Article

Analysis of Flavivirus NS5 Methyltransferase Cap Binding

Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, CO 80523, USA.
Journal of Molecular Biology (Impact Factor: 4.33). 02/2009; 385(5):1643-54. DOI: 10.1016/j.jmb.2008.11.058
Source: PubMed

ABSTRACT

The flavivirus 2'-O-nucleoside N-terminal RNA methyltransferase (MTase) enzyme is responsible for methylating the viral RNA cap structure. To increase our understanding of the mechanism of viral RNA cap binding we performed a detailed structural and biochemical characterization of the guanosine cap-binding pocket of the dengue (DEN) and yellow fever (YF) virus MTase enzymes. We solved an improved 2.1 A resolution crystal structure of DEN2 Mtase, new 1.5 A resolution crystal structures of the YF virus MTase domain in apo form, and a new 1.45 A structure in complex with guanosine triphosphate and RNA cap analog. Our structures clarify the previously reported DEN MTase structure, suggest novel protein-cap interactions, and provide a detailed view of guanine specificity. Furthermore, the structures of the DEN and YF proteins are essentially identical, indicating a large degree of structural conservation amongst the flavivirus MTases. Guanosine triphosphate analog competition assays and mutagenesis analysis, performed to analyze the biochemical characteristics of cap binding, determined that the major interaction points are (i) guanine ring via pi-pi stacking with Phe24, N1 hydrogen interaction with the Leu19 backbone carbonyl via a water bridge, and C2 amine interaction with Leu16 and Leu19 backbone carbonyls; (ii) ribose 2' hydroxyl interaction with Lys13 and Asn17; and (iii) alpha-phosphate interactions with Lys28 and Ser215. Based on our mutational and analog studies, the guanine ring and alpha-phosphate interactions provide most of the energy for cap binding, while the combination of the water bridge between the guanine N1 and Leu19 carbonyl and the hydrogen bonds between the C2 amine and Leu16/Leu19 carbonyl groups provide for specific guanine recognition. A detailed model of how the flavivirus MTase protein binds RNA cap structures is presented.

Download full-text

Full-text

Available from: Susan Keenan
    • "In other structures the cap analogue adopts an extended conformation with the triphosphate pointing towards the SAM pocket. While this conformation is likely to be more relevant for catalysis, the first nucleotide is disordered (Assenberg et al., 2007; Bollati et al., 2009; Egloff et al., 2007; Geiss et al., 2009). A crystal structure of a catalytically-relevant conformation remains to be determined. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The non-structural protein 5 (NS5) of flaviviruses is the most conserved amongst the viral proteins. It is about 900 kDa and bears enzymatic activities that play vital roles in virus replication. Its N-terminal domain encodes dual N7 and 2'-O methyltransferase activities (MTase), and possibly guanylyltransferase (GTase) involved in RNA cap formation. The C-terminal region comprises a RNA-dependent RNA polymerase (RdRp) required for viral RNA synthesis. Both MTase and RdRp activities of dengue virus NS5 are well characterized, structurally and functionally. Numerous crystal structures of the flavivirus MTase and RdRp domains have been solved. Inhibitors of both functions have been identified through screening activities using biochemical and cell-based assays, as well as via rational design approaches. This review summaries the current knowledge as well as prospective views on these aspects. This article forms part of a symposium on flavivirus drug discovery in Antiviral Research. Copyright © 2015. Published by Elsevier B.V.
    No preview · Article · Apr 2015 · Antiviral research
  • Source
    • "391 NS3 DENV Hel and NS5 DENV MTase domains have been readily 392 crystallized as a monomeric free enzyme (Luo et al., 2008) and as 393 a dimeric complex with AdoMet (Lim et al., 2011), respectively, 394 yielding high-resolution X-ray diffraction data. Presence of AdoMet 395 co-purified with MTases from the bacterial lysates has already 396 been widely described (Benarroch et al., 2004; Egloff et al., 2002, 397 2007; Geiss et al., 2009; Lim et al., 2011; Yap et al., 2010). Since 398 one of the objectives of FBDD is to find new binding sites, we did 399 not attempt to exclude AdoMet from its binding pocket. "
    [Show abstract] [Hide abstract]
    ABSTRACT: Seasonal and pandemic flaviviruses continue to be leading global health concerns. With the view to help drug discovery against Dengue virus (DENV), a fragment-based experimental approach was applied to identify small molecule ligands targeting two main components of the flavivirus replication complex: the NS3 helicase (Hel) and the NS5 mRNA methyltransferase (MTase) domains. A library of 500 drug-like fragments was first screened by thermal-shift assay (TSA) leading to the identification of 36 and 32 fragment hits binding Hel and MTase from DENV, respectively. In a second stage, we set up a fragment-based X-ray crystallographic screening (FBS-X) in order to provide both validated fragment hits and structural binding information. No fragment hit was confirmed for DENV Hel. In contrast, a total of seven fragments were identified as DENV MTase binders and structures of MTase-fragment hit complexes were solved at resolution at least 2.0 Å or better. All fragment hits identified contain either a five- or six-membered aromatic ring or both, and three novel binding sites were located on the MTase. To further characterize the fragment hits identified by TSA and FBS-X, we performed enzymatic assays to assess their inhibition effect on the N7- and 2’-O-MTase enzymatic activities: five of these fragment hits inhibit at least one of the two activities with IC50 ranging from 180 μM to 9 mM. This work validates the FBS-X strategy for identifying new anti-flaviviral hits targeting MTase, while Hel might not be an amenable target for fragment-based drug discovery (FBDD). This approach proved to be a fast and efficient screening method for FBDD target validation and discovery of starting hits for the development of higher affinity molecules that bind to novel allosteric sites.
    Full-text · Article · Jun 2014 · Antiviral research
  • Source
    • "To facilite stable crystallization, a shorter version of the DENV2 MTase (aa 1-265) was cloned into the the pET26b vector (EMD Biosciences) at the NdeI and HindIII sites using a pair of primers GCGGATCCCATATGACGGGAAACATAGGAGAGACGCTTGGAGAG and CCCAAGCTTCTAATGGTGGTGATGATGGTGTGAGCTTGATCCGATGTTGCGGGTTCCG (restriction sites were underlined). The shorter DENV2 MTase (aa 1-265) contained additional C-terminal SSSHHHHHH sequence according to the reported crystal structure [38] and was used throughout this manuscript. "
    [Show abstract] [Hide abstract]
    ABSTRACT: The methyltransferase enzyme (MTase), which catalyzes the transfer of a methyl group from S-adenosyl-methionine (AdoMet) to viral RNA, and generates S-adenosyl-homocysteine (AdoHcy) as a by-product, is essential for the life cycle of many significant human pathogen flaviviruses. Here we investigated inhibition of the flavivirus MTase by several AdoHcy-derivatives. Unexpectedly we found that AdoHcy itself barely inhibits the flavivirus MTase activities, even at high concentrations. AdoHcy was also shown to not inhibit virus growth in cell-culture. Binding studies confirmed that AdoHcy has a much lower binding affinity for the MTase than either the AdoMet co-factor, or the natural AdoMet analog inhibitor sinefungin (SIN). While AdoMet is a positively charged molecule, SIN is similar to AdoHcy in being uncharged, and only has an additional amine group that can make extra electrostatic contacts with the MTase. Molecular Mechanics Poisson-Boltzmann Sovation Area analysis on AdoHcy and SIN binding to the MTase suggests that the stronger binding of SIN may not be directly due to interactions of this amine group, but due to distributed differences in SIN binding resulting from its presence. The results suggest that better MTase inhibitors could be designed by using SIN as a scaffold rather than AdoHcy.
    Full-text · Article · Oct 2013 · PLoS ONE
Show more