Article

Prevalence of Deafness in Dogs Heterozygous or Homozygous for the Merle Allele

Authors:
If you want to read the PDF, try requesting it from the authors.

Abstract

Deafness in dogs is frequently associated with the pigment genes piebald and merle. Little is known about the prevalence of deafness in dogs carrying the merle allele. To determine the prevalence of deafness in dogs heterozygous and homozygous for the merle allele of the mouse Silver pigment locus homolog (SILV) gene. One hundred and fifty-three privately owned merle dogs of different breeds and both sexes. Hearing was tested by brainstem auditory-evoked response and classified as bilaterally hearing, unilaterally deaf, or bilaterally deaf. DNA from buccal cells was genotyped as either heterozygous or homozygous for the merle allele. Deafness association tests among merle genotype, eye color, and sex were performed by the chi(2) test. Deafness prevalence in merles overall was 4.6% unilaterally deaf and 4.6% bilaterally deaf. There was a significant association between hearing status and heterozygous versus homozygous merle genotype. For single merles (Mm), 2.7% were unilaterally deaf and 0.9% were bilaterally deaf. For double merles (MM), 10% were unilaterally deaf and 15% were bilaterally deaf. There was no significant association with eye color or sex. Deafness prevalence in merle dogs was greater than that in some dog breeds homozygous for the piebald gene, such as the English Cocker Spaniel, but comparable to, or lower than, that in the Dalmatian and white Bull Terrier. Dogs homozygous for the merle allele were significantly more likely to be deaf than heterozygotes.

No full-text available

Request Full-text Paper PDF

To read the full-text of this research,
you can request a copy directly from the authors.

... However, heritability and genetic correlations of CSD and pigmen-tation phenotypes were not assessed. In a more recent study on 153 merle-genotyped dogs of different breeds, including five Border Collies, the prevalence of deafness was estimated at 3.5% in heterozygotes and 25.0% in homozygotes for the merle genotype (Strain et al., 2009). ...
... It occurs in many canine breeds, including the Border Collie. The M allele produces a pattern of random patches of diluted pigmentation alternating dark versus light over an underlying uniform colouration (Strain et al., 2009). Merle dogs often have partly or completely blue irises and may have CSD. ...
... Among the 366 Border Collies with a merle coat colour pattern, the prevalence of CSD was 7.4% (5.2% unilaterally deaf and 2.2% bilaterally deaf). It has been suggested that the impact of the merle allele on auditory function may vary among different canine breeds (Strain et al., 2009). In a recent study on 153 merle-genotyped dogs of different breeds, including five Border Collies, the prevalence of deafness was estimated at 3.5% in heterozygotes and 25.0% in homozygotes for the merle genotype (Strain et al., 2009). ...
Article
The objectives of this study were to estimate prevalence, heritability and genetic correlations of congenital sensorineural deafness (CSD) and pigmentation phenotypes in the Border Collie. Entire litters of Border Collies that presented to the Animal Health Trust (1994-2008) for assessment of hearing status by brain stem auditory evoked response (BAER) at 4-10 weeks of age were included. Heritability and genetic correlations were estimated using residual maximum likelihood (REML). Of 4143 puppies that met the inclusion criteria, 97.6% had normal hearing status, 2.0% were unilaterally deaf and 0.4% were bilaterally deaf. Heritability of deafness as a trichotomous trait (normal/unilaterally deaf/bilaterally deaf) was estimated at 0.42 using multivariate analysis. Genetic correlations of deafness with iris colour and merle coat colour were 0.58 and 0.26, respectively. These results indicate that there is a significant genetic effect on CSD in Border Collies and that some of the genes determining deafness also influence pigmentation phenotypes.
... CCSD results from degeneration of the stria vascularis and the hair cells as well as from the collapse of Reissner's membrane and the saccule in the inner ear. It can be pigment associated or neuroepithelial (Strain, 2015). The recessive alleles of the piebald locus (S) and the dominant alleles of the merle locus (M) are suspected of instigating hereditary deafness, although the causative genes and mode of inheritance have not been determined (Strain, 2015). ...
... It can be pigment associated or neuroepithelial (Strain, 2015). The recessive alleles of the piebald locus (S) and the dominant alleles of the merle locus (M) are suspected of instigating hereditary deafness, although the causative genes and mode of inheritance have not been determined (Strain, 2015). The Bull Terrier (BT) is a breed with homozygous extreme white piebald (s w ). ...
... CCSD can be identified in dogs as young as four weeks old (Strain et al., 1992). Histological studies have shown that inner ear structures develop physiologically prior to and after birth with atrophy of the stria vascularis occurring between the first and the fourth week of age in affected dogs (Johnsson et al., 1973;Strain et al., 2009). The age of the dogs included in our study ranged from 4 to 184 weeks, at which age the organ of Corti was fully developed. ...
Article
Full-text available
Canine congenital sensorineural deafness (CCSD) affects predisposed breeds of dogs and is primarily caused by an atrophy of the stria vascularis of the organ of Corti. The analysis of the brainstem auditory evoked response (BAER) is a reliable method for the evaluation of hearing in animals as it allows an accurate detection of unilateral or bilateral deafness. The occurrence of unilateral and bilateral deafness using the BAER was determined in a representative group of dogs in Poland, including Bull Terriers (n = 117), Australian Cattle Dogs (n = 62), English Setters (n = 32) and the Dogo Argentino (n = 32). Overall deafness, deafness in each dog breed and an association between deafness and phenotype were studied. Among the 243 dogs tested, 156 (81%) had a normal BAER, 27 (11%) were unilaterally deaf, and 12 (5%) were bilaterally deaf. The amplitudes and latencies of waves I, II, III, V, the V/I wave amplitude ratio, and wave I-V, I-III and III-V inter-peak intervals were recorded for each dog. Unilaterally and bilaterally deaf dogs were present in all the dog breeds studied. There were 17 (14.5%) deaf Bull Terriers, three (4.8%) deaf Australian Cattle Dogs, seven (21.9%) deaf English Setters, and 12 (37.5%) deaf Dogos Argentinos. Preventive BAER screening should be routinely performed in these four breeds to prevent the spread of genes responsible for deafness.
... Breeds that may carry the dominant merle allele include Australian shepherd, Shetland sheepdog, Catahoula, Cardigan Welsh corgi, Dachshund, Great Dane, Chihuahua, American pit bull terrier, American Staffordshire terrier, Beauceron, border collie, Koolie, poodle, Pyrenean shepherd, Old English sheepdog, American cocker, Pomeranian, Hungarian Mudi, and Norwegian Dunkerhound among others. Dogs homozygous for the dominant allele can be deaf and frequently have ocular abnormalities (106), and heterozygous dogs can be deaf, but there may be breed differences in the prevalence of deafness in merle carriers (107). In general, the prevalence of deafness in dogs carrying merle is similar to that of breeds with piebald, although merle-carrying breeds were long considered to be tainted with a high deafness prevalence based on a flawed study in Dachshunds (108); see Strain et al. (107) for discussion. ...
... Dogs homozygous for the dominant allele can be deaf and frequently have ocular abnormalities (106), and heterozygous dogs can be deaf, but there may be breed differences in the prevalence of deafness in merle carriers (107). In general, the prevalence of deafness in dogs carrying merle is similar to that of breeds with piebald, although merle-carrying breeds were long considered to be tainted with a high deafness prevalence based on a flawed study in Dachshunds (108); see Strain et al. (107) for discussion. Some breeds, such as Great Danes, carry both merle and piebald, and some breeds with merle, such as Great Danes, also carry dominant dilution loci known as harlequin (H) and tweed (Tw) that modify merle ( Table 4) (109)(110)(111), but no association with deafness has been shown for either H or Tw. ...
... Shorter (<65) poly-A tails produce "cryptic" merles that do not have the merle phenotype but produce merle offspring. An example of the cryptic pattern was illustrated by genotyping of two Australian shepherds (107). A genotyped male was Mm, while its genotyped daughter was MM. ...
Article
Full-text available
Although deafness can be acquired throughout an animal’s life from a variety of causes, hereditary deafness, especially congenital hereditary deafness, is a significant problem in several species. Extensive reviews exist of the genetics of deafness in humans and mice, but not for deafness in domestic animals. Hereditary deafness in many species and breeds is associated with loci for white pigmentation, where the cochlear pathology is cochleo-saccular. In other cases, there is no pigmentation association and the cochlear pathology is neuroepithelial. Late onset hereditary deafness has recently been identified in dogs and may be present but not yet recognized in other species. Few genes responsible for deafness have been identified in animals, but progress has been made for identifying genes responsible for the associated pigmentation phenotypes. Across species, the genes identified with deafness or white pigmentation patterns include MITF, PMEL, KIT, EDNRB, CDH23, TYR, and TRPM1 in dog, cat, horse, cow, pig, sheep, ferret, mink, camelid, and rabbit. Multiple causative genes are present in some species. Significant work remains in many cases to identify specific chromosomal deafness genes so that DNA testing can be used to identify carriers of the mutated genes and thereby reduce deafness prevalence.
... Merle is a coat pattern in the domestic dog characterized by patches of diluted pigment intermingled with normal melanin. The coat color pattern is seen in the Collie, Australian Shepherd, Shetland Sheepdog, Catahoula Leopard Dog, Cardigan Welsh Corgi, Dachshund, and Great Dane breeds, and less commonly in the Chihuahua, American Pit Bull Terrier, American Staffordshire Terrier, Beauceron, Border Collie, Coolie, and others [3,4]. ...
... Some dogs may have eyes covered by the third eyelid permanently. The defects can vary from minor vision and hearing loss to complete deafness and blindness [4,6]. ...
... The amplifi cation of the specifi c SINE element localized in exon 11 was done by DNA primers described by Strain et al. [4] with a modifi cation of the reverse primer. The identifi cation of Merle allele was done using a locus-specifi c reverse primer (5´CCTCGGCAAATCACAGCA 3´) designed with an added universal M13 tag (5´CACACAGGAAACAGCTATGACCAT 3´) at the 5´ end, a locus-specifi c forward primer (5´CAGTTTCTCCTTTATTCTCCCA 3´) and a M13 homologous primer labeled with D3 WellRED dye (Sigma-Aldrich). ...
Article
Full-text available
Merle patterning in dogs, caused by the insertion of a short interspersed element (SINE) in the genetic structure of SILV gene, is characterized by patches of diluted pigment intermingled with normal melanin. Sequencing analyses of SINE element localized in the canine SILV gene discovered a variability of the poly (A)-tail length which is responsible for the different expression of merle pattern. The SINE element with the length of poly(A)-tail between 91-101 nucleotides is responsible for the merle phenotype with all characters of merle pattern. On the contrary the dogs which have SINE element with the shorter length of poly(A) tail between 54-65 nucleotides are referred as cryptic merles without expresion of Merle pattern. The aim of this study was to improve molecular genetics method for the detection of cryptic allele for merle patterning in dogs. A total of 40 dogs of four breeds - Border collie, Shetland sheepdog, Australian Shepherd dog, and Chihuahua were used in this study. Canine genomic DNA was isolated from samples of whole blood and buccal cells by commercial column kit. Detection of merle (M), cryptic merle (Mc) and non-merle (m) alleles was done using M13-tailed primer protocol and two different allele-sizing methods for the verification of the electrophoresis result. In the analyzed population of dogs were detected 20 dogs with non-merle genotype mm, 17 dogs with merle genotype Mm, 2 dogs with double merle genotype MM and one dog with merle phenotype but with the presence of cryptic merle allele Mc with the consequential genotype MMc.
... Pigment-associated deafness typically presents as total deafness in 1 or both ears. [4][5][6][7][8][9] The diagnosis of congenital sensorineural deafness is currently limited to identifying the affected phenotype by auditory screening. ...
... 2,10 For deafness screening, the BAER test is performed with relatively loud sound stimuli and no attempt is made to determine hearing thresholds. 5,7,11 Puppies with congenital sensorineural deafness have no response to loud stimuli. 7,11,12 Bilaterally deaf dogs are unable to anticipate dangers such as cars or predators, are difficult to train, might develop anxious or aggressive personalities, and might bite when startled. ...
... 5,7,11 Puppies with congenital sensorineural deafness have no response to loud stimuli. 7,11,12 Bilaterally deaf dogs are unable to anticipate dangers such as cars or predators, are difficult to train, might develop anxious or aggressive personalities, and might bite when startled. 2,5 Unilaterally deaf dogs have difficulty localizing sound, 2,5 but otherwise make acceptable pets. ...
Article
Transient evoked otoacoustic emissions (TEOAE) are widely used for human neonatal deafness screening, but have not been reported for clinical use in dogs. To investigate the feasibility of TEOAE testing in conscious puppies and the ability of TEOAE testing to correctly identify deaf and hearing ears, as defined by brainstem auditory evoked response (BAER). Forty puppies from 10 litters. Prospective study on puppies presented for hearing assessment as part of a congenital deafness BAER screening program. Hearing status was determined using BAER. TEOAE testing was performed after the BAER assessment and the results of the TEOAE testing were compared with the hearing status for each ear. Parameters were tested for normality using the D'Agostino Pearson test and comparisons between the deaf and hearing ears were made using Mann-Whitney tests. TEOAE testing was readily performed in puppies presented for congenital deafness screening. Using analysis parameters based on those used in human neonatal hearing screening, TEOAE testing correctly identified all deaf ears, as defined by BAER testing, with a sensitivity of 100% (95% CI: 56-100%) for diagnosing deafness and specificity of 78% (95% CI: 66-87%). TEOAE testing is an effective screening modality for identifying congenital sensorineural deafness in dogs. In light of the simpler and less expensive equipment, TEOAE testing has the potential to improve access to hearing screening and through this reduce the prevalence of congenital deafness in the dog.
... Serious efforts to assess the prevalence of deafness in dog breeds began in the early 1990s (Holliday et al., 1992; Strain et al., 1992) and have continued (Strain, 2004; Wood et al., 2004; Platt et al., 2006; Strain et al., 2009), including the study in Border Collies by Luisa De Risio and colleagues at the Animal Health Trust, Newmarket, UK, published in this issue of The Veterinary Journal (De Risio et al., 2011). The prevalence of deafness in dog breeds in the USA ranges from 30% (unilateral and bilateral deafness) in Dalmatians to 1.3% in colored Bull Terriers (Strain, 2004). ...
... Dogs with this gene mutation have a random pattern of diluted pigmentation overlying uniform pigmentation; homozygous merle carriers have been reported to be prone to both auditory and visual system disorders and even heterozygous dogs can be deaf. The prevalence of deafness in merle dogs is similar to that reported in dogs with the piebald gene (Strain et al., 2009). The mutation responsible for merle is a 253 base pair short interspersed element (SINE) just before exon 11 that also includes a multiple adenine repeat (poly-A) tail. ...
... These melanocytes are thought to be required for the formation and integrity of the stria vascularis and maintenance of the endocochlear potential (Pla & Larue 2003). White spotting has also been associated with deafness in dogs and cats, but EDNRB has not yet been associated (Geigy et al. 2007;Strain et al. 2009). ...
... Investigating the eyes of silver horses from other breeds, such as the Icelandic horse, could add to our understanding of the interaction of SILV with MCOA. Moreover, dogs with the SINE insertion have a higher prevalence of deafness, and homozygotes are more significantly affected (Strain et al. 2009). Unlike EDNRB, SILV and/or MCOA association with deafness has not yet been investigated in the horse. ...
Article
Horses are valued for the beauty and variety of colouration and coat patterning. To date, eleven different genes have been characterized that contribute to the variation observed in the horse. Unfortunately, mutations involving pigmentation often lead to deleterious effects in other systems, some of which have been described in the horse. This review focuses on six such pleiotropic effects or associations with pigmentation genes. These include neurological defects (lethal white foal syndrome and lavender foal syndrome), hearing defects, eye disorders (congenital stationary night blindness and multiple congenital ocular anomalies), as well as horse-specific melanoma. The pigmentation phenotype, disorder phenotype, mode of inheritance, genetic or genomic methods utilized to identify the genes involved and, if known, the causative mutations, molecular interactions and other susceptibility loci are discussed. As our understanding of pigmentation in the horse increases, through the use of novel genomic tools, we are likely to unravel yet unknown pleiotropic effects and determine additional interactions between previously discovered loci.
... Non-coat color-related inherited sensorineural deafness has been observed as an autosomal-recessive condition associated with congenital vestibular disease in the doberman pinscher (2). Coat color-related sensorineural deafness has been described in numerous species including cats (3)(4)(5)(6), dogs (7)(8)(9)(10)(11)(12)(13)(14)(15)(16)(17), horses (18), llamas (19), and alpacas (19). A common phenotype for animals with coat color-related sensorineural deafness, regardless of the species, is that they have substantial white patterning or merleor dappled-colored coats. ...
... For instance, deafness in white cats or cats with significant white patterning is commonly associated with inheritance of the "white" gene (23), albeit this trait is polygenic; similarly, in paint horses, deafness is likely polygenic though many affected animals are heterozygous for the endothelin receptor type B (EDNRB) gene which is responsible for lethal white foal syndrome (18). In dogs with coat color-related deafness, the disease is polygenic though it is associated with the piebald and merle genes (7,9,10). The mode of inheritance in camelids is unknown though it has been reported only in solid white llamas and alpacas with pale blue irides (19). ...
... Congenital deafness is not necessarily hereditary, but there is good evidence for a genetic basis in many breeds, especially those with white or dilute pigmentation patterns. In recent years, significant effort has gone into documenting the prevalence of deafness in breeds affected by pigmentassociated deafness [17][18][19][20][21][22][23] ; rates vary by breed, ranging from a high of 30% (unilateral and bilateral) in Dalmatians in the United States, to 1.3% in colored bull terriers. 18 Hearing testing of puppies can be performed beginning at about 5 weeks of age; breeders in breeds with significant deafness prevalence rates frequently have BAER testing performed before placing puppies and may cull bilaterally deaf puppies. ...
... Dogs homozygous for the dominant allele can be deaf and frequently have ocular abnormalities; even heterozygous dogs can be deaf, but there may be breed differences in the prevalence of deafness in merle carriers. 20 Breeds carrying the merle allele include Shetland sheepdog, Australian shepherd, Cardigan Welsh Corgi, and Dachshund. In general, the prevalence of deafness in dogs carrying merle is similar to that of breeds with piebald. ...
Article
Full-text available
Conductive deafness, caused by outer or middle ear obstruction, may be corrected, whereas sensorineural deafness cannot. Most deafness in dogs is congenital sensorineural hereditary deafness, associated with the genes for white pigment: piebald or merle. The genetic cause has not yet been identified. Dogs with blue eyes have a greater likelihood of hereditary deafness than brown-eyed dogs. Other common forms of sensorineural deafness include presbycusis, ototoxicity, noise-induced hearing loss, otitis interna, and anesthesia. Definitive diagnosis of deafness requires brainstem auditory evoked response testing.
... ificativa entre os animais que possuíam pelo branco e/ou pais com déficits auditivos, descartando a influência do sexo e da textura de pelagem, e apoiando-se por outro lado, na associação de uma hereditariedade ligada aos genes de pigmentação. Tabela 2 -Associação entre a porcentagem de animais com déficit auditivo e o padrão de pelagem merle.Fonte: Strain et. al, 2009; Risio et al, 2011;Platt et al, 2006 Nos estudosde Strain et al., 2009, analisou-se o padrão de pelagem merle envolvendo diferentes raças (Catahoula, Australian Shepherd, Chihuahua, Collie, Shetland Sheepdog, Cardigan Welsh Corgi, Great Dane, Border Collie, Dachshund, Cocker Spaniel e um cão de raça mista), de ambos os sexos. Observou-se ...
Article
Atualmente, há uma grande demanda por características estéticas que sejam lucrativas no mercado pet, evidenciado pelo aumento crescente do número de animais no país, de acordo com as pesquisas. Um dos padrões raciais desejados em cães é o padrão merle, onde apresenta-se como uma pelagem semelhante a mármore, devido a influência do gene M (merle), sendo esse tipo de coloração aparente em diversas raças. Sabendo disso, objetiva-se com o presente trabalho realizar uma revisão quanto a influência do gene merle e as patologias associadas, e comparar com outras anomalias que possuem influência genética das pelagens. Haja vista essas características fenotípicas, os animais portadores dessa linhagem genética oferecem o risco de gerar animais a maior possibilidade de déficit auditivo, quando comparado à cães da mesma raça, porém com outros padrões de cores. Além disso, como resultado do cruzamento entre dois animais de pelagem merle, há a possibilidade da geração de filhotes portadores da síndrome do duplo merle, cuja condição é associada a uma série de patologias concomitantes como surdez, cegueira, esterilidade entre outras, que podem ser incompatíveis com a vida. Com isso, é de extrema importância conhecer sobre os possíveis riscos e prejuízos que podem ocorrer de um cruzamento realizado de forma irracional. Portanto, é de responsabilidade do médico veterinário a instrução quanto a reprodução comercial da espécie, de modo a promover a educação dos tutores e criadores, e a manutenção do bem-estar dos cães.
... A merle coat results from heterozygosity for the semi-dominant Merle allele. Homozygosity for Merle causes severe hypopigmentation with patches of merling and is associated with visual and auditory defects [1,2]. ...
Article
Full-text available
Background The antisense insertion of a canine short interspersed element (SINEC_Cf) in the pigmentation gene PMEL (or SILV) causes a coat pattern phenotype in dogs termed merle. Merle is a semi-dominant trait characterized by patches of full pigmentation on a diluted background. The oligo(dT) tract of the Merle retrotransposon is long and uninterrupted and is prone to dramatic truncation. Phenotypically wild-type individuals carrying shorter oligo(dT) lengths of the Merle allele have been previously described and termed cryptic merles. Two additional coat patterns, dilute merle (uniform, steely-grey coat) and harlequin merle (white background with black patches), also appear in breeds segregating the Merle allele. Results Sequencing of all PMEL exons in a dilute and a harlequin merle reveals that variation exists solely within the oligo(dT) tract of the SINEC_Cf insertion. In fragment analyses from 259 dogs heterozygous for Merle, we observed a spectrum of oligo(dT) lengths spanning 25 to 105 base pairs (bp), with ranges that correspond to the four varieties of the merle phenotype: cryptic (25–55 bp), dilute (66–74 bp), standard (78–86 bp), and harlequin (81–105 bp). Somatic contractions of the oligo(dT) were observed in 43% of standard and 51% of harlequin merle dogs. A small proportion (4.6%) of the study cohort inherited de novo contractions or expansions of the Merle allele that resulted in dilute or harlequin coat patterns, respectively. Conclusions The phenotypic consequence of the Merle SINE insertion directly depends upon oligo(dT) length. In transcription, we propose that the use of an alternative splice site increases with oligo(dT) length, resulting in insufficient PMEL and a pigment dilution spectrum, from dark grey to complete hypopigmentation. We further propose that during replication, contractions and expansions increase in frequency with oligo(dT) length, causing coat variegation (somatic events in melanocytes) and the spontaneous appearance of varieties of the merle phenotype (germline events). Electronic supplementary material The online version of this article (10.1186/s13100-018-0131-6) contains supplementary material, which is available to authorized users.
... Additional genes have been identified that cause white coat-color and variations of white pattern phenotypes in dogs, which are occasionally associated with other undesired traits such as deafness (e.g., Dalmatians, Australian shepherds and Boxers) [2]. These include genes such as SILV, MITF and PSMB7 [3][4][5]. These genes are known to be involved in melanocyte migration during development and/or survival of melanocytes. ...
Article
Full-text available
The first white Doberman pinscher (WDP) dog was registered by the American Kennel Club in 1976. The novelty of the white coat color resulted in extensive line breeding of this dog and her offspring. The WDP phenotype closely resembles human oculocutaneous albinism (OCA) and clinicians noticed a seemingly high prevalence of pigmented masses on these dogs. This study had three specific aims: (1) produce a detailed description of the ocular phenotype of WDPs, (2) objectively determine if an increased prevalence of ocular and cutaneous melanocytic tumors was present in WDPs, and (3) determine if a genetic mutation in any of the genes known to cause human OCA is causal for the WDP phenotype. WDPs have a consistent ocular phenotype of photophobia, hypopigmented adnexal structures, blue irides with a tan periphery and hypopigmented retinal pigment epithelium and choroid. WDPs have a higher prevalence of cutaneous melanocytic neoplasms compared with control standard color Doberman pinschers (SDPs); cutaneous tumors were noted in 12/20 WDP (<5 years of age: 4/12; >5 years of age: 8/8) and 1/20 SDPs (p<0.00001). Using exclusion analysis, four OCA causative genes were investigated for their association with WDP phenotype; TYR, OCA2, TYRP1 and SLC45A2. SLC45A2 was found to be linked to the phenotype and gene sequencing revealed a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4∶77,062,968-77,067,051). This mutation is highly likely to be the cause of the WDP phenotype and is supported by a lack of detectable SLC45A2 transcript levels by reverse transcriptase PCR. The WDP provides a valuable model for studying OCA4 visual disturbances and melanocytic neoplasms in a large animal model.
... Congenital hereditary sensorineural deafness is the most common form of deafness observed in dogs (Strain, 1996, 1999, 2004, 2011). Over 90 breeds have been identified with congenital sensorineural deafness (Strain, 2004, 2011), and reports of deafness have increased with heightened awareness of the disease (Strain, 2004; Rak and Distl, 2005; Strain et al., 2009). Deafness has long been associated with white or diluted pigmentation in breeds carrying the piebald and merle genes (Strain, 1996, 2011; Strain et al., 2009). ...
... Remarkably, the Merle trait of dogs is characterized, in analogy to human WS2, by segmental hypopigmented coat patterns (Murphy, Evans, Tsai, & Clark, 2018), ocular heterochromia with sectorial iris bicolor and sectorially hypopigmented fundus (Schwab et al., 2016), and asymmetrical hearing loss (Strain, Clark, Wahl, Turner, & Murphy, 2009). This canine phenotype has been shown to reflect epigenetic mosaicism due to insertion of the retrotransposon "sine oculis-binding protein" (SINE) into the Merle allele premelanosome protein (PMEL) (or mouse homolog of silver, SILV) (Murphy et al., 2018). ...
... Une étude portant sur 153 chiens merle et double merle de différentes races a montré que 2,7 % des chiens merle étaient sourds unilatéraux et 0,9 % étaient sourds bilatéraux. Ces proportions montaient à 10,0 et 15,0 % respectivement chez les chiens double merle [38] . Chez les chiens arlequin, la surdité n'est pas associée à la modification arlequin, mais au patron merle [6] . ...
Article
Full-text available
La surdité congénitale canine et féline constitue une préoccupation d'importance pour les éleveurs qui travaillent avec des races prédisposées. Dans les deux espèces, la surdité congénitale est presque exclusivement associée à certaines couleurs ou patrons de robe. Chez le chien, la panachure et le patron merle constituent les deux principaux facteurs de risque de surdité congénitale, alors que chez le chat la robe uniformément blanche, avec ou sans yeux bleus, constitue le facteur de risque prépondérant. Les déterminismes moléculaires et modes de transmission des surdités canines et félines restent très mal compris à ce jour. Le dépistage avant la mise à la reproduction des individus à risque, ainsi que le respect de certaines précautions dans la planification des accouplements, permettent cependant d'espérer diminuer la prévalence de la surdité chez les carnivores domestiques.
... This applies especially to distinctive coloration, which can be straightforward to observe and maintain in a captive stock. Examples include coat color variants for Merle dogs, where homozygotes for a retrotransposon insertion in the SILV gene have an increased risk of deafness and blindness (Strain et al. 2009;Langevin et al. 2018), and in overo horses, where foals homozygous for a mutated Endothelin Receptor B (EDNRB) develop Lethal White Syndrome (Metallinos et al. 1998). "Lemon frost" geckos have been selected for their unique color, but exhibit an increased risk of iridophoroma, the formation of tumors from iridophores (analogous to melanoma) (Guo et al. 2021). ...
Article
Full-text available
As the genetic basis of natural and domesticated variation has been described in recent years, a number of hotspot genes have been repeatedly identified as the targets of selection, Heliconius butterflies display a spectacular diversity of pattern variants in the wild and the genetic basis of these patterns has been well-described. Here we sought to identify the mechanism behind an unusual pattern variant that is instead found in captivity, the ivory mutant, in which all scales on both the wings and body become white or yellow. Using a combination of autozygosity mapping and coverage analysis from 37 captive individuals, we identify a 78kb deletion at the cortex wing patterning locus, a gene which has been associated with wing pattern evolution in H. melpomene and 10 divergent lepidopteran species. This deletion is undetected among 458 wild Heliconius genomes samples, and its dosage explains both homozygous and heterozygous ivory phenotypes found in captivity. The deletion spans a large 5’ region of the cortex gene that includes a facultative 5’UTR exon detected in larval wing disk transcriptomes. CRISPR mutagenesis of this exon replicates the wing phenotypes from coding knock-outs of cortex, consistent with a functional role of ivory-deleted elements in establishing scale color fate. Population demographics reveal that the stock giving rise to the ivory mutant has a mixed origin from across the wild range of H. melpomene, and supports a scenario where the ivory mutation occurred after the introduction of cortex haplotypes from Ecuador. Homozygotes for the ivory deletion are inviable while heterozygotes are the targets of artificial selection, joining 40 other examples of allelic variants that provide heterozygous advantage in animal populations under artificial selection by fanciers and breeders. Finally, our results highlight the promise of autozygosity and association mapping for identifying the genetic basis of aberrant mutations in captive insect populations.
... Bilateral congenital deafness was diagnosed in 78% of camelids with white coat color and blue irises based on BAER and presumed to be associated with the lack of pigment (Gauly et al., 2005). Similar to other domestic animal species, non-pigmented coat and irises have been associated with congenital sensorineural deafness (Aleman, Madigan, Williams, & Holliday, 2014;Kral & Lomber, 2015;Magdesian, Williams, Aleman, LeCouteur, & Madigan, 2009;Strain, 2011dStrain, , 2015Strain, Clark, Wahl, Turner, & Murphy, 2009). Congenital deafness is usually hereditary but might result from other causes (Aleman, Madigan, et al., 2014). ...
Article
Full-text available
Auditory loss has been reported in camelids using brainstem auditory evoked responses (BAER). Differentiation between conductive versus sensorineural dysfunction has not been investigated. Therefore, the objective of the study was to investigate auditory function using BAER and bone conduction (BC). Twenty-four alpacas: 15 females, 9 intact males (2–16 years of age) were included in a randomized clinical trial. BAER and BC were recorded using two derivations (vertex to mastoid and vertex to cranial aspect of second cervical vertebra). All alpacas underwent complete physical examinations and were sedated with xylazine hydrochloride at 0.6 mg/kg IM. Peaks, when present, were identified and latencies, amplitudes, and amplitude ratios were determined. Eleven alpacas had normal responses and 13 had auditory loss based on BAER. The latter consisted of complete absence of peaks bilaterally (n = 3), absence of peaks unilaterally (n = 1), delayed latencies bilaterally (n = 4), and delayed latencies unilaterally (n = 5). Distinct peaks on BC supported conductive auditory loss in 6 alpacas, difficult to interpret due to stimulus artifact and additional undefined peaks in 4, and absent peaks in 3 alpacas. The cause of auditory loss was presumed to be due to otitis in 6, aging in 4 (10 to 16 years old), and congenital sensorineural (absent peaks on BAER and BC) in 3 alpacas with unpigmented skin and irises. BAER and BC are useful and non-invasive to perform techniques for the investigation of auditory loss in alpacas, and further characterization as conductive or sensorineural.
... The fact that this report found more bilateral deafness than unilateral, when other published reports, studying other breeds, found a higher prevalence of unilateral than bilateral, is certainly the result of the small sample size. Deafness in dogs is frequently associated with altered expression of pigment genes, such as piebald and merle (Strain et al. 2009), and several prior studies have identified statistically significant associations between deafness and a blue iris colour and white coat pigmentation (Strain 2004, Platt et al. 2006, Famula et al. 2007). Since not all dogs with piebald are deaf or have blue eyes, it can be argued that this variable outcome is the consequence of incomplete penetrance of a causative gene, or that one or more additional genes regulate the expression of the pigment gene (Strain 2011a). ...
Article
Full-text available
Brainstem auditory-evoked potential (BAEP) has been widely used for different purposes in veterinary practice and is commonly used to identify inherited deafness and presbycusis. In this study, 43 Boxer dogs were evaluated using the BAEP. Deafness was diagnosed in 3 dogs (2 bilateral and 1 unilateral) allowing the remaining 40 Boxers to be included for normative data analysis including an evaluation on the influence of age on the BAEP. The animals were divided into 2 groups of 20 Boxers each based on age. The mean age was 4.54 years (range, 1-8) in group I, and 9.83 years (range, 8.5-12) in group II. The mean latency for I, III, and V waves were 1.14 (+/- 0.07), 2.64 (+/- 0.11), and 3.48 (+/- 0.10) ms in group I, and 1.20 (+/- 0.12), 2.73 (+/- 0.15), and 3.58 (+/- 0.22) ms in group II, respectively. The mean inter-peak latencies for the I-III, III-V and I-V intervals were 1.50 (+/- 0.15), 0.84 (+/- 0.15), and 2.34 (+/- 0.11) ms in group I, and 1.53 (+/- 0.16), 0.85 (+/- 0.15), and 2.38 (+/- 0.19) ms in group II, respectively. Latencies of waves land III were significant different between group land II. For the I-III, III-V and I-V intervals, no significant differences were observed between the 2 groups. As far as we know, this is the first normative study of BAEP obtained from Boxer dogs.
Chapter
Overselection for production traits has caused animal welfare problems such as feather pecking in hens, tail biting in pigs, and overly aggressive animals. In dogs, overselection for appearance traits has caused neurological problems such as deafness. Both feather pecking and tail biting may be displaced foraging behaviors, because these behaviors are reduced by providing foraging materials such as straw. Another problem is hunger in broiler breeder hens and breeding sows. Animals that have been selected for rapid growth are also selected for a huge appetite. If breeder animals eat to satiation, they will become obese and have health problems. High-roughage feeds may improve welfare. Researchers suggest that new genetic breeding tools could be used to select against harmful behaviors and still have a productive animal. Breeders must avoid creating animals that will have poor welfare even when they are housed in the best environment.
Book
Deafness in pets is a very common problem and is increasingly being presented to veterinarians, as owners and breeders become more aware and concerned about such issues. This book provides complete coverage of the subject describing the anatomy and physiology of the auditory system, types of deafness, testing for deafness, methods of amelioration and management, behaviour of deaf animals, and other issues associated with living and dealing with deaf pets.
Article
Over-selection for production traits has caused animal welfare problems such as feather pecking in hens, tail biting in pigs, and overly aggressive animals. In dogs, over-selection for appearance traits has caused neurological problems such as deafness. Both feather pecking and tail biting may be displaced foraging behaviors, because these behaviors are reduced by providing foraging materials such as straw. Another problem is hunger in broiler breeder hens and breeding sows. Animals that have been selected for rapid growth are also selected for a huge appetite. If breeder animals eat to satiation, they will become obese and have health problems. High-roughage feeds may improve welfare. Researchers suggest that new genetic breeding tools could be used to select against harmful behaviors and still have a productive animal. Breeders must avoid creating animals that will have poor welfare even when they are housed in the best environment.
Chapter
This chapter presents an overview of Merle ocular dysgenesis (MOD) that results from abnormal embryonic differentiation of tissues and may lead to multiple ocular abnormalities, including any combination of microphthalmos, microcornea, scleral staphyloma, persistent pupillary membranes (PPMs), heterochromia iris, iridal hypoplasia/coloboma, pseudopolycoria, iridocorneal angle dysplasia, lenticular coloboma/cataract/subluxation, choroidal hypoplasia, optic nerve coloboma, retinal dysplasia, and/or retinal detachment. Commonly affected breeds include the Australian Shepherd, (merled) Collies, Shetland Sheepdog, Harlequin Great Dane and (merled) Long-Haired Dachshund. The diagnosis of MOD is made on the basis of a combination of signalment and clinical findings. Surgical intervention in order to address scleral, lenticular, and/or retinal pathology may also be indicated in select cases. Selective breeding reduces the incidence and severity of disease.
Article
This article explores the relationship between standards of beauty and genetic knowledge in regulations for the breeding of nonhuman animals. Collie breeding and views concerning the coat color white, in North America and Britain between 1870 and the present, illustrate how advances in dog coat genetics did little to alter perceptions concerning beauty and/or quality held in the different countries. Today, North American Collie breeders consider white coats to be desirable. Modern British breeders see these coats as unacceptable. Breed standards that support practices have not changed to reflect a better understanding of genetics. An assessment of how attitudes to white Collies arose, and why these views differed between North America and Britain, illustrates how entrenched cultural perceptions concerning beauty/quality can be in the face of information that undermines their validity. The story introduces a larger topic: how can change be introduced in light of the complicated beauty/science axis?
Article
Full-text available
The births of domestic dogs with pigment deletion and associated congenital hearing and/or vision impairments are increasing, as a result of mutations of certain genes expressing popular coat colour patterns (Merle, piebald, Irish spotting). The future of these dogs is often pessimistic (early euthanasia or placement in rescues/fosters, lack of interactions and activities for adults). These pessimistic scenarios result from popular assumptions predicting that dogs with congenital hearing/vision impairments exhibit severe Merle-related health troubles (cardiac, skeletal, neurological), impairment-related behavioural troubles (aggressiveness, anxiety), and poor capacities to communicate, to be trained, and to be engaged in leisure or work activities. However, there is no direct scientific testing, and hence no evidence or refutation, of these assumptions. We therefore addressed an online questionnaire to owners of 223 congenitally sensory impaired (23 vision impaired, 63 hearing impaired, 137 hearing and vision impaired) and 217 sensory normal dogs from various countries. The sensory normal cohort was matched in age, lifetime with owner, breed and sex with the sensory impaired cohort, and was used as a baseline. The questionnaire assessed demographics, morphology, sensory impairments, health and behavioural troubles, activities, and dog-owner communication. Most hearing and/or vision impaired dogs exhibited abnormal pigment deletion in their coat and irises. Vision impaired dogs additionally exhibited ophthalmic abnormalities typically related to Merle. The results are opposed to all above-listed assumptions, except for neurological troubles, which were more frequently reported in sensory impaired dogs. However, we suggest that this finding could be partially accounted for by a lack of diagnosis of breed-related drug sensitivity and impairment-related compulsive behaviours. Results about communication and activities are particularly optimistic. The need for future studies of numerous dogs from various breeds tested for Merle, piebald and medical-drug-resistance genes, and the beneficial effects that present and future research may have on the future of sensory impaired dogs, are discussed.
Article
The Australian Cattle dog (ACD) is one of many breeds predisposed to congenital sensorineural deafness (CSD). The objective of this study was to estimate CSD prevalence and investigate any association with phenotype in the ACD in the UK. The database of the authors’ institution was searched for ACD puppies undergoing brainstem auditory evoked response (BAER) testing for CSD screening (1999–2019). Inclusion criteria were BAER performed at 4–10 weeks of age, testing of complete litters and available phenotypic data. The age, sex, coat and iris colour, presence and location of face and body patches, hearing status and BAER- determined parental hearing status of each puppy were recorded. A multivariable mixed-effects logistic regression model was used to calculate odds ratios and 95% confidence intervals to determine whether any of these variables were significantly associated with CSD, while adjusting for clustering at litter level. Inclusion criteria were met for 524 puppies. Hearing was bilaterally normal in 464 puppies (88.6%). The prevalence of unilateral and bilateral CSD was 9.7% and 1.7%, respectively. On the basis of multivariable analysis, the presence of a pigmented face patch was the only phenotypic variable significantly associated with CSD, and was linked to a reduced risk of the condition. The prevalence was similar to that reported in an Australian population of ACDs. The key findings from this study were that overall CSD prevalence in the ACD population in the UK was 11.4%, and puppies with a face patch were at reduced risk of the condition.
Article
Congenital deafness results from degeneration of the cochlear blood supply at age 3 to 4 weeks, presumably resulting from suppression of melanocytes merle or piebald genes. Cochleosaccular deafness may originate from genetic causes, or it may result from external factors such as mechanical trauma, exposure to noise, pathogens or ototoxic drugs as well as senescence. Hereditary factors are suspected in breeds with a high prevalence of congenital deafness and the inherited nature of deafness has been documented in the Dalmatian. Diagnostic protocol includes clinical and neurologic examination, otoscopic examination, and brainstem evoked potentials (BAER).
Article
Full-text available
Hereditary loss of hearing affects many breeds of the domestic dog, but the Dalmatian has the highest prevalence. Approximately 30% are affected in the United States (U.S.) population. It is widely accepted that a relationship exists between deafness and pigmentation in the dog and also in other animals. While the Dalmatian exemplifies this relationship, the genetic origin and mode of inheritance of deafness in this breed are unknown. The goals of this study were to: (1) estimate the heritability of deafness in an extended kindred of U.S. Dalmatians and (2) determine, through complex segregation analysis, whether there is a major segregating locus that has a large effect on the expression of deafness. A kindred of 266 Dalmatians was assembled, of which 199 had been diagnosed using the brainstem auditory evoked response to determine auditory status. Of these, 74.4% (N = 148) had normal hearing, 18.1% (N = 36) were unilaterally deaf, and 7.5% (N = 15) were bilaterally deaf. A heritability of 0.73 was estimated considering deafness a dichotomous trait and 0.75 considering it as a trichotomous trait. Although deafness in the Dalmatian is clearly heritable, the evidence for the presence of a single major gene affecting the disorder is not persuasive.
Article
Full-text available
Merle is a pattern of coloring observed in the coat of the domestic dog and is characterized by patches of diluted pigment. This trait is inherited in an autosomal, incompletely dominant fashion. Dogs heterozygous or homozygous for the merle locus exhibit a wide range of auditory and ophthalmologic abnormalities, which are similar to those observed for the human auditory-pigmentation disorder Waardenburg syndrome. Mutations in at least five genes have been identified as causative for Waardenburg syndrome; however, the genetic bases for all cases have not been determined. Linkage disequilibrium was identified for a microsatellite marker with the merle phenotype in the Shetland Sheepdog. The marker is located in a region of CFA10 that exhibits conservation of synteny with HSA12q13. This region of the human genome contains SILV, a gene important in mammalian pigmentation. Therefore, this gene was evaluated as a candidate for merle patterning. A short interspersed element insertion at the boundary of intron 10/exon 11 was found, and this insertion segregates with the merle phenotype in multiple breeds. Another finding was deletions within the oligo(dA)-rich tail of the short interspersed element. Such deletions permit normal pigmentation. These data show that SILV is responsible for merle patterning and is associated with impaired function of the auditory and ophthalmologic systems. Although the mutant phenotype of SILV in the human is unknown, these results make it an intriguing candidate gene for human auditory-pigmentation disorders.
Article
Full-text available
With several hundred genetic diseases and an advantageous genome structure, dogs are ideal for mapping genes that cause disease. Here we report the development of a genotyping array with approximately 27,000 SNPs and show that genome-wide association mapping of mendelian traits in dog breeds can be achieved with only approximately 20 dogs. Specifically, we map two traits with mendelian inheritance: the major white spotting (S) locus and the hair ridge in Rhodesian ridgebacks. For both traits, we map the loci to discrete regions of <1 Mb. Fine-mapping of the S locus in two breeds refines the localization to a region of approximately 100 kb contained within the pigmentation-related gene MITF. Complete sequencing of the white and solid haplotypes identifies candidate regulatory mutations in the melanocyte-specific promoter of MITF. Our results show that genome-wide association mapping within dog breeds, followed by fine-mapping across multiple breeds, will be highly efficient and generally applicable to trait mapping, providing insights into canine and human health.
Article
Full-text available
The association between patterns of pigmentation and deafness in the dog has a long-documented history, with reports dating back over one hundred years. Long suspected of having a genetic basis, the search for loci with a pronounced influence in the expression of hearing loss in the dog has yet to be successful. No studies in the dog to date have found a possible influence of a specific colour locus associated with deafness. The present study is intended to evaluate the heritability of deafness in the Jack Russell Terrier (JRT), characterize the mode of inheritance, and evaluate the existence of a sex, coat colour, or coat texture influence on the expression of sensorineural deafness. The estimation of heritability of deafness in the JRT was 0.22 when deafness was considered a binary (normal/deaf) trait and 0.31 when deafness was considered a three-category (normal/unilateral/bilateral deafness). The influence of coat colour in the incidence of JRT deafness was statistically significant, indicating that dogs with more white are more likely to be deaf. The influence of sex or coat texture was not statistically significant in the incidence of JRT deafness. Complex segregation analysis revealed a model of a single locus with a large effect on the binary measure of hearing loss is not supported. This is the first attempt, to our knowledge, to characterize a genetic component responsible for deafness in the JRT. The heritability of deafness in the JRT was found to be 0.22 and 0.31 considering deafness to be a two-category or three-category trait, respectively. There appears to be an influence of coat colour on the expression of deafness. In an attempt to characterize the mode of inheritance of deafness in the JRT, a model of a single locus with a large effect on hearing loss is not supported with this data. Further study is needed to determine if a single locus may be influencing deafness in the JRT. While the absence of a clear mode of inheritance complicates genetic dissection of deafness in the JRT, the assembling of this pedigree provides a tool for eventually defining the genetic bases of this disorder.
Article
Hereditary loss of hearing affects many breeds of the domestic dog, but the Dalmatian has the highest prevalence. Approximately 30% are affected in the United States (U.S.) population. It is widely accepted that a relationship exists between deafness and pigmentation in the dog and also in other animals. While the Dalmatian exemplifies this relationship, the genetic origin and mode of inheritance of deafness in this breed are unknown. The goals of this study were to: (1) estimate the heritability of deafness in an extended kindred of U.S. Dalmatians and (2) determine, through complex segregation analysis, whether there is a major segregating locus that has a large effect on the expression of deafness. A kindred of 266 Dalmatians was assembled, of which 199 had been diagnosed using the brainstem auditory evoked response to determine auditory status. Of these, 74.4% (N = 148) had normal hearing, 18.1% (N = 36) were unilaterally deaf, and 7.5% (N = 15) were bilaterally deaf. A heritability of 0.73 was estimated considering deafness a dichotomous trait and 0.75 considering it as a trichotomous trait. Although deafness in the Dalmatian is clearly heritable, the evidence for the presence of a single major gene affecting the disorder is not persuasive.
Article
Peripheral deafness may be inherited or acquired, congenital or later-onset, and sensorineural or conductive. The most commonly observed forms are inherited congenital sensorineural, acquired later-onset sensorineural (ototoxicity, presbycusis) and acquired later-onset conductive (chronic otitis externa/media). In most dog and cat breeds inherited congenital sensorineural deafness results from perinatal degeneration of the stria vascularis, the vascular bed of the outer wall of the cochlear duct, which leads to hair cell degeneration. The strial degeneration appears to result from the absence of melanocytes, but their function in this structure is unknown. Ototoxicity may result from any of a large number of drugs and chemicals that directly or indirectly destroy cochlear hair cells. The effects are dose-dependent and in rare cases reversible. The most commonly recognized ototoxic drugs are the aminoglycoside antibiotics. Presbycusis, the ageing-related progressive hearing loss unattributable to other causes, is sensorineural but may also include mechanical changes in the tympanum and ossicles. Hearing aids may be accepted by some dogs as long as some residual function remains. Breeds reported to have been affected by congenital sensorineural deafness are listed and those with the highest prevalence are noted. Methods for diagnosis of deafness are described.
Article
Two puppies, a 4-month-old female Maltese terrier and a 6-week-old male Great Pyrenean, were presented for confirmation of bilateral deafness by electrophysiological testing. In both puppies, brainstem auditory potentials were not evoked by 90 dB NHL click stimulation of each ear. Examination of the inner ear revealed a bilateral cochleo-saccular degeneration in both animals. The lesions were characterized by generalized atrophy of the stria vascularis, collapse of the cochlear duct, degeneration of the organ of Corti, an abnormal tectorial membrane, and saccular collapse, with a normal spiral ganglion. The cochlear duct was entirely obliterated throughout the cochleae in the Maltese terrier puppy, but was locally and asymmetrically affected in the Great Pyrenean. The abnormalities observed in the Maltese terrier puppy were identical with those previously described in deaf Dalmatian puppies; the lesions observed in the Great Pyrenean, however, were less typical. This is the first histopathological description of cochleo-saccular degeneration in the Maltese terrier and Great Pyrenean breeds. In both puppies the defect was probably congenital.
Article
The clinically important melanoma diagnostic antibodies HMB-45, melan-A, and MITF (D5) recognize gene products of the melanocyte-lineage genes SILV/PMEL17/GP100, MLANA/MART1, and MITF, respectively. MITF encodes a transcription factor that is essential for normal melanocyte development and appears to regulate expression of several pigmentation genes. In this report, the possibility was examined that MITF might additionally regulate expression of the SILV and MLANA genes. Both genes contain conserved MITF consensus DNA sequences that were bound by MITF in vitro and in vivo, based on electrophoretic mobility shift assay and chromatin-immunoprecipitation. In addition, MITF regulated their promoter/enhancer regions in reporter assays, and up- or down-regulation of MITF produced corresponding modulation of endogenous SILV and MLANA in melanoma cells. Expression patterns were compared with these factors in a series of melanoma cell lines whose mutational status of the proto-oncogene BRAF was also known. SILV and MLANA expression correlated with MITF, while no clear correlation was seen relative to BRAF mutation. Finally, mRNA expression array analysis of primary human melanomas demonstrated a tight correlation in their expression levels in clinical tumor specimens. Collectively, this study links three important melanoma antigens into a common transcriptional pathway regulated by MITF.
Article
Hearing function was tested in dogs from breeds at risk for pigment-associated congenital sensorineural deafness - Dalmatian, English setter (ES), English cocker spaniel (ECS), bull terrier (BT), Australian cattle dog (ACD), whippet, Catahoula leopard dog, and Jack Russell terrier. Deafness prevalence was highest in Dalmatians and lowest in ECS. Phenotype correlation studies were performed in breeds with >100 brainstem auditory evoked responses (BAER) tested subjects. No gender differences were observed. No differences were seen between black- and liver-spotted Dalmatians, among the ES roan colour varieties, among the ECS parti varieties, or among the ACD colour varieties. Blue eyes were positively associated and patches were negatively associated with deafness in the Dalmatian. Blue eyes were also associated with deafness in the ES and ECS. White BT were more likely than coloured BT to be deaf. Having one or more parent's ear deaf was positively associated with deafness in Dalmatians, ES, and ECS.
Article
Congenital sensorineural deafness (CSD) occurs in Border Collies, but its prevalence and inheritance are unknown. This study estimated the prevalence of CSD in Border Collies and investigated its association with phenotypic attributes linked to the merle gene, including coat pigmentation and iris color. Deafness in Border Collies is associated with pigmentation patterns linked to the merle gene. A total of 2597 Border Collies from the United Kingdom. A retrospective study of Border Collies tested, during 1994-2002, by using brainstem auditory evoked responses. Associations between deafness and phenotypic attributes were assessed by using generalized logistic regression. The prevalence of CSD in puppies was estimated as 2.8%. The corresponding rates of unilateral and bilateral CSD were 2.3 and 0.5%, respectively. Adjustment for clustering of hearing status by litter reduced the overall prevalence estimate to 1.6%. There was no association between CSD and sex (P = .2). Deaf Border Collies had higher rates of merle coat pigmentation, blue iris pigment, and excess white on the head than normal hearing Border Collies (all P < .001). The odds of deafness were increased by a factor of 14 for Border Collies with deaf dams, relative to the odds for dogs with normal dams (P = .007), after adjustment for phenotypic attributes. Associations between CSD and pigmentation patterns linked to the merle gene were demonstrated for Border Collies. Evidence for an inherited component to CSD in Border Collies supports selective breeding from only tested and normal parents to reduce the prevalence of this disease.
Article
Tremendous progress has been made in identifying genes involved in pigmentation in dogs in the past few years. Comparative genomics has both aided and benefited from these findings. Seven genes that cause specific coat colours and/or patterns in dogs have been identified: melanocortin 1 receptor, tyrosinase related protein 1, agouti signal peptide, melanophilin, SILV (formerly PMEL17), microphthalmia-associated transcription factor and beta-defensin 103. Although not all alleles have been yet identified at each locus, DNA tests are available for many. The identification of these alleles has provided information on interactions in this complex set of genes involved in both pigmentation and neurological development. The review also discusses pleiotropic effects of some coat colour genes as they relate to disease. The alleles found in various breeds have shed light on some potential breed development histories and phylogenetic relationships. The information is of value to dog breeders who have selected for and against specific colours since breed standards and dog showing began in the late 1800s. Because coat colour is such a visible trait, this information will also be a valuable teaching resource.
Inner ear abnormalities in dogs
  • Alford M Igarashi
  • Br
  • Am Cohn
Igarashi M, Alford BR, Cohn AM, et al. Inner ear abnormalities in dogs. Ann Otol Rhinol Laryngol 1972;81:249–255.
Retrotransposon insertion in SILV is responsible for merle patterning of the domestic dog
  • L A Clark
  • J M Wahl
  • C A Rees
Clark LA, Wahl JM, Rees CA, et al. Retrotransposon inser-tion in SILV is responsible for merle patterning of the domestic dog. Proc Nat Acad Sci 2006;103:1376–1381.
GP100 are transcriptionally regulated by MITF in melanocytes and melanoma
  • J Du
  • Miller Aj
  • Widlund
  • Hr
Du J, Miller AJ, Widlund HR, et al. MLANA/MART1 and SILV/PMEL17/GP100 are transcriptionally regulated by MITF in melanocytes and melanoma. Am J Pathol 2003;163: 333–343.
Efficient map-ping of Mendelian traits in dogs through genome-wide association
  • Karlsson Ek
  • I Baranowska
  • Wade
  • Cm
Karlsson EK, Baranowska I, Wade CM, et al. Efficient map-ping of Mendelian traits in dogs through genome-wide association. Nat Genet 2007;39:1321–1328.
Hearing damage from noise exposure In: Handbook of Noise Measurement. Chapter 3
  • Apg Peterson
Peterson APG. Hearing damage from noise exposure. In: Handbook of Noise Measurement. Chapter 3. Concord, MA: Gen-Rad Inc; 17–24.
13. Peterson APG. Hearing damage from noise exposure In: Handbook of Noise Measurement. Chapter 3
J Comp Pathol 2000;122:223–228. 13. Peterson APG. Hearing damage from noise exposure. In: Handbook of Noise Measurement. Chapter 3. Concord, MA: Gen- Rad Inc; 17–24.
Audiometrische Befunde in einer Merlezucht
  • I Reetz
  • M Stecker
  • W Wegner