Exendin-4 has an anti-hypertensive effect in salt-sensitive mice model

Article (PDF Available)inBiochemical and Biophysical Research Communications 380(1):44-9 · February 2009with47 Reads
DOI: 10.1016/j.bbrc.2009.01.003 · Source: PubMed
Abstract
The improvement of salt-sensitive hypertension is a therapeutic target for various vascular diseases. Glucagon-like peptide 1 (GLP-1), an incretin peptide, has been reported to have natriuretic effect as well as blood glucose lowering effect, although its exact mechanism and clinical usefulness remain unclear. Here, we examined anti-hypertensive effect of exendin-4, a GLP-1 analog, in salt-sensitive obese db/db mice and angiotensin II (angII)-infused C57BLK6/J mice. The treatment of exendin-4 for 12 weeks inhibited the development of hypertension in db/db mice. In db/db mice, the urinary sodium excretion was delayed and blood pressure was elevated in response to a high-salt load, whereas these were attenuated by exendin-4. In db/db mice, intra-renal angII concentration was increased. Furthermore, exendin-4 prevented angII-induced hypertension in non-diabetic mice and inhibited angII-induced phosphorylation of ERK1/2 in cultured renal cells. Considered together, our results indicate that exendin-4 has anti-hypertensive effects through the attenuation of angII-induced high-salt sensitivity.
Exendin-4 has an anti-hypertensive effect in salt-sensitive mice model
Kunio Hirata
a
, Shinji Kume
a
, Shin-ichi Araki
a
, Masayoshi Sakaguchi
a
, Masami Chin-Kanasaki
a
,
Keiji Isshiki
a
, Toshiro Sugimoto
a
, Akira Nishiyama
b
, Daisuke Koya
c
, Masakazu Haneda
d
,
Atsunori Kashiwagi
a
, Takashi Uzu
a,
*
a
Department of Medicine, Shiga University of Medical Science, Tsukinowa-cho, Seta, Otsu, Shiga 520-2192, Japan
b
Department of Pharmacology, Kagawa University, Kagawa, Japan
c
Division of Endocrinology and Metabolism, Kanazawa Medical University, Ishikawa, Japan
d
Department of Medicine, Asahikawa Medical College, Hokkaido, Japan
article info
Article history:
Received 24 December 2008
Available online 14 January 2009
Keywords:
Angiotensin II
db/db mice
Diabetic nephropathy
Exendin-4
GLP-1
GLP-1 receptor
Renin-angiotensin system
Salt-sensitivity
Hypertension
Type 2 diabetes
abstract
The improvement of salt-sensitive hypertension is a therapeutic target for various vascular diseases. Glu-
cagon-like peptide 1 (GLP-1), an incretin peptide, has been reported to have natriuretic effect as well as
blood glucose lowering effect, although its exact mechanism and clinical usefulness remain unclear. Here,
we examined anti-hypertensive effect of exendin-4, a GLP-1 analog, in salt-sensitive obese db/db mice
and angiotensin II (angII)-infused C57BLK6/J mice. The treatment of exendin-4 for 12 weeks inhibited
the development of hypertension in db/db mice. In db/db mice, the urinary sodium excretion was delayed
and blood pressure was elevated in response to a high-salt load, whereas these were attenuated by exen-
din-4. In db/db mice, intra-renal angII concentration was increased. Furthermore, exendin-4 prevented
angII-induced hypertension in non-diabetic mice and inhibited angII-induced phosphorylation of
ERK1/2 in cultured renal cells. Considered together, our results indicate that exendin-4 has anti-hyper-
tensive effects through the attenuation of angII-induced high-salt sensitivity.
Ó 2009 Elsevier Inc. All rights reserved.
It has been postulated that patients diagnosed as having obese
type 2 diabetes mellitus or metabolic syndrome are at great risk for
developing cardiovascular diseases [1,2]. It has been established
that the blood pressure becomes salt-sensitive in patients with
obesity, and salt-sensitivity has been reported to become greater
as renal function declines [3]. Also, cardiovascular events occurred
more frequently in patients with salt-sensitive hypertension [4,5].
Thus, salt-sensitivity seen in obese or diabetic patients is an inde-
pendent risk factor for various vascular diseases, and its improve-
ment is thought to be as a therapeutic target in these patients.
Glucagon-like peptide-1 (GLP-1) is an incretin peptide secreted
from enteroendocrine L cells in the intestine, and is known to stim-
ulate insulin secretion from pancreatic b-cells [6,7]. Thus, the stim-
ulating GLP-1 signaling is considered as new therapeutic target in
type 2 diabetes. However, GLP-1 is rapidly degraded by dipeptidyl
peptidase-IV (DPP-IV) in the bloodstream. Therefore, GLP-1 itself is
clinically difficult to apply. In contrast, exendin-4, a GLP-1 analog,
is highly resistant to degradation by DPP-IV, is recently approved
as an anti-diabetic drug in some countries. Interestingly, GLP-1
receptor (GLP-1R) is expressed not only in b-cells but also in
numerous tissues including kidney [8–10]. Also, GLP-1 has been re-
ported to have natriuretic effect in obese human subjects or animal
model [11,12]. These findings suggest that exendin-4, a GLP-1 ana-
log, has any extra-islet effects including the regulation of sodium
excretion. However, it has been not determined whether exen-
din-4, which has only 54% homology to GLP-1 [13], really has the
extra-islet effects.
We have previously reported that obese type 2 diabetic db/db
mice showed a significant increase in blood pressure [14,15],
although its mechanism has been not elucidated. Previous studies
in mice also showed that an increase in intra-renal angiotensin II
(angII) levels following an infusion of angII causes salt-sensitive
hypertension with impaired salt-handling in the kidney [16] and
that the increase of renal angII is a key mediator of hypertension
under diabetic condition [17]. Thus, to explore the possibility that
exendin-4 has the additional clinical usefulness beyond its blood
glucose lowering effect, we examined the effect of exendin-4 on
0006-291X/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved.
doi:10.1016/j.bbrc.2009.01.003
Abbreviations: AngII, angiotensin II; DPP-IV, dipeptidyl peptidase IV; GLP-1,
Glucagon-like peptide 1; GLP-1R, Glucagon-like peptide 1 receptor; MAPKinase,
mitogen-activated protein kinase; PKCb, protein kinase Cb; RAS, renin-angiotensin
system.
* Corresponding author. Fax: +81 775 43 3858.
E-mail address: takuzu@belle.shiga-med.ac.jp (T. Uzu).
Biochemical and Biophysical Research Communications 380 (2009) 44–49
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications
journal homepage: www.elsevier.com/locate/ybbrc
salt-sensitive hypertension using by type 2 diabetic db/db mice and
an angII-infusion in non-diabetic C57BLK/6J mice.
Materials and methods
Animals and experimental design. Male, 6-week-old, db/db mice
and non-diabetic db/m mice were purchased from CLEA Japan Co.
(Osaka, Japan), and maintained on a 12 h-light/dark cycle under a
standard laboratory diet and water. The mice were divided into
four groups; diabetic db/db mice and non-diabetic db/m mice were
treated intraperitoneally with 20 mg kg body weight exendin-4
(Sigma, St. Louis, MO) or vehicle twice daily for 12 weeks. During
experimental periods, blood pressure was measured by the tail cuff
method. For the measurement of blood pressure, conscious mice
were placed on a hearted pad (37 °C) in temperature-controlled
quiet room. After 5 min of rest, systolic blood pressure was mea-
sured by a programmable tail-cuff sphygmomanometer (BP98-A;
Softron, Tokyo, Japan). The average of 10 consecutive measure-
ments was analyzed in each mouse. All experimental protocols de-
scribed in this study were approved by the Animal Care
Committees of Shiga University of Medical Science.
Urine volume and urinary sodium excretion in response to salt-
loading. Evaluation of urinary sodium excretion in response to
acute sodium-loading was performed as reported previously [18].
After fasting for 12 h and collection/measurement of excreted ur-
ine, 10-week-old, db/db and db/m mice treated with exendin-4
(20 mg/kg/day) or vehicle were injected intraperitoneally with
1.5 ml of 0.9% saline. During the following 6 h, we collected urine
and determined urine volume and urinary sodium excretion.
High salt-induced hypertension. Ten-week-old, db/db and db/m
mice were used. During 2 weeks of drinking 2.0% saline, we inject
exendin-4 or vehicle, and then systolic blood pressure was mea-
sured and urine was collected intermittently under treatment with
exendin-4 or vehicle [19]. Urine samples were analyzed for 24-h
urinary sodium excretion.
Measurement of intra-renal angiotensin II (angII) concentration.
Intra-renal angII contents were measured by radioimmunoassay
as described previously [20].
AngII-induced hypertension. Male, 8-week-old, C57BLK/6J mice
(CLEA Japan, Tokyo) were individually housed in box cages. We
surgically implanted osmotic minipumps (Alzet, Cupertino, CA)
for subcutaneous delivery of angII (1
l
g/kg/min) donated by Daii-
chi Suntory Biomedical Research (Tokyo) [15]. The selected dosage
of angII was based on previous studies [16,21]. During the 2-week
experimental period, we injected exendin-4 or vehicle and mea-
sured blood pressure intermittently. After 2 weeks of angII-infu-
sion, we removed the osmotic minipumps, and finally measured
blood pressure at 5 days after removal of pumps.
RNA extraction and quantitative real-time PCR. Total RNA was iso-
lated from various tissues by TRIzol protocol (Invitrogen Life Tech-
nologies, Carlsbad, CA). Complementary DNA (cDNA) was
synthesized using reverse transcript reagents (Takara, Otsu, Japan)
after treatment with DNAase (Invitrogen Life Technologies). To
determine GLP-1R mRNA expression, these cDNA were amplified
by standard polymerase chain reaction (PCR) method [22]. The se-
quences of the primers of GLP1-R were: (GLP1-R; forward: AT
CTTTGCCTTTGTGATGGAC; reverse: CAGCATTTCCGAAACTCCATC).
Urinary cAMP excretion in response to a single injection of exendin-4.
Male, 8-week-old, C57BLK/6J mice were housed individually in box
0-2 h 0-4 h 0-6 h
Accumulated urine volume (ml)
**** *
db/m
+ vehicle
db/m
+ Exendin-4
db/db
+ vehicle
db/db
+ Exendin-4
0
0.5
1.0
1.5
(time after saline infusion)
Accumulated urinary sodium excretion (mEq)
0
40
80
120
160
200
0-2 h
0-4 h 0-6 h
**
** **
(time after saline infusion)
db/m
+ vehicle
db/m
+ Exendin-4
db/db
+ vehicle
db/db
+ Exendin-4
Systolic blood pressure
(mmHg)
(Week)
db/m
+ vehicle
db/m
+ Exendin-4
db/db
+ vehicle
db/db
+ Exendin-4
*
*
Fig. 1. Effects of exendin-4 on hypertension and salt-sensitivity in db/db mice. (A) Systolic blood pressure in each group of mice during 12 weeks of experimental periods.
Data are means ± SEM. n = 12 for each groups.
*
P < 0.05 vs. db/m + vehicle.
P < 0.05 vs. db/db + exendin-4. (B) Urine volume in each of the indicated four groups of mice over
6 h following intraperitoneal injection of 1.5 ml normal saline. Data are expressed as cumulative urine volume; n = 6 for each data point. Values are expressed as
means ± SEM.
*
P < 0.01. (C) Urinary sodium excretion in each of the four groups of mice over 6 h following intraperitoneal 1.5 ml normal saline. Data are expressed as
cumulative urinary sodium excretion; n = 6 for each data point. Data are means ± SEM.
*
P < 0.01.
K. Hirata et al. / Biochemical and Biophysical Research Communications 380 (2009) 44–49
45
cages. Each was injected with exendin-4 (20 mg/kg/day) or vehicle
and urine samples were collected for 2 h before and after the injec-
tions. These urine samples were followed by the measurement of
cAMP levels by using ELISA (R&D Systems, Minneapolis, MN).
Cell culture. Opossum kidney (OK) proximal tubular cells were
purchased (American Type Culture Collection, Manassas, VA) and
grown in Dulbecco’s modified Eagle medium culture media supple-
mented with 10% serum under constant flow of 5% carbon dioxide
at 37 °C. To examine the effect of exendin-4 in angII-induced phos-
phorylation of extracellular signal-regulated kinase (pERK1/2), OK
cells were pre-incubated with exendin4 for 4 h and followed by
stimulation with angII at the concentration of 10
9
M. After
5 min of stimulation with angII, the cells were harvested and
ERK1/2 phosphorylation was determined by immunoblot analysis
using anti-ERK2 (Santa Cruz Biotechnology, Santa Cruz, CA) and
anti-phospho-p42/p44 ERK (Cell Signaling Technology, Beverly,
MA). The results were expressed as the ratio of pERK1/2 to ERK2.
Statistical analysis. Data were expressed as means ± SEM, with n
denoting the number of animals. Differences between groups were
examined for statistical significance using analysis of variance (AN-
OVA) followed by Scheffe’s test. A P value less than 0.05 denoted
the presence of a statistically significant difference.
Results
Effects of exendin-4 on impaired salt-sensitivity in db/db mice
Firstly, we confirmed the significant increase in systolic blood
pressure in db/db mice at 6 and 12 weeks of observation periods
(Fig. 1A). This increase at 12 week was significantly attenuated
by daily injection of exendin-4 (Fig. 1A). We thus examined the ef-
fect of exendin-4 on impaired salt-sensitivity in db/db mice. In an
acute salt-loading study, the urine volume of db/db mice tended
to be smaller during the first 2-h after infusion of saline than that
of db/m mice, and it was significantly less than db/m mice during
the next 4 h (Fig. 1B). The sum of urinary sodium excretion in db/
db mice was significantly less than in the other groups throughout
a total of 6 h (Fig. 1C). The delays in urine excretion and urinary so-
dium excretion in response to acute salt-loading were significantly
attenuated in db/db mice treated with exendin-4 (Fig. 1B and C).
Effects of exendin-4 on salt-sensitive hypertension in db/db mice
We next examined the effect of exendin-4 on the development
of 2-week high salt-induced hypertension in db/db mice. In db/db
mice, systolic blood pressure gradually increased during the period
of 2% saline loading. This increase was significantly inhibited by
daily injection of exendin-4 during experimental periods
(Fig. 2A). Fig. 2B shows the pressure natriuresis curve, i.e., the rela-
tionship between blood pressure and sodium intake (sodium
excretion) in each group of mice. Exendin-4 significantly increased
the slope of pressure natriuresis curve but had no effect on the
x-intercept, indicating that exendin-4 attenuated high salt-sensi-
tivity in db/db mice (Fig. 2B and C).
Functional expression of GLP-R in the kidney
We confirmed the expression of GLP-1R in various tissues includ-
ing kidney by a series of RT-PCR assay (Fig. 3A). Exendin-4 is also re-
ported to increase intracellular cAMP levels after its binding to the
receptor, which is required for the induction of its physiological ac-
tions in several tissues [23]. A single injection of exendin-4 resulted
in a significant increase in urinary cAMP excretion (Fig. 3B), suggest-
ing that exendin-4 functionally interacts with its receptor in the kid-
ney of mice and may have any direct effects in the kidney.
5
15
25
0714
drinking 2.0% NaCl
0
10
20
30
(increase to day 0)
Systolic blood pressure (mmHg)
db/db
+ 2.0% NaCl + Vehicle
db/db
+ 2.0% NaCl + Exendin-4
*
*
(day)
B
0.5
1.5
2.5
0
1.0
2.0
3.0
3.5
0 40 80 120
Systolic blood pressure
(mmH
g
)
24-h urinary sodium excretion (mEq)
20 60 100
140
db/db
+ 2.0% NaCl + Exendin-4
y=0.087x-8.41
y=0.265x-25.8
db/db
+ 2.0% NaCl + Vehicle
slope of pressure natriuresis
Vehicle
*
Exendin-4
db/db
+ 2.0% NaCl
0.1
0.3
0
0.2
0.4
0.5
C
A
Fig. 2. Effects of exendin-4 on high salt-induced hypertension in db/db mice. (A)
Systolic blood pressure in db/db mice provided with water containing 2.0% NaCl
treated with vehicle or exendin-4 for 2 weeks. Values are expressed as means ± SEM.
*
P < 0.01 vs. db/db mice + 2.0% NaCl + vehicle. n = 6 for each data point.
*
P < 0.01. (B)
Pressure-natriuresis curves in db/db mice provided with water containing 2.0% NaCl
treated with vehicle or exendin-4 for 2 weeks. (C) Slopes of pressure-natriuresis
curves shown in (B). Data are means ± SEM. n = 6 for each data point.
*
P < 0.01 vs.
db/db mice with exendin-4.
Brain
Heart
Lung
Liver
Stomach
30 cycle
40 cycle
S.Intestine
L.Intestine
Pancreas
Skin
Muscle
Kidney
Spleen
Testis
Placenta
Ovary
Urinary cAMP excretion
(Fold increase to before injection)
0
2
6
10
14
Vehicle
Exendin-4
4
8
12
*
Fig. 3. Functional expression of GLP-1 receptor in the kidney. (A) Expression of GLP-
1 receptor in various tissues determined by RT-PCR. (B) Urinary cAMP excretion in
response to a single injection of exendin-4 or vehicle. Data were expressed as fold
increases of cAMP levels. Data are means ± SEM. n = 8 for each groups.
*
P < 0.01.
46 K. Hirata et al. / Biochemical and Biophysical Research Communications 380 (2009) 44–49
Effects of exendin-4 on angII-induced hypertension
Next, we confirmed that intra-renal angII levels in db/db mice
were significantly higher than in db/m mice (Fig. 4A). Then, we inves-
tigated the anti-hypertensive effect of exendin-4 against angII-in-
duced hypertension. Infusion of angII through implanted osmotic
mini-pump in lean and non-diabetic C57BLK6/J mice resulted in a
gradual rise in systolic blood pressure and increase in body weight,
but these two parameters returned immediately to baseline levels
after the removal of the implanted mini-pump (Fig. 4B). Treatment
with exendin-4 significantly inhibited these angII-induced increases
in systolic blood pressure and body weight (Fig. 4B). Next, we deter-
mined the possible mechanism of the above effect of exendin-4 by
investigating ang-II-induced phosphorylation of ERK1/2, which is
an important mediator of intracellular angII signaling in renal cells.
AngII significantly increased the phosphorylation of ERK1/2,
whereas exendin-4 significantly inhibited its phosphorylation in a
dose–dependent manner (Fig. 4C and D).
Discussion
In this study, we demonstrated that obese type 2 diabetic db/db
mice show high salt-sensitivity, and that exendin-4 has an anti-
hypertensive effect in db/db mice and angII-infused mice, which
is related to attenuation of high salt-sensitivity. These results indi-
cate the first finding that exendin-4, a GLP-1 analog, has extra-islet
effect including the regulation of salt-handling.
Several previous reports have shown that intravenous infusion
of GLP-1 enhanced sodium excretion in obese men [11] and inhib-
ited the development of hypertension in Dahl salt-sensitive (Dahl
S) rats [12]. However, by now, the effect of exendin-4, aGLP-1 ana-
log, on salt-sensitivity or hypertension remains unclear. Here, we
can show that exendin-4 also has anti-hypertensive effect through
the attenuation of high salt-sensitivity, although exendin-4 has
only 53% amino acid homology to GLP-1 [13]. This finding is first
evidence that new anti-diabetic agent, exendin-4, improves high
salt-sensitivity and hypertension. Recent reports suggest that high
10
30
50
037
(day)
0
20
40
60
(increase to day 0)
Systolic blood pressure (mmHg)
10 14 19
Angiotensin II infusion
Vehicle
Exendin-4
*
*
*
B
Intrarenal angiotensin II content
(fmol/g kidney weight)
0
100
200
300
db/m db/db
50
150
250
350
400
450
*
A
(Vehicle)
(Exendin-4)
23.4 ± 0.5
22.3 ± 0.4
24.6 ± 0.3
23.0 ± 1.0
26.0 ± 1.2
23.0 ± 1.3
23.0 ± 1.4
23.2 ± 1.1
(g)
(g)
Exendin-4
(µM)
p-ERK
ERK
AII (×10
-9
M)
0151001510
AII (-)
C
D
0
2
4
pERK/ERK
(Densitmetry)
1
3
AII (×10
-9
M)
Exendin-4
(µM)
01 510 01 510
AII (-)
*
*
*
*
Fig. 4. Intra-renal angiotensin II content and effects of exendin-4 on angiotensin II-induced hypertension. (A) Intra-renal angiotensin II content in the kidney of db/m and db/
db mice. Data are means ± SEM. n = 4 for each group.
*
P < 0.01. (B) Systolic blood pressure and body weight (numerical data only) in C57BLK6/J mice after angiotensin II
treatment combined with vehicle or exendin-4. Data are means ± SEM. n = 4 for each data point.
*
P < 0.01. (C) Representative blots showing exendin-4-related dose–
dependent inhibition of angII-induced phosphorylation of ERK. (D) Quantitative results of three independent experiments are shown. Data are means ± SEM;
*
P < 0.05 vs.
angII (0 M) + exendin-4 (0
l
M),
P < 0.05 vs. angII (10
9
M) + exendin-4 (0
l
M).
K. Hirata et al. / Biochemical and Biophysical Research Communications 380 (2009) 44–49
47
salt-sensitivity largely contributes to the development of hyper-
tension and subsequent micro- and macro-vascular diseases [24] .
Taken together, these findings suggest that exendin-4 has addi-
tional clinical usefulness for the prevention of cardi- or renal-vas-
cular diseases associated with salt-sensitivity beyond its blood
glucose lowering effect.
We have previously reported that db/db mice showed signifi-
cant increase in blood pressure, although its mechanism has been
not elucidated. In this study, we showed first evidence that db/db
mice has high-salt-sensitivity, suggesting that high salt-sensitivity
might partially contribute to the increase in blood pressure in db/
db mice. Several metabolic factors such as obesity, hyperglycemia
and hyperinsulinemia contribute to the impairment of salt-sensi-
tivity in obese type 2 diabetes [24]. A recent study reported that
activation of intra-renal RAS largely contributed to the develop-
ment of salt-sensitive hypertension in mice treated with angII
[16]. In our study, we showed significantly high intra-renal angII
contents in db/db mice. This finding is first evidence showing that
enhanced RAS activity exists in the kidney of db/db mice. AngII-
infusion into lean and non-diabetic C57BLK/6J mice increased sys-
tolic blood pressure and body weight gain and these increases
were immediately reversed after cessation of angII-infusion. These
results confirmed the findings of previous studies [16,25], which
also indicated that the angII-induced increase in systolic blood
pressure was caused by fluid retention via excess sodium reabsorp-
tion. Our study demonstrated that GLP-1R was expressed in the
kidney as previous report, and that exendin-4 antagonized this an-
gII-induced hypertension and fluid retention. Considered together,
these results suggest that exendin-4 can regulate renal salt-han-
dling regardless of metabolic condition and prevent salt-sensitive
hypertension. A previous report concluded that anti-hypertensive
effect of GLP-1 infusion in Dahl S rats was totally dependent on
the attenuation of salt-sensitivity but not insulin resistance. In
addition this report, our result showing that exendin-4 inhibited
the development of hypertension in angII-infused mice and that
single injection of exendin-4 increased urinary cAMP excretion
can provide the further evidence that the stimulating GLP-1 signal-
ing in the kidney directly regulates salt-handling in the kidney.
Intra-renal RAS activation is reported in various renal patholog-
ical conditions, such as inflammation, apoptosis, oxidative stress,
fibrosis and impaired salt-sensitivity [26]. There is ample evidence
that the actions of angII in the kidney are mainly mediated by the
activation of ERK and are antagonized by increased cellular cAMP
levels [27,28]. In this study, injection of exendin-4 in non-diabetic
mice increased urinary cAMP excretion and pre-incubation of cul-
tured renal cells with exendin-4 inhibited angII-induced phosphor-
ylation of ERK1/2. Therefore, it is possible that exendin-4 could
potentially result in improvement of renal pathology associated
with angII activation such as inflammation, fibrosis and
hypertension.
Based on our present results indicating the effect of exendin-4 on
hypertension in two salt-sensitive mice model, we conclude that
exendin-4, a new anti-diabetic agent, has anti-hypertensive proper-
ties, which may be associated with improvement of high salt-sensi-
tivity and angII-induced abnormalities. Collectively, our results
suggest that exendin-4 is a potentially useful and multipotent ther-
apeutic agent for vascular diseases associated with high salt-
sensitivity.
Acknowledgments
We thank Makiko Sera for the excellent technical assistance.
We also thank the Technical Supporting Center of Shiga University
of Medical Science for the technical assistance. This work was sup-
ported by the Salt Science Research Foundation Grant No. 0724 and
Takeda Science Foundation (to D.K.).
References
[1] B. Isomaa, P. Almgren, T. Tuomi, B. Forsen, K. Lahti, M. Nissen, M.R. Taskinen, L.
Groop, Cardiovascular morbidity and mortality associated with the metabolic
syndrome, Diabetes Care 24 (2001) 683–689.
[2] R. Kahn, J. Buse, E. Ferrannini, M. Stern, The metabolic syndrome: time for a
critical appraisal: joint statement from the American Diabetes Association and
the European Association for the Study of Diabetes, Diabetes Care 28 (2005)
2289–2304.
[3] H.A. Koomans, J.C. Roos, P. Boer, G.G. Geyskes, E.J. Mees, Salt sensitivity of
blood pressure in chronic renal failure. Evidence for renal control of body fluid
distribution in man, Hypertension 4 (1982) 190–197.
[4] A. Morimoto, T. Uzu, T. Fujii, M. Nishimura, S. Kuroda, S. Nakamura, T. Inenaga,
G. Kimura, Sodium sensitivity and cardiovascular events in patients with
essential hypertension, Lancet 350 (1997) 1734–1737.
[5] T. Uzu, G. Kimura, A. Yamauchi, M. Kanasaki, K. Isshiki, S. Araki, T. Sugiomoto,
Y. Nishio, H. Maegawa, D. Koya, M. Haneda, A. Kashiwagi, Enhanced sodium
sensitivity and disturbed circadian rhythm of blood pressure in essential
hypertension, J. Hypertens. 24 (2006) 1627–1632.
[6] D.J. Drucker, The biology of incretin hormones, Cell Metab. 3 (2006) 153–165.
[7] R. Perfetti, P. Merkel, Glucagon-like peptide-1: a major regulator of pancreatic
beta-cell function, Eur. J. Endocrinol. 143 (2000) 717–725.
[8] B.P. Bullock, R.S. Heller, J.F. Habener, Tissue distribution of messenger
ribonucleic acid encoding the rat glucagon-like peptide-1 receptor,
Endocrinology 137 (1996) 2968–2978.
[9] Y. Wei, S. Mojsov, Tissue-specific expression of the human receptor for
glucagon-like peptide-I: brain, heart and pancreatic forms have the same
deduced amino acid sequences, FEBS Lett. 358 (1995) 219–224.
[10] P. Schlatter, C. Beglinger, J. Drewe, H. Gutmann, Glucagon-like peptide 1
receptor expression in primary porcine proximal tubular cells, Regul. Pept. 141
(2007) 120–128.
[11] J.P. Gutzwiller, S. Tschopp, A. Bock, C.E. Zehnder, A.R. Huber, M. Kreyenbuehl,
H. Gutmann, J. Drewe, C. Henzen, B. Goeke, C. Beglinger, Glucagon-like peptide
1 induces natriuresis in healthy subjects and in insulin-resistant obese men,
J. Clin. Endocrinol. Metab. 89 (2004) 3055–3061.
[12] M. Yu, C. Moreno, K.M. Hoagland, A. Dahly, K. Ditter, M. Mistry, R.J. Roman,
Antihypertensive effect of glucagon-like peptide 1 in Dahl salt-sensitive rats,
J. Hypertens. 21 (2003) 1125–1135.
[13] R. Goke, H.C. Fehmann, T. Linn, H. Schmidt, M. Krause, J. Eng, B. Goke, Exendin-
4 is a high potency agonist and truncated exendin-(9-39)-amide an antagonist
at the glucagon-like peptide 1-(7-36)-amide receptor of insulin-secreting
beta-cells, J. Biol. Chem. 268 (1993) 19650–19655.
[14] M. Chin, M. Isono, K. Isshiki, S. Araki, T. Sugimoto, B. Guo, H. Sato, M. Haneda, A.
Kashiwagi, D. Koya, Estrogen and raloxifene, a selective estrogen receptor
modulator, ameliorate renal damage in db/db mice, Am. J. Pathol. 166 (2005)
1629–1636.
[15] K. Shibuya, K. Kanasaki, M. Isono, H. Sato, M. Omata, T. Sugimoto, S. Araki, K.
Isshiki, A. Kashiwagi, M. Haneda, D. Koya, N-acetyl-seryl-aspartyl-lysyl-proline
prevents renal insufficiency and mesangial matrix expansion in diabetic db/db
mice, Diabetes 54 (2005) 838–845.
[16] S.D. Crowley, S.B. Gurley, M.I. Oliverio, A.K. Pazmino, R. Griffiths, P.J. Flannery,
R.F. Spurney, H.S. Kim, O. Smithies, T.H. Le, T.M. Coffman, Distinct roles for the
kidney and systemic tissues in blood pressure regulation by the renin-
angiotensin system, J. Clin. Invest. 115 (2005) 1092–1099.
[17] G.F. Strippoli, M. Craig, F.P. Schena, J.C. Craig, Antihypertensive agents for
primary prevention of diabetic nephropathy, J. Am. Soc. Nephrol. 16 (2005)
3081–3091.
[18] Y. Ge, A. Bagnall, P.K. Stricklett, K. Strait, D.J. Webb, Y. Kotelevtsev, D.E. Kohan,
Collecting duct-specific knockout of the endothelin B receptor causes
hypertension and sodium retention, Am. J. Physiol. Renal Physiol. 291 (2006)
F1274–F1280.
[19] D.Y. Huang, K.M. Boini, H. Osswald, B. Friedrich, F. Artunc, S. Ullrich, J.
Rajamanickam, M. Palmada, P. Wulff, D. Kuhl, V. Vallon, F. Lang, Resistance of
mice lacking the serum- and glucocorticoid-inducible kinase SGK1 against
salt-sensitive hypertension induced by a high-fat diet, Am. J. Physiol. Renal
Physiol. 291 (2006) F1264–F1273.
[20] A. Nishiyama, D.M. Seth, L.G. Navar, Renal interstitial fluid concentrations of
angiotensins I and II in anesthetized rats, Hypertension 39 (2002) 129–134.
[21] N. Kawada, E. Imai, A. Karber, W.J. Welch, C.S. Wilcox, A mouse model of
angiotensin II slow pressor response: role of oxidative stress, J. Am. Soc.
Nephrol. 13 (2002) 2860–2868.
[22] S. Kume, T. Uzu, S. Araki, T. Sugimoto, K. Isshiki, M. Chin-Kanasaki, M.
Sakaguchi, N. Kubota, Y. Terauchi, T. Kadowaki, M. Haneda, A. Kashiwagi,
D. Koya, Role of altered renal lipid metabolism in the development of
renal injury induced by a high-fat diet, J. Am. Soc. Nephrol. 18 (2007)
2715–2723.
[23] S. Park, X. Dong, T.L. Fisher, S. Dunn, A.K. Omer, G. Weir, M.F. White, Exendin-4
uses Irs2 signaling to mediate pancreatic beta cell growth and function, J. Biol.
Chem. 281 (2006) 1159–1168.
[24] T. Uzu, M. Nishimura, T. Fujii, M. Sakaguchi, M. Kanasaki, K. Isshiki, S. Araki, T.
Sugiomoto, A. Kashiwagi, G. Kimura, Benidipine attenuates glomerular
hypertension and reduces albuminuria in patients with metabolic syndrome,
Hypertens. Res. 30 (2007) 161–165.
[25] S.D. Crowley, S.B. Gurley, M.J. Herrera, P. Ruiz, R. Griffiths, A.P. Kumar, H.S. Kim,
O. Smithies, T.H. Le, T.M. Coffman, Angiotensin II causes hypertension and
48 K. Hirata et al. / Biochemical and Biophysical Research Communications 380 (2009) 44–49
cardiac hypertrophy through its receptors in the kidney, Proc. Natl. Acad. Sci.
USA 103 (2006) 17985–17990.
[26] Y. Huang, N.A. Noble, J. Zhang, C. Xu, W.A. Border, Renin-stimulated TGF-beta1
expression is regulated by a mitogen-activated protein kinase in mesangial
cells, Kidney Int. 72 (2007) 45–52.
[27] E. Giasson, M.J. Servant, S. Meloche, Cyclic AMP-mediated inhibition of
angiotensin II-induced protein synthesis is associated with suppression of
tyrosine phosphorylation signaling in vascular smooth muscle cells, J. Biol.
Chem. 272 (1997) 26879–26886.
[28] X.C. Li, O.A. Carretero, J.L. Zhuo, Cross-talk between angiotensin II and
glucagon receptor signaling mediates phosphorylation of mitogen-activated
protein kinases ERK 1/2 in rat glomerular mesangial cells, Biochem.
Pharmacol. 71 (2006) 1711–1719.
K. Hirata et al. / Biochemical and Biophysical Research Communications 380 (2009) 44–49
49
    • "Since the increase in eGFR levels in patients with reduced renal function is independent of the changes in other variables considered, this could address a direct effect of liraglutide on the kidney. As discussed above, this hypothesis is supported by a few studies in animals, which showed that GLP-1 is responsible for a natriuretic effect, by reducing sodium reuptake in proximal tube and aldosterone levels in mice [23] . Moreover, the infusion of native GLP-1 activates an intracellular pathway mediated by cAMP/PKA which also causes an increase in eGFR, renal plasma flow, and bicarbonate and fractional potassium excretion [7], suggesting a direct effect on renal vasculature, most likely by decreasing the resistance of the pre-glomerular capil- laries [8, 9]. "
    [Show abstract] [Hide abstract] ABSTRACT: Unlike GLP-1, liraglutide is not cleared by the glomerulus and its pharmacokinetic is not altered in patients with mild renal impairment. The aim of our study was to analyze the effects of liraglutide on renal function in patients with type 2 diabetes. A twelve-month longitudinal prospective post-marketing study was performed. According to eGFR (estimated glomerular filtration rate) calculated with CKD-EPI equation, 84 consecutive patients were divided in Group A (eGFR > 90 ml/min) and Group B (eGFR < 90 ml/min). BMI, glucose, HbA1c, serum creatinine, microalbuminuria, and eGFR were evaluated at baseline and after 12 months of treatment. A reduction in fasting plasma glucose (p < 0.01), HbA1c (p < 0.003), BMI (p < 0.01), and systolic (p < 0.01) and diastolic blood pressure (p < 0.006) was recorded irrespective of eGFR category. Concerning renal function, creatinine levels had a trend to decrease in both groups. eGFR did not change in Group A, while it increased in Group B (p < 0.05) independently from the concomitant changes of other parameters. Moreover, seven out of 41 patients of Group B had increased eGFR levels which reached the normal values (>90 ml/min). At baseline, five patients had pathological microalbuminuria, but at 12 months three of them returned to normal albuminuria (p < 0.006). Total microalbuminuria levels improved in both groups (p < 0.02). According to preliminary data in animals, our study shows that liraglutide is effective in preserving eGFR in diabetic patients, increasing it in those with reduced renal function. This was associated with a decrease of frequency of patients positive to microalbuminuria. Further studies are needed to confirm these data.
    Full-text · Article · Jan 2015
    • "Consistent with an indirect BP-lowering effect, it was recently reported that liraglutide-stimulated reduction of angiotensin IIinduced hypertension in mice was blocked by the natriuretic peptide receptor antagonist, anantin, in a GLP-1 receptordependent manner, but unaltered by the NOS inhibitor, N G monomethyl-L-arginine , and that liraglutide induced rapid increases in atrial natriuretic peptide (ANP) secretion both in vivo and in isolated perfused hearts, suggesting that observed BP reduction occurred at least partly via direct activation of cardiac ANP (Kim et al., 2013). Importantly, in the context of diabetes, the GLP-1 mimetic, exendin-4, inhibited development of both spontaneous and high salt-induced hypertension in obese db/db mice via beneficial actions on renal sodium handling (Hirata et al., 2009). Furthermore, it was recently reported that treatment of insulin-resistant Zucker rats with the DPP-4 inhibitor, linagliptin, for 8 weeks reduced BP and improved diastolic function (Aroor et al., 2013). "
    [Show abstract] [Hide abstract] ABSTRACT: Glucagon-like peptide-1 (GLP-1) is an incretin hormone whose glucose-dependent insulinotropic actions have been harnessed as a novel therapy for glycaemic control in type 2 diabetes. Although it has been known for some time that the GLP-1 receptor is expressed in the cardiovascular system where it mediates important physiological actions, it is only recently that specific cardiovascular effects of GLP-1 in the setting of diabetes have been described. GLP-1 confers indirect benefits in cardiovascular disease (CVD) under both normal and hyperglycaemic conditions via reducing established risk factors, such as hypertension, dyslipidaemia and obesity, which are markedly increased in diabetes. Emerging evidence indicates that GLP-1 also exerts direct effects on specific aspects of diabetic CVD, such as endothelial dysfunction, inflammation, angiogenesis and adverse cardiac remodelling. However, the majority of studies have employed experimental models of diabetic CVD and information on the effects of GLP-1 in the clinical setting are limited although several large-scale trials are ongoing. It is clearly important to gain a detailed knowledge of the cardiovascular actions of GLP-1 in diabetes given the large number of patients currently receiving GLP-1 based therapies. This review will therefore discuss current understanding of the effects of GLP-1 on both cardiovascular risk factors in diabetes and direct actions on the heart and vasculature in this setting, and the evidence implicating specific targeting of GLP-1 as a novel therapy for CVD in diabetes.
    Article · Sep 2014
    • "Moreover, recent studies have revealed that markedly reducing the expression of GLP-1 receptors in the glomeruli and activating the GLP-1R pathway with a GLP-1R agonist confers protection against oxidative stress, glomerular endothelial dysfunction, apoptotic and profibrotic actions in both type 1 and type 2 diabetic rodents [42][43][44]. Alternate GLP-1 mechanisms may also be involved, including the inhibition of angiotensin II signalling [45,46]. Mima et al. [42] demonstrated how hyperglycemia can activate PKCb isoforms, which enhance the toxic actions of angiotensin II and inhibit GLP-1's protective effects by reducing the expression of GLP-1 receptors in the glomerular endothelial cells. "
    [Show abstract] [Hide abstract] ABSTRACT: Background: Despite the beneficial effects of type 4 dipeptidyl peptidase (DPP-4) inhibitors on glucose levels, its effects on diabetic nephropathy remain unclear. Method: This study examined the long-term renoprotective effects of DPP-4 inhibitor linagliptin in db/db mice, a model of type 2 diabetes. Results were compared with the known beneficial effects of renin-angiotensin system blockade by enalapril. Ten-week-old male diabetic db/db mice were treated for 3 months with either vehicle (n = 10), 3 mg linagliptin/kg per day (n = 8), or 20 mg enalapril/kg per day (n = 10). Heterozygous db/m mice treated with vehicle served as healthy controls (n = 8). Results: Neither linagliptin nor enalapril had significant effects on the parameters of glucose metabolism or blood pressure in diabetic db/db mice. However, linagliptin treatment reduced albuminuria and attenuated kidney injury. In addition, expression of podocyte marker podocalyxin was normalized. We also analysed DPP-4 expression by immunofluorescence in human kidney biopsies and detected upregulation of DPP-4 in the glomeruli of patients with diabetic nephropathy, suggesting that our findings might be of relevance for human kidney disease as well. Conclusion: Treatment with DPP-4 inhibitor linagliptin delays the progression of diabetic nephropathy damage in a glucose-independent and blood-pressure-independent manner. The observed effects may be because of the attenuation of podocyte injury and inhibition of myofibroblast transformation.
    Full-text · Article · Sep 2014
Show more

    Recommended publications

    Discover more