Clostridium novyi infection causing sow mortality in an Iberian pig herd raised in an outdoor rearing system in Spain

Abstract

Clostridium novyi was the suspected cause of death of two mature gestating Iberian-breed sows, on evidence of a gas-filled necrotic liver, rapid decomposition and tympany of the carcasses, and the absence of any other detectable cause of death. Anaerobic cultures yielded large numbers of Clostridium-like organisms, and C novyi type B was identified using a Multiplex polymerase chain reaction (PCR) assay. In cases of unexpected mortality in gestating sows, veterinarians need to be aware of the most common causes of death, Including C novyi infection. In order to achieve a correct diagnosis, it is essential to perform a postmortem examination and collect samples as soon as possible after death. In addition, use of PCR procedures may allow rapid identification of C novyi and the types implicated.

Full text

Journal of Swine Health and Production — September and October 2009264
Case report Peer reviewed
Clostridium novyi infection causing sow mortality in an
Iberian pig herd raised in an outdoor rearing system in Spain
Alfredo García, DVM, PhD; Dolores Ayuso, DVM; Jose Manuel Benítez, DVM; Waldo Luis García, DVM; Remigio Martínez, DVM;
Sergio Sánchez, DVM, PhD
Summary
Clostridium novyi was the suspected cause
of death of two mature gestating Iberian-
breed sows, on evidence of a gas-filled
necrotic liver, rapid decomposition and
tympany of the carcasses, and the absence
of any other detectable cause of death.
Anaerobic cultures yielded large numbers
of Clostridium-like organisms, and C novyi
type B was identified using a multiplex
polymerase chain reaction (PCR) assay. In
cases of unexpected mortality in gestating
sows, veterinarians need to be aware of the
most common causes of death, including
C novyi infection. In order to achieve a
correct diagnosis, it is essential to perform
a postmortem examination and collect
samples as soon as possible after death. In
addition, use of PCR procedures may allow
rapid identification of C novyi and the
types implicated.
Keywords: swine, Clostridium novyi, Ibe-
rian breed pig, sudden death.
Received: April 6, 2009
Accepted: May 28, 2009
AG, DA: Research Center Finca la Orden-Valdesequera, Junta de Extremadura, Badajoz, Spain.
JMB, WLG, RM, SS: Infectious Diseases, Department of Animal Health, School of Veterinary
Sciences, University of Extremadura, Cáceres, Spain.
Corresponding author: Dr Alfredo García, Department of Animal Production, Research Center
Finca la Orden-Valdesequera, Autovía A5 Km 372, 06187 Guadajira (Badajoz), Spain; Tel: 0034
924014031; Fax: 0034 924014001; E-mail: alfrgcia@unex.es.
This article is available online at http://www.aasv.org/shap.html.
García A, Ayuso D, Benítez JM, et al. Clostridium novyi infection causing sow mortality in an Iberian
pig herd raised in an outdoor rearing system in Spain. J Swine Health Prod. 2009;17(5):264–268.
Sow culling and mortality are among
the most important determinants of
financial well-being in pig-breeding
units.1 Financial losses associated with high
sow mortality include the value of lost sows
and pigs, the cost of early female replace-
ment, and depletion of sow-herd quality as
culling is less intentional.2,3
The Iberian pig is a unique autochthonous
breed, perfectly adapted to the Mediter-
ranean natural ecosystem in the southwest
of the Iberian Peninsula. Traditionally, they
are reared outdoors in long production
cycles (12 to 18 months), with the finish-
ing pigs grown by making use of natural
resources, mainly acorns from evergreen
oaks (Quercus ilex and Quercus rotundifolia)
and pasture.4 At least 1 hectare (2.47 acres)
of healthy oak-wooded meadow is needed
to raise a single pig (extensive production
system).
Nowadays, the Iberian pig breed is popular
because its meat and meat products have
very little in common with those obtained
from selected pigs raised under inten-
sive conditions. The high acceptance of
these products in the Spanish market has
allowed the flourishing of a niche market
of increasing importance and very high
profits.
Case description
Two mature gestating sows died unexpect-
edly in mid-January in an Iberian pig-
breeding unit during their confinement
Resumen - Infección por Clostridium
novyi causa mortalidad en hembras en
un hato de cerdos Ibéricos criado en
producción extensiva en España
El Clostridium novyi fue la causa sospechada
de muerte de dos hembras gestantes de raza
Ibérica, basándose en la evidencia de hígado
necrótico lleno de gas, una rápida descom-
posición y timpanismo de las canales, así
como la ausencia de otra causa detectable de
muerte. Los cultivos anaeróbicos rindieron
grandes cantidades de organismos similares
a Clostridium, y se identificó el C novyi
tipo B utilizando una prueba multiplex de
reacción en cadena de la polimerasa (PCR
por sus siglas en inglés). En casos de mor-
talidad inesperada en hembras gestantes, los
veterinarios deben estar conscientes de las
causas más comunes de muerte, incluyendo
la infección por C novyi. Para lograr un
diagnóstico correcto, es esencial realizar un
examen post mortem y colectar muestras
después de la muerte tan pronto como sea
posible. Además, el uso de la prueba de PCR
puede permitir la rápida identificación del C
novyi y los serotipos implicados.
Résumé - Infection par Clostridium
novyi entraînant de la mortalité chez des
truies élevées dans un système d’élevage
extérieur en Espagne
Clostridium novyi était la cause suspectée
de la mort de deux truies matures en gesta-
tion de race ibérique, sur la base d’un foie
nécrotique empli de gaz, d’une décomposi-
tion rapide et de tympanisme des carcasses,
et de l’absence d’autres causes détectables
de mortalité. Des cultures anaérobiques ont
permis la croissance d’un grand nombre
de micro-organismes apparentés à des
clostridies, et C novyi type B a été identifié
à l’aide d’une réaction d’amplification en
chaîne par la polymérase (PCR) multiplex.
Dans les cas de mortalité soudaine chez des
truies en gestation, les vétérinaires doivent
être au fait des causes les plus courantes de
la mort, incluant l’infection par C novyi.
Afin d’arriver à un diagnostic correct, il
est essentiel d’effectuer un examen post-
mortem et de prélever des échantillons aus-
sitôt que possible après le décès. De plus,
l’utilisation de méthodes PCR pourrait
permettre une identification rapide de C
novyi et des types impliqués.

265Journal of Swine Health and Production — Volume 17, Number 5
in farrowing crates. At present, on many
Iberian pig farms, traditional outdoor sow
gestation is followed by indoor farrowing
in modern premises (semi-extensive man-
agement). These buildings are equipped
with slatted flooring and natural ventila-
tion. The case farm had 160 sows fed a
commercial feed and with access to the
natural meadowland resources of pasture
and acorns. Sows farrowed twice a year and
pregnant sows were confined in farrowing
crates 1 week before giving birth.
Although postmortem examinations were
performed only 2 or 3 hours after the death
of the sows and ambient temperature was
approximately 7˚C, the carcasses were
grossly distended and there was purple
discoloration of the skin. Necropsy find-
ings revealed generalized subcutaneous
edema, a foul odor when the carcass was
opened, enlarged and congested lymph
nodes, bloodstained fluid in pleural,
pericardial, and peritoneal cavities, serosal
hemorrhages, and enlarged spleen. In each
case, the stomach was full, the lungs were
congested, and the liver was enlarged, fri-
able, and dark, with gas bubbles uniformly
infiltrated, thereby presenting a spongy
appearance on the cut surface (Figure 1).
Necropsy samples were submitted to the
School of Veterinary Sciences at the Uni-
versity of Extremadura (Cáceres, Spain)
for examination of smears, culture, histo-
pathology examination, and fecal flotation
and sedimentation assays.
Figure 1: The abdominal cavity of a mature gestating Iberian breed sow at necropsy. A: Full stomach and gas bubbles in
the liver; B: The liver uniformly infiltrated with gas bubbles, presenting a spongy appearance on the cut surface, probably
the most distinguishing feature of sudden death in sows caused by Clostridium novyi.
AB
Figure 2: Histopathology section of the liver of an Iberian sow stained with
hematoxilin and eosin showing hepatocellular degeneration and intrahepatic
spherical non-staining cavities (gas bubbles) associated with Clostridium novyi
infection (magnification ×100).
Histopathological examination of the liver
of one sow revealed intrahepatic spherical
non-staining cavities (gas bubbles) (Figure
2) and moderate multifocal lymphohisto-
cytic hepatitis with hepatocellular degen-
eration and necrosis.
Large numbers of gram-positive rods were
observed in Gram-stained smears from
the heart, lungs, kidneys, spleen, and
liver of each sow (Figure 3). Anaerobic
cultures yielded large number of Clos-
tridium-like organisms. To make a rapid
identification of pathogenic clostridia,
the multiplex polymerase chain reaction
(PCR) procedure described by Sasaki et
al5 was performed. A BLAST homology

Journal of Swine Health and Production — September and October 2009266
Figure 3: Smears from the liver of an Iberian sow that died of Clostridium novyi
infection, showing large gram-positive rods with oval to cylindrical subterminal
spores (magnification ×1000).
search (program available at www.ncbi.nlm.
nih.gov/BLAST) revealed that the 427-bp
nucleotide sequence of the amplified
product (Figure 4) matched the partial
flagellin (fliC) gene of Clostridium novyi
type B ATCC 25758 (DDBJ accession no.
AB058936) (Figure 5).
Discussion
Clostridium novyi is an anaerobic, spore-
forming, gram-positive rod that varies in
size.6 The organism produces highly potent
exotoxins (A to D)7 of which the lethal,
necrotizing alpha toxin is considered to be
the principal toxin of the type B strain in
pigs.8 This toxin causes necrosis, increases
permeability of the cell barrier, and dis-
rupts intercellular junctions.6,9,10
Clostridium novyi is the causative agent
responsible for gas gangrene in humans and
infectious necrotic hepatitis (black disease)
in sheep, cattle, goats, and horses.7 Both
C novyi types A and B have been isolated
from reported cases of sudden death in
sows.7,8
Although C novyi infections are unusual in
pigs,8 cases of sudden death in sows have
been reported in intensive swine-breeding
units in Europe7,11 and in outdoor pig units
in eastern Europe.12,13 Nevertheless, to our
knowledge, mortality of sows caused by C
novyi has not been reported in Iberian pigs
reared under extensive or semi-extensive
conditions, an important livestock subsector
in the southwest of the Iberian Peninsula.
The pathogenesis of C novyi sudden death
in sows has not been elucidated. Clos-
tridium novyi is a normal inhabitant of the
large intestine and liver in pigs, although
the route by which the organism reaches
the liver has not been documented. If
disease develops, spores in the liver become
vegetative and produce potent exotoxins,
responsible for the severe necrotizing and
edematous tissue damage.7 In sheep with
infectious necrotic hepatitis, previous dam-
age to the liver parenchyma, usually by
migrating liver flukes, is required for pro-
liferation of C novyi.14 In this case, we did
not find lesions of parasitic or larval migra-
tion in the liver, and the fecal flotation for
intestinal nematodes was negative for each
sow. However, an outbreak of swine dysen-
tery had occurred in the herd. Some studies
have reported that other concomitant
low-grade infectious processes (eg, metritis,
cystitis, enteritis) may predispose sows
Figure 4: Gel electrophoresis (2% agarose gel stained with ethidium bromide)
showing a species-specific 427-pb band identifying Clostridium novyi type B.
The band was amplified using the multiplex polymerase chain reaction system
described by Sasaki et al.5 Lanes 1 and 6: molecular weight marker ladder 1 kb
(Bioline GmbH, Luckenwalde, Germany); lanes 2 to 5, PCR amplification prod-
ucts from duplicate positive cultures from the livers of two Iberian sows that
died of C novyi infection.

267Journal of Swine Health and Production — Volume 17, Number 5
Figure 5: The amplification product obtained from the multiplex PCR in Figure 4 was sequenced. A BLAST homology
search (program available at www.ncbi.nlm.nih.gov/BLAST) showed that the nucleotide sequence matched the partial
flagellin (fliC) gene of Clostridium novyi type B ATCC 25758.
Clostridium novyi fliC gene for flagellin, complete cds, strain: ATCC 25758 Length=864
Score = 580 bits (314), Expect = 1e-162
Identities = 360/382 (94%), Gaps = 4/382 (1%)
Strand=Plus/Plus
Query 1 AAAAATGAGAGGACAAATTAGAGGATTAAACCCAAGC-TCAAGAAATGCTCAAGATGGTA 59
|||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||||||
Sbjct 172 AAAAATGAGAGGACAAATCAGAGGATTAAA-TCAAGCATCAAGAAATGCTCAAGATGGTA 230
Query 60 TCTCTTTAATCCAAACAGCTGAAGGAGCTGTAAACGAAACACACGCAATACTTCAAAGAA 119
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct 231 TCTCTTTAATCCAAACAGCTGAAGGAGCTTTAAACGAAACACACGCAATACTTCAAAGAA 290
Query 120 TGAGAGAATTATCAGTACAAGCTGCTAATGATACAAACAAAACAGAAGATAGAGCAATGA 179
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 291 TGAGAGAATTATCAGTACAAGCTGCTAATGATACAAACAAAACAGAAGATAGAGCAATGA 350
Query 180 TACAAAAAGAATTCTCACAATTACAAACAGAAATCACAAAAATTGGAAAAGACACTCAAT 239
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct 351 TACAAAAAGAATTCTCACAATTACAAACAGAAATCACAAGAATTGGAAAAGACACTCAAT 410
Query 240 TCAATAAACAAAACCTATTAACAGGATCAGCTTCAAGCAT-AGACTTCCAAGTAGGAGCT 298
|||||||||||||||||||||||||||||||| || | | |||||||||||||||||||
Sbjct 411 TCAATAAACAAAACCTATTAACAGGATCAGCTA-AATCTTTAGACTTCCAAGTAGGAGCT 469
Query 299 AATGAAAAACAAGTTATAAATGTTAAAATTGGTGATATGAGAGCCACTGCTTTAAATGTT 358
|||| | |||||||||||||||||||||| |||||||||||| ||||||||||| |
Sbjct 470 AATGCAGGACAAGTTATAAATGTTAAAATTAATGATATGAGAGCTACTGCTTTAAAAATA 529
Query 359 GGCGCAGCTAATGTTAGCATAA 380
| ||||||||| ||||||||||
Sbjct 530 GACGCAGCTAAAGTTAGCATAA 551
Clostridium novyi fliC gene for flagellin, complete cds, strain: ATCC 25758 Length=864
Score = 580 bits (314), Expect = 1e-162
Identities = 360/382 (94%), Gaps = 4/382 (1%)
to proliferation of C novyi in the liver.7
Furthermore, the peripartum period is a
particularly stressful stage; much of the sow
mortality associated with C novyi appears
to occur at or near the critical farrowing
period. In our opinion, general functional
changes in the sow’s immune system dur-
ing gestation may also play an important
role in occurrence of C novyi hepatopathy.
Diagnosis of C novyi infection in swine
is difficult, since suspect cases are usually
found dead, and the interval between death
and necropsy introduces the possibility of
postmortem invasion. Demonstration of
C novyi in the liver of a sow dead for > 24
hours does not alone constitute sufficient
evidence of infectious necrotic hepatitis or
clostridial hepatopathy.7.15 It is then essen-
tial to perform a postmortem examination
and collect samples as soon as possible after
death. Difficulties in determining whether
necropsy findings constitute postmortem
degeneration, particularly in the summer,
have probably caused under-reporting of
this cause of sow mortality.7
In one study, fluorescent antibody (FA)
tests on liver smears were more sensitive
than culture for identification of C novyi.7
However, the frequency of false-positive
FA tests results increased with the interval
between death and necropsy.8 Further-
more, the FA test can be confounded by
cross-reactions between C novyi and Clos-
tridium botulinum.16 Culture for C novyi
must be performed in a specialized labora-
tory, as not all laboratories are skilled in
its isolation. Clostridium novyi type B has
very demanding anaerobic and nutritional
requirements; thus, a negative culture may
not necessarily rule out C novyi infection.13
Although great care must be taken in
interpreting bacteriological findings, iden-
tification of clostridial organisms, along
with the history of sudden death, rapid
postmortem decomposition of internal
organs, and the presence of gas bubbles in
the liver, suggests death due to clostridial
infection. Probably the most distinguishing
feature of sudden sow mortality due to C
novyi is an enlarged, friable, gas-filled liver,
with liver lobes filled with pockets of gas
that produce a honeycomb-like appearance
(similar to a chocolate bar filled with air
bubbles).7,8

Journal of Swine Health and Production — September and October 2009268
Disease caused by C novyi can be con-
trolled by reducing the incidence of
pneumonia, metritis, and enteritis in
affected groups of pigs. Several studies
have reported the use of zinc bacitracin to
reduce mortality, and disposal of carcasses
by incineration or deep burial may reduce
the contamination of the environment
by spores.6,17,18 Prevention may also be
achievable by the use of bacterin-toxoids
or toxoids, and second-generation vaccines
may be based upon native or recombinant
alpha19 or beta toxoids. In contrast, vac-
cination of sows at risk with a multivalent
clostridial vaccine does not seem to be an
effective control measure.11,17
Implications
• Clostridium novyi infection is a com-
mon cause of death in gestating sows.
• If carcasses are not examined soon
after death and depending on weather
and other postmortem conditions, it
may not be possible to reach a diagno-
sis of C novyi infection.
• A timely postmortem examination
and sample collection, along with
microbial isolation and the use of PCR
procedures, may allow a correct diag-
nosis of C novyi infection in swine.
Acknowledgments
This work is part of the Research project
PRI08A062 supported by the Regional
Government Junta de Extremadura and the
European Social Fund.
References
1. Bilkei G, Bölcskei A. Production related cull-
ing strategy in a large pig production unit. Pig J.
1995;35:140–149.
*2. Sanz M, Roberts J, Almond G, Alvarez R,
Donovan T, Perfumo C. What we see with sow
mortality. Proc AD Leman Swine Conf. St Paul,
Minnesota. 2002;181–184.
*3. Deen J, Xue J. Sow mortality in the US: An
industry-wide perspective. Proc AD Leman Swine
Conf. St Paul, Minnesota. 1999;26:91–94.
4. López-Bote C. Sustained utilization of the Ibe-
rian pig breed. Meat Sci. 1998;49:17–27.
5. Sasaki Y, Kojima A, Aoki H, Ogikubo T, Taki-
kawa N, Tamura Y. Phylogenetic analysis and PCR
detection of Clostridium chauvoei, Clostridium
haemolyticum, Clostridium novyi types A and B,
and Clostridium septicum based on the flagellin
gene. Vet Microbiol. 2002;86:257–267.
*6. Schultz R, Dau D, Höfling D, Duran O, Car-
son T, Becton L, Woodward C, Pollard K, Busker
K, Kaster D, Steidinger M. A sow mortality study
- the real reason sows die. Identifying causes and
implementing actions. Proc AASV. Ames, Iowa.
2001;387–395.
7. Duran CO, Walton JR. Clostridium novyi
sudden death in sows: Toxaemia or post mortem
invader? Pig J. 1997;39:37–53.
8. Taylor DJ. Clostridial infections. In: Straw
BE, D’Allaire S, Mengeling WL, Taylor DJ, eds.
Diseases of Swine. 8th ed. Ames, Iowa: Iowa State
University Press; 1999:405–406.
*9. Reeves DE, Harmon B. Clostridium novyi
associated mortality in the sow. Proc AASV. Kansas
City, Missouri. 2002;153–154.
10. Songer JG. Clostridial diseases of animals. In:
Rood JI, McClane BA, Songer JG, Titball RW,
eds. The Clostridia: Molecular Biology and Patho-
genesis. New York, New York: Academic Press;
1997:153–184.
*11. Walton JR, Duran CO. Sow deaths due to
Clostridium novyi infection. Proc IPVS Cong. The
Hague, Netherlands. 1992;296.
12. Almond P, Bilkei G. Clostridium novyi
caused outdoor sow mortality in Croatia. Ber-
liner und Münchener Tierärtzliche Wochenschrift.
2005;118:296–299.
13. Friendship D, Bilkei G. Mortality caused by
Clostridium novyi in outdoor sows in Slovakia. Vet
Rec. 2006;158:601.
14. Bagadi HO, Sewell MMH. Experimental stud-
ies on infectious necrotic hepatitis (Black Disease)
of sheep. Res Vet Sci. 1973;15:53–61.
15. Batty I, Kerry JB, Walker PD. The incidence
of Clostridium oedematiens in postmortem material.
Vet Rec. 1967;80:32.
16. Friendship CR, Bilkei G. Concurrent swine
erysipelas and Clostridium novyi infections associ-
ated with sow mortality in outdoor sows in Kenya.
Vet J. 2007;173:694–696.
17. Marco E. Sudden deaths in sows. Pig J.
1995;35:157–163.
*18. Kavanaugh NT, Spillane P. Cost benefit stud-
ies of zinc bacitracin for control of Clostridium
novyi infection in intensively housed sows. Proc
IPVS Cong. Birmingham, England. 1998;2:241.
19. Amimoto K, Sasaki O, Isogai M, Kitajima T,
Oishi E, Okada N, Yasuhara H. The protective
effect of Clostridium novyi type B alpha-toxoid
against challenge with spores in guinea pigs. J Vet
Med Sci. 1998;60:681.
* Non-refereed references.