No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Novel multiplex PCR for the detection of lactic acid bacteria during kimchi fermentation
Abstract
We developed a multiplex PCR assay for the detection of lactic acid bacteria (LAB) species, and used it to examine the LAB species involved in kimchi fermentation. The LAB profile during kimchi fermentation varied with pH and acidity. Leuconostoc mesenteroides was observed during early fermentation (pH 5.64-4.27 and acidity 0.48-0.89%), and Lactobacillus sakei become dominant later in fermentation (pH <or=4.15 and acidity >or=0.98%). The efficiency of the multiplex PCR ranged from 86.5% at day 0 (pH 6.17 and acidity 0.24%) to 100% at day 96 (pH 4.16 and acidity 1.14). This multiplex PCR assay will facilitate study of the microbial ecosystem of kimchi and its impact on kimchi fermentation.
... In fact, the major microorganisms responsible for kimchi fermentation are lactic acid bacteria (LAB). Previously, the LAB that were isolated and identified from fermented kimchi included: Leuconsotoc citreum, Leuconsotoc gasicomitatum, Leuconsotoc mesenteroides, Lactobacillus brevis, Lactobacillus curvatus, Lactobacillus plantarum, Lactobacillus sakei, Lactococcus lactis, Pediococcus pentosaceus, and Weissella Korenesis etc. [3][4][5][6][7][8][9][10]. ...
... The common quality indices of kimchi are pH and acidity, which are affected by a number of factors during fermentation [1,5]. The important factors that affect kimchi fermentation are microorganisms, temperature, oxygen level, pH, salt concentration, fermentable carbohydrates, and other available nutrients or any inhibitory compounds in the raw materials used [4]. ...
... Molecular ecological studies have received increasing attention for exploring the microbial diversity in kimchi including polymerase chain reaction (PCR) with a strain-specific primer [5], sodium dodecyl sulfate polyacrylamide gel electrophoresis [12], PCR-denaturing gradient gel electrophoresis (DGGE) [9], genome-probing microarray [13], and 16S rRNA gene sequence [6][7][8]14]. In particular, a multiplex PCR method allows the simultaneous amplification of more than one target sequence in a single PCR reaction, which saves considerable time and effort and decreases the number of reactions that need to be performed to assess the possible presence of microorganisms in the food [5,15,16]. ...
... For V. parahaemolyticus ATCC 27969, a specific primer pair (irgB_F and irgB_R) was used to amplify a 369 bp region of the iron-regulated virulence regulatory gene [23]. For Lpb. plantarum NCIMB 6105, a species-specific primer pair (LplF and LplR) was used to amplify a 313 bp region of the cadmium-manganese transport ATPase gene (AF136521) [24]. Similarly, for Le. ...
... Similarly, for Le. mesenteroides ATCC 10830, a specific primer pair (LmeF and LmeR) was used to amplify a 358 bp region of the alcohol acetaldehyde dehydrogenase gene (AY804189) [24]. The primer sequences used for RT-qPCR analysis are listed in Table 1. ...
Vibrio cholerae and Vibrio parahaemolyticus are common pathogens linked to human gastroenteritis, particularly in seafood like shrimp. This study investigated the impact of lactic acid bacteria on V. cholerae and V. parahaemolyticus regarding the production of cadaverine, a concerning compound. V. cholerae NCCP 13589 and V. parahaemolyticus ATCC 27969 were significant producers of amines in experiments conducted using white-leg shrimp (Litopenaeus vannamei) and lysine decarboxylase broth. Notably, the Lactiplantibacillus plantarum NCIMB 6105 and Leuconostoc mesenteroides ATCC 10830 lactic acid bacteria strains demonstrated a pronounced antagonistic effect on the production of biogenic amines by these food-borne pathogenic bacteria. The presence of lactic acid bacteria led to a substantial reduction in cadaverine production in the lysine decarboxylase broth and shrimp extract. The co-culture of two lactobacilli species reduced the cadaverine production in V. cholerae and V. parahaemolyticus by approximately 77 and 80%, respectively. Consequently, the favorable influence of lactic acid bacteria in curbing cadaverine production by food-borne pathogens presents clear advantages for the food industry. Thus, effectively managing these pathogens could prove pivotal in controlling the biogenic amine levels in shrimp.
... A collection of 217 kimchi bacterial isolates were obtained from the Food Microbiology Laboratory (Chung-Ang University, Ansung, South Korea). Species-specific polymerase chain reaction (PCR) methods were used to identify GABA-producing LAB isolates, as described previously (Cho et al., 2009;Kim and Kim, 2014). ...
... For this study, species-specific PCR reactions using previously published primer sets for L. plantarum, L. brevis, and L. mesenteroides (Cho et al., 2009;Kim and Kim, 2014) could identify the 24 GABA-producing isolates. Representative species-specific PCR fragments amplified from each bacterial species are shown in Fig. 6. ...
The objectives of this study were to optimize the medium and culture conditions using a strong γ-aminobutyric acid (GABA) producer as a reference lactic acid bacterial strain, to screen and identify GABA-producing lactic acid bacterial isolates from kimchi, and to determine their extracellular GABA-producing abilities. Thin-layer chromatography was used to screen GABA-producing bacterial isolates and high-performance liquid chromatography was used to evaluate the bacterial GABA production abilities. Species-specific polymerase chain reaction analyses were used to identify GABA-producing bacterial isolates. The optimal medium and culture conditions were found to be the modified Man–Rogosa–Sharpe (MRS) broth (with an initial pH of 6.5) containing 4% sucrose, 5% glutamate, and 1% yeast extract at 37°C for 5 days. After incubation under the optimized culture conditions, 217 kimchi bacterial isolates were screened to evaluate their respective GABA-producing abilities. Screening the 217 kimchi bacterial isolates identified 24 GABA-producing lactic acid bacterial isolates (11%): Lactobacillus plantarum (17), Lactobacillus brevis (six), and Leuconostoc mesenteroides (one), indicating that only a small proportion of the strains produce GABA in the culture broth. The extracellular GABA-producing abilities of the bacterial strains identified in this study varied even within the same species, ranging from 5.8 to 101.7 mM among the 17 GABA-producing L. plantarum isolates and from 8.5 to 88.6 mM among the six GABA-producing L. brevis isolates. In summary, three species of the 24 kimchi GABA-producing bacterial isolates were identified, including one rare species (L. mesenteroides) and the two most dominant species (L. brevis and L. plantarum). Keywords: Lactobacillus brevis; Lactobacillus plantarum; Leuconostoc mesenteroides; Optimization; γ-aminobutyric acid (GABA)
... The ability of the strains to survive in the presence of the pesticide varies from one strain to another. Cho et al. (2009) demonstrated that four LAB strains (Lb. brevis, L. plantarum, Lb. sakei and Leuconostoc mesenteroides) isolated from kimchi fermentation supplemented with 30 mg/l of chlorpyrifos can used it as sole carbon source. ...
... The ability of LAB to tolerate or to degrade chlorpyrifos has been tested by several researchers. Cho et al. (2009) found that LAB have the ability to degrade chlorpyrifos during Kimchi fermentation. Moreover, Bo et al. (2011) confirmed that milk lactic culture tolerated the presence of high concentrations of seven organophosphate pesticides, where residues of these pesticides were found later during the yogurt formation process. ...
Pesticides play an important role in agriculture; however, their excessive use causes several problems such as pollution of ecosystems and risks to human health. The presence of microorganisms able to degrade these pollutants can reduce their negative effect. The objective of this study was to test the capacity of Weissella confusa Lb.Con to tolerate or to degrade the chlorpyrifos pesticide. The results showed the capacity of the strain to tolerate a concentration of 200 μg/ml of chlorpyrifos. The strain Lb.Con has a remarkable capacity to grow in glucose-free MRS medium which contains different concentrations of chlorpyrifos. HPLC analysis showed that this strain was able to remove about 25% of chlorpyrifos. The evaluation of some probiotic properties showed that the strain Lb.Con had a remarkable resistance to the gastrointestinal conditions and a good antibacterial activity towards the pathogenic bacteria. The probiotic potential was evaluated to verify the possible use of W. confusa Lb.Con to detoxify harmful chlorpyrifos contained in food.
... Numerous molecular assays that are based on the use of 16S rDNA together with a well-characterised metabolic gene are commonly used for the detection and identification of Weissella species. However, serious drawbacks have been observed for the specific identification and detection of W. cibaria isolates, as these assays also detect other Weissella species 14 . Additionally, many multiplex PCR and chromogenic DNA microarray systems have been developed for the simultaneous amplification of several genes in a single assay. ...
... Additionally, many multiplex PCR and chromogenic DNA microarray systems have been developed for the simultaneous amplification of several genes in a single assay. However, these approaches exhibit some limitations, as the detection of target cells in food samples or in mixtures that vary widely with respect to their ratios of bacterial species is difficult 14 . Consequently, detection specificity, which can be influenced both by the uniqueness of the sequence within the targeted microbial genome of interest and by the precise annealing of the primers and probe to their target, is crucial to the efficiency of any PCR detection method. ...
Weissella cibaria has been found in Korean kimchi and other sources, including fermented foods, Greek salami, Spanish sausages, and animal and human excrement. W. cibaria was recently reported to show anticancer, immunomodulatory, anti-inflammatory and antioxidant properties. Nevertheless, fundamental ecological succession studies are required to scientifically confirm the probiotic action of W. cibaria under various conditions, such as fermentation. Therefore, in the present study, we mined the W. cibaria KACC11862 genome in search of species-specific genes to use as new PCR targets for the detection and quantification of W. cibaria in kimchi. The sensitivity and specificity of the identified primer set from the putative outer membrane protein gene for the detection of W. cibaria KACC11862 in kimchi were analysed. Primer set specificity was evaluated using genomic DNA from eight W. cibaria isolates, 10 different species of Weissella and 13 other reference lactic acid bacteria (LAB) strains. Interestingly, by using the qPCR assay developed herein, we found that red pepper powder markedly affects the ontogeny of W. cibaria during kimchi fermentation.
... Recently, species, subspecies, and strain-specific deoxyribonucleic acid (DNA) probes have been used extensively to screen, detect, quantify, and identify strains of bacteria, yeast, and viruses 6 . Many molecular assays based on 16S ribosomal RNA (rRNA) and a well-characterized gene that encodes a function relevant for a specific microorganism's metabolism have been used to detect and identify Weissella species, but serious problems with the identification and detection of W. koreensis isolates have been identified: these assays also detect other Weissella species or do not produce amplicons from W. koreensis strains 7 . In addition, many multiplex PCR and chromogenic DNA macroarray systems for simultaneous amplification of several genes in a single assay have been developed. ...
... In addition, many multiplex PCR and chromogenic DNA macroarray systems for simultaneous amplification of several genes in a single assay have been developed. Nevertheless, these methods exhibit limitations: detecting target cells in mixtures with significantly different bacteria ratios or in food samples remains a challenge 7 . Consequently, the detection specificity, which depends on both the uniqueness of the sequence to a bacterium of interest and the specific binding of the primers and probe to the target sequence, is crucial for the efficacy of any PCR detection method. ...
Weissella koreensis is a psychrophilic bacterium that is the dominant species found in kimchi and exhibits anti-obesity effects via its production of ornithine. In this study, we mined the genome of W. koreensis KACC15510 to identify species-specific genes that can serve as new targets for the detection and quantification of W. koreensis in kimchi. A specific polymerase chain reaction (PCR) primer set for the membrane protein-encoding gene of W. koreensis KACC15510 was designed and investigated to quantify its sensitivity and specificity for detecting the bacterium in kimchi. The specificity of the primer set was evaluated using genomic DNA from eight isolates of W. koreensis, 11 different species of Weissella and 13 other reference lactic acid bacterium (LAB) strains. In addition, red pepper powder was observed to strongly influence the density of W. koreensis during kimchi fermentation.
... We demonstrated that the microbiota and immunomodulatory activity were changed by the fermentation of B. rapa L. The characteristic of fermentation of B. rapa L. is an increase in L. curvatus. A previous study demonstrated that L. mesenteroides and L. sakei were predominantly observed in the early and late fermentation stages of kimchi (6). To the best of our knowledge, this is the first study to investigate the immunomodulatory effects of fermented vegetables. ...
Lactic acid bacteria (LAB) exert beneficial health effects by regulating immune responses. Brassica rapa L., known as Nozawana, is commonly consumed as a lactic acid-fermented food called nozawana-zuke. Few studies have investigated changes in the bacterial community and cytokine production activities during the fermentation of B. rapa L. In order to obtain more detail information, we herein conducted a study on fresh B. rapa L. fermented for 28 d. An amplicon analysis of the 16S rRNA gene revealed that Lactobacillales predominated during fermentation, and the microbiota became less diverse on day 7 or later. Fermented B. rapa L. promoted the production of interferon (IFN)-γ and interleukin (IL)-10 by mouse spleen cells more than non-fermented vegetables. Lactobacillus curvatus was the predominant species during fermentation, followed by L. plantarum and L. brevis. L. sakei was occasionally detected. A correlation analysis showed that IFN-γ concentrations positively correlated with the numbers of L. curvatus and L. plantarum, while those of IL-10 correlated with the numbers of L. sakei in addition to these 2 species. Significantly higher levels of IFN-γ and IL-10 were induced by fermented B. rapa L. when isolated Lactobacillus strains were added as starter cultures. These results suggest that the Lactobacillus species present in fermented B. rapa L. are beneficial for manufacturing vegetables with immunomodulatory effects.
... Simply, the molecular approaches provide efficient solutions for microbial identification in fermented foods of which for example nucleic acid probe, species-specific PCR, Rep-PCR, multiplex PCR, 16S rDNA sequencing, DGGE, and TTGE are used to analyze the microbial flora of fermented food products (Torriani, Felis, and Dellaglio 2001;Elegado et al. 2004;Kim and and Chun, 2005;Miyamoto et al. 2005;Pulido et al. 2005;Abriouel et al. 2008;di Cagno et al. 2008;Panagou et al. 2008;Cho et al. 2009;de Bellis et al. 2010;Paramithiotis, Hondrodimou, and Drosinos 2010;Botta and Cocolin 2012;Sulistiani et al. 2014). Moreover, DNA restriction fragment analysis (RFLP, RAPD), ribotyping, pulsedfield gel electrophoresis (PFGE) and Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) can be used as primary molecular tools (Nguyen et al. 2013;El Sheikha 2018a). ...
Fermented foods were likely to have been the first among all types of processed foods consumed by human beings. The role that fermented food plays is not only related to the development of civilizations and cultural relationships between countries but also related to the nutritional importance of its population. Of course, the early manufacturers of fermented foods didn’t take into account the advantages of modern sciences, because enzymes and microorganisms were discovered just 150-200 years ago. For that reason, we can conclude why the ancient fermentation techniques were known to philosophers and alchemists, but not to biologists. It demonstrated that the fermentation mechanisms involved many secrets still undiscovered. Recently, applications of molecular techniques for analyzing and study the fermented foods have been explored. In this review, we provide answers with a critical vision to many questions for understanding the role of molecular techniques to discover the secrets of fermented foods such as how to evaluate the traditional fermented foods? Why using molecular techniques to study the fermented foods not else? Is the future will carry to us a boom in molecular technologies contribute to the detection of more secrets of the fermented food?
... PpeF/PpeR CTTTGTGCCCGGTGGATCCT/AAAGGCTGCAATGTAGTTGATGCT 330 [13] 27f/Lla AGAGTTTGATCMTGGCTCA/CAGTCGGTACAAGTACCAAC 81 [14] Lp-F/Lp-R TGATCCTGGCTCAGGACGAA/TGCAAGCACCAATCAATACCA 81 [15] Lc-F/Lc-R CAGGTCTTGACATCTTTTGATCA/CTAAATGCTGGCAACTAGTCAT 154 [16] 1 qPCR Table 3 The qPCR amplification reaction conditions of various primers ；Elizaquível [23] Nocker [24] 50 μmol/L PMA ...
The molecular detection method of qPCR combined with PMA is an effective method for the detection of active microorganisms. This study aimed to develop PMA-qPCR method for the six dominant bacteria (including Staphylococcus pasteuri, Leuconostoc mesenteroides, Pediococcus pentosaceus, Lactococcus lactis subsp. lactis, Lactobacillus plantarum and Lactobacillus casei) during the traditional brewing of Hong Qu glutinous rice wine. Firstly, specific primers were designed and synthesized for real-time quantitative PCR analysis, and PMA treatment conditions were further optimized. Then, the PMA-qPCR method for the quantitative detection of six dominant bacteria was constructed through the construction of standard curves. The results showed that the six designed and synthesized specific primers were effective and feasible; the optimal PMA treatment condition was PMA concentration 50 μmol/L and cross linking exposure time 5 min. The constructed PMA-qPCR assay for the live bacteria was applied to the traditional brewing process of Hong Qu glutinous rice wine. Pediococcus pentosaceus, Leuconostoc mesenteroides and Lactococcus lactis subsp. lactis were determined to be the three dominant bacteria during traditional brewing system. The constructed PMA-qPCR assay for viable bacteria could be used to detect the dominant bacteria and their dynamic changes timely and quantitatively during the traditional brewing of Hong Qu glutinous rice wine, which is helpful to elucidate the mechanism of action of different bacteria during the traditional brewing process of Hong Qu glutinous rice wine.
... Thus, the use of these assays has significant drawbacks in the identification and detection of Bacillus groups, because they also detect other Bacillus species or subspecies. These technical limitations have become a significant obstacle that has prevented the elucidation of the microbial communities of various assayed samples, such as food or soil samples, even though pyrosequencing methods can provide insight into understanding the overall microbial composition of a particular niche 8,13,[16][17][18] . ...
Bacillus subtilis and B. velezensis are frequently isolated from various niches, including fermented foods, water, and soil. Within the Bacillus subtilis group, B. velezensis and B. subtilis subsp. subtilis have received significant attention as biological resources for biotechnology-associated industries. Nevertheless, radical solutions are urgently needed to identify microbes during their ecological succession to accurately confirm their action at the species or subspecies level in diverse environments, such as fermented materials. Thus, in this study, previously published genome data of the B. subtilis group were compared to exploit species- or subspecies-specific genes for use as improved qPCR targets to detect B. velezensis and B. subtilis subsp. subtilis in kimchi samples. In silico analyses of the selected genes and designed primer sequences, in conjunction with SYBR Green real-time PCR, confirmed the robustness of this newly developed assay. Consequently, this study will allow for new insights into the ontogeny and succession of B. velezensis and B. subtilis subsp. subtilis in various niches. Interestingly, in white kimchi without red pepper powder, neither B. subtilis subsp. subtilis nor B. velezensis was detected.
... curvatus were found to be extremely important microbes responsible for kimchi fermentation. In 2009, the main species in kimchi with different fermentation times were analyzed by Cho et al. (2009) with a new type of multiple polymerase chain reaction. Leu. ...
This study investigated the lactic acid bacteria (LAB) population in la-baicai (spicy cabbage), a traditional fermented food made by the Korean-Chinese community in northeastern China and screened for functional LAB. LAB diversity was analyzed using denaturing gradient gel electrophoresis (DGGE), and 81 LAB strains were isolated and identified based on 16S rDNA sequencing analysis. Polymerase chain reaction DGGE detected 21 LAB species, belonging to the genera Lactobacillus (Lb.), Leuconostoc (Leu.), Pediococcus and Weissella, in 45 la-baicai samples. Lb. plantarum and Lb. sakei were considered to be dominant in the bacterial community. Among 81 LAB isolated by traditional pure culture methods were Lb. plantarum (25 strains), Lb. brevis (two strains), Lb. casei, (four strains), Lb. pentosus (three strains), Enterococcus faecium (45 strains), and E. durans (two strains). The tolerances of these LAB were investigated. Six LAB with high salt (NaCl)-tolerance were screened from the isolates, and 16% (w/v) was the highest salt-tolerance reached. Among the isolates, strain N1, identified as Lb. pentosus, survived well in a simulated digestive environment. Traditional fermented la-baicai from northeastern China is a rich LAB resource. Further study is needed and would be worthwhile to advance the benefits of these LAB.
... It is a popular side dish that is served at every meal with rice. Kimchi production in Korea is estimated at over 1.5 million tonnes, mainly at household level and daily consumption is estimated at 150 to 250 g (Cho et al. 2009). The main ingredient of kimchi is either Chinese cabbage to which radish and cucumber may be eventually added. ...
The book chapter described the overview in lactic acid fermentation of vegetables and fruits,lacto juice and smoothies. food safety aspects as well as health benefits.Factors such as brine concentration, pH, temperature etc are discussed
... In previous studies, the antimicrobial actions of multiple strains of LAB during the fermentation processes of many fermented foods including kimchi and sauerkraut were shown to make these foods microbiologically safe from pathogenic bacteria (10,11). Treatment with individual or combined strains of L. acidophilus were shown to inhibit the growths of E. coli O157:H7 and S. Typhimurium in tryptic soy broth (TSB) or ground beef (4). ...
Lactic acid-producing bacteria (LAB) and organic acids can inhibit the growth of pathogenic bacteria and spoilage organisms. Here, synergistic effect of LAB and citric acid was examined. Escherichia coli O157:H7 or Salmonella Typhimurium were treated with a 1% citric acid, 2% citric acid, LAB mixture, LAB mixture+1% citric acid, and LAB mixture+2% citric acid for 10, 20, 30, and 60 min, respectively. While LAB only, the addition of 1 or 2% citric acid caused 0.28–0.57 log reductions of E. coli O157:H7 or S. Typhimurium within 60 min, the treatment of LAB mixture+2% citric acid showed 1.96 and 6.24 log reductions of E. coli O157:H7 and S. Typhimurium, respectively. In conclusion, LAB and citric acid act synergistically and the combination showed its potential of an effective hurdle for the inactivation of foodborne pathogens.
... Generally, a batch of kimchi product processed in a container has a distinct microbial community that is influenced by environmental factors, such as the major vegetable ingredients, temperature, seasonal changes and inoculated starter microorganisms, and is considered as an individual closed ecosystem (Cho et al., 2009). Here, we report the metagenomic analysis of bacterial community dynamics with time-series samples of ten representative kimchi during the fermentation process. ...
Kimchi, a food made of fermented vegetables, is densely populated by indigenous microorganisms that originate from the raw ingredients under normal conditions. Most microbiological studies on kimchi have been on the most popular dish, baechu-kimchi (Chinese cabbage kimchi). Therefore, relatively little is known about the various other kinds of kimchi (depending on the region, season, main ingredient, starter culture inoculation and recipe). In this study, we collected 100 samples periodically during the fermentation of ten representative kinds of kimchi (including starter-inoculated kimchi) that were stored in the refrigerator (4 °C) during the 30-35 days fermentation period. The multiplex barcoded pyrosequencing of a hypervariable V1-V3 region of the 16S ribosomal RNA (rRNA) gene tagged with sample-specific barcodes for multiplex identifiers was employed for bacterial community profiling. We found that bacterial communities differed between starter-inoculated and non-inoculated kimchi at the early stages of fermentation, but overall there were no significant differences in the late phases. Also, the diversity and richness of bacterial communities varied depending on the various types of kimchi, and these differences could largely be explained by the major ingredients and the manufacture processes of each types of kimchi. This study provides the comprehensive understanding of the factors influencing the biodiversity of the kimchi ecosystem.
... And more, many authors have described the development of PCR or multiplex PCR assay for the LAB detection in food based on the use of different target genes (Cho et al., 2009;Karapetsas et al., 2010;Sheu et al., 2009;Sul et al., 2007) but none of these assays was able to detect, with high discriminative power, the simultaneous presence of the above mentioned five LAB in dairy products. This method offers the possibility to screen several whey starter cultures in a rapid and effective way and to obtain a general picture of the LAB community structure without the need of using cumbersome and time consuming strain isolation plans. ...
... Compared with conventional real-time PCR assays, multiplex PCR assays are more difficult to design due to the potential competition and similarities between primer-probe combinations, annealing temperatures, and effects of multiple primer-probe concentrations (King et al., 2008;Shum and Paul, 2009;Wada et al., 2009). Multiplex assays have been developed to detect bacteria, viruses, parasites, and retroviral vector promoters (Cho et al., 2009;Rao et al., 2009;Veron et al., 2009). Although multiplex PCR assays have been used for simultaneous quantification of 2 or more transcripts (Xu et al., 2002;Nygaard et al., 2005), to our knowledge, primer-probe multiplex assays have not been used previously to quantify mRNA variants. ...
Pyruvate carboxylase (PC; EC 6.4.1.1) is a critical enzyme for gluconeogenesis and maintenance of tricarboxylic acid (TCA) cycle intermediates, and expression of PC mRNA is increased at calving and during feed restriction. The bovine PC gene contains 3 promoters (3, 2, and 1 from 5' to 3') that produce 6 mRNA 5' variants (A through F). Products of promoter 1, untranslated region (UTR) variants A, B, C, and F are specifically expressed in glucogenic and lipogenic tissues. The objective of this study was to develop a quantitative PCR-based assay for bovine PC 5' UTR variants that would permit simultaneous characterization of PC variant expression and to determine the pattern of PC variant expression during the transition to lactation and during feed restriction. Primer combinations specific to the coding region of PC and the 5' UTR for variants D, E, and F were used with Taqman probes in a real-time PCR multiplex assay to simultaneously determine total PC mRNA and expression of each UTR variant. The intraassay and interassay CV were less than 2 and 10%, respectively. Total PC mRNA and PC 5' UTR variant profile was determined for liver biopsy samples collected from Holstein cows (n = 8) at -28, +1, and +28 d relative to calving (DRTC) and from mid-lactation Holstein cows subjected to either feed restriction (n = 8) or fed for ad libitum intake (n = 8). The expression of PC mRNA corresponding to the coding region of PC and PC 5' UTR variant regions A, B, C, and F increased (P < 0.05) 4-fold with feed restriction and 6-fold at calving. Nuclei isolated from liver biopsy samples and used to determine the rates of PC gene transcription indicate changes in the abundance of PC 5' mRNA variants A, B, C, and F that are due to corresponding changes in the rate of transcription of the bovine PC gene. The data support the use of the multiplex assay described here as a proxy measure of the activity of bovine PC promoter 1. The increased PC mRNA expression observed at calving and during feed restriction is the result of specific increases in 5' UTR variants A, B, C, and F due to increased transcriptional activity of promoter 1 of the PC gene.
This study aimed to evaluate the physicochemical and microbiological quality of kimchi seasoning products purchased from an online shopping mall, using cluster analysis to inform consumers about the quality of commercial kimchi seasoning and enable them to make informed purchasing decisions. The clusters were classified into four groups: CKS02 to 03 (group I), CKS04 to 05 (group II), CKS07 to 09 (group III), and others (CKS01, CKS06, and CKS10) (group IV). Principal component analysis (PCA) validated the cluster characteristics and a strong correlation between the moisture content in group I, salinity in group II, capsaicinoids content in group III, and pH in group IV. Highly significant correlations were observed between the L (lightness) and b (yellowness) values, solid and moisture content, and viscosity and solid content of kimchi seasoning. The findings of this study provide information on the baseline quality of commercially available seasoning products, and it is expected that items with a high correlation among the seasoning qualities can be used as management indicators to ensure consistency.
A wide variety of lactic acid-fermented fruits and vegetables currently exists. Among them, kimchi and sauerkraut are the ones that have met worldwide commercial significance and are most widely consumed. Cabbage is the primary ingredient for both; however, kimchi production involves incorporating many more ingredients, reflected in the complexity of the respective micro-ecosystem. Traditional fermented foods have a long history of being consumed by local communities and are important nutritional and functional properties. Their health functionality includes anticancer, antiobesity, anticonstipation, colorectal health promotion, probiotic properties, cholesterol reduction, fibrinolytic effect, antioxidative, antiaging, brain health promotion, immune promotion, skin health promotion, etc. This chapter presents and critically discusses the various aspects of fermentation and processing along with nutritional and health functionalities of kimchi and sauerkraut.
Sufu, a traditional fermented soybean product, is a popular side dish in China and other Asian nations. This paper presents an overview of the relationships between the biogenic amines (BAs) of sufu and its processing and storage conditions. Putrescine and cadaverine were found in almost all sufu products. Thus, a BAs-derived formula is proposed to evaluate sufu quality. The use of selected microorganisms as starters reduces the formation of BAs. While, addition of NaCl and alcohol positively delays the formation of BAs by reducing strain and decarboxylase activities. Similarly, lowering the storage temperature and shortening the storage time are practical measures to control activity of bacteria and of decarboxylases. Industrial sufu products require a long storage time, and thus use of additives, particularly natural ones, represents a viable alternative for the control of BAs.
In this study, we compared the changes in the quality of kimchi fermented with a complex starter and a single starter. Lactic acid bacteria strains isolated from kimchi were used as starters, and fermention was performed at 10°C for 26 days. The rate of reduction in lactic acid bacteria was low, the initial pH was maintained at a constant level, and the dominance rate of the starter was high at 83% on the 15th day of fermentation with the complex starter, compared to fermentation with the control and single starters. Regarding the CO2 and free sugar content, which are factors affecting product quality and are influenced by lactic acid bacteria fermentation, 1.4 and 1.5 times higher CO2 and mannitol production, respectively, were observed during fermentation of free sugars with the complex starter than in fermentation with the single starter. These results show that the use of a complex starter can improve the distribution quality of kimchi as it results in an extended shelf life and enhanced sensory quality.
Lactobacillus plantarum KC28 showed a beneficial (anti-obesity) effect in a diet-induced obese (DIO) C57BL/6 murine model receiving an intermediate high-fat diet (IF). This diet was selected for probiotic studies by prior comparisons of different combinations of basic (carbohydrate, protein and fat) components for optimized induction of dietary obesity in a murine model. Prior selection of Lact. plantarum strain KC28 was based on different physiological tests for safety and functionality including cell line adhesion and anti-adipogenic activity. The strain was administered at 5.0 × 109 CFU/mouse/day to the DIO mice (control mice received a normal diet). The anti-obesity effect of KC28 and the well-known probiotic strains Lact. rhamnosus GG (LGG) and Lact. plantarum 299v was assessed over 12 weeks. Xenical served as anti-obesity control. The high-fat diet groups receiving strains KC28 and LGG and the control Xenical group showed significant weight loss and notable changes in some obesity-related biomarkers in the liver (significant up-regulation of PGC1-α and CPT1-α only by KC28; p < 0.05) and mesenteric adipose tissue (significant down-regulation of ACOX-1, PPAR-γ, and FAS; KC28 p < 0.001 for PPAR-γ and FAS), compared with the IF control. Favourable changes in the studied biomarkers suggest a similar beneficial influence of Lact. plantarum KC28 on the alleviation of obesity comparable with that of the two well-studied probiotic strains, LGG and 299v. This probably resulted from a modulation in the cecal microbiota of the IF group by either probiotic strain, yet in a different manner, showing a highly significant increase in the families Desulfovibrionaceae and Lactobacillaceae only in the group receiving Lact. plantarum KC28.
This study aimed to investigate bacterial diversity in paocai and Chinese spicy cabbage and compare the microbial communities using high-throughput sequencing. Bacteria representing 26 phyla, 480 genera and 338 species were observed in these Chinese fermented vegetables. Firmicutes and Proteobacteria were the main phyla observed in both paocai and Chinese spicy cabbage. Additionally, Lactobacillus, Pediococcus, Serratia, Stenotrophomonas and Weissella were the major genera observed in both paocai and Chinese spicy cabbage. Overall, the relative abundances of Lactobacillus, Pediococcus and Weissella in Chinese spicy cabbage were much higher than those in paocai, but the proportions of Stenotrophomonas and Serratia in Chinese spicy cabbage were less than those in paocai. The results showed that the composition of the microbial community in Chinese spicy cabbage was positively correlated with total titratable acidity (TA), lactic acid and acetic acid contents but was negatively correlated with salinity. In contrast, the composition of the microbial community in paocai was negatively correlated with TA, lactic acid and acetic acid contents but was positively correlated with salinity. This study provides insights into the relationship between bacterial profiles and environmental factors in Chinese spicy cabbage and paocai, and its findings will aid in guiding future research on fermented vegetables.
Chlorpyrifos (CP) residues are absorbed from soil and often found in Korean cabbages that are being used to make kimchi. Lactobacillus sakei WCP904, harboring the organophosphorus (OP) hydrolase gene opdD, was isolated from CP-impregnated mulkimchi. The cloned gene opdD from strain CP904 comprises 825 base-pair nucleotides that encode 274 amino acids. The recombinant Escherichia coli harboring the opdD gene depleted 73% of CP after 6 days in M9 medium. In fact, the OpdD protein is a novel member of the GHSQG family of esterolytic enzymes or lactic acid bacterial Opd groups. The molecular weight of the OpdD protein was estimated to be 31 kDa using SDS-PAGE. Broad-spectrum activities of the OpdD protein were obtained against OP insecticides containing both P–O and P–S bonds. The OpdD protein exhibits maximum activity at 30 °C with pH 6. No enzyme activities of the mutated OpdD (Ser116 → Ala116) protein toward ρ-nitrophenyl butyrate and CP substrates were observed. These results suggested that the strain WCP904 scavenges insecticide residues from mulkimchi vegetables, thus abolishing health hazards by secreting OP hydrolase during fermentation.
In this study, with grass fish bones as the substrate, after flavourzyme treatment, and fermentation with Leuconostoc mesenteroides, the fermentation solution with the high content of soluble calcium was obtained. High performance liquid chromatography and GC-MS analysis indicated that free calcium (11.29 mmol/L) in the fermentation solution was composed of calcium lactate (3.89 mmol/L), calcium acetate (6.21 mmol/L), calcium amino acids and small peptide calcium. Animal experiments shows that the fermentation solution of grass fish bones could promote the growth and development of calcium-deficient rats. Complex organic calcium could be well absorbed and utilized by rats so that serum calcium, alkaline phosphatase levels, femur weight and other indicators in calcium-deficient rats could be returned to normal levels. The fermentation solution of grass fish bones can avoid the waste of aquatic proteins and fish bone calcium, and it exhibited high calcium bioavailability. Therefore, the fermentation solution of grass fish bones might be used as a new efficient calcium supplement.
With the continuous increase in the world's population, lactic acid fermentation plays a significant role in preserving foodstuffs for feeding humanity, especially in developing countries. However, several fermented fruit and vegetable products have a long history in human nutrition and are associated with different communities. Detection, differentiation, and identification of microorganisms including LAB are still intrinsically ambiguous when exclusively based on morphological, physiological, and biochemical characteristics. Recently, applications of molecular tools for identifying microbes and analyzing their activity have been explored. This chapter is the first review to answer many important questions, such as: Why do we need to use molecular tools to identify and differentiate LAB present in fermented fruits and vegetables? What are the pros and cons of different molecular methods for the detection of lactic acid bacteria?
GC-MS datasets coupled with multivariate statistical analysis were used to investigate metabolic changes in Kimchi during fermentation and metabolic differences in Kimchi added with various amounts (0, 1.25, 2.5, and 5%) of salts. PCA score plot obtained after 1 day of fermentation were clearly distinguishable by different salinity groups, implying that early fermentation speed varied according to Kimchi salinity. PLS-DA score plot from data obtained on the 50th day of fermentation also showed a clear separation, indicating metabolites of Kimchi were different according to salinity. Concentrations of lactic acid, acetic acid, and xylitol were the highest in Kimchi with 5% salinity while concentration of fumaric acid was the highest in Kimchi with 0% salinity. Rarefaction curves showed that numbers of operational taxonomic units (OTUs) in Kimchi with 5% salinity were higher than those in Kimchi with 0% salinity, implying that Kimchi with 5% salinity had more bacterial diversities. This study highlights the applicability of GC–MS based metabolomics for evaluating fermentative characteristics of Kimchi with different salinities.
To explore the function of probiotic bacteria in puer tea pile fermentation which was implemented by a symbiosis of many fermenting microbes and enzymes, the species, abundances and dynamics of probiotic bacteria were quantitatively investigated. Using the real-time quantitative PCR (qPCR) primers specifically targeting different genera bacteria, the results showed that Enterococcus spp., Lactococcus spp., Lactobacillus group and Bacillus spp. were all found at 0, 15, 30, and 45 days during the fermentation, but Bifidobacterium spp. was not involved throughout the fermentation. Furthermore, among these four genera, Lactococcus spp. was the predominant probiotic with population of 1.68 × 10⁹–2.78 × 10⁹ copy g⁻¹ in the fermentation, followed by Enterococcus spp. harboring 3.43 × 10⁴–6.25 × 10⁵ copy g⁻¹, and Lactobacillus group and Bacillus spp. had 4.26 × 10³–5.17 × 10⁴ and 2.21 × 10³–2.31 × 10⁵ copy g⁻¹, respectively. In addition, the dynamics of four genera probiotic bacteria and universal bacteria were explored to show completely different and complex change trends with no significant correlation with pH of tea and each other. Population dynamic studies of probiotic bacteria revealed their ecological feature and importance for puer tea pile fermentation, and also facilitated further exploration of probiotic resources and health benefits of puer tea.
The use of kefir coculture as a starter in the production of ricotta like cheese made from different types of milk was investigated. Total solids, total nitrogen, protein as well as fat/dry matter values were high on produced cheese made from buffalo's milk with kefir coculture in comparison with the same treatments made from cow and goat's milk with kefir coculture as a starter or the ricotta cheese made from buffalo's milk with yoghurt starter as a control. As well as that use of buffalo's milk for the making of ricotta like cheese affected the preference of the tasters and gained the tasters' preference compared to the other treatments. Overall, the use of kefir coculture suggested improvement of ricotta like cheese sensory characteristics and increased Total solids, total nitrogen, protein, fat in produced cheese. All samples of cheese were free from coliform group, staphylococcus spp., yeasts and alcohol. The microbial community composition of kefir grains was also investigated by culture-independent methods (PCR). The dominant microorganisms of kefir grains were Leuconostoc mesenteroides, Lactobacillus brevis, Lactobacillus plantarum, Lactococcus lactis, Kluyveromyces lactis, Streptococcus thermophilus, Saccharomyces cerevisiae, Pediococcus pentosaceus and Lactobacillus pentosus.
Lactic acid can induce sublethal injury of Escherichia coli. When conditions become favorable, injured E. coli can recover physiological function and fully virulence, which is a great concern in the field of food safety. The injury and recovery of E. coli O157:H7 and K-12 by lactic acid were investigated in this study. Sublethally injured E.coli cells widely persisted after a 60-min exposure to lactic acid with different pH values (E.coli O157:H7: pH 3.0-4.6, E.coli K-12: pH 3.4-5.0). The sublethally injured ratio of E. coli O157:H7 and K-12 by lactic acid decreased as incubation temperature decreasing. Both sublethally injured E. coli O157:H7 and K-12 induced by lactic acid could be completely recovered in trypticase soy broth at 37°C within 60 min. For both E. coli O157:H7 and K-12, sodium pyruvate, Tween 80, or certain cations (Mn, Fe, or Zn) could significantly increase the recovery ratio. The recovery ratios of injured E.coli K-12 and O157:H7 were only 74.2% and 92.6% after 80 min incubation in minA, respectively. But they can both be completely recovered within 80 min in minA with sodium pyruvate, with Tween 80, or with cations (Mn, Fe, or Zn). But Mg and Ca cations did not affect the recovery time. The understanding of injury and recovery of E. coli could contribute to develop effective decontaminating treatment by lactic acid, and develop techniques for detecting sublethally injured E. coli cells.
The role of kimchi probiotic bacteria in reducing the amounts of N-nitrosodimethylamine (NDMA) and its precursors occurring in the kimchi-making process and digestion was assessed using Leuconostoc carnosum (LEC), Leuconostoc mesenteroides (LEM), Lactobacillus plantarum (LP), and Lactobacillus sakei (LS) grown in MRS broth containing NDMA or its precursors. The results showed that the four bacteria could directly deplete NDMA and nitrite levels in the MRS broth, and this effect was more pronounced in the presence of LP and LS than in LEC and LEM. The concentration of NDMA and its precursors (nitrite, dimethylamine, and biogenic amine) were significantly reduced in bacteria-fortified kimchi compared with the control kimchi, the extent of which depended on the respective bacterial load. Endogenous formation of NDMA by precursors in bacteria-fortified kimchi was demonstrated under simulated gastric digestion. Following digestion, the bacteria-fortified kimchi inhibited NDMA formation. These results suggest that probiotic bacteria may cause a significant decrease in NDMA occurring in kimchi, possibly by direct degradation and inhibition of NDMA formation. Therefore, such lactic acid bacteria could be used in the kimchi-making process to reduce NDMA levels, with an emphasis on LP as it exerted a greater reduction in NDMA concentration in the bacteria-fortified kimchi.
To investigate whether lactic acid bacteria (LAB) play a role in reducing the concentrations of N-nitrosodimethylamine (NDMA) and its precursors during kimchi production, experimental kimchi prepared with added Lactobacillus sakei, Lactobacillus curvatus, and Lactobacillus brevis was periodically monitored for 20 days to analyze the concentrations of NDMA, nitrite, dimethylamine (DMA), nitrate, and biogenic amines. LAB species in MRS broth with and without NDMA or NaNO2 were grown and NDMA and nitrite concentrations studied. The amounts of NDMA, nitrite, DMA, nitrate, and biogenic amines remaining in the LAB-fortified kimchi decreased significantly relative to that of the control kimchi. The effects of L. sakei and L. curvatus on the reduction of NDMA concentration in kimchi were higher than that of L. brevis. These LAB species might be indirectly reducing the amounts of NDMA in LAB-fortified kimchi by inhibiting the formation of NDMA precursors originating from kimchi. Interestingly, LAB were found to directly degrade NDMA during culture in MRS broth containing NDMA.
The aim of this study is to investigate the change in flavonoid composition and antioxidative activity during fermentation of onion (Allium cepa L.) by Leuconostoc mesenteroides with different NaCl concentrations. In order to qualify and quantify the flavonoids during fermentation of onion, 7 flavonoids, [quercetin 3,7-O-β-d-diglucopyranoside (Q3,7G), quercetin 3,4'-O-β-d-diglucopyranoside (Q3,4'G), quercetin 3-O-β-d-glucopyranoside (Q3G), quercetin 4'-O-β-d-glucopyranoside (Q4'G), isorhamnetin 3-O-β-d-glucopyranoside (IR3G), quercetin (Q), and isorhamnetin (IR)], were isolated and identified from onion. During fermentation, the contents of flavonoid glucosides (Q3,7G, Q3,4'G, Q3G, Q4'G, and IR3G) gradually decreased, whereas the contents of flavonoid aglycones (Q, IR) gradually increased. Decline rates of the flavonoid glucosides increased with the addition of L. mesenteroides. Furthermore, the activity of β-glucosidase, which is produced by L. mesenteroides, is dose-dependently inhibited with different NaCl concentrations during fermentation. The presence of L. mesenteroides enhanced the antioxidative activity of onion as demonstrated using the 1,1-diphenyl-2-picrylhydrazyl, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), and reducing power assays. The enhancement of antioxidative activity was considered because the content of flavonoid aglycones increased during fermentation. However, the addition of NaCl may decrease the antioxidative activity; we surmise that this phenomenon occurs because of the inhibition of β-glucosidase by NaCl. Therefore, we conclude that the addition of NaCl may be useful for the regulation of antioxidative activity via the control of β-glucosidase action, during the fermentation of flavonoid glucoside-rich foods.
Probiotics have been defined as living microorganisms. They may promote the ecological balance of intestinal bacteria that exert beneficial effects on the health and/or physiological function of the host. In this paper, the concept of probiotics, the history of their development, their applications in foods especially the use in the fermented fruit and vegetable products, as well as the current research status of the key techniques of the fruit and vegetable products fermented by using probiotics are reviewed. The potential problems and possible research directions in this field in the future are also addressed. ©, 2014, Chinese Institute of Food Science and Technology. All right reserved.
The purpose of this research is to draw the bacterial community difference between Korean and Chinese kimchi for future use in the confirmation of kimchi origin. Initial fermentation stage kimchi samples (above pH 5) were used for the analysis of bacterial diversity. From 26 Korean kimchi samples, 1,017 strains in the 45 genera and from 22 Chinese kimchi samples, 842 strains in the 54 genera were isolated with use of marine medium, nutrient medium, succinate minimal medium (SMM), leuconostocs selective medium (LUSM) agars. In the order of isolated numbers, Bacillus, Weissella, Leuconostoc, Pseudomonas, and Lactobacillus genera and Bacillus, Weissella, Lactobacillus, Pseudomonas, Serratia, and Enterobacter genera were predominated in Korean and Chines kimchi, respectively. Among the isolated lactic acid bacteria, Weissella spp. were isolated most dominantly owing to the biased growth of Weissella spp. on LUSM agar. Species in the genera Leuconostoc and Lactobacillus were the next frequently isolated LAB from Korean and Chinese kimchi, respectively. Weissella confusa was isolated only from Korean kimchi and W. soli and Serratia proteamculans were isolated only from Chinese kimchi. They have a possibility to be used as target bacteria to differentiate Korean kimchi from Chinese kimchi.
Potential of kimchi lactic acid bacteria (LAB) isolates to produce volatile phenols and factors affecting their phenolic acid decarboxylase (padA) gene expression profiles were investigated in this study. Twelve percent (12%) of 50 tested LAB isolates were found to decarboxylate hydroxycinnamic acids. All six isolates were identified as Lactobacillus plantarum and possessed the padA gene. The highest padA expression was achieved on the third day of incubation with ferulic acid, with a relative expression of 3.30. ±. 0.32. The effects of glucose, substrate, and product concentrations, and the pH of the medium were investigated using response surface methodology for the first time in this study. The expression profiles of the padA gene were diverse in various stress environments. The concentration of p-coumaric acid was the most significant factor being positively correlated with the expression levels of the padA gene, but other factors did not show any significant effects. High concentrations of substrates could confer antibacterial activity. Therefore, decarboxylation reaction was suggested as a bacterial response to overcome the antibacterial activity. The phenolic acid decarboxylase activities of L. plantarum isolates found in this study can provide insights for their potential application in the development of food-grade flavors and additives.
My PhD dissertation: using flavor chemistry to investigate novel and understudied gastronomic ideas, and building and using new instruments for flavor chemistry
The intestinal lactic acid microflora of the edible snail Cornu aspersum was studied by culture-based methods and was phenotypically and molecularly characterized. The antibacterial activity of lactic acid bacteria (LAB) isolates was investigated. Snails in different stages of development were collected from farms located in several regions of Bulgaria. One hundred twenty-two isolates, belonging to the group of LAB, were characterized morphologically and were divided into four groups. Representative isolates from each morphological type were subjected to phenotypic characterization and molecular identification. The snail gut lactic acid microflora was composed by Enterococcus (17 isolates), Lactococcus (12 isolates), Leuconostoc (7 isolates), Lactobacillus (18 isolates) and Weissella (1 isolate). The species affiliation of Lactococcus lactis (12), Leuconostoc mesenteroides (4) and Lactobacillus plantarum (2) was confirmed by species-specific primers. The Lactobacillus isolates were identified by sequence analysis of 16S rDNA as Lactobacillus brevis (12), L. plantarum (2), Lactobacillus graminis (1) and Lactobacillus curvatus (3). The species L. brevis, L. graminis and L. curvatus were found in snails in a phase of hibernation, whereas L. plantarum was identified both in active and hibernation phases. Antibacterial activity (bacteriocine-like) was shown only by one strain of L. mesentereoides P4/8 against Propionibacterium acnes. The present study showed that the LAB are a component of the microbial communities in the snail digestive system. This is the first report on Lactobacillus strains detected in the gut of C. aspersum.
Lactic acid bacteria (LAB) are naturally found in fermented vegetable products. The ability of 230 kimchi bacterial isolates was investigated to produce tyramine by biochemical and genetic methods. The production of tyramine was determined by thin-layer chromatography (TLC) and high-performance liquid chromatography (HPLC). The presence of the gene encoding the corresponding tyrosine decarboxylase was also determined by PCR assay. After the production of tyramine was confirmed by chromatographic and molecular methods, the bacterial isolates producing the amine were identified by 16S rRNA gene sequence and species-specific PCR analyses. Only a small proportion of the bacterial isolates (14/230 isolates) decarboxylated tyrosine in vitro. All of the 14 bacterial isolates that produced tyramine were shown to possess the tdc gene, indicating that a positive correlation existed between the production of tyramine and the presence of the corresponding decarboxylase gene. The 14 isolates included three LAB species and one other species: Lactobacillus brevis (six), Lactobacillus curvatus (four), Leuconostoc mesenteroides (two), and Staphylococcus hominis (two). This study demonstrated that only a small proportion of LAB and other microbiota growing in kimchi had the ability to produce tyramine.
Lactic acid bacterial diversity and the composition of individual bacterial communities during the fermentation of mulkimchi were examined using a polymerase chain recation (PCR)-based approach. Based on 16S rRNA sequence similarity values, a total of fifteen different lactic acid bacterial species were found in eight sampling sites, including Lactobacillus alimentarius, Lactobacillus brevis, Lactobacillus farciminis, Lactobacillus fabifermentans, Lactobacillus nantensis, Lactobacillus parabrevis, Lactobacillus plantarum, Lactobacillus versnoldensis, Lactobacillus zymae, and Lactobacillus sp., Leuconostoc pseudomesenteroides, Weissella cibaria, Weissella confusa, and Weissella sp. The prevalence of We. cibaria, belonging to the Weissella genus, was the highest (86.7%) at 0 h (initial stages) and gradually decreased at 72 h (rancid stage). In contrast, La. plantarum was observed at 36 h (16.7%, over-ripening stage) and gradually increased up to 84 h (70.0%, rancid stage) during mulkimchi fermentation. We. cibaria was found to be associated with the microorganisms that were present during the initial stage of fermentation, whereas La. plantarum was associated with the production of lactic acid in the over-ripening and rancid stages during fermentation at 30°C±2.
Presumptive lactic acid bacteria (LAB) were isolated from 20 kimchi samples (total of 230 isolates) and screened for their capacity to synthesize γ-aminobutyric acid (GABA). Only 68 isolates (ca. 30%) showed this activity and were identified by a polyphasic approach consisting of morphological characteristics, catalase and biochemical tests, and species-specific polymerase chain reaction and 16S rRNA gene sequence analyses. Five species were found, including Lactobacillus plantarum (55 isolates), Lactobacillus brevis (six), Leuconostoc mesenteroides (four), Leuconostoc lactis (one), and Weissella viridescens (two). The 68 GABA-producing LAB isolates were isolated from only 11 among 20 kimchi samples indicating that they were not evenly distributed. This is the first report on the isolation of two species of Leuconostoc (Le. mesenteroides and Le. lactis) and one species of Weissella (Ws. viridescens) from kimchi with the capacity to synthesize GABA under in vitro conditions. Additionally, in previous screening results, Le. lactis and Ws. viridescens with the capacity to synthesize GABA isolated and identified from fermented food source were not observed.
Pickled mustard tuber is a traditional Chinese food preserved by high-salinity pickling process. A cleaner production technique of pickling mustard tuber process has been widely focused on the pickled fermentation with a low salt concentration. The objective of this present study was to determine the microbial community structure and its predominant functional species by single strand conformation polymorphism (SSCP) profiles under the optimizing pickling conditions with low salinity. Effects of SSCP conditions on gel electrophoresis assay as well as changes of lactic acid bacteria (LAB) population were also investigated. Results: Twenty two percent of gel concentration and addition of 6% glycerol in gel preparation for electrophoresis separation were ideal conditions for SSCP analysis of microbial community in pickled mustard tuber. The pH value in leaching liquid was descending throughout the pickling process and the total LAB population increased, reached the peak of 7.51 log cfu mL -1 at day 10 by plate counting then decreased gradually until to a stable level. With the optimal SSCP technique, 11 distinct dominant bands were obtained throughout the fermentation process of mustard tuber. Based on the sequence comparison the results showed that Leuconostoc mesenteroides was the predominant microorganism in the initial stage of fermentation. Then the Lactobacillus plantarum and Lactobacillus brevis appeared quickly. At the later stage, the predominant species were Lactobacillus plantarum and Lactobacillus versmoldensis. Conclusions: SSCP technique is a feasible method for microbial community analysis in pickled mustard tuber. Gel concentration and addition of glycerol in gel for electrophoresis operation had influences on the SSCP pattern performance for microbial community analysis of pickled samples. The contribution of some dominant LAB species was confirmed by SSCP method under the optimized processing condition of pickled mustard tuber.
Leek (Allium ampeloprasum var. porrum) is one of Belgium's most important vegetables. All or part of the green leek parts are often left on the fields because of their limited cooking applications compared to the white leek parts. Therefore, the possibility to perform leek fermentations in view of product valorization and diversification was investigated. This study deals with the community dynamics, species diversity, and metabolite kinetics of spontaneous leek fermentations, thereby studying the influence of added NaCl concentration, harvesting season, and duration of the fermentation. The combination of a culture-dependent and culture-independent approach revealed the prevalence of lactic acid bacteria (LAB) from the third day of fermentation onwards, which was not influenced by the fermentation conditions applied. Enterobacteriaceae, Pseudomonadaceae, and yeasts disappeared after one week of fermentation. Leuconostoc mesenteroides, Lactobacillus sakei, and Lactobacillus plantarum, Lactobacillus brevis, and Lactobacillus parabrevis were the most frequently isolated LAB species. Both added NaCl concentrations were suitable to perform successful fermentations within three weeks. By that time, glucose and fructose, the main leek carbohydrates, were metabolized into mainly lactic acid, acetic acid, ethanol, and mannitol. A sensory analysis revealed that the fermented white leek parts were generally more appreciated than the fermented green leek parts.
BACKGROUND: Artisanal vegetable fermentations are very popular in Eastern European countries. Fresh vegetables undergo a spontaneous fermentation in the presence of salt, which is mainly carried out by lactic acid bacteria (LAB).
RESULTS: Culture-dependent and culture-independent analyses of end-samples of various spontaneous vegetable fermentations carried out in houses of the Chiodju region (central Romania) revealed Lactobacillus plantarum and Lactobacillus brevis as the most frequently isolated LAB species. Leuconostoc mesenteroides and Leuconostoc citreum were also found. Furthermore, the community dynamics of spontaneous cauliflower and mixed-vegetable (green tomatoes, carrots and cauliflower) fermentations revealed three steps: an initial phase characterised by the presence of Enterobacteriaceae and a wide LAB species diversity, encompassing Weissella species; a second phase from day 3 onwards wherein L. citreum and Lb. brevis occurred; and a final phase characterised by the prevalence of Lb. brevis and Lb. plantarum. Metabolite target analysis revealed that glucose and fructose were mostly depleted at the end of fermentation. The main products of carbohydrate metabolism were lactic acid, acetic acid, ethanol and small amounts of mannitol, indicating heterolactate fermentation.
CONCLUSION: Given their prevalence at the end of vegetable fermentations, Lb. brevis and Lb. plantarum appear to be good candidate starter cultures for controlled vegetable fermentation processes.
Two whey culture supernatants of CJNU 0147 and CJNU 0400 were found to effectively enhance the growth of Bifidobacterium longum FI10564 by 1.58 fold compared to non-fermented whey medium. The 2 isolates were identified to be Leuconostoc mesenteroides (99% identity) by 16S rRNA gene sequence analysis. To determine whether the whey culture supernatant of CJNU 0147 selectively
stimulate the growth of bifidobacteria, the growth rates of Escherichia coli DH5α, Enterococcus faecalis KFRI 675, Listeria monocytogenes ATCC 19111, and Staphylococcus aureus ATCC 14458 with the supernatant were measured. In these experiments, the supernatant slightly inhibited the growths of bacteria
except for E. coli, indicating that the whey culture supernatant had very little influence on the growth of these bacterial strains.
Keywords
Leuconostoc mesenteroides
-bifidogenic growth stimulator-whey fermentation-bifidobacteria
Kimchi fermentation usually relies upon the growth of naturally-occurring various heterofermentative lactic acid bacteria (LAB). This sometimes makes it difficult to produce kimchi with uniform quality. The use of Leuconostoc mesenteroides as a starter has been considered to produce commercial fermented kimchi with uniform and good quality in Korea. In this study, a combination of a barcoded pyrosequencing strategy and a (1)H NMR technique was used to investigate the effects of Leu. mesenteroides strain B1 as a starter culture for kimchi fermentation. Baechu (Chinese cabbage) and Chonggak (radish) kimchi with and without Leu. mesenteroides inoculation were prepared, respectively and their characteristics that included pH, cell number, bacterial community, and metabolites were monitored periodically for 40 days. Barcoded pyrosequencing analysis showed that the numbers of bacterial operational taxonomic units (OTU) in starter kimchi decreased more quickly than that in non-starter kimchi. Members of the genera Leuconostoc, Lactobacillus, and Weissella were dominant LAB regardless of the kimchi type or starter inoculation. Among the three genera, Leuconostoc was the most abundant, followed by Lactobacillus and Weissella. The use of Leu. mesenteroides as a starter increased the Leuconostoc proportions and decreased the Lactobacillus proportions in both type of kimchi during kimchi fermentation. However, interestingly, the use of the kimchi starter more highly maintained the Weissella proportions of starter kimchi compared to that in the non-starter kimchi until fermentation was complete. Metabolite analysis using the (1)H NMR technique showed that both Baechu and Chonggak kimchi with the starter culture began to consume free sugars earlier and produced a little greater amounts of lactic and acetic acids and mannitol. Metabolite analysis demonstrated that kimchi fermentation using Leu. mesenteroides as a starter was completed earlier with more production of kimchi metabolites compared to that not using a starter, which coincided with the decreases in pH and the increases in bacterial cell number. The PCA strategy using all kimchi components including carbohydrates, amino acids, organic acids, and others also showed that starter kimchi fermented faster with more organic acid and mannitol production. In conclusion, the combination of the barcoded pyrosequencing strategy and the (1)H NMR technique was used to effectively monitor microbial succession and metabolite production and allowed for a greater understanding of the relationships between the microbial community and metabolite production in kimchi fermentation.
Bacteriophage Sha1, a newly isolated temperate phage from a mitomycin-C-induced lysate of Lactobacillus plantarum isolated from Kimchi, has an isometric head (58 nm × 60 nm) and a long tail (259 nm × 11 nm). The double-strand DNA genome of the phage Sha1 was 41,726 base pairs (bp) long, with a G+C content of 40.61%. Bioinformatic analysis of Sha1 shows that this phage contains 58 putative open reading frames (ORFs). Sha1 can be classified as a member of the large family Siphoviridae by genomic structure and morphology. To our knowledge, this is the first report of genomic sequencing and characterization of temperate phage Sha1 from wild-type L. plantarum isolated from kimchi in Korea.
We recently identified Leuconostoc gelidum, a typical psychrophile, as a microbial component from kimchi that has been laboratory-prepared and fermented at 20°C. However, it has been shown that the growth of leuconostocs in food products is highly influenced by fermenting temperature. To determine the distribution of L. gelidum species in kimchi fermented at a lower temperature, 8°C, we characterized a total of 64 dextran-forming strains isolated from kimchi using a polyphasic method including 16S rDNA sequencing and DNA-DNA hybridization. We found that 80% of the isolates were L. gelidum, which has been found mainly at chill-stored meat products. We also found that L. gelidum could be a dominant Leuconostoc species in so-called Kimjang kimchi, which is traditionally prepared at late fall to be preserved during winter in Korea. These results suggest that L. gelidum can be a predominant species in kimchi especially when fermented at low temperature.
The application of recombinant DNA technology to prenatal diagnosis of many recessively inherited X-linked diseases is complicated
by a high frequency of heterogenous, new mutations (1). Partial gene deletions account for more than 50% of Duchenne muscular
dystrophy (DMD)) lesions, and approximately one-third of all cases result from a new mutation (2-5). We report the isolation
and DNA sequence of several deletion prone exons from the human DMD gene. We also describe a rapid method capable of detecting
the majority of deletions in the DMD gene. This procedure utilizes simultaneous genomic DNA smplification of multiple widely
separated sequences and should permit deletion scanning at any hemizygous locus. We demonstrate the application of this multiplex
reaction for prenatal and postnatal diagnosis of DMD.
In this study, we succeeded in differentiating Lactobacillus plantarum, Lactobacillus pentosus, andLactobacillus paraplantarum by means ofrecA gene sequence comparison. Short homologous regions of about 360 bp were amplified by PCR with degenerate consensus primers,
sequenced, and analyzed, and 322 bp were considered for the inference of phylogenetic trees. Phylograms, obtained by parsimony,
maximum likelihood, and analysis of data matrices with the neighbor-joining model, were coherent and clearly separated the
three species. The validity of the recA gene and RecA protein as phylogenetic markers is discussed. Based on the same sequences, species-specific primers were designed,
and a multiplex PCR protocol for the simultaneous distinction of these bacteria was optimized. The sizes of the amplicons
were 318 bp for L. plantarum, 218 bp for L. pentosus, and 107 bp for L. paraplantarum. This strategy permitted the unambiguous identification of strains belonging to L. plantarum, L. pentosus, and L. paraplantarum in a single reaction, indicating its applicability to the speciation of isolates of the L. plantarum group.
To determine the dominant microorganisms involved in kimchi fermentation and to examine their effect on kimchi fermentation, we randomly isolated and characterized 120 lactic acid bacteria from kimchi during a 5-day fermentation at 15 degrees C. Leuconostoc citreum was dominant during the early and mid-phases of kimchi fermentation whereas Lactobacillus sake/Lactobacillus curvatus or Lactobacillus brevis were found during later stages. Eighty-two out of 120 isolates (68%) were identified as Leuconostoc citreum by means of a polyphasic method, including 16S rDNA sequencing and DNA/DNA hybridization. A few Weissella confusa-like strains were also isolated during the mid-phase of the fermentation. Strain IH22, one of the Leuconostoc citreum isolates from kimchi, was used as an additive to evaluate growth and acid production in kimchi fermentation. This strain was consistently over 95% of the population in IH22-treated kimchi over a 5-day fermentation, while heterogeneous lactic acid bacteria were observed in the control kimchi. The pH in IH22-treated kimchi dropped rapidly but was stably maintained for 5 days, compared to its slow and prolonged decrease in the control kimchi. These results indicate that Leuconostoc citreum IH22 dominates over and retards the growth of other lactic acid bacteria in kimchi, suggesting it can be used as a bacterial starter culture to maintain the quality of kimchi for prolonged periods.
A multiplex PCR assay was developed to identify the six clinically important enterohemorrhagic Escherichia coli (EHEC) serotypes classified in seropathotypes A and B and to differentiate these from Shiga toxigenic E. coli. The assay simultaneously detects genes for Shiga toxin (stx) and intimin (eae), including allelic variants of both genes, 16S internal amplification control, as well as unique sequences in the wzx genes that are specific for serotypes O157, O26, O111, O103, O121 and O145. PCR analysis of 40 representative strains showed that the assay correctly identified the virulence genes, if present, and the respective O antigen type of all the strains, including some atypical EHEC, as well as enteropathogenic E. coli and E. coli strains examined.
A rapid and reliable PCR-based method was developed to distinguish three species that are closely related both physiologically and genotypically: Lactobacillus plantarum, Lb. pentosus, and Lb. paraplantarum. A primer for Lb. plantarum was designed from the species-specific sequence in the 16S/23S rDNA spacer region, and two specific primer pairs for Lb. pentosus and Lb. paraplantarum were complementary to species-specific sequences in the recA gene of each species. The primers allowed the specific detection and identification of each species, and were successfully applied to the detection of each species in kimchi. Lb. plantarum and Lb. paraplantarum were detected in all kimchi samples tested but Lb. pentosus was not detected. In addition, multiplex PCR performed with combinations of each primer pair enabled the simultaneous detection of Lb. plantarum with either Lb. pentosus or Lb. paraplantarum.
A polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) technique was used to determine the microfloral composition during the fermentation of kimchi, a traditional Korean fermented vegetable food. The kimchi was fermented at 10 degrees C or 20 degrees C for 30 or 20 days, respectively. DGGE of the partially amplified 16S rDNA was performed and the most intense bands sequenced. The application of this culture-independent molecular technique determined that the lactic acid bacteria Weissella confusa, Leuconostoc citreum, Lactobacillus sakei, and Lactobacillus curvatus were the main microorganisms responsible for kimchi fermentation. (c) 2005 Elsevier B.V. All rights reserved.
The genus Leuconostoc is generally recognized as a favorable microorganism associated with a good taste of Kimchi and Lactobacillus plantarum is responsible for the overripening and acidification of Kimchi. A rapid and reliable PCR-based method to monitor the change of these lactic acid bacterial populations during Kimchi fermentation was attempted. A Leuconostoc-specific primer set was chosen from the conserved sequences of 16S rRNA genes among Leuconostoc species. The Lb. plantarum-specific primer set was the internal segments of a Lb. plantarum-specific probe which was isolated after randomly amplified polymorphic DNA (RAPD) analysis and tested for identification. The specificity of this protocol was examined in DNA samples isolated from a single strain. In agarose gel, as little as 10 pg of template DNA could be used to visualize the PCR products, and quantitative determination was possible at the levels of 10 pg to 100 ng template DNA. For the semi-quantitative determination of microbial changes during Kimchi fermentation, total DNAs from the 2 h-cultured microflora of Kimchi were extracted for 16 days and equal amounts of DNA templates were used for PCR. The intensities of DNA bands obtained from PCR using Leuconostoc-specific and Lb. plantarum-specific primer sets marked a dramatic contrast at the 1 ng and 100 ng template DNA levels during Kimchi fermentation, respectively. As the fermentation proceeded, the intensity of the band for Leuconostoc species increased sharply until the 5th day and the levels was maintained until the 11th day. The sharp increase for Lb. plantarum occurred after 11 days with the decrease of Leuconostoc species. The results of this study indicate that Leuconostoc species were the major microorganisms at the beginning of Kimchi fermentation and reach their highest population during the optimum ripening period of Kimchi.
To effectively investigate the identification and distribution of the lactic acid bacteria in Kimchi, polyphasic methods, including a PCR, SDS-PAGE of the whole-cell proteins, and 16S rRNA gene sequence analysis, were used. In various types of Kimchi fermented at 20°C, the isolate KHU-31 was found to be the predominant lactic acid bacteria. This isolate was identified as Lactobacillus sake KHU-31, based on SDS-PAGE of the whole-cell proteins and a 16S rRNA gene sequence analysis, which provided accurate and specific results. Accordingly, the approach used in the current study demonstrated that Lactobacillus sake KHU-31, together with Leuconostoc mesenteroides, were the most predominant lactic acid bacteria in all types of Kimchi in the middle stage of fermentation at 20°C.
Despites many attempts to explore the microbial diversity in kimchi fermentation, the predominant flora remains controversial to date. In the present study, major lactic acid bacteria (LAB) were investigated in Chinese cabbage kimchi in the early phase of fermention. For the samples over pH 4.0, viable cell counts of Leuconostoc and Pediococcus were 106 cfu/ml and below 102 cfu/ml, respectively, and 20 isolates out of 172 were subjected to a biochemical identification (API 50 CH kit) as well as molecular-typing methods including ITS-PCR with a RsaI digestion and 16s rRNA gene sequence analysis for species confirmation. Seven isolates were nicely assigned to Lb. brevis, 6 to Leuconostoc spp. (2 mesenteroides, 2 citreum, 1 carnosum, 1 gasicomitatum), 4 to Weissella (3 kimchii/cibaria, 1 hanii) and 2 to other Lactobacillus spp. (1 farciminis, 1 plantarum). On the other hand, the biochemical identification data revealed 9 strains of Lb. brevis, 6 strains of Leuconostocs, 2 strains of Lb. plantarum and 1 strain each of Lb. coprophilus and Lactococcus lactis. However, a single isolates, YSM 16, was not matched to the ITS-PCR database constructed in the present study. Two Lb. brevis strains by API 50 CH kit were reassigned to W. kimchii/cibaria, Lb. coprophilus or W. hanii, respectively, judging from the results by the above molecular typing approaches. As a whole, the identification data obtained by the biochemical test were different from those of ITS-PCR molecular method by about 63% at genus-level and 42% at species-level. The data by the ITS-PCR method conclusively suggest that predominant LAB species is probably heterolactic Lb. brevis, followed by W. kimchii/cibaria, Leuc. mesenteroides, and Leuc. citreum, in contrast to the previous reports [3] that Leuc. mesenteroides is the only a predominant species in the early phase kimchi fermentation.
Commercially packed kimchi products from 6 different manufacturers, which are exported overseas as well as sold domestically, were analyzed to determine their microorganism distributions and presence of pathogenic bacteria. All samples showed decreasing pH levels (from 5.7-6.2 to 3.9-4.3) and increasing titratable acidities (from 0.3-0.4 to 0.8-1.2%) during 15 days of storage at 4°C. Total bacterial counts ranged from 2.1× 105-1. 9×106 CFU/mL in the initial kimchi samples, and then increased to 1.1×108-1.8×109CFU/mL. The coliform numbers decreased from approximately 2.5×102-1.7×104 CFU/mL to zero. Major foodborne pathogens such as Salmonella spp., Staphylococcus aureus, Escherichia coli O157:H7, Listeria monocytogenes, Bacillus cereus, Yersinia enterocolitica, and Shigella spp. were not detected in any of the samples. However, 2 out of the 6 samples carried E. coli, emphasizing the need for improved hygiene practice. Interestingly, Hafhia alvei, belonging to the Enterobacteriaceae family, was isolated in all of the samples. Further study is needed on this newly reported bacterium in kimchi.
The small subunit rRNA sequences of 55 species of the genus Lactobacillus were determined by reverse transcription in an attempt to elucidate their natural interrelationships. Comparative analysis of the sequence data revealed the presence of 3 phylogenetically distinct clusters. Cluster 1 (designated) the L. delbrueckii group) included L. delbrueckii the type species of the genus and 11 other obligately homofermentative species. Cluster 2 (designated the L. casei group) comprised 32 Lactobacillus species and 5 Pediococcus species (including P. damnosus, the type species of the genus). With the exception of 5 obligately homofermentative species (L. animalis, L. ruminis, L. salivarius, L. sharpeae, L. yamanashiensis) most members of cluster 2 were heterofermentative. Cluster 3 (designated the Leuconostoc paramesenteroides group) included the atypical heterofermentative lactobacilli, L. confusus L. kandleri, L. minor, L. viridescens and Leu. paramesenteroides.
The sequence data clearly demonstrate that the genus Lactobacillus as presently constituted is phylogenetically very heterogeneous. Further, the rRNA groups identified in the present study do not correspond to the classical division of Lactobacillus into the subgenera Thermobacterium, Streptobacterium and Betabacterium established on the basis of phenotype.
A Gram-positive, catalase-negative, facultatively anaerobic, coccus-shaped bacterium, designated IH25T, was isolated from kimchi, a traditional Korean vegetable product. Phylogenetic analysis based on almost complete 16S rDNA sequences placed the isolate in a monophyletic clade corresponding to the genus Leuconostoc. All validly described species in the genus Leuconostoc, with the exception of Leuconostoc fallax, showed high sequence identity of over 97%. The 16S rDNA sequence of strain IH25T showed the highest homology to those of Leuconostoc gelidum DSM 5578T (98.9%) and Leuconostoc citreum KCTC 3526T (98.3 %). However, DNA-DNA hybridization experiments indicated that the organism represents a novel genomic species in the genus, since the previously known leuconostocs share DNA homology with strain IH25T of less than 70%. In this work, it is proposed that isolate IH25T be classified in the genus Leuconostoc as Leuconostoc kimchii sp. nov. The type strain of Leuconostoc kimchii is IH25T (= KCTC 2386T = IMSNU 11154T).
Using a sensitive and rapid method combining broad-range PCR amplification of bacterial 16S rDNA fragments and pyrosequencing for detection, identification and typing, we have found contaminating bacterial DNA in our reagents used for PCR. Identified bacteria are the water-borne bacterial genera Pseudomonas, Stenotrophomonas, Xanthomonas, Ralstonia and Bacillus. Our results are in concordance with recent reports of contaminated industrial water systems. In light of this conclusion, we believe that there is a need for increased awareness of possible contamination in uncertified widely used molecular biology reagents, including ultra-pure water. Since sequence-based 16S rDNA techniques are used in a variety of settings for bacterial typing and the characterization of microbial communities, we feel that future certification of molecular biology reagents, as free of nucleic acids, would be advantageous.
A polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) technique was used to determine the microfloral composition during the fermentation of kimchi, a traditional Korean fermented vegetable food. The kimchi was fermented at 10 degrees C or 20 degrees C for 30 or 20 days, respectively. DGGE of the partially amplified 16S rDNA was performed and the most intense bands sequenced. The application of this culture-independent molecular technique determined that the lactic acid bacteria Weissella confusa, Leuconostoc citreum, Lactobacillus sakei, and Lactobacillus curvatus were the main microorganisms responsible for kimchi fermentation.
Kimchi is a traditional Korean food fermented from a variety of vegetables. We elucidated the microbial community structure of five commercially produced kimchis made from Chinese cabbage by examining culture-independent 16S rRNA gene clone libraries. Most of the clones (347 out of 348) belonged to lactic acid bacteria and included several species of the genera Lactobacillus, Leuconostoc and Weissella. Weissella koreensis was found in all the samples and predominated in three of them (42.6-82%). Leuconostoc gelidum, Leuconostoc gasicomitatum and Lactobacillus sakei were common in the remaining kimchi clone libraries (>34%). The composition of bacterial phylotypes in kimchi varied between samples. Our approach revealed different community structures from those reported in previous culture-dependent studies based on phenotypic identification methods. The culture-independent method used here proved to be efficient and accurate and showed that the bacterial communities in kimchi differ from those in other fermented vegetable foods.
Lactic acid bacteria are known to perform significant roles in the fermentation of kimchi, a fermented cabbage product. However, the microbial population dynamics inherent to kimchi fermentation remain to be clearly elucidated. In this study, we have characterized the microbial dynamics via the identification of a total of 970 bacterial isolates, representing 15 species of the genera Lactobacillus, Leuconostoc, and Weissella, all of which were primarily identified by PCR-based restriction enzyme analysis. These population dynamics appear to be influenced markedly by fermentation temperature. Distinct biphasic microbial growth was observed with preliminary 2-day incubation at 15 degrees C, conducted before main fermentation at -1 degrees C. Leuconostoc citreum, as well as Leuconostoc gasicomitatum, predominated during the first growth phase, whereas Weissella koreensis predominated during the second phase. By way of contrast, with preliminary 4-day incubation at 10 degrees C, only W. koreensis grew rapidly from the beginning of the process. Therefore, our findings suggest that a short incubation at 15 degrees C enhances the growth of the less psychrophilic Leuconostoc species, including Lc. citreum, thus delaying the growth of the predominant W. koreensis, which is a more adaptive species at -1 degrees C.
Regarding food safety, rapid detection of microbial species is crucial to develop effective preventive and/or adjustment measures. Classical methods for determining the presence of certain species are time-consuming and labor-intensive, hence, molecular methods, which offer speed, sensitivity and specificity, have been developed to address this problem. Multiplex PCR (MPCR) is widely applied in the various fields of microbiology for the rapid differentiation of microbial species without compromising accuracy. This paper describes the method and reports on the state-of-the-art application of this technique to the identification of microorganisms vehiculated with foods and beverages. The identification of both pathogens and probiotics and the species important for food fermentation or deterioration will be discussed. Applications of MPCR in combination with other techniques are also reviewed. Potentials, pitfalls, limitations and future prospects are summarised.
A single step novel multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of human filarial parasites, Brugia malayi and Wuchereria bancrofti, from blood samples and mosquitoes. The primers used were novel and have been tested with the parasite DNA amplifying 188bp (BM) and 129bp (WB) DNA fragments, specific to B. malayi and W. bancrofti, respectively, in a single reaction. The specificity of the PCR product was confirmed by DNA sequencing and slot blot hybridization assay. The test was found highly sensitive for both B. malayi and W. bancrofti by detecting the parasitaemia up to the level of one microfilaria per reaction. The assay was further evaluated on 98 blood samples and 144 mosquito samples collected from filarial endemic areas. The PCR was found to be more efficient in comparison to microscopy by detecting 8% and 5% more filarial parasites in field-collected blood and mosquito samples, respectively. This novel PCR that offers scope for simultaneous detection of both the parasites may be used as a diagnostic tool for the detection of filariasis in population and can be adopted for rapid surveillance and monitoring of mosquitoes for use in the effective control of filariasis.
A major problem of switched reluctance motors (SRMs) is torque ripple, which causes undesirable acoustic noise and vibration. It is caused by the saliency of the stator and rotor. In this paper, the geometry for low torque ripple is researched and a motor having notched teeth is proposed. Its characteristics are simulated by finite-element method (FEM) analysis and compared with SRMs having conventional shape.
Characteristics of kimchi containing paprika instead of hot pepper [3] Codex Alimentarius Commission (Codex) Codex standard for kimchi
- Hj Kim
- Jhon
Kim HJ, Jhon JY. Characteristics of kimchi containing paprika instead of hot pepper. Food Sci Biotechnol 2001;10:241–5. [3] Codex Alimentarius Commission (Codex). Codex standard for kimchi. Codex Stan 223. Rome, Italy: Food and Agriculture Organization of the United Nations; 2001.
Real-time PCR monitoring of Lactobacillus sakei, Lactobacillus plantarum, and Lactobacillus paraplantarum during kimchi fermentation
- S Um
- Ws Shin
- Lee
Um S, Shin WS, Lee JH. Real-time PCR monitoring of Lactobacillus sakei, Lactobacillus plantarum, and Lactobacillus paraplantarum during kimchi fermentation. Food Sci Biotechnol 2006;15:595–8.
The physic-chemical changes and sensory characteristics of kimchi added with the mashed red pepper
- Sy Hwang
- Sh Park
- Go Kang
- Hj Lee
- Bok
Hwang SY, Park SH, Kang GO, Lee HJ, Bok JH. The physic-chemical changes and sensory characteristics of kimchi added with the mashed red pepper. Korean J Food Cult 2005;20:221–31.
Official Methods of Analysis of AOAC Int 17th ed Method. Association of Official Analytical Communities
- Aoac
AOAC. Official Methods of Analysis of AOAC Int 17th ed Method. Association of Official Analytical Communities, Gaithersburg, MD, USA; 2000. p. 942:15.
Characteristics of kimchi containing paprika instead of hot pepper
- Kim
The physic-chemical changes and sensory characteristics of kimchi added with the mashed red pepper
- Hwang
Real-time PCR monitoring of Lactobacillus sakei, Lactobacillus plantarum, and Lactobacillus paraplantarum during kimchi fermentation
- Um