Clinical and Genetic Findings of Five Patients with WT1-Related Disorders

Universidade de Campinas, SP, Brasil.
Arquivos brasileiros de endocrinologia e metabologia (Impact Factor: 0.84). 11/2008; 52(8):1236-43. DOI: 10.1590/S0004-27302008000800006
Source: PubMed
ABSTRACT
To present phenotypic variability of WT1-related disorders.
Description of clinical and genetic features of five 46,XY patients with WT1 anomalies.
Patient 1: newborn with genital ambiguity; he developed Wilms tumor (WT) and chronic renal disease and died at the age of 10 months; the heterozygous 1186G>A mutation compatible with Denys-Drash syndrome was detected in this child. Patients 2 and 3: adolescents with chronic renal disease, primary amenorrhea and hypergonadotrophic hypogonadism; patient 2 had a gonadoblastoma. The heterozygous IVS9+4, C>T mutation, compatible with Frasier syndrome was detected. Patient 4: 9-year-old boy with aniridia, genital ambiguity, dysmorphisms and mental deficiency; a heterozygous 11p deletion, compatible with WAGR syndrome was detected. Patient 5: 2 months old, same diagnosis of patient 4; he developed WT at the age of 8 months.
Constitutional abnormalities of WT1 cause gonadal and renal anomalies and predisposition to neoplasia and must be investigated in patients with ambiguous genitalia, chronic renal disease and(or) Wilms tumors; primary amenorrhea with chronic renal disease; and aniridia, genital ambiguity and dysmorphisms.
1236 Arq Bras Endocrinol Metab 2008;52/8
copyright
©
ABE&M todos os direitos reservados
clinical case report
Ju l i a n a Ga b r i e l r. d e an d r a d e
Ma r a Sa n C h e S Gu a r a G n a
fe r n a n d a Ca r o l i n e So a r d i
Gil Gu e r r a -Jú n i o r
MariCilda pa l a n d i d e Me l l o
an d r é a tr e v a S Ma C i e l -Gu e r r a
Grupo Interdisciplinar de Estudos
da Determinação e
Diferenciação do Sexo (GIEDDS),
Faculty of Medical Sciences,
University of Campinas
(Unicamp) (JGRA, GGJ, ATMG);
Centro de Biologia Molecular e
Engenharia Genética (CBMEG),
Unicamp (MSG, FCS, MPM);
Campinas, SP, Brazil.
Received in 25/8/2008
Accepted in 14/10/2008
Clinical and Genetic Findings of Five Patients
with WT1-Related Disorders
ABSTRACT
Aim: To present phenotypic variability of WT1-related disorders. Methods: De-
scription of clinical and genetic features of five 46,XY patients with WT1 anom-
alies. Results: Patient 1: newborn with genital ambiguity; he developed Wilms
tumor (WT) and chronic renal disease and died at the age of 10 months; the
heterozygous 1186G>A mutation compatible with Denys-Drash syndrome was
detected in this child. Patients 2 and 3: adolescents with chronic renal dis-
ease, primary amenorrhea and hypergonadotrophic hypogonadism; patient 2
had a gonadoblastoma. The heterozygous IVS9+4, C>T mutation, compatible
with Frasier syndrome was detected. Patient 4: 9-year-old boy with aniridia,
genital ambiguity, dysmorphisms and mental deficiency; a heterozygous 11p
deletion, compatible with WAGR syndrome was detected. Patient 5: 2 months
old, same diagnosis of patient 4; he developed WT at the age of 8 months.
Conclusions: Constitutional abnormalities of WT1 cause gonadal and renal
anomalies and predisposition to neoplasia and must be investigated in patients
with ambiguous genitalia, chronic renal disease and(or) Wilms tumors; primary
amenorrhea with chronic renal disease; and aniridia, genital ambiguity and
dysmorphisms. (Arq Bras Endocrinol Metab 2008; 52/8:1236-1242)
Keywords: Sex differentiation; WT1 gene; Denys-Drash syndrome; Frasier
syndrome; WAGR syndrome
RESUMO
Achados Clínicos e Genéticos de Cinco Pacientes com Anomalias
Relacionadas ao Gene WT1.
Objetivo: Descrever a variabilidade fenotípica das anomalias relacionadas ao
WT1. Métodos: Descrição das características clínicas e genéticas de cinco pa-
cientes 46,XY com anomalias no WT1. Resultados: Paciente 1: Recém-nascido
com ambigüidade genital desenvolveu tumor de Wilms (TW) e insuficiência
renal crônica (IRC), com óbito aos 10 meses. Detectada a mutação 1186G>A
em heterozigose, compatível com síndrome de Denys-Drash. Pacientes 2 e 3:
Adolescentes com IRC, amenorréia primária e hipogonadismo hipergonado-
trófico; a paciente 2 apresentava gonadoblastoma. Ambas apresentavam
mutação IVS9+4, C>T em heterozigose, característica da síndrome de Frasier.
Paciente 4: Idade 9 anos, aniridia, ambigüidade genital, dismorfismos e defi-
ciência mental; deleção 11p, compatível com síndrome WAGR foi encontrada
em heterozigose. Paciente 5: Dois meses, mesmo diagnóstico do paciente 4,
desenvolveu TW aos 8 meses. Conclusões: Alterações constitucionais do
WT1 determinam anomalias gonadais, renais e predisposição a neoplasias;
devem ser pesquisadas em casos de ambigüidade genital associada a IRC
e(ou) TW; de amenorréia primária com IRC; e aniridia, ambigüidade genital e
dismorfismos. (Arq Bras Endocrinol Metab 2008; 52/8:1236-1242)
Descritores: Diferenciação sexual; Gene WT1; Síndrome de Denys-Drash;
Síndrome de Frasier; Síndrome WAGR
Page 1
Arq Bras Endocrinol Metab 2008;52/8 1237
WT1-Related Disorders
Andrade et al.
copyright
©
ABE&M todos os direitos reservados
sex ambiguity as a result of dysgenetic testis, diffuse
mesangial sclerosis with chronic renal disease and high
incidence of Wilms tumour (WT) (13-14). The clinical
picture of FS includes dysgenetic gonads with male-to-
female sex reversal in 46,XY subjects and pubertal delay
in both sexes, nephrotic syndrome and focal segmental
glomerulosclerosis leading to chronic renal disease ,
and high incidence of gonadoblastoma but not of WT.
Mutations in FS affect the splice site in intron 9, with
WT1(+KTS) isoforms (15-16) losses.
WAGR (WT, aniridia, genitourinary malformations,
mental retardation) is a contiguous gene syndrome ari-
sing from deletions of chromosome 11p13 which en-
compass at least both the PAX6 and WT1 genes
(17-19).
We report five patients followed in a reference ser-
vice for disorders of sex development which illustrate
the broad spectrum of presentation of WT1-associated
disorders.
METHODS
Patients
The five patients were evaluated by the Interdisciplina-
ry Study Group of Disorders of Sex Development
(GIEDDS) of the State University of Campinas, São
Paulo. The protocol was approved by the local Ethics
Committee (N. 434/06) and informed consent was
obtained from the parents of the children included in
the study.
Laboratory assays
LH, FSH, testosterone were measured by electroche-
miluminescence (BM/Hitachi Elecsys 2010, Roche
Diagnostics, Boehringer, Mannheim, Germany).
Karyotype
Chromosome analysis of peripheral blood lymphocytes
was performed by G-banding at 500-600 bands resolu-
tion using standard procedures.
Genomic DNA extraction, amplification
and sequencing
Genomic DNA from peripheral blood leukocytes was
purified by Proteinase K digestion and phenol/chloro-
form extraction followed by ethanol precipitation using
standard techniques (20).
INTRODUCTION
S
ex determination is a complex and yet not fully elu-
cidated process which depends on a complex ne-
twork of interrelated genes. Gonadal development
starts by the end of the 5
th
week of gestation with the
migration of primordial germ cells from the yolk sac to
the gonadal anlage. Formation of the primordial gona-
ds, which have no apparent sexual differences up to 8
weeks, depend on the expression of many genes, inclu-
ding SF-1 (steroidogenic factor 1) (1), DAX1 (dosage-
sensitive sex reversal, adrenal hypoplasia critical region,
on chromosome X, gene 1) (2) and WT1 (Wilms tu-
mour 1) (3).
WT1 (OMIM 607102) is located at 11p13 and en-
codes a zinc finger motif-containing transcription factor
involved in regulation of growth and differentiation (4).
Beyond its role in the genesis of Wilms tumour (5-6), it
regulates early gonad and kidney development (7).
Alternative splicing generates four major WT1 iso-
forms: an alternative splice site in intron 9 allows the
addition of three amino acids (KTS) between zinc fin-
gers 3 and 4 and the fifth exon, encoding 17 aminoaci-
ds, may or may not be present. These isoforms are
highly conserved among different species and play a
crucial role in normal gene function. Gene action de-
pends on the predominant isoform: WT1 (-KTS) va-
riants act as transcriptional regulators, while WT1
(+KTS) participates on the regulation of certain genes
at the post-transcriptional level (8-10).
WT1 (-KTS) isoforms act in association with the
product of SF1 to promote expression of anti-müllerian
hormone (AMH), responsible for regression of the
müllerian ducts in male embryos. The product of DAX1
can repress the synergistic action of WT1 and SF1, re-
sulting in down-regulation of AMH (11). In vitro ex-
periments suggested that WT1 (-KTS) variants are also
responsible for transcriptional activation of SRY, which
activates the male differentiation pathway (10).
Mutations in WT1 are found in a variety of syndro-
mes, including Denys-Drash (DDS, OMIM 194080),
Frasier (FS, OMIM 136680) and WAGR (OMIM
194072) syndromes. Both DDS and FS are characterized
by gonadal and renal anomalies and predisposition to ne-
oplasia associated with “de novo” constitutional WT1
point mutations with a negative dominant effect (12).
In DDS, mutations often occur in the zinc finger
region abolishing DNA binding capacity and leading to
Page 2
1238 Arq Bras Endocrinol Metab 2008;52/8
WT1-Related Disorders
Andrade et al.
copyright
©
ABE&M todos os direitos reservados
The 10 exons and the exon-intron junction regions
of the WT1 gene were PCR amplified from genomic
DNA with primers described in Table 1. Genomic se-
quence of the WT1 gene was obtained in the published
sequence ENSG00000184937 (www.ensembl.org).
The final volume of all reactions was 50 uL and con-
tained 10X Taq DNA polymerase buffer (Invitrogen,
CA, USA), 1.0-1.5 mM MgCl2, 2 mM of each dNTP,
20 pmol of each primer, 300-500 ng genomic DNA
templates 2 units recombinant Taq DNA polymerase
(Invitrogen), 5% DMSO used only for exon 1. After a
first denaturation step (5 min, 94°C), the cycling profile
was: 94°C, 1 min; 53,5°C 63,5°C, 1 min; 72°C 1-6
min (30 cylcles), followed by 5 min at 72°C (final exten-
sion). The size of the PCR products was verified in 1%
agarose gel electrophoresis stained with ethidium bromi-
de. Before sequencing, purification of PCR products was
performed using the Wizard SV Gel and PCR clean-up
system (Promega, Madison, WI, USA). Further direct
sequencing using ABI PRISM Big Dye Terminator v3.1
Cycle Sequencing Kit (ABI PRISM/PE Biosystems,
Foster City, CA, USA) was carried out in two separate
reactions for each exon, except for exon 1 which requi-
red four reactions, using sense and antisense primers
(Table 1). The sequences were obtained in an automatic
sequencer ABI PRISM 3700 DNA Analyzer (ABI
PRISM/PE Biosystems). Free softwares Chromas Lite
and CLC Sequence Viewer v.5.0.1 were used to analyze
and compare sequences with the published WT1 sequen-
ce at Ensembl database.
RESULTS
Case 1
A 1-month-old child was referred to us due to sex am-
biguity. He was born at term after an uneventful preg-
nancy with a birth weight of 3,655 g and length 50 cm.
He was the second child of unrelated parents and fami-
Table 1. Primers designed for WT1 coding sequence amplification.
Primer Direction Sequences 5’-3’ nt
2
Ta (°C)
3
Size (bp)
4
Exon 1 Forward TGAGTGAATGGAGCGGCCGAG 512-532 60.5 1049
Reverse TTGGGAAGCAGCTGGGTAAGAG 1539-1560
Intron 1Int
1
Forward TTCATCAAACAGGAGCCGAG 1211-1230
Intorn 1Int
1
Reverse AAAGTGGACAGTGAAGGCGC 1269-1288
Exon 2-3 Forward CTGTCCCAAGGTCACATCCAG 7324-7344 57.5 1015
Reverse AAGTAGTAGAGTGGAGTCGAGGC 8313-8338
Intorn 2Int
1
Reverse ATTTGCTGTGGGTTAGGAATTC 7710-7731
Intron 2Int
1
Forward GGCTTAGCTTCTTGCATTCTG 7921-7941
Exon 4-5 Forward GATTTGCATATTCTGTCATTCTG 18351-18373 53.4 1406
Reverse ATGCTACCCTGATTACCCACG 19737-19757
Intron 4Int
1
Reverse AAGCGTTCTAATGTCACAGAGAG 18678-18700
Intron 4Int
1
Forward GCACTCTTGATAGCTAGCTTGATG 19475-19498
Exon 6 Forward TGCATCTAAAGTGGCCCCATG 35945-35965 57.5 375
Reverse AAAGGAGCCTGCAGTGAAGAAG 36298-36319
Exon 7 Forward TGGGGATCTGGAGTGTGAATG 39586-39606 56.6 442
Reverse TCTTTACAACACCTGGATCAGACC 40004-40027
Exon 8-9 Forward TACCCTAACAAGCTCCAGCG 43258-43277 55,1 1037
Reverse TCTCTCAACTGAGTCTAAACCTTAG 44271-44295
Intorn 8Int
1
Reverse GAGAATCATGAAATCAACCCTAG 43522-43544
Intron 8Int
1
Forward TGAGGCAGATGCAGACATTG 43949-43968
Exon 10 Forward CGGGCCTTGATAGTTGAACTTG 46892-46913 56.1 890
Reverse GTTTCTTAAGAGCAGTGTGCCAG 47759-47781
1
Internal primers used only for sequencing;
2
nucleotide position in the sequence ENSG00000184937;
3
Anealing temperature used in PCR;
4
size of amplified fragments.
Page 3
Arq Bras Endocrinol Metab 2008;52/8 1239
WT1-Related Disorders
Andrade et al.
copyright
©
ABE&M todos os direitos reservados
ly history was unremarkable. He had a 2-cm phallus
with chordee, penoscrotal hypospadia, shawl scrotum,
bilateral cryptorchidism, and there was no dysmorphic
picture associated to sex ambiguity. Sonography revea-
led no mullerian derivatives while genitography showed
a urogenital sinus.
His karyotype was 46,XY, and there were normal
basal levels of LH (5.4 U/L), FSH (3.8 U/L), free
(5.4 pg/mL) and total (157 ng/dL) testosterone (T).
When the child was 6 months old, a hCG stimulation
test was performed (three intramuscular injections of
Chorionic Gonadotropin (Profasi
®
, 1,000 IU, on suc-
cessive days), and testosterone levels increased from
157 to 395 ng/dL. He developed unilateral WT and
chronic renal disease at 8 months, and died 2 months
later as a result of septicemia.
An 1186G>A heterozygous mutation was detected
in exon 9 and confirmed the diagnosis of DDS; this
case was first reported by Tagliarini and cols. (21).
CASE 2
A 17.3-year-old girl was evaluated for primary amenor-
rhea and hypergonadotrophic hypogonadism. She was
born at term after an uneventful pregnancy, with a birth
weight of 3,560g and length 46cm. She was the second
child of unrelated parents, and family history was unre-
markable. She was subject to renal transplantation at 11
years as a consequence of chronic renal disease; at the
same age, bilateral inguinal hernia repair was performed.
She referred spontaneous pubertal onset. On phy-
sical examination, she had normal external genitalia
and pubertal development was on Tanner stage B3P2.
There was no dysmorphic picture. Ultrasound revealed
a 2.8cm
3
uterus, and gonads could not be found.
Her karyotype was 46,XY, and there were high le-
vels of FSH (188 U/L) and LH (46 U/L) and low
estradiol (11pg/mL). Bilateral gonadectomy was per-
formed, and histology revealed a right dysgenetic go-
nad with mesonephric remnants and a gonadoblastoma
on the left. Female hormonal replacement therapy was
initiated later on. Molecular analysis revealed an
IVS9+4, C>T heterozygous mutation in intron 9 (Fi-
gure 1), thus confirming the diagnosis of Frasier syn-
drome.
Case 3
A 18-years-old girl was referred with a suspected diag-
nosis of FS to molecular analysis. She was the second
child of unrelated parents, and family history was unre-
markable. The girl had chronic renal disease treated
with peritoneal dialysis, and primary amenorrhea was
investigated when she was 15 years old cytogenetic
investigation revealed a 46,XY karyotype, bilateral go-
nadectomy was performed and histology revealed dys-
genetic gonads. She has been on HRT since then.
On physical examination, she had no dysmorphic
picture, external genitalia were normal, and breast de-
velopment was incomplete.
Molecular analysis revealed the same mutation of
case 2, thus confirming the diagnosis of FS.
Case 4
A 9-year-old boy presented with a history of sex ambi-
guity, aniridia, mental and motor retardation and dys-
morphic features. He was born at term by cesarian
section for breech presentation, after an uneventful
pregnancy, with a birth weight of 2,550g. He was the
first child in a sibship of three; his parents were not re-
lated, and family history was unremarkable.
Figure 1. A) The 1037 bp exon 8-9 fragment was amplified by polymerase chain reaction (PCR). L- 1 kb-Plus Ladder (Invitrogen);
patient (1), normal control (2), control without DNA (3); B) Eletropherogram of exon 9 sequence showing the C>T heterozygous
mutation on WT1 intron 9. The KTS motif and the positions of alternative splicings are denoted.
Page 4
1240 Arq Bras Endocrinol Metab 2008;52/8
WT1-Related Disorders
Andrade et al.
copyright
©
ABE&M todos os direitos reservados
Physical examination revealed flat occiput, small
and dysmorphic ears, short upslanted palpebral fissures,
aniridia, nystagmus, short nose with high nasal bridge,
clinodactyly of the V fingers, bilateral single transverse
palmar crease, predominance of arches on the finger-
tips, fusiform fingers, nail hypoplasia, increased inter-
mamillary distance and diastasis recti. He had a
4.5cm-phallus, bifid scrotum, penoscrotal hypospadia
and nonpalpable gonads.
Ophthalmologic evaluation revealed macular hypo-
plasia. The testes were not seen on pelvic ultrasound
and genitography did not reveal a urogenital sinus.
He had prepubertal levels of LH (<0.2 U/L), FSH
(0.4 U/L), total (<20 ng/dL) and free (1 pg/mL) tes-
tosterone. An hCG stimulation test was performed,
and testosterone levels increased from <20 to 396 ng/
dL. Cytogenetic investigation revealed a de novo
46,XY,del(11p) karyotype, thus leading to the diagno-
sis of WAGR syndrome.
Case 5
A 3-month-old boy was evaluated for aniridia and dys-
morphic features. He was born in the 38
th
week of ges-
tation by cesarian section, and intrauterine growth
retardation was noted at the 7
th
month. Birth weight was
2,650g and length 44cm. He was the only child of unre-
lated parents, and family history was unremarkable.
On physical examination, he presented high fo-
rehead, low anterior hairline, dysmorphic ears, antever-
ted nostrils, notched alae nasi, long and flat philtrum,
thin upper lip, retrognathism, short neck, single trans-
verse palmar crease and hypoplastic nails. He had a 3.5-
cm phallus, bilateral cryptorchidism and hypoplastic
scrotum. Ophthalmologic evaluation revealed photo-
phobia, nystagmus, remnants of pupillary membrane
and peripheral iris and mottled retinal pigment epithe-
lium.
He had normal levels of LH (9.5 U/L), FSH (8.8
U/L), and total testosterone (669 ng/dL) for age. His
karyotype was 46,XY,del (11p) de novo (Figure 2), lea-
ding to the diagnosis of WAGR syndrome. When he
was 8 months old, a unilateral Wilms tumour was de-
tected by sonography. He was subject to nephrectomy,
chemotherapy and radiotherapy. There was no tumor
relapse until the age of 4 years, and renal function re-
mained normal. Data on these five cases are summari-
zed in Table 2
Table 2. Description of five 46,XY patients with WT1-related disorders.
N
Age at
diagnosis
Sex
assignment
Clinical picture Neoplasia WT1 Diagnosis
1 1 mo M
penoscrotal hypospadia, BL
cryptorchidism, ESRD*
Wilms tumour 1186G>A
Denys-Drash
syndrome
2 17 y F
Primary amenorrhea,
hypergonadotrophic hypogonadism, ESRD
L gonado-
blastoma
IVS9+4, C>T
Frasier
syndrome
3 18 y F
Primary amenorrhea,
hypergonadotrophic hypogonadism, ESRD
IVS9+4, C>T
Frasier
syndrome
4 9 y M
Aniridia, perineal hypospadia, BL
cryptorchidism, dysmorphic picture, motor
and speech delay, mental deficiency
11p13 deletion WAGR
5 2 mo M
Aniridia, BL cryptorchidism, dysmorphic
picture, motor and speech delay
Wilms tumour 11p13 deletion WAGR
BL = bilateral; ESRD = end stage renal disease; F = female; L = left; M = male; NB = newborn; *deceased (10 months)
Figure 2. Karyotype of patient 5.
Page 5
Arq Bras Endocrinol Metab 2008;52/8 1241
WT1-Related Disorders
Andrade et al.
copyright
©
ABE&M todos os direitos reservados
DISCUSSION
Disorders of gonadal development (DGD) are a highly
heterogeneous group of disorders of sex development
(DSD) and include individuals with dysgenetic gonads
(streaks), dysgenetic or rudimentary testes and true
hermaphroditism or ovotesticular DSD. Some 46,XY
individuals with DGD are born with sex ambiguity, and
thus may be evaluated in infancy. However, those with
female internal and external genitalia (male-to-female
sex reversal) may be diagnosed only in adolescence be-
cause of pubertal delay. The latter are of great concern
because of the risk of neoplastic transformation of dys-
genetic gonads, which is significantly elevated after
adolescence (22). Hormonal activity of gonadoblasto-
ma may be found in some patients (23); in case 2, for
instance, there was spontaneous breast development
which may be due to an estrogen-producing gonado-
blastoma.
Among DGD, WT1-related disorders are characte-
rized by the association of gonadal and renal anomalies.
As a consequence, screening for mutations in WT1
should be considered in 46,XY patients with ambiguous
genitalia associated with chronic renal disease and (or)
WT and in 46,XY females with hypergonadotrophic
hypogonadism and history of chronic renal disease ,
thus allowing the diagnosis of DDS and FS.
In addition, all newborns with aniridia who do not
have a family history of this ocular anomaly must be
subject to high-resolution cytogenetic testing, which
detects deletions involving 11p13 in up to 20% of indi-
viduals (24). FISH testing with probes spanning PAX6,
WT1, the regions flanking PAX6, and the intervening
sequence between PAX6 and WT1 can also be used
to detect cryptic deletions in individuals with other
clinical features of WAGR and normal cytogenetic
studies (24).
Genotype-phenotype correlations in WT1-related
disorders are well established. Mutations in DDS pa-
tients inactivate DNA binding by the zinc fingers, le-
ading to early and severe impairment of renal function,
dysgenetic testes and high incidence of WT, while in
FS mutations in the donor splice site of intron 9 of
the WT1 gene lead typically to dysgenetic gonads,
end-stage renal failure in the second decade and go-
nadoblastoma. In turn, the reduced haploinsuffi-
ciency of WT1 in 11p13 deletion has a less pronounced
effect on development, especially on that of the renal
system.
However, there are some reports of atypical pre-
sentations, including a 46,XY child with sex ambiguity,
nephrotic syndrome, gonadal tumour and normal tes-
tosterone production despite high levels of gonadotro-
pins, who had a mutation associated with FS (25), In
another study, a 46,XY child with sex ambiguity, nor-
mal testosterone production, aortic coarctation and no
renal disease was found to have a P181S mutation in
WT1 inherited from the mother (26).
Diagnosis of WT1-related disorders is more diffi-
cult in 46,XX subjects, who lack features of sex ambi-
guity and sex reversal. However, clinicians must have in
mind that WT1 mutations may be found in up to 5% of
cases of steroid-resistant nephrotic syndrome (SRNS)
(27-28). Routine evaluation of patients with this syn-
drome would allow early diagnosis of both DDS and
FS in both sexes.
The heterozygous 1186G>A (D396N) mutation
in exon 9 of patient 1 leads to an aspartic acid-aspara-
gine substitution changing the structural organization
of the third zinc finger of the WT1 protein. It was
described in 1991 (13) and is a frequent nding in
DDS; the most frequent mutation is 1180C>T
(R394W) (39.6%) (29). The apparent dominant-ne-
gative nature of DDS mutations results from the ac-
tion of altered WT1 in blocking the normal activity of
the wildtype protein (12).
The heterozygous mutation in intron 9 found in
both patients with FS (IVS9+4, C>T) is the most fre-
quent mutation identified in these patients (52%)
(15,25). This and the other four different mutations
described in intron 9 of WT1 in patients with FS lead to
reversal of the (+KTS)/(-KTS) ratio from 2:1 to 1:2
(15-16). Most of the patients with FS show the +4 C>T
and +5G>A mutations; this hotspot is probably a con-
sequence of the potential to deaminate 5-methylcytosi-
ne at the +4/+5 CpG dinucleotide (16).
Recurrence risk of WT1-related disorders varies ac-
cording to each specific situation. DDS and FS usually
arise as a consequence of de novo mutations, while 11p
deletion in WAGR syndrome may be de novo or may
result from transmission by a parent with a balanced
chromosome rearrangement (24).
In conclusion, constitutional abnormalities of WT1
should be considered in patients with ambiguous geni-
talia and renal disease (chronic renal disease or Wilms
tumors), primary amenorrhea with chronic renal disea-
Page 6
1242 Arq Bras Endocrinol Metab 2008;52/8
WT1-Related Disorders
Andrade et al.
copyright
©
ABE&M todos os direitos reservados
se, and those with aniridia, genital ambiguity and dys-
morphic picture with or without WT.
Acknowledments: We are grateful to the Main Clinical Labora-
tory of the University Hospital and to the Cytogenetics Labora-
tory of the Department of Medical Genetics of State University
of Campinas (Unicamp). No potencial conflict of interest rele-
vant to this article was reported.
REFERENCES
1. Luo X, Ikeda, Y, Parker, KL. A cell-specific nuclear receptor is
essential for adrenal and gonadal development and sexual di-
fferentiation. Cell. 1994;77:481-90.
2. Swain A, Zanaria E, Hacker A, Lovell-Badge R, Camerino G.
Mouse Dax1 expression is consistent with a role in sex deter-
mination as well as in adrenal and hypothalamus function.
Nature Genet. 1996;12:404-9.
3. Pritchard-Jones K, Fleming S, Davidson D, Bickmore W, Por-
teous D, Gosden C, et al. The candidate Wilms’ tumour gene is
involved in genitourinary development. Nature. 1990;346:
194-7.
4. Rose EA. Glaser T, Jones C, Smith CL, Lewis WH, Call, KM, et
al. Complete physical map of the WAGR region of 11p13 loca-
lizes a candidate Wilms’ tumour gene. Cell. 1990;60:405-508.
5. Call KM, Glaser T, Ito CY, Buckler AJ, Pelletier J, Haber DA, et
al. Isolation and characterization of a zinc finger polypeptide
gene at the human chromosome 11 Wilms’ tumour locus. Cell.
1990;60:509-20.
6. Gessler M, Konig A, Bruns GAP. Homozygous deletion in Wil-
ms tumours of a zinc-finger gene identified by chromosome
jumping. Nature. 1990;343:774-8.
7. Pritchard-Jones K, Fleming S, Davidson D, Bickmore W, Por-
teous D, Gosden C, et al. The candidate Wilms’ tumour gene is
involved in genitourinary development. Nature. 1990;346:
194-7.
8. Haber DA, Sohn RL, Buckler AJ, Pelletier J, Call KM, Housman
DE. Alternative splicing and genomic structure of the Wilms
tumour gene WT1. Proc Nat Acad Sci. 1991;88:9618-22.
9. Laity JH, Chung J, Dyson HJ, Wright PE. Alternative splicing of
Wilms’ tumour suppressor protein modulates DNA binding
activity through isoform-specific DNA-induced conformatio-
nal changes. Biochemistry. 2000;39:5341-8.
10. Hossain A, Saunders GF. The human sex-determining gene
SRY is a direct target of WT1. J Biol Chem. 2001;276:16817-23.
11. Nachtigal MW, Hirokawa Y, Enyeart-VanHouten DL, Flanagan
JN, Hammer GD, Ingraham HA. Wilms’ tumour 1 and Dax-1
modulate the orphan nuclear receptor SF-1 in sex-specific
gene expression. Cell. 1998;93:445-54.
12. Moffett P, Bruening W, Nakagama H, Bardeesy N, Housman D,
Housman DE, Pelletier J. Antagonism of WT1 activity by protein
self-association. Proc Natl Acad Sci USA. 1995;92:11105-9.
13. Pelletier J, Bruening W, Kashtan CE, Mauer SM, Manivel JC,
Striegel JE, et al. Germline mutations in the Wilms’ tumor su-
ppressor gene are associated with abnormal urogenital deve-
lopment in Denys-Drash syndrome. Cell. 1991;67(2):437-47.
14. Patek CE, Little MH, Fleming S, Miles C, Charlieu JP, Clarke AR,
et al. A zinc finger truncation of murine WT1 results in the
characteristic urogenital abnormalities of Denys-Drash syn-
drome. Proc Natl Acad Sci USA. 1999;96(6):2931-6.
15. Barbaux S, Niaudet P, Gubler M-C, Grunfeld J-P, Jaubert F, Kut-
tenn F, et al. Donor splice-site mutations in WT1 are responsi-
ble for Frasier syndrome. Nature Genet. 1997;17:467-70.
16. Klamt B, Koziell A, Poulat F, Wieacker P, Scambler P, Berta P,
Gessler M. Frasier syndrome is caused by defective alternati-
ve splicing of WT1 leading to an altered ratio of WT1 +/-KTS
splice isoforms. Hum Mol Genet. 1998;7(4):709-14.
17. Miller RW, Fraumeni Jr. JF, Manning MD. Association of Wil-
ms’ tumour with aniridia, hemihypertrophy and other conge-
nital malformations. New Eng J Med. 1964;270:922-7.
18. Schmickel RD. Chromosomal deletions and enzyme deficien-
cies. J Pediat. 1986;108:244-6.
19. Gessler M, Poustka A, Cavenee W, Neve RL, Orkin SH, Bruns
GAP. Homozygous deletion in Wilms tumours of a zinc-finger
gene identified by chromosome jumping. Nature. 1990;343:
774-8.
20. Sambrook J, Fritsch EF, Maniatis TE. Molecular cloning, a la-
boratory manual. Cold Spring Harbor, New York. 1989.
21. Tagliarini EB, Assumpção JG, Scolfaro MR, Mello MP, Maciel-
Guerra AT, Guerra Júnior G, et al. Mutations in SRY and WT1
genes required for gonadal development are not responsible
for XY partial gonadal dysgenesis. Braz J Med Biol Res.
2005;38(1):17-25.
22. Verp MS, Simpson JL. Abnormal sexual differentiation and
neoplasia. Cancer Genet Cytogenet. 1987;25:191-218.
23. Hoepffner W, Horn LC, Simon E, Sauerbrei G, Schröder H,
Thamm-Mücke B, et al. Gonadoblastoma in 5 patients with
46,XY gonadal dysgenesis. Exp Clin Endocrinol Diabetes.
2005;113(4):231-5.
24. Hingorani M, Moore A. Aniridia. In: GeneReviews at Gene-
Tests: Medical Genetics Information Resource (database on
the internet). Seattle: University of Washington, 2002 [Upda-
ted 2008 July 12; cited 2008 August 19]. Available from: http://
www.genetests.org.
25. Melo KF, Martin RM, Costa EM, Carvalho FM, Jorge AA, Ar-
nhold IJ, et al. An unusual phenotype of Frasier syndrome due
to IVS9 +4C>T mutation in the WT1 gene: predominantly male
ambiguous genitalia and absence of gonadal dysgenesis. J
Clin Endocrinol Metab. 2002;87(6):2500-5.
26. Köhler B, Pienkowski C, Audran F, Delsol M, Tauber M, Paris F,
et al. An N-terminal WT1 mutation (P181S) in an XY patient
with ambiguous genitalia, normal testosterone production,
absence of kidney disease and associated heart defect: enlar-
ging the phenotypic spectrum of WT1 defects. Eur J Endocri-
nol. 2004;150(6):825-30.
27. Cho HY, Lee JH, Choi HJ, Lee BH, Ha IS, Choir Y, et al. WT1 and
NPHS2 mutations in Korean children with steroid-resistant ne-
phrotic syndrome. Pediatr Nephrol. 2008;23(1):63-70.
28. Gbadegesin R, Hinkes B, Vlangos C, Mucha B, Liu J, Hopcian
J, et al. Mutational analysis of NPHS2 and WT1 in frequently
relapsing and steroid-dependent nephrotic syndrome. Pediatr
Nephrol. 2007;22(4):509-13.
29. Little M, Wells C. A clinical overview of WT1 gene mutations.
Hum Mutat. 1997;9(3):209-25.
Correspondence to:
Andréa Trevas Maciel Guerra
Department of Medical Genetics, Faculty of Medical
Sciences, PO Box 6111, Unicamp
13083-970, Campinas, SP, Brazil
E-mail: atmg@fcm.unicamp.br
Page 7
Show more