Content uploaded by Paula L Hartzell
Author content
All content in this area was uploaded by Paula L Hartzell on Apr 06, 2015
Content may be subject to copyright.
Distribution and phylogeny of glacier ice worms
(Mesenchytraeus solifugus and Mesenchytraeus
solifugus rainierensis)
Paula L. Hartzell, Jefferson V. Nghiem, Kristina J. Richio, and Daniel H. Shain
Abstract: Glacier ice worms, Mesenchytraeus solifugus (Emery, 1898) and Mesenchytraeus solifugus rainierensis
Welch, 1916 (Enchytraeidae), are the only known oligochaetes adapted to life in ice. We have collected ice worm spec-
imens from over 100 populations throughout the Pacific northwestern region of North America. Their current range ex-
tends ~2500 km along the Pacific coastline between south-central Alaska and central Oregon, with most populations
occurring on relatively low-elevation, temperate glaciers. Phylogenetic analyses utilizing partial nuclear 28S rDNA and
mitochondrial cytochrome coxidase subunit I (COI) loci revealed the presence of two geographically distinct clades
(northern and southern). The northern clade comprises all Alaskan populations, while the southern clade contains Brit-
ish Columbia, Washington State, and Oregon State populations. No evidence of gene flow was detected between these
two lineages or between noncontiguous glaciers throughout their geographic range. Our results suggest that the mecha-
nism of ice worm dispersal is primarily active, though at least one episode of passive dispersal is noted at the southern
extent of their range.
Résumé : Les vers de glaciers, Mesenchytraeus solifugus (Emery, 1898) et Mesenchytraeus solifugus rainierensis
Welch, 1916 (Enchytraeidae), sont les seuls oligochètes connus adaptés à la vie dans la glace. Nous avons récolté des
spécimens de vers de glaciers dans plus de 100 populations dans toute la région pacifique du nord-ouest de l’Amérique
du Nord. Leur répartition actuelle couvre ~2500 km le long de la côte du Pacifique, du centre-sud de l’Alaska au
centre de l’Oregon, la plupart des populations se retrouvant sur des glaciers tempérés d’altitude relativement basse. Des
analyses phylogénétiques basées sur le séquençage partiel des locus de l’ADNr 28S nucléaire et de la sous-unité I de
la cytochrome coxydase (COI) mitochondriale révèlent l’existence de deux clades distincts (boréal et austral). Le clade
boréal regroupe toutes les populations de l’Alaska, alors que le clade austral contient les populations de Colombie-
Britannique et des états de Washington et d’Oregon. Nous ne décelons aucune indication de flux génétique entre ces
deux lignées, ni entre les populations de glaciers non contigus dans l’ensemble de l’aire de répartition. Nos résultats
laissent croire que les mécanismes de dispersion des vers de glaciers sont surtout de type actif; il a cependant un cas
de dispersion passive à signaler à l’extrême sud de leur aire de répartition.
[Traduit par la Rédaction] Hartzell et al. 1213
Introduction
Glaciers are among the least explored ecosystems, yet
they hold about 75% of the world’s freshwater supply and
cover approximately 10% of the Earth’s land surface. Gla-
cier ice worms, Mesenchytraeus solifugus (Emery, 1898) and
Mesenchytraeus solifugus rainierensis Welch, 1916, are the
only known oligochaetes adapted to life in glacier ice. Their
unusual habitat makes them a species of evolutionary inter-
est, yet they have not been included in prior phylogenetic
studies of Enchytraeidae, and are poorly represented in pub-
lished studies on Clitellata.
The species was first described by Emery (1898a, 1898b,
1898c, 1900) based on specimens collected from Malaspina
Glacier, Mount St. Elias, Alaska. Moore (1899) corrected
Emery’s designation from Melanenchytraeus to the pre-
existing Mesenchytraeus genus. Welch (1916a, 1916b,
1917a), Goodman and Parrish (1971), and Shain et al.
(2000) further described their morphology, and to a lesser
extent, their ecology. Glacier ice worms have been docu-
mented from some glaciers in Alaska (Emery 1898a, 1898b;
Moore 1899; Eisen 1905; Odell 1949; Tynen 1970; Russell
1892; Shain et al. 2001), British Columbia (Welch 1917a;
Tynen 1970), and Washington State (Welch 1916a, 1916b;
Gudger 1923; Tynen 1970). Welch (1916a, 1916b) proposed
the subspecies Mesenchytraeus solifugus rainierensis based
on morphological differences between Mt. Rainier, Wash-
ington, ice worms and Alaskan glacier ice worms (e.g.,
smaller number of setae per bundle, only two instead of
three diverticula on the spermathecae, straighter speriducal
Can. J. Zool. 83: 1206–1213 (2005) doi: 10.1139/Z05-116 © 2005 NRC Canada
1206
Received 29 December 2004. Accepted 15 August 2005. Published on the NRC Research Press Web site at http://cjz.nrc.ca on
22 September 2005.
P. Hartzell1and K.J. Richio. Clark University, Department of Biology, 950 Main Street, Worcester, MA 01610, USA.
J.V. Nghiem1and D.H. Shain.2Rutgers The State University of New Jersey, Department of Biology, 315 Penn Street, Camden,
NJ 08102, USA.
1Equally contributing authors.
2Corresponding author (e-mail: dshain@camden.rutgers.edu).
funnel, complete enclosure of the sperm sacs and ducts by
the ovisac). Hartzell (2005) noted significant differences in
the mean sizes of Washington State (~1.5 cm long, ~300 µm
wide) versus Alaskan (~1 cm long, ~250 µm wide) ice worms.
Dietary information is limited to cursory examinations of
gut contents, and suggests that ice worms ingest glacial al-
gae and other organic debris found in ice and snow (Emery
1900; Goodman 1971). Ice worms are highly pigmented
compared with other enchytraeids, presumably an adaptation
related to elevated levels of radiation in a glacial environ-
ment (Emery 1898a, 1898b, 1898c, 1900; Moore 1899;
Welch 1916a, 1916b, 1917a; Goodman and Parrish 1971).
Ice worms otherwise display no apparent morphological
adaptations to their extreme environment (Goodman and
Parrish 1971; Shain et al. 2000). While other enchytraeids
endure Arctic permafrost by dehydration (Holmstrup and
Westh 1994; Sømme and Birkemoe 1997; Pedersen and
Holmstrup 2003) or by accumulating sugars (Holmstrup and
Sjursen 2001; Holmstrup et al. 2002), these mechanisms do
not appear useful to ice worms that survive in a hydrologic
environment which vacillates only a few degrees from 0 °C.
Recent biochemical analyses indicate that ice worm
adenylate levels (e.g., ATP) are unexpectedly high and con-
tinue to rise as temperatures fall, suggesting a compensatory
adaptation in ice worm energy metabolism (Napolitano and
Shain 2004; Napolitano et al. 2004).
The purposes of this study were to establish the current
geographic range of glacier ice worms and to identify any
large-scale evolutionary relationships between populations
based on molecular data. Our analyses indicate that ice
worms form distinct northern and southern clades, and that
most populations appear to be genetically isolated.
Materials and methods
Field methods
In total, 145 glaciers were included in this study. Of these,
49 glaciers were subject to systematic survey along one or
more longitudinal transects, beginning as close to the glacier
terminus as possible and continuing up-glacier as high as
possible given safety considerations. Data and sample col-
lection stations were placed every 50- to 100-m intervals
along a transect, depending on the size of the glacier (e.g.,
on glaciers <300 m in length, sampling intervals were short-
ened to 50 m to have multiple samples on a transect, but
transects were typically >500 m in length). Collections were
made between May and August during the 2000–2004 field
seasons. Ice worms were collected after sundown and before
sunrise, when they appear on the glacial surface (Goodman
1971; Tynen 1970; Shain et al. 2001). Population densities
were estimated as described (Shain et al. 2001); briefly, ice
worms were counted in square-metre plots at collection sta-
tions and averaged along each transect. Field sites were in
Alaska, California, Montana, Oregon, and Washington in the
United States, and Alberta and British Columbia in Canada.
A complete list of survey sites is available (Table S1)3.
Additional ice worm specimens were provided by Begich
Boggs Visitor’s Center, Chugach National Forest, Alaska;
Roberta Holden and Sheila Byers (Vancouver Natural
History Society, British Columbia); and Heidi Weigner
(University of Alaska, Anchorage). Specimens of
Mesenchytraeus pedatus Eisen, 1905 were provided by
Steve Fend (USGS Water Resources); Mesenchytraeus
gelidus Welch, 1916 (Yosemite snow worms) by Kathryn
Coates (Bermuda Biological Research Station); and
Mesenchytraeus flavus and Mesenchytraeus armatus
Levinson, 1883 by Tarmo Timm (Estonian Agricultural Uni-
versity, Tartu).
Molecular methods
Live ice worms were either placed in 95% ethanol in the
field or packed in snow and expressed-mailed to one of our
home institutions. Ethanol-preserved specimens were selected
randomly from each population (usually from multiple col-
lection stations along a transect to represent different
microhabitats; e.g., snow, firn, crevasse pools, ice) and
rehydrated before DNA extraction. Genomic DNA from
individual worms was extracted by standard phenol–
chloroform methods (Lee and Taylor 1990), or by an Omega
E.Z.N.A. forensic DNA kit. A 731 base pair (bp) fragment
from the 5′end of nuclear 28S rDNA was amplified by the
polymerase chain reaction (PCR) with primers LROR (ACC-
CGCTGAACTTAAGC) and LR5 (TCCTGAGGGAAACTT-
CG). PCR conditions were as follows: 94 °C for 30 s, 50 °C
for 30 s, 72 °C for 1 min (40 cycles), and 72 °C for 10 min.
A 493-bp fragment from the 5′end of mitochondrial cyto-
chrome coxidase subunit I (COI) was amplified with prim-
ers COI5′1 (GATTCTTTGGACATCCAGAAG) and COI3′2
(CTACGTTGGGCTGCGAATC). PCR conditions were as
follows: 94 °C for 15 s, 51 °C for 1 min, 72 °C for 1 min
(35 cycles), and 72 °C for 10 min. The 28S rDNA and COI
analyses were conducted independently in different laborato-
ries, and therefore these loci were generally not sequenced
in the same individual.
PCR products were purified using a Q-Biogene BIO 101
GeneClean kit. Sequencing reactions for 28S rDNA were
performed using the following primers: LROR, LR5, LR3
(CCGTGTTTCAAGACGGG), LR3R (GTCTTGAAACAC-
GGACC), and LR22 (CCTCACGGTACTTGTTCGCT) on
an ABI 377-XL automated sequencer. COI primers (above)
were used for sequencing as above or by Northwoods DNA
(Becida, Minnesota).
Other 28S rDNA and COI sequences were obtained from
NCBI GenBank. Lists of sequences included in this study
are listed in Table 1 (28S) and Table 2 (COI). Nucleotide se-
quences were aligned in Clustal X (Thompson et al. 1997),
with manual adjustments made in McClade version 4.06
(Maddison and Maddison 2004) or BioEdit (Hall 1999).
Phylogenetic analysis
Optimal model parameters were chosen by model testing
on the ice worm data set with ModelTest version 3.06
(Posada and Crandall 1998) using 10 rate classes and α=
0.01. For the 28S sequences, optimal parameters based on
Akaike’s Information Criterion (AIC) model testing were
general time reversible plus gamma nucleotide substitution
© 2005 NRC Canada
Hartzell et al. 1207
3Table S1 containing supplementary data for this article is available on the Web site or may be purchased from the Depository of Unpub-
lished Data, Document Delivery, CISTI, National Research Council Canada, Building M-55, 1200 Montreal Road, Ottawa, ON K1A 0R6,
Canada. DUD 4022. For more information on obtaining material refer to http://cisti-icist.nrc-cnrc.gc.ca/irm/unpub_e.shtml.
(GTR + Γ), with a log likelihood of –6809. Optimal parame-
ters based on hierarchical model testing were Tamura–Nei
two parameter plus gamma (TrN + Γ), with a log likelihood
of –6821. (For a discussion of the advantages and disadvan-
tages of different model testing see Posada and Buckley
2004). Trees based on GTR + Γand TrN +Γwere not nota-
bly different; the final analyses were based on GTR + Γpa-
rameters. For COI sequences, both hierarchical and AIC
model testing identified general time reversible plus gamma
plus codon (GTR + Γ+ I) as most optimal, with log-
likelihood scores of –12 292.
Each locus was analyzed separately, as there were insuffi-
cient numbers of sequences from the same specimen at both
loci to allow the two data sets to be joined. A freshwater
leech, (Haemadipsidae; AY101558) was used to root the fi-
nal 731-bp 28S alignment. The 493-bp alignment of COI se-
quences was rooted using a Lumbriculus variegatus Mueller,
1774 sequence (AY519464) as the outgroup. Bayesian anal-
ysis (BA) was performed for 10 million replicates, with a
burn-in of 10 000 trees and tree sampling every 1000 gener-
ations, using MrBayes version 3.0B4 (Huelsenbeck and
Ronquist 2003). Phylogenetic trees were generated under
maximum likelihood (ML) criterion using TreeFinder (Jobb
et al. 2004). ML analysis used general time reversible plus
gamma plus codon (GTR + Γ+ I) as most optimal, 4 rate
categories, 50% consensus, and a population size of 4, for
10 000 replicates for each locus. Branch support was as-
sessed through posterior probabilities for BA, and with boot-
strapping for ML.
Type specimens
The location of the holotypes for M. solifugus and M. s.
rainierensis is unknown to the best of our knowledge. Origi-
nal paratypes are stored at the United States Natural History
Museum. Paratypes from our work are stored with Mount
Rainier National Park, Ashford, Washington, and the Royal
British Columbia Museum, Vancouver.
Results
Glacier ice worm distribution
To date, ice worm populations have been confirmed on
106 different glaciers in the Pacific northwest of North
America (Fig. 1; a full list is also available from Table S13).
It is noteworthy that ice worms were not found on all gla-
ciers within this range nor as far inland as the Rocky Moun-
tains.
Ice worm densities within populations (i.e., in square-
metre plots) were generally lower in the northern half of
their geographic range. For example, mean densities on
Alaskan glaciers seldom exceeded 100/m2, but were
>400/m2in the Pacific, North Cascades, and Olympic
ranges. Ice worms were found on some glaciers in the Kenai
Peninsula of south-central Alaska (e.g., Alice, Exit, Por-
tage), but they were not found on the Matanuska Glacier just
to the east in the Chugach Mountains (which lies ~50-km in-
land), nor were they found on glaciers in the Valdez, Alaska,
area. In southeastern Alaska, ice worms were not found in
the Juneau Icefield (northern Coastal Range); however, they
are present farther north, in the Glacier Bay region (Tynen
1970; Goodman 1971), and on coastal glaciers of the Alsek
Range (e.g., Grand Pacific, Grand Plateau, and Ferris gla-
ciers). Ice worms have not been observed above an elevation
of ~1400 m in this area (R. Holden, personal communica-
tion) and were generally below 1000 m on Alaskan glaciers.
© 2005 NRC Canada
1208 Can. J. Zool. Vol. 83, 2005
Family and species Location GenBank accession No. Source
Enchytraeidae
Mesenchytraeus pedatus California DQ164256, DQ164257 S. Fend, personal
communication
Mesenchytraeus solifugus Alaska, British Columbia,
Oregon, Washington AY613868, AY577788–AY577802,
DQ164258–DQ164305
Lumbriculidae
Lumbriculus variegatus AY519464 D.A. Price and M.E.
Saunders
Table 2. Cytochrome coxidase subunit I (COI) sequences.
Family and species Location GenBank accession No. Source
Enchytraeidae
Achaeta bohemica AF406595 Jamieson et al. 2002
Enchytraeus albidus AF406597 Jamieson et al. 2002
Fredericia bisetosa AF406596 Jamieson et al. 2002
Mesenchytraeus armatus Estonia DQ164254 T. Timm, personal communication
Mesenchytraeus flavus Estonia DQ164255 T. Timm, personal communication
Mesenchytraeus gelidus California DQ164250–DQ164253 K. Coates, personal communication
Mesenchytraeus solifugus Alaska, British Columbia,
Oregon, Washington AY227193, AY303941–AY303947,
DQ164235–DQ164249
Haemadipsidae
Freshwater leech AY101558 Jamieson et al. 2002
Table 1. Large subunit ribosomal RNA (28S) sequences.
By comparison, in the southern part of their distribution
(i.e., southern British Columbia, Washington, and central
Oregon), ice worms were present on nearly all glaciers that
were explored (generally an elevation <2500 m). Indeed, in
the Pacific, North Cascades, and Olympic ranges, only ice
remnants were recorded as having no or low densities of ice
worms. All 51 active glaciers surveyed in this subregion had
moderate to high densities (400–1000/km2) of ice worms
across their surfaces during late-evening hours in summer
(i.e., after sundown and before sunrise). The absence or low-
density counts exhibited on nonactive ice remnants (n=3)
in this subregion suggests some role in glacial activity for
supporting ice worm populations.
One notable gap in ice worm distribution in the southern
part of their range is on Mt. Hood, Oregon, where no ice
worms were found, even though this mountain lies between
areas that support large ice worm populations (e.g., Mt.
Rainier, Mt. St. Helens before eruption, Mt. Jefferson, the
Sisters). The apparent absence of ice worms on Mt. Hood
was confirmed by local climbers and forest managers. Ice
worms were not found on glaciers in the Rocky Mountain
regions of Canada or the United States, or south of the Sis-
ters Range in Oregon.
Phylogeny
The 80% majority rule tree from BA of 28S rRNA and
COI sequences are presented in Figs. 2 and 3, respectively;
the single most likely trees from the ML analysis of each
loci were nearly identical (data not shown). As expected, the
Yosemite snow worm (M. gelidus) branched off most
closely to the ice worm clades, preceded by an earlier split
of M. armatus and M. flavus. Thus, the genus Mesenchy-
traeus appears to be phylogenetically supported within the
limits presented in this analysis.
Two distinct clades (i.e., northern and southern) were
formed by ice worm sequences on the COI tree (Fig. 3)
where greater variation in sequences allowed better resolu-
tion at shallower nodes. The level of sequence divergence
between the two clades was ~2% for 28S rRNA and ~10%
for COI. The node representing the bifurcation of the north-
ern and southern regions had strong support in the BA and
ML analyses. The northern clade includes all the Alaskan
ice worm sequences from this study. Sequences obtained
from the St. Elias area appear the most basal and variable
than those from any other northern subregion. Those from
the Kenai area in Alaska (e.g., Exit, Marathon) appear more
derived, suggesting ice worm expansion to this area through
a founding population (Ibrahim et al. 1996).
The southern clade comprises all British Columbia, Wash-
ington, and Oregon ice worm sequences. Those from the
southern-most part of this clade’s range, namely those from
Oregon, Mount Rainier, and the Glacier Peak/Daniels area,
formed distinct subclades within the larger clade, respec-
tively. Those from the Pacific Range/North Cascades of Brit-
ish Columbia and northern Washington State were much
more variable, suggesting that the greatest genetic diversity
is centered in the northern part of this clade’s range. Surpris-
ingly, gene flow was not apparent between ice worm popula-
© 2005 NRC Canada
Hartzell et al. 1209
Fig. 1. Distribution of glacier ice worms (Mesenchytraeus solifugus and Mesenchytraeus solifugus rainierensis). Representation of loca-
tions is approximate. Open circles indicate sites where ice worms have been confirmed; solid squares indicate sites visited, but where
no ice worms were found. Shaded areas indicate regions with current glaciation. Ice worms were found on an ~2500-km strip along
the Pacific coastline between south-central Alaska and central Oregon, predominantly on low-elevation, temperate glaciers.
tions on noncontiguous ice throughout their geographic
range (as evidenced by the absence of shared 28S rRNA or
COI genotypes).
Discussion
Tynen (1970) reported that ice worms occur in coastal
glaciers from Bagley Icefield in Alaska to Mt. Rainier in
Washington State, and hypothesized that extant ice worm
populations were likely remnants of a pan-Cordilleran popu-
lation. During the course of this study, however, we have
recorded ice worms in central Oregon, well outside the max-
imum extent of the Cordilleran ice sheet (e.g., Porter and
Denton 1967; Waitt and Thorson 1983). The Oregon ice
worm populations may have originated from an earlier, pre-
Cordilleran ice age, or perhaps a founding population dis-
persed passively via aviary transport (e.g., Edwards and
Bohlen 1996; Milbrink 20034). The very limited variability
of Oregon sequences seems to support the latter hypothesis.
The clear discontinuity of the northern versus southern
clades, and the lack of ice worms on many glaciers in the
northern half of their geographic range, however, suggests
that ice worms lack a robust dispersal mechanism. The ap-
parent lack of ice worms on Mt. Hood, with substantial ice
© 2005 NRC Canada
1210 Can. J. Zool. Vol. 83, 2005
0.1
Hirudinida: freshwater leech (outgroup)
Enchytraeidae: Achaeta bohemica
Enchytraeidae: Fredericia bisetosa
Enchytraeidae: Enchytraeus albidus
Enchytraeidae: Mesenchytraeus armatus
Enchytraeidae: Mesenchytraeus flavus
Enchytraeidae: Mesenchytraeus gelidus
Enchytraeidae: Mesenchytraeus gelidus
Enchytraeidae: Mesenchytraeus gelidus
Enchytraeidae: Mesenchytraeus gelidus
Alaska: Grand Pacific
Alaska: Grand Pacific/Junction
Alaska: Grand Pacific/Junction
Alaska: Grand Pacific/Junction
Alaska: Byron
Alaska: Portage
Washington: Williwakas
Washington: Williwakas
Washington: Rainbow
Washington: Easton
Washington: Easton
Washington: Baker
Washington: Daniels
Washington: Ice Worm
Washington: Whiteriver
Washington: Whitechuck
Washington: Honeycomb
St. Elias
Area
Kenai
Peninsula
Mount
Ranier
Mount
Baker
Glacier Peak/
Daniels Area
Glacier
Ice Worms
93
50
100
100
100
52
71
63
100
87
93
70
87
60
62
Fig. 2. Majority rule consensus tree of glacier ice worms based on Bayesian analysis of nuclear 28S ribosomal RNA (731 base pair
partial fragment). Numerical values >50 are indicated and represent posterior probabilities. Scale indicates number of substitutions per site.
4G. Milbrink. 2003. Distributional patterns of freshwater tubificid oligochaetes and the capacities for long-way dispersal of tubificids and
other freshwater invertebrates with particular reference to “alien” species and birds as vectors of dispersal. In Proceedings of the 9th Interna-
tional Symposium on Aquatic Oligochaeta, Wageningen, the Netherlands, 6–10 October 2003. Edited by P.F.M. Verdonschot. Submitted for
publication.
worm populations 125 km to the north and 80 km to the
south, highlights this isolation. This gap in ice worm distri-
bution in the southern region is perhaps due to a stochastic
event (i.e., local extinction); their absence on all four of the
Mt. Hood glaciers surveyed suggests that such an event
probably preceded the separation of these glaciers. Mt. Hood
erupted in the 1790s, and again in the mid-1800s (Gardner et
al. 2000), raising the possibility that either or both of these
eruptions are related to the current absence of ice worms at
this location. It is also possible that Mt. Hood’s glaciers
© 2005 NRC Canada
Hartzell et al. 1211
Easton
Easton
Wedgemount
Easton
Daniels
Daniels
Honeycomb
(Lost Provenience)
El Dorado
Overlord Black Fin
Black Fin
Black Fin
Black Fin
Black Fin
Black Fin
Paradise Paradise
Overlord
Wedgemount Disconnect
Paradise Disconnect
Paradise Disconnect
Paradise Disconnect
El Dorado
El Dorado
Wedgemount Disconnect
Nisqually
Paradise
Paradise
Williwakas
Williwakas
Williwakas
Williwakas
El Dorado
Wedgemount Disconnect
Overlord
Columbia
1
Enchytraeidae: Mesenchytraeus pedatus
Enchytraeidae: Mesenchytraeus pedatus
Bering
Portage
Portage
Portage
Portage
Portage
Learnard
Burns
Byron
Byron
Learnard
Milk
Milk
Milk Learnard
Marathon
Exit
Exit Exit
Marathon
Marathon
Byron
Byron
Burns
Burns
Burns
Burns
Burns
Burns
Burns
Burns
Alice
Burns
Alice
Alice
Portage
Byron
Byron
Grand Pacific/Junction
Grand Pacific/Junction
Grand Pacific
Grand Pacific
EastonWedgemount
Easton
Wedgemount
Washington
Baker
Baker
Baker
Baker
Baker
Baker
Baker
Kenai
Peninsula
St. Elias
Area
Pacific Range/
North Cascades
Glacier Peak/
Daniels Area
Oregon
Mount Rainier
Alaska
British Columbia, Oregon and Washington
Glacier Ice Worms
93
94
100
94
100
83 100
85
86
71
57
66
66
100
86
71
100
84
69
100
86
58
73 64
54
Lumbriculidae: Lumbriculus variegatus
Fig. 3. Strict consensus tree of glacier ice worms based on Bayesian analysis of mitochondrial cytochrome coxidase subunit 1 (COI;
493 base pair partial fragment). Pacific Range / North Cascades Range leaves are indicated by double lines. Numerical values >50 are
indicated and represent posterior probabilities. Scale indicates number of substitutions per site.
were never colonized, and that colonization of Mt. Jefferson
and glaciers of the Sisters Range to the south represent sepa-
rate, independent events. The apparent absence of ice worms
on inland glaciers of Alaska and the Rocky Mountain region
may be due to severe climate regimes where biota must sur-
vive temperatures well below –5 °C. Note that ice worm
protoplasm freezes at –6.8 °C (Edwards 1986).
The lack of detectable gene flow between noncontiguous
glaciers throughout their geographic range further suggests
that ice worms lack a robust dispersal mechanism. With the
exception of the Oregon populations (e.g., Mt. Jefferson, the
Sisters), ice worm dispersal has probably been active
throughout most of their range. Thus, ice worms likely ex-
pand their range during periods of glacial maxima, in con-
trast with most temperate species that disperse rapidly during
interglacial periods following episodes of refugia (Hewitt
2000, 2004).
Phylogenetic evidence presented in this report supports
the monophyletic status of the glacier ice worm, with the ca-
veat that few Mesenchytraeus species have been collected.
The only other morphologically and ecologically compara-
ble member of the genus that was available for analysis, the
allopatric species M. gelidus, fell outside of the ice worm
clade in 28S rRNA comparisons. Mesenchytraeus gelidus
(“snow worm”) has been recorded on Mt. Rainier, Washing-
ton (Welch 1916a), as well as Yosemite National Park in
California (Aitchison 1977), and can survive in seasonal
snowpack. The widespread distribution of the snow worm
M. gelidus and also M. altus (Welch 1917b) makes the tran-
sition from a snow-dwelling ancestor feasible, in terms of
punctuated evolutionary steps (e.g., Gould and Eldredge
1993) and physical proximity to glacial habitats. On the
other hand, snow worms could have descended from a
glacier-dwelling ancestor. Species of snow worms (i.e.,
M. gelidus,M. altus,M. hydrius, and Moore’s Mesenchy-
traeus niveus) lack intestinal diverticula, suggesting a more
derived relationship to others in this genus, although this
may simply be an expression of a neotanous state. Other de-
scribed members of the genus Mesenchytraeus are morpho-
logically and ecologically very different from ice worms
(e.g., Welch 1919, 1920).
The northern and southern ice worm clades appear to be
reproductively isolated from each other, as imposed by geo-
graphic separation and supported by genetic and morpholog-
ical evidence. The genetic distances between northern and
southern populations are comparable with species-level di-
vergences based on COI comparisons in naidid worms (Bely
and Wray 2004). Moreover, the northern and southern ice
worm clades are nearly as distant to each other as they are to
M. pedatus (Fig. 3), an ecologically and morphologically
very distinct species. At the same time, the two clades ap-
pear to be derived from an ancestor more recent than other
members of the genus examined in this study, arguing
against convergent evolution. Collectively, these observations
suggest that the northern and southern clades are allopatric
subspecies under biological, morphological, and phylogen-
etic concepts produced through geographic isolation (i.e.,
not capable of producing offspring in nature, morphologi-
cally distinguishable, and sharing a unique genetic history).
The time frame of ice worm origins and their putative
split into northern and southern lineages remain unclear, but
these could be estimated once an appropriate molecular
clock is established (perhaps by correlating genetic and geo-
graphic distances between contiguous population pairs
throughout their range). Nonetheless, their relatively long
geographic range coupled with an apparent mode of active
dispersal (~10 m/year for other oligochaetes; Marinissen and
van den Bosch 1992) suggests that ice worms probably
endured the periodic Ice Ages of the Quaternary Period
(~2.4 million years ago to present), and are potentially much
more ancient than that.
Acknowledgements
We thank David Hibbett, Todd Livdahl, Deborah Robert-
son, Denis Larochelle, and others at Clark University for
their advice and support; Manfred Binder, Zheng Wang, and
Andrew Wilson for their patience and assistance; Kathryn
Coates of the Bermuda Biological Research Station, Tarmo
Timm of the Estonian Agricultural University, Steve Fend of
the USGS Water Resources Division, Stuart Gelder of Uni-
versity of Maine at Presque Isle, and Christer Erséus of the
Swedish Museum of Natural History for sharing their tech-
nical expertise and for help obtaining specimens; and Boggs
Visitors Center (Chugach National Forest), Roberta Holden,
Sheila Byers, and the Vancouver Natural History Society for
ice worms. Funding for P.H.’s 2003 field research was pro-
vided by a research grant from the American Alpine Club.
We also thank Mauri Pelto for his assistance, technical ex-
pertise, and encouragement during the 2002 fieldwork, as
well as the innumerable friends and strangers who provided
rides, good company, food, and drink throughout Montana,
Alberta, British Columbia, and Alaska. We are indebted to
the rangers and management of Denali, Glacier, Glacier Bay,
Mt. Rainier, North Cascades, Olympic, Wrangell – St. Elias,
and Yosemite National parks for permits and advice and the
rangers and management of Chugach, Gifford Pinchot, Inyo,
Mt. Baker – Snoqualmie, Mount Hood, Shasta, Deschutes,
Tongass National Forests for their support and advice. Most
of all, unlimited thanks and respect go to our families for
their support and patience, especially Charity Scott who has
put up with more than her share.
References
Aitchison, S.W. 1977. Ice worms. Summit, Aug.–Sept., 6–9.
Bely, A.E., and Wray, G.A. 2004. Molecular phylogeny of naidid
worms (Annelida: Clitellata) based on cytochrome oxidase I.
Mol. Phylogenet. Evol. 30: 50–63.
Edwards, C.A., and Bohlen, P.J. 1996. The biology and ecology of
earthworms. Chapman and Hall, London.
Edwards, J.S. 1986. How small ectotherms thrive in the cold with-
out really trying. Cyro Lett. 6: 388–390.
Eisen, G. 1905. Enchytraeidae of the West Coast of North Amer-
ica. Harriman Alaska Expedition, with the Cooperation of
Washington Academy of Sciences. Smithsonian Institution,
Washington, D.C.
Emery, C. 1898a. Diagnosi di un nuovi genere e nuova specie di
annelidi della famiglia degli Enchytraeidae. Atti R. Accad.
Lincei, 5: 100–111.
Emery, C. 1898b. Über einen schwarzen Oligochäten von den
Alaska Gletschern. Verh. Schweiz. Naturforsch. Ges. Sektion
Zool. 89.
© 2005 NRC Canada
1212 Can. J. Zool. Vol. 83, 2005
Emery, C. 1898c. Sur un oligochete noir des glacier deli Alaska.
Rev. Suisse Zool. 5(Suppl.): 21–22.
Emery, C. 1900. On Melanenchytraeus solifugus.In The ascent of
Mount St. Elias, H.R.H. Edited by Prince Luigi Amedeo Di
Savoia, Duke of the Abruzzi. Archibald Constable & Co.,
Westminister. Appendix D. pp. 224–231.
Gardner, C.A., Scott, W.E., Major, J.J., and Pierson, T.C. 2000.
Mount Hood — history and hazards of Oregon’s most recently
active volcano. U.S. Geol. Surv. Survey Fact Sheet No. 060-00.
Goodman D. 1971. Ecological investigations of ice worms on
Casement Glacier, southeastern Alaska. Institute of Polar
Studies Report No. 39. Ohio State University Research Founda-
tion, Columbus.
Goodman, D., and Parrish, W.B. 1971. Ultrastructure of the epider-
mis in the ice worm, Mesenchytraeus solifugus. J. Morphol.
135: 71–86.
Gould, S.J., and Eldredge, N. 1993. Punctuated equilibrium comes
of age. Nature (Lond.), 366: 223.
Gudger, E.W. 1923. Snow worms. Nat. Hist. 23: 451–456.
Hall, T.A. 1999. BioEdit: A user-friendly sequence alignment edi-
tor and analysis program for Windows 95/98/NT. Nucleic Acids
Symp. Ser. 41: 95–98.
Hartzell, P.L. 2005. Pacific northwest glacial ecosystems. Ph.D.
thesis, Clarke University, Worcester, Mass.
Hewitt, G.M. 2000. The genetic legacy of the Quaternary ice ages.
Nature (Lond.), 405: 907–913.
Hewitt, G.M. 2004. Genetic consequences of climatic oscillations
in the Quaternary. Philos. Trans. R. Soc. Lond. B Biol. Sci. 359:
183–195.
Holmstrup, M., and Sjursen, H. 2001. Freeze induced glucose ac-
cumulation in the enchytraeid, Fredericia ratzeli from Green-
land. Cryo Lett. 22: 272–276.
Holmstrup, M., and Westh, P. 1994. Dehydration of earthworm co-
coons exposed to cold: a novel cold hardiness mechanisms. J.
Comp. Physiol. B, 164: 312–315.
Holmstrup, M., Bayley, M., and Ramlow, H. 2002. Supercool or
dehydrate? An experimental analysis of overwintering strategies
in small permeable arctic invertebrates. Proc. Natl. Acad. Sci.
U.S.A. 99: 5716–5720.
Huelsenbeck, J.P., and Ronquist, F. 2003. MrBayes 3: Bayesian
phylogenetic inference under mixed models. Bioinfomatics
(Oxf.), 19: 1572–1574.
Ibrahim, K., Nichols, R.A., and Hewitt, G.M. 1996. Spatial pat-
terns of genetic variation generated by different forms of dis-
persal during range expansion. Heredity, 77: 282–291.
Jamieson, B.G., Tillier, S., Tillier, A., Justine, J., Ling, E., James,
S., et al. 2002. Phylogeny of the Megascolecidae and Crassi-
clitellata (Annelida, Clitellata): combined versus partitioned
analysis using nuclear (28S) and mitochondrial (12S, 16S)
rDNA. Zoosystema, 24(4): 707–733.
Jobb, G., von Haeseler, A., and Strimmer, K. 2004. TREEFINDER:
A powerful graphical analysis environment for molecular phylo-
genetics. BMC Evol. Biol. 4: 18–27.
Lee, S., and Taylor, J.W. 1990. Isolation of DNA from fungal my-
celia and single cells. In PCR protocols, a guide to methods and
applications. Edited by M.A. Innis, D.H. Gelfand, J.J. Sninsky,
and T.J. White. Academic Press, San Diego. pp. 282–287.
Maddison, J., and Maddison, M. 2004. McClade. Version 4.06
[computer program]. Sinauer Associates, Inc., Sunderland, Mass.
Marinissen, J.Y.C., and van den Bosch, F. 1992. Colonization of
new habitats by earthworms. Oecologica (Berl.), 91: 371–376.
Moore, J.P. 1899. A snow-inhabiting enchytraeid (Mesenchytraeus
solifugus Emery) collected by Mr. Henry G. Bryant on the
Malaspina Glacier, Alaska. Proc. Acad. Nat. Sci. Phila. 1899:
125–144.
Napolitano, M.J., and Shain, D.H. 2004. Four kingdoms on glacier
ice: convergent energetic processes boost energy levels as tem-
peratures fall. Proc. R. Soc. Lond. B Biol. Sci. 271(Suppl.):
S273–S276.
Napolitano, M.J., Nagele, R.G., and Shain, D.H. 2004. The ice
worm, Mesenchytraeus solifugus, elevates adenylate at low
physiological temperature. Comp. Biochem. Physiol. A, 137:
227–235.
Odell, N.E. 1949. Ice worms in Yukon and Alaska. Nature (Lond.),
164: 1098.
Pedersen, P.G., and Holmstrup, M. 2003. Freeze or dehydrate: only
two options for the survival of subzero temperatures in the arctic
enchytraeid Fridericia ratzeli. J. Comp. Physiol. B, 173: 601–609.
Porter, S.C., and Denton, G.D. 1967. Chronology of neoglaciation
in the North American Cordilleran. Am. J. Sci. 265: 177–210.
Posada, D., and Buckley, T.R. 2004. Model selection and model
averaging in phylogenetics: advantages of the AIC and Bayesian
approaches over likelihood ratio tests. Syst. Biol. 53: 793–808.
Posada, D., and Crandall, K.A. 1998. MODELTEST: testing the
model of DNA substitution. Bioinformatics, 14: 817–818.
Russell, I.C. 1892. Second expedition to Mt. St. Elias in 1891.
Thirteenth Annual Report of the U.S. Geol. Surv. 1891–1892, Pt
Ii, Geology. p. 33.
Shain, D.H., Carter, M.R., Murray, K.P., Maleski, K.A., Smith,
N.R., McBride, T.R., et al. 2000. Morphologic characterization
of the ice worm, Mesenchytraeus solifugus. J. Morphol. 246:
192–197.
Shain, D.H., Mason, T.A., Farrell, A.H., and Michalewicz, L.A.
2001. Distribution and behavior of ice worms (Mesenchytraeus
solifugus) in south-central Alaska. Can. J. Zool. 79: 1813–1821.
Sømme, L., and Birkemoe, T. 1997. Cold tolerance and dehydra-
tion in Enchytraeidae from Svalbard. J. Comp. Physiol. B, 167:
264–269.
Thompson, J.D., Gibson, T.J., Pleaniak, F., Jeanmougin, F., and
Higgins, D.G. 1997. The Clustal X windows interface: flexible
strategies for multiple sequence alignment aided by quality anal-
ysis tools. Nucleic Acids Res. 24: 4876–4882.
Tynen, M.J. 1970. The geographical distribution of ice worms
(Clitellata: Enchytraeidae). Can. J. Zool. 48: 1363–1367.
Waitt, R.B., and Thorson, R.M. 1983. The Cordilleran Ice Sheet in
Washington, Idaho, and Montana. In Late-Quaternary environ-
ments of the United States. Vol. 1. The late Pleistocene. Edited
by Stephen C. Porter, University of Minnesota Press, St. Paul.
Welch, P.S. 1916a. Snowfield and glacier Clitellata from Mt.
Rainier, Washington. Trans. Am. Microsc. Soc. 35: 85–124.
Welch, P.S. 1916b. Glacier Clitellata from Mt. Rainier. Science
(Wash., D.C.), 43: 143.
Welch, P.S. 1917a. Alaskan glacier worms (Clitellata). Bionomical
Leaflets No. 2, McGill University, Montreal, Que.
Welch, P.S. 1917b. Enchytraeidae (Oligochaeta) from the Rocky
Mountain Region. Trans. Am. Microsc. Soc. 38: 175–188.
Welch, P.S. 1919. Further studies on North American mesen-
chytraeids (Clitellata). Trans. Am. Microsc. Soc. 38: 175–189.
Welch, P.S. 1920. The genera of the Enchytraeidae (Oligochaeta).
Trans. Am. Microsc. Soc. 39: 25–50.
© 2005 NRC Canada
Hartzell et al. 1213
