NHK
kind-1
cells. C) Phase/
contrast images of NHK and NHK
kind-1
cells on Col-1 (top) and
quantification of average cell area (bottom). AU, arbitrary units.
Bar, 10 mm.
(TIF)
Movie S1 Dynamics of mCherry-vinculin in KS cells.
Dynamics of mCherry-vinculin at the cell-substratum interface
were monitored by TIRF microscopy on Col-1-coated glass
coverslips. Penetration depth 90 nm, image interval 30 sec, total
time 30 min. ImageJ lookup table ‘fire’ was used to enhance
visibility.
(AVI)
Movie S2 Dynamics of mCherry-vinculin and eGFP-
kindlin-1 in KSK cells. Dynamics of mCherry-vinculin (left)
and eGFP-kindlin-1 (right) at the cell-substratum interface were
monitored by TIRF microscopy on Col-1-coated glass coverslips.
Penetration depth 90 nm, image interval 30 sec, total time
30 min. ImageJ lookup table ‘fire’ was used to enhance visibility.
(AVI)
Movie S3 Dynamics of mCherry-vinculin and eGFP-
kindlin-1
del581
in KSK
del581
cells. Dynamics of mCherry-
vinculin (left) and eGFP-kindlin-1 (right) at the cell-substratum
interface were monitored by TIRF microscopy on Col-1-coated
glass coverslips. Penetration depth 90 nm, image interval 30 sec,
total time 30 min. ImageJ lookup table ‘fire’ was used to enhance
visibility.
(AVI)
Acknowledgments
We are grateful to Andre van Agthoven, Reinhard Fassler, Cristina Has,
Katsushi Owaribe, Johan de Rooij, Takako Sasaki, Dietmar Vestweber,
and Kevin Wilhelmsen for their generous gifts of antibodies or constructs.
We thank Lauran Oomen and Lenny Brocks for their excellent assistance
with TIRF and confocal microscopy, and Anita Pfauth and Frank van
Diepen for expert technical assistance with FACS. Many thanks to Ana
Jimenez Orgaz and Tomas Meijer for technical support.
Author Contributions
Conceived and designed the experiments: CM AS. Performed the
experiments: CM MK AS. Analyzed the data: CM AS. Contributed
reagents/materials/analysis tools: GZ. Wrote the paper: CM AS.
Kindlin-1 Regulates Integrin Dynamics
PLOS ONE | www.plosone.org 9 June 2013 | Volume 8 | Issue 6 | e65341

References
1. Legate KR, Fassler R (2009) Mechanisms that regulate adaptor binding to b-
integrin cytoplasmic tails. J Cell Sci 122: 187–198.
2. Geiger B, Yamada KM (2011) Molecular architecture and function of matrix
adhesions. Cold Spring Harb Perspect Biol 3, doi:10.1101/cshperspect.a005033.
3. Margadant C, Frijns E, Wilhelmsen K, Sonnenberg A (2008) Regulation of
hemidesmosome disassembly by growth factor receptors. Curr Opin Cell Biol
20: 589–596.
4. Watt FM (2002) Role of integrins in regulating epidermal adhesion, growth and
differentiation. EMBO J 21: 3919–3926.
5. Margadant C, Charafeddine RA, Sonnenberg A (2010) Unique and redundant
functions of integrins in the epidermis. FASEB J 24: 4133–4152.
6. Kim C, Ye F, Ginsberg MH (2011) Regulation of integrin activation. Annu Rev
Cell Dev Biol 27: 321–345.
7. Larjava H, Plow EF, Wu C (2008) Kindlins: essential regulators of integrin
signalling and cell-matrix adhesion. EMBO Rep 9: 1203–1208.
8. Meves A, Stremmel C, Gottschalk K, Fassler R (2009) The kindlin protein
family: new members to the club of focal adhesion proteins. Trends Cell Biol 19:
504–513.
9. Jobard F, Bouadjar B, Caux F, Hadj-Rabia S, Has C, et al. (2003) Identification
of mutations in a new gene encoding a FERM family protein with a pleckstrin
homology domain in Kindler syndrome. Hum Mol Genet 12: 925–935.
10. Siegel DH, Ashton GH, Penagos HG, Lee JV, Feiler HS, et al. (2003) Loss of
kindlin-1, a human homolog of the Caenorhabditis elegans actin-extracellular
matrix linker protein UNC-112, causes Kindler syndrome. Am J Hum Genet 73:
174–187.
11. Ussar S, Wang HV, Linder S, Fassler R, Moser M (2006) The kindlins:
subcellular localization and expression during murine development. Exp Cell
Res 312: 3142–3151.
12. Ashton GHS (2004) Kindler syndrome. Clin Exp Dermatol 29: 116–121.
13. White SJ, McLean WH (2005) Kindler surprise: mutations in a novel actin-
associated protein cause Kindler syndrome. J Dermatol Sci 38: 169–175.
14. Lai-Cheong JE, McGrath JA (2010) Kindler syndrome. Dermatol Clin 28: 119–
124.
15. Has C, Castiglia D, del Rio M, Diez MG, Piccinni E, et al (2011) Kindler
syndrome: extension of FERMT1 mutational spectrum and natural history.
Hum Mutat 32:1204–1212.
16. Sadler E, Klausegger A, Muss W, Deinsberger U, Pohla-Gubo G, et al. (2006)
Novel KIND1 gene mutation in Kindler syndrome patients with severe gastro-
intestinal tract involvement. Arch Dermatol 142: 1619–1624.
17. Kern JS, Herz C, Han E, Moore D, Nottelmann S, et al. (2007) Chronic colitis
due to an epithelial barrier defect: the role of kindlin-1 isoforms. J Pathol 213:
462–470.
18. DiPersio CM, Hodivala-Dilke KM, Jaenisch R, Kreidberg JA, Hynes RO (1997)
a3b1 integrin is required for normal development of the epidermal basement
membrane. J Cell Biol 137: 729–742.
19. Brakebusch C, Grose R, Quondamatteo F, Ramirez A, Jorcano JL, et al. (2000)
Skin and hair follicle integrity is crucially dependent on b1 integrin expression in
keratinocytes. EMBO J 19: 3990–4003.
20. Raghavan S, Bauer C, Mundschau G, Li Q, Fuchs E (2000) Conditional
ablation of b1 integrin in skin: severe defects in epidermal proliferation,
basement membrane formation, and hair follicle invagination. J Cell Biol 150:
1149–1160.
21. Margadant C, Raymond K, Kreft M, Sachs N, Janssen H, et al (2009) Integrin
a3b1 inhibits directional migration and wound re-epithelialization in the skin.
J Cell Sci 122: 278–288.
22. Has C, Sparta G, Kiritsi D, Weibel L, Moeller A, et al. (2012) Integrin a3
mutations with kidney, lung, and skin disease. N Engl J Med 366: 1508–1514.
23. Kloeker S, Major MB, Calderwood DA, Ginsberg MH, Jones DA (2004) The
Kindler syndrome protein is regulated by transforming growth factor-band
involved in integrin-mediated adhesion. J Biol Chem 279: 6824–6833.
24. Herz C, Aumail ley M, Schulte C, Schlotzer-Schrehardt U, Bruckner-Tuderman
L (2006) Kindlin-1 is a phosphoprotein involved in regulation of polarity,
proliferation, and motility of epidermal keratinocytes. J Biol Chem 281: 36082–
36090
25. Has C, Herz C, Zimina E, Qu HY, He Y, et al. (2009) Kindlin-1 Is required for
RhoGTPase-mediated lamellipodia formation in keratinocytes. Am J Pathol
175: 1442–1452.
26. Has C, Wessagowit V, Pascucci M, Baer C, Didona B, et al. (2006) Molecular
basis of Kindler syndrome in Italy: novel and recurrent Alu/Alu recombination,
splice site, nonsense, and frameshift mutations in the KIND1 gene. J Invest
Dermatol 126: 1776–1783.
27. Schaapveld RQ, Borradori L, Geerts D, van Leusden MR, Kuikman I, et al.
(1998) Hemidesmosome formation is initiated by the b4 integrin subunit,
requires complex formation of b4 and HD1/plectin, and involves a direct
interaction between b4 and the bullous pemphigoid antigen 180. J Cell Biol 142:
271–284.
28. Hodivala-Dilke KM, DiPersio CM, Kreidberg JA, Hynes RO (1998). Novel
roles for a3b1 integrin as a regulator of cytoskeletal assembly and as a trans-
dominant inhibitor of integrin receptor function in mouse keratinocytes. J Cell
Biol 142: 1357–1369.
29. DeHart GW, Healy KE, Jones JC (2003). The role of a3b1 integrin in
determining the supramolecular organization of laminin-5 in the extracellular
matrix of keratinocytes. Exp Cell Res 283: 67–79.
30. Kim JP, Zhang K, Kramer RH, Schall TJ, Woodley DT (1992). Integrin
receptors and RGD sequences in human keratinocyte migration: unique anti-
migratory function of a3b1 epiligrin receptor. J Invest Dermatol 98: 764–770.
31. Qu H, Wen T, Pesch M, Aumailley M (2012) Partial loss of epithelial phenotype
in kindlin-1-deficient keratinocytes. Am J Pathol 180: 1581–1592.
32. O’Toole EA, Marinkovich MP, Hoeffler WK, Furthmayr H, Woodley DT
(1997) Laminin-5 inhibits human keratinocyte migration. Exp Cell Res 233:
330–333.
33. Wen T, Zhang Z, Yu Y, Qu H, Koch M, et al. (2010) Integrin a3 subunit
regulates events linked to epithelial repair, including keratinocyte migration and
protein expression. Wound Repair Regen 18: 325–334.
34. Gagnoux-Palacios L, Vailly J, Durant-Clement M, Wagner E, Ortonne JP, et al.
(1996) Functional re-expression of laminin-5 in laminin-c2-deficient human
keratinocytes modifies cell morphology, motility, and adhesion. J Biol Chem
271: 18437–18444.
35. Hartwig B, Borm B, Schneider H, Arin MJ, Kirfel G, et al. (2007) Laminin-5
deficient human keratinocytes: defective adhesion results in a saltatory and
inefficient mode of migration. Exp Cell Res 313: 1575–1587.
36. Miquel C, Gagnoux-Palacios L, Durand-Clement M, Marinkovich P, Ortonne
JP, et al. (1996) Establishment and characterization of a cell line LSV5 that
retains the altered adhesive properties of human junctional epidermolysis bullosa
keratinocytes. Exp Cell Res 224: 279–290.
37. Lauffenburger DA, Horwitz AF (1996) Cell migration: a physically integrated
molecular process. Cell 84: 359–369.
38. Hamill KJ, Kligys K, Hopkinson SB, Jones JC (2009) Laminin deposition in the
extracellular matrix: a complex picture emerges. J Cell Sci 122: 4409–4417.
39. Lai-Cheong JE, Parsons M, Tanaka A, Ussar S, South AP, et al. (2009) Loss-of-
function FERMT1 mutations in Kindler syndrome implicate a role for fermitin
family homolog-1 in integrin activation. Am J Pathol 175: 1431–1441.
40. Ussar S, Moser M, Widmaier M, Rognoni E, Harrer C, et al. (2008) Loss of
kindlin-1 causes skin atrophy and lethal neonatal intestinal epithelial
dysfunction. PLoS Genet 4: e1000289.
41. He Y, Esser P, Heinemann A, Bruckner-Tu derman L, Has C (2011) Kindlin-1
and -2 have overlapping functions in epithelial cells; implications for phenotype
modification. Am J Pathol 178: 975–982.
42. Bandyopadhyay A, Rothschild G, Kim S, Calderwood DA, Raghavan S (2012)
Uncovering functional differences between kindlin-1 and kindlin-2 in keratino-
cytes. J Cell Sci 125: 2172–2184.
43. Lai-Cheong JE, Ussar S, Arita K, Hart IR, McGrath JA (2008) Colocalization of
kindlin-1, kindlin-2, and migfilin at keratinocyte focal adhesion and relevance to
the pathophysiology of Kindler syndrome. J Invest Dermatol 128: 2156–2165.
44. Postel R, Margad ant C, Fischer B, Kreft M, Janssen H, Secades P, Zambruno
G, Sonnenberg A (2013) Kindlin-1 mutant zebrafish as in vivo model system to
study adhesion mechanisms in the epidermis. J Invest Dermatol, doi: 10.1038/
jid.2013.154.
45. Harburger DS, Bouaouina M, Calderwood DA (2009) Kindlin-1 and -2 directly
bind the C-terminal region of b-integrin cytoplasmic tails and exert integrin-
specific activation effects. J Biol Chem 284: 11485–11497.
46. Bo¨ ttcher RT, Stremmel C, Meves A, Meyer H, Widmaier M (2012) Sorting
nexin-17 prevents lysosomal degradation of b1 integrins by binding to the b1-
integrin tail. Nat Cell Biol 14: 584–592.
47. Margadant C, Kreft M, de Groot DJ, Norman JC, Sonnenberg A (2012) Distinct
roles of talin and kindlin in regulating integrin a5b1 function and trafficking.
Curr Biol 22: 1554–1563.
48. Has C, Ludwig RJ, Herz C, Kern JS, Ussar S, et al. (2008) C-terminally
truncated kindlin-1 leads to abnormal adhesion and migration of keratinocytes.
Br J Dermatol 159: 1192–1196.
49. Caswell PT, Valdevr u S, Norman JC (2009) Integrins: masters and slaves of
endocytic transport. Nat Rev Mol Cell Biol 10: 843–853.
50. Margadant C, Monsuur HN, Norman JC, Sonnenberg A (2011) Mechanisms of
integrin activation and trafficking. Curr Opin Cell Biol 23: 607–614.
51. Powelka AM, Sun J, Li J, Gao M, Shaw LM, et al. (2004) Stimulation-dependent
recycling of integrin b1 regulated by ARF6 and Rab11. Traffic 5: 20–36.
52. Kru¨ ger M, Moser M, Ussar S, Thievessen I, Luber CA, et al. (2008) SILAC
mouse for quantitative proteomics uncovers kindlin-3 as an essential factor for
red blood cell function. Cell 134: 353–364.
53. Steinberg F, Heesom KJ, Bass MD, Cullen PJ (2012) SNX17 protects integrins
from degradation by sorting between lysosomal and recycling pathways. J Cell
Biol 197: 219–230.
Kindlin-1 Regulates Integrin Dynamics
PLOS ONE | www.plosone.org 10 June 2013 | Volume 8 | Issue 6 | e65341