ArticlePDF Available

Cross-talk between Akkermansia muciniphila and intestinal epithelium controls diet-induced obesity

Authors:

Abstract and Figures

Obesity and type 2 diabetes are characterized by altered gut microbiota, inflammation, and gut barrier disruption. Microbial composition and the mechanisms of interaction with the host that affect gut barrier function during obesity and type 2 diabetes have not been elucidated. We recently isolated Akkermansia muciniphila, which is a mucin-degrading bacterium that resides in the mucus layer. The presence of this bacterium inversely correlates with body weight in rodents and humans. However, the precise physiological roles played by this bacterium during obesity and metabolic disorders are unknown. This study demonstrated that the abundance of A. muciniphila decreased in obese and type 2 diabetic mice. We also observed that prebiotic feeding normalized A. muciniphila abundance, which correlated with an improved metabolic profile. In addition, we demonstrated that A. muciniphila treatment reversed high-fat diet-induced metabolic disorders, including fat-mass gain, metabolic endotoxemia, adipose tissue inflammation, and insulin resistance. A. muciniphila administration increased the intestinal levels of endocannabinoids that control inflammation, the gut barrier, and gut peptide secretion. Finally, we demonstrated that all these effects required viable A. muciniphila because treatment with heat-killed cells did not improve the metabolic profile or the mucus layer thickness. In summary, this study provides substantial insight into the intricate mechanisms of bacterial (i.e., A. muciniphila) regulation of the cross-talk between the host and gut microbiota. These results also provide a rationale for the development of a treatment that uses this human mucus colonizer for the prevention or treatment of obesity and its associated metabolic disorders.
A. muciniphila abundance is decreased in obese and diabetic mice, and prebiotic treatment restored A. muciniphila to basal levels and reversed metabolic endotoxemia and related disorders. (A) A. muciniphila abundance (log 10 of bacteria per g of cecal content) measured in the cecal content of leptin-deficient (ob-ob) obese mice and their lean littermates (lean) (n = 5). (B) A. muciniphila abundance (log 10 of bacteria per g of cecal content) measured in the cecal content of control diet-fed mice (CT) or CT diet-fed mice treated with prebiotics (CT-Pre) added to their drinking water and HF dietfed mice (HF) or HF diet-fed mice treated with prebiotics (HF-Pre) added to their drinking water for 8 wk (n = 10). (C ) A. muciniphila abundance (log 10 of bacteria per g of cecal content) measured in the cecal content of obese mice fed a control diet (ob-CT) or treated with prebiotics (obPre) for 5 wk (n = 10). (D) Portal vein serum LPS levels (n = 7-9). (E) mRNA expression of the adipose tissue macrophage infiltration marker CD11c (n = 10). (F) Total fat mass gain measured by time-domain NMR (n = 10). (G) Pearson's correlation between log values of portal vein LPS levels and A. muciniphila abundance (log 10 of bacteria per g of cecal content); (Inset) Pearson's correlation coefficient (r) and the corresponding P value. Data are shown as means ± SEM; *P < 0.05 by two-tailed Student t test, data with different superscript letters are significantly different (P < 0.05) according to post hoc ANOVA one-way statistical analysis.
… 
Heat-killed A. muciniphila did not counteract metabolic endotoxemia, diet-induced obesity, oral glucose intolerance, and did not improve adipose tissue metabolism and gut barrier function in diet-induced obese mice. Control mice were fed a control (CT) or HF diet (HF) and treated with a daily oral gavage containing sterile anaerobic PBS and glycerol for 4 wk daily. Treated mice received an oral gavage of alive A. muciniphila (HF-Akk) or killed A. muciniphila (HF-K-Akk) (2.10 8 bacterial cells suspended in 200 μ L of sterile anaerobic PBS) and fed an HF diet ( n = 8). (A ) Portal vein serum LPS levels ( n = 6 – 7). ( B ) Total fat mass gain measured by time-domain NMR ( n = 7 – 8). ( C ) Plasma glucose pro fi le after 2 g/kg glucose oral challenge in freely moving mice. ( Inset ) Mean area under the curve (AUC) measured between 0 and 120 min after glucose load ( n = 7 – 8). ( D ) mRNA expression of markers of adipocyte differentiation ( Cebpa ), lipogenesis ( Acc1 ; Fasn ), and lipid oxidation ( Cpt1; Acox1 ; Pgc1a ; and Ppara ) was measured in visceral fat depots (mesenteric fat) ( n = 8). ( E ) Thickness of the mucus layer measured by histological analyses after alcian blue staining (CT n = 4, HF n = 6, HF-Akk and HF-K-Akk n = 5). ( F ) Representative alcian blue images that were used for mucus layer thickness measurements. M, mucosa; IM, inner mucus layer. (Scale bars, 40 μ m.) Data are shown as means ± SEM. Data with different superscript letters are signi fi cantly different ( P < 0.05) according to post hoc ANOVA one-way statistical analysis.
… 
Content may be subject to copyright.
Cross-talk between Akkermansia muciniphila and
intestinal epithelium controls diet-induced obesity
Amandine Everard
a
, Clara Belzer
b
, Lucie Geurts
a
, Janneke P. Ouwerkerk
b
, Céline Druart
a
, Laure B. Bindels
a
, Yves Guiot
c
,
Muriel Derrien
b
, Giulio G. Muccioli
d
, Nathalie M. Delzenne
a
, Willem M. de Vos
b,e
, and Patrice D. Cani
a,1
a
Metabolism and Nutrition Research Group, Walloon Excellence in Life sciences and BIOtechnology (WELBIO), Louvain Drug Research Institute, Université
catholique de Louvain, B-1200 Brussels, Belgium;
b
Laboratory of Microbiology, Wageningen University, 6703 HB, Wageningen, The Netherlands.
c
Department
of Pathology, Cliniques Universitaires Saint-Luc, Université catholique de Louvain, B-1200 Brussels, Belgium;
d
Bioanalysis and Pharmacology of Bioactive Lipids
Research Group, Louvain Drug Research Institute, Université catholique de Louvain, B-1200 Brussels, Belgium; and
e
Departments of Bacteriology and
Immunology and Veterinary Biosciences, University of Helsinki, 00014 Helsingin yliopisto, Helsinki, Finland
Edited* by Todd R. Klaenhammer, North Carolina State University, Raleigh, NC, and approved March 28, 2013 (received for review November 8, 2012)
Obesity and type 2 diabetes are characterized by altered gut
microbiota, inammation, and gut barrier disruption. Microbial
composition and the mechanisms of interaction with the host that
affect gut barrier function during obesity and type 2 diabetes have
not been elucidated. We recently isolated Akkermansia muciniphila,
which is a mucin-degrading bacterium that resides in the mucus
layer. The presence of this bacterium inversely correlates with body
weight in rodents and humans. However, the precise physiological
roles played by this bacterium during obesity and metabolic disor-
ders are unknown. This study demonstrated that the abundance of
A. muciniphila decreased in obese and type 2 diabetic mice. We also
observed that prebiotic feeding normalized A. muciniphila abun-
dance, which correlated with an improved metabolic prole. In ad-
dition, we demonstrated that A. muciniphila treatment reversed
high-fat diet-induced metabolic disorders, including fat-mass gain,
metabolic endotoxemia, adipose tissue inammation, and insulin
resistance. A. muciniphila administration increased the intestinal
levels of endocannabinoids that control inammation, the gut bar-
rier, and gut peptide secretion. Finally, we demonstrated that all
these effects required viable A. muciniphila because treatment with
heat-killed cells did not improve the metabolic prole or the mucus
layer thickness. In summary, this study provides substantial insight
into the intricate mechanisms of bacterial (i.e., A. muciniphila)reg-
ulation of the cross-talk between the host and gutmicrobiota. These
results also provide a rationale for the development of a treatment
that uses this human mucus colonizer for the prevention or treat-
ment of obesity and its associated metabolic disorders.
RegIIIγ
|
LPS
|
gut permeability
|
Lactobacillus plantarum
|
antimicrobial peptides
Gut microbiota were once characterized as bystanders in the
intestinal tract, but their active role in intestinal physiology is
now widely investigated. In particular, the mutualism that exists
between gut microbiota and the host has received much attention.
Obesity and type 2 diabetes are characterized by altered gut
microbiota (1), inammation (2), and gut barrier disruption (35).
We recently demonstrated an association of obesity and type 2 di-
abetes with increased gut permeability, which induced metabolic
endotoxemia and metabolic inammation (35). Unequivocal evi-
dence demonstrates that gut microbiota inuence whole-body me-
tabolism (1, 6) by affecting the energy balance (6), gut permeability
(4, 5), serum lipopolysaccharides [i.e., metabolic endotoxemia (7)],
and metabolic inammation (35, 7) that are associated with obesity
and associated disorders. However, the microbial composition and
the exact mechanisms of interaction between these two partners that
affect hostgut barrier function and metabolism remain unclear.
The intestinal epithelium is the interface for the interaction
between gut microbiota and host tissues (8). This barrier is en-
hanced by the presence of a mucus layer and immune factors that
are produced by the host (9). Antimicrobial peptides for innate
immunity are produced by Paneth cells (e.g., α-defensins, lysozyme
C, phospholipases, and C-type lectin, primarily regenerating islet-
derived 3-gamma, RegIIIγ) or enterocytes (RegIIIγ) (1012).
Adaptive immune system effectors that are secreted into the in-
testinal lumen, such as IgA, may also restrict bacterial penetration
into the host mucus and mucosal tissue (13). These immune factors
allow the host to control its interactions with gut microbiota and
shape its microbial communities (11).
The endocannabinoid system has also been implicated in the
control of the gut barrier and inammation (5, 14). One lipid in this
system, 2-arachidonoylglycerol (2-AG), reduces metabolic endo-
toxemia and systemic inammation (15). Another acylglycerol, 2-
palmitoylglycerol (2-PG), potentiates the antiinammatory effects
of 2-AG (16). Importantly, 2-oleoylglycerol (2-OG) stimulates the
release of gut peptides, such as glucagon-like peptide-1 (GLP-1) and
glucagon-like peptide-2 (GLP-2), from intestinal L-cells (17). These
peptides are implicated in the control of glucose homeostasis and
gut barrier function, respectively (4).
Recently, Akkermansia muciniphila has been identied as a
mucin-degrading bacteria that resides in the mucus layer (18), and it
is the dominant human bacterium that abundantly colonizes this
nutrient-rich environment (18). A. muciniphila may represent 35%
of the microbial community (18, 19) in healthy subjects, and its
abundance inversely correlates with body weight (2023) and type 1
diabetes (24) in mice and humans, although a recent metagenomic
study found that some of the genes belonging to A. muciniphila were
enriched in type 2 diabetic subjects (25).
We recently discovered that the administration of prebiotics
(oligofructose) to genetically obese mice increased the abun-
dance of A. muciniphila by 100-fold (23). However, the direct
implications of A. muciniphila for obesity and type 2 diabetes
have not been determined, and the precise physiological roles it
plays during these processes are not known.
Our previous results and the close proximity of this bacterium
to the human intestinal epithelium support the hypothesis that
A. muciniphila plays a crucial role in the mutualism between the
gut microbiota and host that controls gut barrier function and
other physiological and homeostatic functions during obesity and
type 2 diabetes. We administered alive or heat-killed A. muciniphila
to mice that were fed a high-fat diet and investigated the gut barrier,
glucose homeostasis, and adipose tissue metabolism to test this
hypothesis.
Author contributions: P.D.C. designed research; A.E., C.B., L.G., J.P.O., C.D., L.B.B., M .D.,G .G.M.,
W.M.d.V., and P.D.C. performed research; C.B. , J.P.O., Y.G., M.D., G.G.M., N.M.D. , W.M.d.V.,
and P.D.C. contributed new reagents/analytic tools; A.E., C.B., L.G., J.P.O., Y.G., G.G.M.,
W.M.d.V., and P.D.C. analyzed data; and A.E., C.B., W.M.d.V., and P.D.C. wrote the paper.
The authors declare no conict of interest.
*This Direct Submission article had a prearranged editor.
Freely available online through the PNAS open access option.
1
To whom correspondence should be addressed. E-mail: patrice.cani@uclouvain.be.
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.
1073/pnas.1219451110/-/DCSupplemental.
www.pnas.org/cgi/doi/10.1073/pnas.1219451110 PNAS Early Edition
|
1of6
MICROBIOLOGY
Results
A. muciniphila Abundance Decreased in Obese and Type 2 Diabetic
Mice. We observed that the abundance of A. muciniphila was
3,300-fold lower in leptin-decient obese mice than in their lean
littermates (Fig. 1A). We also observed a 100-fold decrease of
this bacterium in high-fat-(HF)-fed mice (Fig. 1B).
Prebiotic Treatment Restored Basal Levels of A. muciniphila and Improved
Metabolic Endotoxemia and Related Disorders That Are Associated with
HF-Diet-Induced Obesity. Prebiotics (oligofructose) completely re-
stored A. muciniphila counts in both models (Fig. 1 Band C),
therefore supporting the data obtained in our previous study
performed in ob/ob mice (23). Administration of prebiotics in
HF-fed mice abolished metabolic endotoxemia (Fig. 1D)and
normalized the CD11c subpopulation of macrophages in adi-
pose tissue, which is the primary population of increased adi-
pose tissue macrophages in obesity (2) (Fig. 1E). Administration
of prebiotics also reduced the total fat mass, the mass of the
different fat pads (i.e., s.c., mesenteric, and epididymal), and the
body weight (Fig. 1Fand Fig. S1 AC). These results were sig-
nicantly and inversely correlated with A. muciniphila abun-
dance (Fig. 1Gand Fig. S1 Dand E). However, the role of the
lack of A. muciniphila in the molecular mechanisms that un-
derlie the onset of these disorders has not been demonstrated,
and whether an increased abundance of A. muciniphila reverses
these disorders must be investigated. A. muciniphila was orally
administered to control or HF-fed mice for 4 wk to address
these questions.
HF Diet Altered the Gut Microbiota Composition, Whereas A. muciniphila
Did Not Signicantly Induce Changes. A. muciniphila treatment was
associated with an increase in A. muciniphila abundance in the
cecal content of mice (Fig. S2A). We also demonstrated that an
HF diet signicantly changes the gut microbiota using a phyloge-
netic microarray (Mouse Intestinal Tract Chip, MITChip) (10,
23), as shown by principal component analyses (Fig. 2A), den-
drogram clustering, and representational difference analysis (Fig.
S2 Band C), whereas A. muciniphila treatment did not modify this
prole (Fig. 2Aand Fig. S2 Band C).
A. muciniphila Improved Metabolic Disorders in Diet-Induced Obese
Mice. A. muciniphila treatment normalized diet-induced metabolic
endotoxemia, adiposity, and the adipose tissue marker CD11c
(Fig. 2 BDand Fig. S3A). Similarly, A. muciniphila treatment
reduced body weight and improved body composition (i.e., fat
mass/lean mass ratio) (Fig. S3 Band C) without changes in food
intake (Fig. S3D). We demonstrated that A. muciniphila treatment
completely reversed diet-induced fasting hyperglycemia (Fig. 2E)
via a mechanism that was associated with a 40% reduction in he-
patic glucose-6-phosphatase expression (Fig. 2F), thereby suggest-
ing a reduction in gluconeogenesis. Notably, the insulin resistance
index was similarly reduced after A. muciniphila treatment (Fig.
S3E). These results suggest a key role for A. muciniphila in gut
barrier function, metabolic inammation, and fat storage. There-
fore, we hypothesized that A. muciniphila would impact adipose
tissue metabolism. We demonstrated that A. muciniphila treat-
ment under an HF diet increased the mRNA expression of
markers of adipocyte differentiation (e.g., CCAAT/enhancer
binding protein-α,encodedbyCebpa) and lipid oxidation (e.g.,
carnitine palmitoyltransferase-1, encoded by Cpt1;acyl-CoA-
oxidase, encoded by Acox1; peroxisome proliferator-activated
receptor γcoactivator, encoded by Pgc1a; and peroxisome
proliferator-activated receptor alpha, encoded by Ppara) without
affecting lipogenesis markers (e.g., acetyl-CoA carboxylase,
encoded by Acc1 and fatty acid synthase, encoded by Fasn)(Fig.
2G). These data further conrm our hypothesis that A. muciniphila
controls fat storage, adipose tissue metabolism, and glucose
homeostasis.
A. muciniphila Treatment Exerted Minor Effects on Antibacterial Peptide
Content in the Ileum and IgA Levels in the Feces. Recent data sug-
gest that the intestinal mucosa contributes to the maintenance of
the gut barrier by secreting antimicrobial peptides for innate
immunity that are produced by Paneth cells (e.g., α-defensins,
lysozyme C, phospholipases, and C-type lectin, primarily the
RegIIIγ) or enterocytes (RegIIIγ) (10, 12). We measured the
expression of Paneth and epithelial cell antibacterial markers in
the ileum to elucidate the impact of the HF diet and A. muciniphila
treatment on gut barrier function. A. muciniphila increased the
Fig. 1. A. muciniphila abundance is de-
creased in obese and diabetic mice, and
prebiotic treatment restored A. muciniphila
to basal levels and reversed metabolic
endotoxemia and related disorders. (A)A.
muciniphila abundance (log
10
of bacteria
per g of cecal content) measured in the
cecal content of leptin-decient (ob-ob)
obese mice and their lean littermates
(lean) (n=5). (B)A. muciniphila abun-
dance (log
10
of bacteria per g of cecal
content) measured in the cecal content of
control diet-fed mice (CT) or CT diet-fed
mice treated with prebiotics (CT-Pre)
added to their drinking water and HF diet-
fed mice (HF) or HF diet-fed mice treated
with prebiotics (HF-Pre) added to their
drinking water for 8 wk (n=10). (C)
A. muciniphila abundance (log
10
of bacteria
per g of cecal content) measured in the
cecal content of obese mice fed a control
diet (ob-CT) or treated with prebiotics (ob-
Pre) for 5 wk (n=10). (D) Portal vein serum
LPS levels (n=79). (E) mRNA expression of
the adipose tissue macrophage inltration
marker CD11c (n=10). (F) Total fat mass
gain measured by time-domain NMR (n=10). (G)Pearsons correlation between log values of portal vein LPS levels and A. muciniphila abundance (log
10
of
bacteria per g of cecal content); (Inset)Pearsons correlation coefcient (r)andthecorrespondingPvalue. Data are shown as means ±SEM; *P<0.05by two-tailed
Student ttest, data with different superscript letters are signicantly different (P<0.05) according to post hoc ANOVA one-way statistical analysis.
2of6
|
www.pnas.org/cgi/doi/10.1073/pnas.1219451110 Everard et al.
expression of Reg3g (RegIIIγ) under the control diet, but this
effect was not observed in HF-fed mice (Fig. S4A). Pla2g2a and
Defa expression were similar between groups, but Lyz1 expres-
sion tended to be lower after bacterial administration (Fig. S4
BD). We also measured IgA in fecal samples as an adaptive
immune system factor (13). Fecal IgA levels were not affected by
the treatments (Fig. S4E), which suggests that A. muciniphila
controls gut barrier function by other mechanisms of epithelial
signaling (26).
A. muciniphila Increased Endocannabinoid (Acylglycerols) Content in
the Ileum. We previously observed a linkbetweengutmicrobiotaand
intestinal endocannabinoid system tone (5). We demonstrated an
association of decreased monoacylglycerol lipase expression with
improved gut barrier function and decreased metabolic inam-
mation (5). We also demonstrated previously that the pharmaco-
logical inhibition of monoacylglycerol lipase reduced metabolic
endotoxemia and systemic inammation (15), which suggests a
direct link between acylglycerols and gut barrier function. There-
fore, we measured intestinal acylglycerol levels and demon-
strated that A. muciniphila treatment increased the levels of
2-OG, 2-AG, and 2-PG (Fig. 3A). These results support a di-
rect link between A. muciniphila administration and intestinal
levels of acylglycerols that are involved in glucose and intestinal
homeostasis.
A. muciniphila Counteracted Diet-Induced Colon Mucosal Barrier
Dysfunction During Obesity. Recent evidence supports that inter-
actions between the gut microbiota and mucus layer are dynamic
systems that affect mucus barrier biology (9, 27). Therefore, we
investigated the impact of A. muciniphila treatment on the
thickness of the inner mucus layer. We demonstrated a 46% thin-
ner mucus layer in HF-fed mice, and A. muciniphila treatment
counteracted this decrease (Fig. 3 Band C).
Viable but Not Heat-Killed A. muciniphila Counteracted Diet-Induced
Metabolic and Mucosal Barrier Dysfunction During Obesity. To fur-
ther demonstrate whether A. muciniphila has to be alive to exert
its metabolic effects, we have compared the impact of viable
A. muciniphila administration with that of heat-killed A. muciniphila.
We found that viable A. muciniphila counteracted diet-induced
metabolic endotoxemia, fat mass development, and altered adi-
pose tissue metabolism (Fig. 4 A,B, and Dand Fig. S5A)toa
similar extent as observed in the rst set of experiments (Fig. 2 B,
C, and Gand Fig. S3A). Importantly, these effects were not ob-
served after administration of heat-killed A. muciniphila (Fig. 4
A,B,andDand Fig. S5A). In addition, we found that viable
A. muciniphila signicantly reduced plasma glucose levels after
an oral glucose tolerance test (Fig. 4C), whereas heat-killed
A. muciniphila exhibited glucose intolerance similar to that of HF-
fed mice (Fig. 4C). Finally, we conrmed that viable A. muciniphila
Fig. 2. A. muciniphila counteracted metabolic endotoxemia, diet-induced
obesity, adipose tissue macrophage inltration, improved glucose homeo-
stasis, and adipose tissue metabolism in diet-induced obese mice without
modifying gut microbiota composition. (A) Principal component analysis
using the MITChip phylogenetic ngerprints of the gut microbiota from the
cecal contents of control mice treated with a daily oral gavage containing
sterile anaerobic PBS for 4 wk and fed a control (CT) or HF diet (HF) (CT in red
and HF in green) and in mice treated with a daily oral gavage containing
A. muciniphila (2.10
8
bacterial cells suspended in 200 μL of sterile anaerobic
PBS) and fed a control (CT-Akk) or HF diet (HF-Akk) (CT-Akk in blue and HF-
Akk in yellow) (n=10). (B) Portal vein serum LPS levels (n=610). (C) Total
fat mass gain measured by time-domain NMR (n=10). (D) mRNA expression
of the adipose tissue macrophage inltration marker CD11c (n=10). (E)
Fasting glycemia (n=10). (F) Liver G6pc mRNA (n=10). (G) mRNA expression
of markers of adipocyte differentiation (Cebpa), lipogenesis (Acc1;Fasn),
and lipid oxidation (Cpt1; Acox1;Pgc1a; and Ppara) was measured in visceral
fat depots (mesenteric fat) (n=10). Data are shown as means ±SEM. Data
with different superscript letters are signicantly different (P<0.05)
according to post hoc ANOVA one-way statistical analysis.
Fig. 3. A. muciniphila colonization restored gut barrier function and in-
creased intestinal endocannabinoids in diet-induced obese mice. (A) Ileum
2-PG, 2-OG, and 2-AG (expressed as percentage of the control) (n=10). (B)
Thickness of the mucus layer measured by histological analyses After alcian
blue staining (n=78). (C) Representative alcian blue images that were used
for mucus layer thickness measurements. M, mucosa; IM, inner mucus layer.
(Scale bars, 40 μm.) Data are shown as means ±SEM. Data with different
superscript letters are signicantly different (P<0.05) according to post hoc
ANOVA one-way statistical analysis.
Everard et al. PNAS Early Edition
|
3of6
MICROBIOLOGY
restored mucus layer thickness upon HF-diet, whereas we found
that heat-killed A. muciniphila did not improve mucus layer
thickness compared with HF (Fig. 4 Eand F). It is worth noting
that we found 100-fold more viable A. muciniphila recovered from
the cecal and colonic content of A. muciniphila-treated mice
compared with the HF and heat-killed bacteria groups (HF-Akk:
9.5 ±1.02 log
10
cells/mg of content; HF and HF-K-Akk: 6.8 ±0.51
log
10
cells/mg of content; P=0.0059), thereby evidencing the vi-
ability of A. muciniphila after oral administration.
This study conrms that that HF diet-induced obesity is as-
sociated with changes in gut microbiota composition (7) (28)
(Fig. 2Aand Fig. S2 Band C). However, antimicrobial peptides
in the ileum were not affected by the treatments. In contrast,
Reg3g expression in colon epithelial cells was signicantly re-
duced, by 50%, in HF and heat-killed A. muciniphila treated
mice, whereas viable A. muciniphila treatment completely blun-
ted this effect and increased Reg3g expression upon HF diet
(Fig. S5B).
Discussion
This study demonstrated a dramatic decrease in A. muciniphila in
genetically and diet-induced obese mice. We demonstrated that
prebiotic (oligofructose) treatment restored A. muciniphila abun-
dance and improved gut barrier and metabolic parameters. How-
ever, the mechanisms that were responsible for the bloom in
A. muciniphila caused by prebiotic administration are not clear.
A. muciniphila does not grow on oligofructose-enriched media (in
vitro), which suggests that complex cross-feeding interactions con-
tributed to this effect. However, it has been previously shown in rats
that oligofructose feeding increases the number of goblet cells and
mucus layer thickness (29). Thus, whether oligofructose feeding
increases A. muciniphila by providing the main source of energy for
this bacterium and thereby favoring its growth or whether the in-
crease of A. muciniphila increases mucus production and degrada-
tion (i.e., turnover) remain to be demonstrated. Oligofructose
changes more than 100 different taxa in mice (23). Therefore, we
cannot exclude that oligofructose induces specic changes in the gut
bacteria and cross-feeding promoting the growth of A. muciniphila.
In the present study, we investigated the direct impact of A. muci-
niphila. We reversed the pathological phenotype by restoring the
physiological abundance of this strain in obese and diabetic mice.
These results demonstrated the key role of A. muciniphila in the
physiopathology of obesity, type 2 diabetes, and metabolic in-
ammation. These experiments clearly demonstrate that viable
A. muciniphila controls gut barrier function, fat mass storage, and
glucose homeostasis in obese and type 2 diabetic mice via several
mechanisms. These results provide proof of this concept in this
context. The major weaknesses in investigations of the role of gut
microbiota in the etiology of obesity and type 2 diabetes is the re-
liance on conclusions that are based on correlative data between
bacteria (or one genus) and physiological parameters, because most
of the gut bacteria have been identied at the phylogenetic level (i.e.,
through metagenomic approaches) but have never been cultured.
Several reports have demonstrated the importance of selected
bacteria [i.e., Lactobacillus spp (30, 31), Bidobacterium spp (32,
33), and Bacteroides uniformis CECTT 7771 (34)] on fat mass
development during diet-induced obesity, but the aims of these
studies were different from that of the present study. These
studies investigated the impact of supplementation with one
specic probiotic strain or strains that were isolated from healthy
infants on physiological parameters. Here we investigated the
strain that is affected during obesity and type 2 diabetes in
humans and rodents (18, 23). Probiotics have far fewer oppor-
tunities for direct contact with the mucosa, but A. muciniphila
may induces differential host responses because of more in-
tensive contact with the host mucosa (26). To further conrm
this hypothesis, we have treated HF-fed mice with a probiotic
(i.e., Lactobacillus plantarum WCFS1). We found that L. plantarum
administration did not change fat mass development, adipose
tissue metabolism, mucus layer thickness, colon Reg3g mRNA,
and metabolic endotoxemia (Fig. S6 AE). Therefore, these data
suggest that A. muciniphila induces specic host responses
compared with other putative benecial microbes.
A. muciniphila is a Gram-negative bacteria (i.e., it contains LPS)
that constitutes 35% of the gut microbial community. However,
our study clearly demonstrated the lack of a direct relationship
between the abundance of Gram-negative bacteria within the gut
and metabolic endotoxemia (i.e., that is caused by serum LPS)
because gut colonization by A. muciniphila decreased metabolic
endotoxemia arising on an HF diet. One explanation for this
Fig. 4. Heat-killed A. muciniphila did not counteract metabolic endotoxemia, diet-induced obesity, oral glucose intolerance, and did not improve adipose
tissue metabolism and gut barrier function in diet-induced obese mice. Control mice were fed a control (CT) or HF diet (HF) and treated with a daily oral
gavage containing sterile anaerobic PBS and glycerol for 4 wk daily. Treated mice received an oral gavage of alive A. muciniphila (HF-Akk) or killed
A. muciniphila (HF-K-Akk) (2.10
8
bacterial cells suspended in 200 μL of sterile anaerobic PBS) and fed an HF diet (n=8). (A) Portal vein serum LPS levels (n=67).
(B) Total fat mass gain measured by time-domain NMR (n=78). (C) Plasma glucose prole after 2 g/kg glucose oral challenge in freely moving mice. (Inset)
Mean area under the curve (AUC) measured between 0 and 120 min after glucose load (n=78). (D) mRNA expression of markers of adipocyte differentiation
(Cebpa), lipogenesis (Acc1;Fasn), and lipid oxidation (Cpt1; Acox1;Pgc1a; and Ppara) was measured in visceral fat depots (mesenteric fat) (n=8). (E) Thickness
of the mucus layer measured by histological analyses after alcian blue staining (CT n=4, HF n=6, HF-Akk and HF-K-Akk n=5). (F) Representative alcian blue
images that were used for mucus layer thickness measurements. M, mucosa; IM, inner mucus layer. (Scale bars, 40 μm.) Data are shown as means ±SEM. Data
with different superscript letters are signicantly different (P<0.05) according to post hoc ANOVA one-way statistical analysis.
4of6
|
www.pnas.org/cgi/doi/10.1073/pnas.1219451110 Everard et al.
counterintuitive result may be that A. muciniphila regulates gut
barrier function at different levels. Previous data suggest that gut
microbiota contribute to gut barrier alterations during obesity and
metabolic endotoxemia (4). However, the different mechanisms of
interaction between bacteria and the host that affect gut barrier
function during obesity and type 2 diabetes have not been eluci-
dated. This study identied an association of obesity with a de-
crease in mucus thickness, which supports an additional mechanism
of increased gut permeability (i.e., metabolic endotoxemia) that is
characteristic of obesity and associated disorders. Furthermore, we
demonstrated that A. muciniphila restored this mucus layer, which
suggests that this mechanism contributes to the reduction in met-
abolic endotoxemia that was observed during A. muciniphila
treatment. Moreover, we found that viable A. muciniphila induces
these effects, whereas heat-killed A. muciniphila did not protect the
mice from diet-induced obesity and associated disorders.
These results suggest that the presence of viable A. muciniphila
within the mucus layer is a crucial mechanism in the control of
host mucus turnover (19), which improves gut barrier function.
However, we cannot exclude additional mechanisms that have
been implicated in the regulation of gut barrier. For example, we
previously demonstrated that gut microbiota control gut peptides
(e.g., GLP-2) that regulate epithelial cell proliferation and gut
barrier function (4). Prebiotics stimulate GLP-1 and GLP-2 se-
cretion by acting on the enteroendocrine L-cells that are primarily
in the ileum and colon (6). The abundance of A. muciniphila is
associated with higher L-cell activity (i.e., GLP-1 and GLP-2 se-
cretion) (4, 23), but the mechanisms underlying this relationship
are not known. Here, we demonstrated that A. muciniphila ad-
ministration signicantly increased intestinal levels of 2-OG,
which stimulates glucagon-like peptide secretion from intestinal
L-cells (17). Altogether our data suggest that this could be a key
mechanism by which A. muciniphila controls gut barrier function,
metabolic endotoxemia, and metabolism. We also demonstrated
that A. muciniphila administration increased 2-AG intestinal
levels. We recently demonstrated that an increase in 2-AG en-
dogenous levels induced by selective monoacylglycerol lipase in-
hibitor protects against trinitrobenzene sulfonic acid-induced
colitis in mice (15) and reduces metabolic endotoxemia as well as
the level of circulating inammatory cytokines and peripheral and
brain inammation. Therefore, the increased 2-AG levels that
were observed after A. muciniphila treatment may have also
contributed to the reduced inammation. However, whether the
induction of these endocannabinoids after A. muciniphila treat-
ment constitutes the molecular event that links these metabolic
features warrants further investigation.
Specically, we demonstrated that the restoration of the
physiological abundance of A. muciniphila reduced diet-induced
body weight gain, fat mass development, and fasting hyperglyce-
mia without affecting food intake. This variation in energy storage
is explained by the normalization of adipose tissue adipogenesis
(i.e., differentiation and lipogenesis) and fatty acid oxidation. We
have previously demonstrated that higher circulating LPS levels
inhibit adipose tissue differentiation and lipogenesis, thereby
contributing to altered adipose tissue metabolism characterizing
obesity (5). Thus, we postulate that A. muciniphila restores gut
barrier function and thereby contributes to normalize meta-
bolic endotoxemia and adipose tissue metabolism. We found
that A. muciniphila improved glucose tolerance and decreased
endogenous hepatic glucose production. These ndings are
not in agreement with the apparent but low association of
A.muciniphila genes with type 2 diabetes-associated metagenome-
wide associated studies (25). Nevertheless, the data by Qin et al.
remain to be conrmed because this related to only 337 of the
2,176 A.muciniphila genes (35) and may be confounded by dietary
or pharmaceutical treatments specically favoring its growth in
the human intestine.
Dynamic insulin resistance assessments and the present results
suggest improved insulin sensitivity. However, we cannot exclude
the possibility that the improvements in glucose and lipid metab-
olism occurred via an LPS-dependent mechanism, as demon-
strated previously (5, 7). We conrmed (7, 36) that an HF diet
profoundly affected the gut microbiota composition, whereas
A. muciniphila administration did not signicantly affect this pro-
le. Therefore, it is tempting to extrapolate our ndings as a single-
species-dependent modulation of the gut microbiota. Moreover,
because heat-killing of A. muciniphila completely abolished the
metabolic effects it is unlikely that specicA. muciniphila-derived
cell-envelope components may directly contribute to the pheno-
type observed with viable A. muciniphila. It is worth noting that
this observation also minimizes the possibility that the host re-
sponse was caused by a substance in the culture media. However,
although not directly tting with the aim of the present study,
follow-up studies of the gut microbiome after viable A. muciniphila
administration may identify the components that contribute to
disease or the host physiological response (37).
Finally, we demonstrated that A. muciniphila regulates intestinal
antimicrobial peptides in the colon (e.g., RegIIIγ). A. muciniphila
exerted minor effects on antimicrobial peptide production in the
ileum. RegIIIγexerts direct bactericidal activity against Gram-
positive bacteria in the intestine. Therefore, A. muciniphila may
manipulate host immunity to favor its own survival through an
increase in RegIIIγexpression, which reduces the competition for
resources and induces long-term tolerance for the development in
the mucus layer. Here, we clearly found that viable A. muciniphila
signicantly increased RegIIIγ, whereas heat-killed A. muciniphila
did not affect this parameter. Whether the effect on RegIIIγ
should be considered as benecial or harmful for the host remain
to be determined. These results link the colonization of the colon,
but not the ileum, by A. muciniphila with the fundamental immune
mechanisms through which RegIIIγpromotes hostbacterial mu-
tualism and regulates the spatial relationships between the
microbiota and host (38). Finally, A. muciniphila is known to de-
grade human mucus (18). However, whether the benecial effects
observed here may be extended to other pathological situations in
which the mucus layer is altered (e.g., intestinal inammatory
diseases) (39) remain to be elucidated.
We recently demonstrated that germ-free mice that were
monoassociated with A. muciniphila exhibit important modu-
lations of gene expression; the most marked changes were ob-
served in the colon (442 genes), followed by the ileum (253 genes)
and the cecum (211 genes) (26). In the colon, 60 genes, including
16 genes encoding CD antigen markers and 10 genes encoding
immune cell membrane receptors, were up-regulated after
A. muciniphila colonization (26). Several pathways that regulate
lipid metabolism, cell signaling, and molecular transport are mostly
affected in the ileum (26). These data have uncovered mechanisms
of bacterialinteraction with the host to control gut permeability and
metabolism. Further studies should explore the cellular processes
and identify the bacterial products that regulate the host cell
responses and metabolic effects of A. muciniphila.
In summary, this study provided unique and substantial
insights into the intricate regulation of the cross-talk between the
host and A. muciniphila bacteria. These results provide a ratio-
nale for the development of a treatment that uses this human
mucus colonizer for the prevention or treatment of obesity and
its associated metabolic disorders.
Materials and Methods
Mice. Male C57BL/6 mice were used in the four series of experiments. Cecal
contents from genetic (ob/ob) and HF-fed obese and type 2 diabetic mice
treated or not with prebiotics (oligofructose, 0.3 g per mouse per day) were
harvested, immersed in liquid nitrogen, and stored at 80 °C for further
A. muciniphila analysis. A subset of 10-wk-old C57BL/6J was fed a control
diet (CT) or an HF diet (60% fat). The mice were treated with A. muciniphila
Everard et al. PNAS Early Edition
|
5of6
MICROBIOLOGY
by oral gavage at a dose 2.10
8
cfu/0.2 mL suspended in sterile anaerobic PBS
(CT-Akk and HF-Akk), or heat-killed A. muciniphila (HF-K-Akk). Control
groups were orally administered an equivalent volume of sterile anaerobic
PBS containing a similar end concentration of glycerol (2.5% vol/vol) (CT and
HF). Treatments were continued for 4 wk. A. muciniphila Muc
T
(ATTC BAA-
835) was grown anaerobically in a mucin-based basal medium as described
previously (18). The cultures were washed and concentrated in anaerobic
PBS that included 25% (vol/vol) glycerol to an end concentration of 1.10
10
cfu/mL under strict anaerobic conditions. Body composition was assessed
using a 7.5-MHz time-domain NMR. Blood, adipose depots, liver, cecal con-
tent, and intestinal segments (ileum, cecum, and colon) were collected at
death and analyzed. A complete description of the mouse experiments and
bacteria preparation is provided in SI Material and Methods.
Gut Microbiota Analysis. Gut microbiota analyses were performed using real-
time quantitative PCR (qPCR) analysis and the MITChip, which is a phylogeneti c
microarray consisting of 3,580 different oligonucleotide probes that target
two hypervariable regions of the 16S rRNA gene (the V1 and V6 regions).
Analyses of the MITChip were performed as described previously (23, 40) and
in SI Material and Methods.
Gene Expression Analysis. The expression of metabolic genes of interest and
RNA expression proles were analyzed using real-time qPCR analysis as de-
scribed in SI Material and Methods.
Measurement of Endocannabinoid Intestinal Levels. Intestinal endocannabi-
noids were measured using an LTQ Orbitrap mass spectrometer as described
in SI Material and Methods.
Biochemical Analysis. Plasma insulin and fecal IgA were analyzed using ELISA as
described in SI Material and Methods. The thickness of the mucus layer was
measured in proximal colon segments that were xed in Carnoys solution
and in 5-μm parafn sections stained with alcian blue as described in SI Ma-
terial and Methods. LPS concentrations in portal vein blood were measured
using Endosafe-Multi-Cartridge System based on the limulus amebocyte ly-
sate kinetic chromogenic methodology as described the in SI Material
and Methods.
Statistical Analysis. Data are expressed as means ±SEM. Differences between
two groups were assessed using the unpaired two-tailed Student ttest. Data
sets that involved more than two groups were assessed using ANOVA followed
by Newman-Keuls post hoc tests. Correlations were analyzed using Pearsons
correlation. In the gures, data with different superscript letters are signi-
cantly different at P<0.05, according to post hoc ANOVA statistical analyses.
Data were analyzed using GraphPad Prism version 5.00 forWindows (GraphPad
Software). The results were considered statistically signicant when P<0.05.
ACKNOWLEDGMENTS. We thank R. M. Goebbels for histological assistance,
and B. Es Saadi and R. Selleslagh for technical assistance. P.D.C. is a research
associate from the Fonds de la Recherche Scientique (FRS-FNRS, Belgium)
and is the recipient of FSR and FRSM (Fonds Spéciaux de Recherches, Univer-
sité catholique de Louvain, Belgium; Fonds de la Recherche Scientique Méd-
icale, Belgium) and Société Francophone du Diabète (France) subsidies. A.E. is
a doctoral fellow from the FRS-FNRS. G.G.M. is the recipient of subsidies from
the FSR and FRSM and from FRS-FNRSGrant FRFC 2.4555.08.J.P.O. and C.B. were
funded by European Research Council Advance Grant 250172-MicrobesInside,
awarded to W.M.d.V., whose work was further supported by a n unrestricted
Spinoza Aw ard of the Nether land s Organiz atio n for Scientic Research.
1. Turnbaugh PJ, et al. (2006) An obesity-associated gut microbiome with increased
capacity for energy harvest. Nature 444(7122):10271031.
2. Osborn O, Olefsky JM (2012) The cellular and signaling networks linking the immune
system and metabolism in disease. Nat Med 18(3):363374.
3. Cani PD, et al. (2008) Changes in gut microbiota control metabolic endotoxemia-
induced inammation in high-fat diet-induced obesity and diabetes in mice. Diabetes
57(6):14701481.
4. Cani PD, et al. (2009) Changes in gut microbiota control inammation in obese mice
through a mechanism involving GLP-2-driven improvement of gut permeability. Gut
58(8):10911103.
5. Muccioli GG, et al. (2010) The endocannabinoid system links gut microbiota to adi-
pogenesis. Mol Syst Biol 6:392.
6. Cani PD, Osto M, Geurts L, Everard A (2012) Involvement of gut microbiota in the
development of low-grade inammation and type 2 diabetes associated with obesity.
Gut Microbes 3(4):279288.
7. Cani PD, et al. (2007) Metabolic endotoxemia initiates obesity and insulin resistance.
Diabetes 56(7):17611772.
8. Wells JM, Rossi O, Meijerink M, van Baarlen P (2011) Epithelial crosstalk at the mi-
crobiota-mucosal interface. Proc Natl Acad Sci USA 108(Suppl 1):46074614.
9. Johansson ME, Larsson JM, Hansson GC (2011) The two mucus layers of colon are
organized by the MUC2 mucin, whereas the outer layer is a legislator of host-microbial
interactions. Proc Natl Acad Sci USA 108(Suppl 1):46594665.
10. Bevins CL, Salzman NH (2011) Paneth cells, antimicrobial peptides and maintenance
of intestinal homeostasis. Nat Rev Microbiol 9(5):356368.
11. Pott J, Hornef M (2012) Innate immune signalling at the intestinal epithelium in
homeostasis and disease. EMBO Rep 13(8):684698.
12. Hooper LV, Macpherson AJ (2010) Immune adaptations that maintain homeostasis
with the intestinal microbiota. Nat Rev Immunol 10(3):159169.
13. Macpherson AJ, Geuking MB, Slack E, Hapfelmeier S, McCoy KD (2012) The habitat,
double life, citizenship, and forgetfulness of IgA. Immunol Rev 245(1):132146.
14. Cani PD (2012) Crosstalk between the gut microbiota and the endocannabinoid sys-
tem: impact on the gut barrier function and the adipose tissue. Clin Microbiol Infect
18(Suppl 4):5053.
15. Alhouayek M, Lambert DM, Delzenne NM, Cani PD, Muccioli GG (2011) Increasing
endogenous 2-arachidonoylglycerol levels counteracts colitis and related systemic
inammation. FASEB J 25(8):27112721.
16. Ben-Shabat S, et al. (1998) An entourage effect: Inactive endogenous fatty acid
glycerol esters enhance 2-arachidonoyl-glycerol cannabinoid activity. Eur J Pharmacol
353(1):2331.
17. Hansen KB, et al. (2011) 2-Oleoyl glycerol is a GPR119 agonist and signals GLP-1 re-
lease in humans. J Clin Endocrinol Metab 96(9):E1409E1417.
18. Derrien M, Vaughan EE, Plugge CM, de Vos WM (2004) Akkermansia muciniphila gen.
nov., sp. nov., a human intestinal mucin-degrading bacterium. Int J Syst Evol Microbiol
54(Pt 5):14691476.
19. Belzer C, de Vos WM (2012) Microbes insidefrom diversity to function: The case of
Akkermansia.ISME J 6(8):14491458.
20. Santacruz A, et al. (2010) Gut microbiota composition is associated with body weight,
weight gain and biochemical parameters in pregnant women. Br J Nutr 104(1):8392.
21. Karlsson CL, et al. (2012) The microbiota of the gut in preschool children with normal
and excessive body weight. Obesity (Silver Spring) 20(11):22572261.
22. Collado MC, Isolauri E, Laitinen K, Salminen S (2008) Distinct composition of gut
microbiota during pregnancy in overweight and normal-weight women. Am J Clin
Nutr 88(4):894899.
23. Everard A, et al. (2011) Responses of gut microbiota and glucose and lipid metabolism
to prebiotics in genetic obese and diet-induced leptin-resistant mice. Diabetes 60(11):
27752786.
24. Hansen CH, et al. (2012) Early life treatment with vancomycin propagates Akker-
mansia muciniphila and reduces diabetes incidence in the NOD mouse. Diabetologia
55(8):22852294.
25. Qin J, et al. (2012) A metagenome-wide association study of gut microbiota in type 2
diabetes. Nature 490(7418):5560.
26. Derrien M, et al. (2011) Modulation of mucosal immune response, tolerance, and
proliferation in mice colonized by the mucin-degrader Akkermansia muciniphila.
Front Microbiol 2:166.
27. Ottman N, Smidt H, de Vos WM, Belzer C (2012) The function of our microbiota: Who
is out there and what do they do? Front Cell Infect Microbiol 2:104.
28. Turnbaugh PJ, Bäckhed F, Fulton L, Gordon JI (2008) Diet-induced obesity is linked to
marked but reversible alterations in the mouse distal gut microbiome. Cell Host Mi-
crobe 3(4):213223.
29. Kleessen B, Hartmann L, Blaut M (2003) Fructans in the diet cause alterations of in-
testinal mucosal architecture, released mucins and mucosa-associated bidobacteria
in gnotobiotic rats. Br J Nutr 89(5):597606.
30. Mohamadzadeh M, et al. (2011) Regulation of induced colonic inammation by
Lactobacillus acidophilus decient in lipoteichoic acid. Proc Natl Acad Sci USA
108(Suppl 1):46234630.
31. Fåk F, Bäckhed F (2012) Lactobacillus reuteri prevents diet-induced obesity, but not
atherosclerosis, in a strain dependent fashion in Apoe-/- Mice. PLoS ONE 7(10):e46837.
32. Chen JJ, Wang R, Li XF, Wang RL (2011) Bidobacterium longum supplementation
improved high-fat-fed-induced metabolic syndrome and promoted intestinal Reg I
gene expression. Exp Biol Med (Maywood) 236(7):823831.
33. An HM, et al. (2011) Antiobesity and lipid-lowering effects of Bidobacterium spp. in
high fat diet-induced obese rats. Lipids Health Dis 10:116.
34. Gaufn Cano P, Santacruz A, Moya A, Sanz Y (2012) Bacteroides uniformis CECT 7771
ameliorates metabolic and immunological dysfunction in mice with high-fat-diet in-
duced obesity. PLoS ONE 7(7):e41079.
35. van Passel MW, et al. (2011) The genome of Akkermansia muciniphila, a dedicated
intestinal mucin degrader, and its use in exploring intestinal metagenomes. PLoS ONE
6(3):e16876.
36. Cani PD, et al. (2007) Selective increases of bidobacteria in gut microora improve
high-fat-diet-induced diabetes in mice through a mechanism associated with endo-
toxaemia. Diabetologia 50(11):23742383.
37. Greenblum S, Turnbaugh PJ, Borenstein E (2012) Metagenomic systems biology of the
human gut microbiome reveals topological shifts associated with obesity and in-
ammatory bowel disease. Proc Natl Acad Sci USA 109(2):594599.
38. Vaishnava S, et al. (2011) The antibacterial lectin RegIIIgamma promotes the spatial
segregation of microbiota and host in the intestine. Science 334(6053):255258.
39. Rajili
c-Stojanovi
c M, Shanahan F, Guarner F, de Vos WM (2013) Phylogenetic analysis
of dysbiosis in ulcerative colitis during remission. Inamm Bowel Dis 19(3):481488.
40. Geurts L, et al. (2011) Altered gut microbiota and endocannabinoid system tone in
obese and diabetic leptin-resistant mice: impact on apelin regulation in adipose
tissue. Front Microbiol 2:149.
6of6
|
www.pnas.org/cgi/doi/10.1073/pnas.1219451110 Everard et al.
Supporting Information
Everard et al. 10.1073/pnas.1219451110
SI Materials and Methods
Mice. Experiment 1: Ob/Ob experiments. For ob/ob vs. lean study, 6-
wk-old ob/ob (n=5 per group) mice (C57BL/6 background,
Jackson Laboratories) were housed in a controlled environment
(12-h daylight cycle, lights off at 0600 hours) in groups of two or
three mice per cage, with free access to food and water. The
mice were fed a control diet (A04) for 16 wk. Cecal content was
harvested immersed in liquid nitrogen and stored at 80 °C for
further Akkermansia muciniphila analysis.
Experiment 2: Ob-prebiotic study. Six-week-old ob/ob (n=10 per
group) mice (C57BL/6 background, Jackson Laboratories) were
housed in a controlled environment (12-h daylight cycle, lights off
at 0600 hours) in groups of two mice/cage, with free access to food
and water. The mice were fed a control diet (A04) or a control diet
supplemented with prebiotics (oligofructose) (10 g/100 g of diet)
(Orafti) for 5 wk as previously described (1). This set of mice has
been previously characterized by Everard et al. (1).
Experiment 3: High-fat diet prebiotics experiments. A set of 10-wk-old
C57BL/6J mice (40 mice, n=10 per group) (Charles River
Laboratories) were housed in groups of ve mice per cage, with
free access to food and water. The mice were fed a control diet
(A04) or a control diet supplemented with prebiotics (oligo-
fructose) (Orafti) (0.3 g per mouse per day) added in tap water,
or fed a high-fat (HF) diet [60% fat and 20% carbohydrates
(kcal/100 g), D12492; Research Diet] or an HF diet supple-
mented with oligofructose (0.3 g per mouse per day) added in
tap water. Treatment continued for 8 wk.
Experiment 4: HF diet A. muciniphila treatment. A set of 10-wk-old
C57BL/6J mice (40 mice, n=10 per group) (Charles River
Laboratories) were housed in groups of 2 mice per cage (lter-top
cages), with free access to food and water. The mice were fed
a control diet (AIN93Mi; Research Diet) or an HF diet [60% fat
and 20% carbohydrates(kcal/100 g), D12492; Research Diet].
A. muciniphila was daily administered by oral gavage at the dose
2.10
8
cfu/0.2 mL suspended in sterile anaerobic PBS (HF-Akk).
Treatment continued for 4 wk. Control and HF groups were
treated daily with an oral gavage of an equivalent volume of sterile
anaerobic PBS for 4 wk. In all cases the sterile anaerobic PBS (pH
7) was supplemented with 0.05% cysteine·HCl, degassed with N
2
,
sealed in serum bottles with butyl rubber stoppers under anaer-
obic conditions provided by a gas phase of 1.8 atm N
2
/CO
2
(80:20,
vol/vol); this is referred as sterile anaerobic PBS.
A. muciniphila MucT (ATTC BAA-835) was grown anaerobi-
cally in a basal mucin-based medium as previously described (2).
The cultures were washed and concentrated in anaerobic PBS
that included 25% (vol/vol) glycerol (reduced with one drop of
100 mM titanium citrate) to an end concentration of 1.10
10
cfu/
mL under strict anaerobic conditions. Subsequently, the cultures
were immediately frozen and stored at 80 °C. A representative
glycerol stock was thawed under anaerobic conditions to de-
termine the cfu/mL by plate counting using mucin media con-
taining 1% agarose (agar noble; Difco). Before administration by
oral gavage, the glycerol stocks were thawed under anaerobic
conditions and diluted with anaerobic PBS to an end concentra-
tion of 2.10
8
viable cfu/0.2 mL. A. muciniphila was inoculated in its
basal media as previously described (2), supplemented with Ca-
sitone (8 g/L) (Bacto Casitone; BD), and oligofructose (50 g/L) as
sole carbon source. The growth was analyzed in triplicate by
measuring absorbance at 600 nm. No growth was observed.
Experiment 4: HFD A. muciniphila alive vs. heat-killed and Lactobacillus
plantarum WCFS1. A set of 10-wk-old C57BL/6J mice (40 mice, n=
8 per group) (Charles River Laboratories) were housed in
groups of 2 mice per cage (lter-top cages), and mice had free
access to food and water. The mice were fed the same control
diet or an HF diet as described above. A. muciniphila was daily
administered by oral gavage at the dose 2.10
8
cfu/0.2 mL sus-
pended in sterile anaerobic PBS. A. muciniphila was heat-killed
by autoclaving (15 min, 121 °C, 225 kPa). A viability check by
culturing on mucin-containing medium conrmed the absence of
any viable cells. Lactobacillus plantarum WCFS1 was grown an-
aerobically in MRS medium (Difco Lactobacilli MRS broth;
BD), washed, concentrated, and manipulated an identical way as
the A. muciniphila preparation. The two control groups (CT and
HF) were treated daily with an oral gavage of an equivalent
volume of sterile anaerobic PBS containing a similar end con-
centration of glycerol (2.5%) (reduced with one drop of 100 mM
titanium citrate) as the treatment groups for 4 wk. The viability
of A. muciniphila was conrmed by serially diluting the cecal and
fecal content immediately postmortem in anaerobe basal mucin-
based medium (2) and conrmed with A. muciniphila-specic
PCR primers (detailed below).
Food and water intake were recorded once per week. Pellets
and spillage were weighed separately. Values for the weekly
assessment were calculated on the basis of two mice per cage and
ve cages per group (n=10 mice per group); the data were
reported as cumulative food intake per mouse.
Body composition was assessed by using 7.5 MHz time domain-
NMR (LF50 minispec; Bruker).
All mouse experiments were approved by and performed in
accordance with the guidelines of the local ethics committee.
Housing conditions were specied by the Belgian Law of April 6,
2010, regarding the protection of laboratory animals (agreement
number LA1230314).
Tissue Sampling. The animals were anesthetized with isourane
(Forene; Abbott) before exsanguination and tissue sampling, then
mice were killed by cervical dislocation. Adipose depots (epi-
didymal, s.c., and mesenteric) and liver were precisely dissected
and weighed; the addition of the three adipose tissues corresponds
to the adiposity index. The intestinal segments (ileum, cecum, and
colon), cecal content, and adipose tissues were immersed in liquid
nitrogen and stored at 80 °C for further analysis.
Mucus Layer Thickness. Proximal colon segments were immediately
removed and xed in Carnoys solution (ethanol 6: acid acetic 3:
chloroform 1, vol/vol) for 2 h at 4 °C. They were then immersed
in ethanol 100% for 24 h. Parafn sections of 5 μm were stained
with alcian blue. A minimum of 20 different measurements were
made perpendicular to the inner mucus layer per eld. Five to
nineteen randomly selected elds were analyzed for each colon
for a total of 4,549 measurements by using an image analyzer
(Motic-image Plus 2.0ML; Motic).
RNA Preparation and Real-Time Quantitative PCR Analysis. Total
RNA was prepared from tissues using TriPure reagent (Roche).
Quantication and integrity analysis of total RNA was performed
by running 1 μL of each sample on an Agilent 2100 Bioanalyzer
(Agilent RNA 6000 Nano Kit). cDNA was prepared by reverse
transcription of 1 μg total RNA using a Reverse Transcription
System Kit (Promega). Real-time PCRs were performed with the
StepOnePlus real-time PCR system and software (Applied Bio-
systems) using Mesa Fast qPCR (Eurogentec) for detection ac-
cording to the manufacturers instructions. RPL19 RNA was
chosen as the housekeeping gene. All samples were run in
Everard et al. www.pnas.org/cgi/content/short/1219451110 1of5
duplicate in a single 96-well reaction plate, and data were ana-
lyzed according to the 2
-ΔCT
method. The identity and purity of
the amplied product was checked through analysis of the melting
curve carried out at the end of amplication. Primer sequences for
the targeted mouse genes are presented in Table S1.
Insulin Resistance Index. Insulin resistance index was determined by
multiplying the area under the curve (0 min and 15 min) of both
blood glucose and plasma insulin obtained after an oral glucose
load (2 g of glucose per kg of body weight) performed after 4 wk
(A. muciniphila study) of treatment. Food was removed 2 h after
the onset of the daylight cycle, and mice were treated after a 6-h
fasting period as previously described (1).
Biochemical Analyses. Portal vein blood LPS concentration was
measured using an Endosafe-Multi-Cartridge System (Charles
River Laboratories) based on the Limulus amaebocytelysate (LAL)
kinetic chromogenic methodology that measures color intensity
directly related to the endotoxin concentration in a sample. Serum
were diluted 1/10 with endotoxin-free buffer to minimize interfer-
ences inthe reaction (inhibition or enhancement)and heated 15 min
at 70 °C. Each sample was diluted 1/70 or 1/100 with endotoxin-free
LAL reagent water (Charles River Laboratories) and treated in
duplicate, and two spikes for each sample were included in the
determination. All samples have been validated for the recovery
and the coefcient variation. The lower limit of detection was 0.005
EU/mL. Plasma insulin concentration was determined in 25 μLof
plasma using an ELISA kit (Mercodia) according to the manu-
facturer instructions.
DNA Isolation from Mouse Cecal Samples. The cecal content of mice
collected postmortem was stored at 80 °C. Metagenomic DNA
was extracted from the cecal content using a QIAamp-DNA stool
minikit (Qiagen) according to the manufacturers instructions.
Measurement of Endocannabinoids Intestinal Levels. Ileon tissues
were homogenized in CHCl
3
(10 mL), and a deuterated stan-
dards (200 pmol) were added. The extraction and the calibration
curves were generated as previously described (3), and the data
were normalized by tissue sample weight.
qPCR: Primers and Conditions. The primers and probes used to detect
A. muciniphila were based on 16S rRNA gene sequences: for-
ward A. muciniphila, CAGCACGTGAAGGTGGGGAC, reverse
A. muciniphila, CCTTGCGGTTGGCTTCAGAT. Detection was
achieved with StepOnePlus real-time PCR system and software
(Applied Biosystems) using Mesa Fast qPCR (Eurogentec) ac-
cording to the manufacturers instructions. Each assay was per-
formed in duplicate in the same run. The cycle threshold of each
sample was then compared with a standard curve (performed
in triplicate) made by diluting genomic DNA (vefold serial di-
lution) (DSMZ). The data are expressed as log of bacteria per g of
cecal content.
Mouse Intestinal Tract Chip: PCR Primers and Conditions. The Mouse
Intestinal Tract Chip (MITChip) is a phylogenetic microarray
consisting of 3,580 different oligonucleotides specic for the
mouse intestinal microbiota. Both the design and analysis of the
MITChip were performed as previously described (1, 4).
Statistical Analysis. Data are expressed as means ±SEM. Differ-
ences between two groups were assessed using the unpaired two-
tailed Student ttest. Data sets involving more than two groups were
assessed by ANOVA followed by Newman-Keuls post hoc tests
after normalization by log transformation. Correlations were ana-
lyzed using Pearsons correlation. Data with different superscript
letters are signicantly different P<0.05, according to post hoc
ANOVA statistical analysis. Data were analyzed using GraphPad
Prism version 5.00 for windows (GraphPad Software). Results
were considered statistically signicant when P<0.05.
1. Everard A, et al. (2011) Responses of gut microbiota and glucose and lipid metabolism
to prebiotics in genetic obese and diet-induced leptin-resistant mice. Diabetes 60(11):
27752786.
2. Derrien M, Vaughan EE, Plugge CM, de Vos WM (2004) Akkermansia muciniphila gen.
nov., sp. nov., a human intestinal mucin-degrading bacterium. Int J Syst Evol Microbiol
54(Pt 5):14691476.
3. Muccioli GG, et al. (2010) The endocannabinoid system links gut microbiota to
adipogenesis. Mol Syst Biol 6:392.
4. Geurts L, et al. (2011) Altered gut microbiota and endocannabinoid system tone in
obese and diabetic leptin-resistant mice: Impact on apelin regulation in adipose tissue.
Front Microbiol 2:149.
Fig. S1. Prebiotic-treated mice on an HF diet exhibited a decrease in s.c., mesenteric, and epididymal fat mass and in body weight. (A) s.c., mesenteric, and
epididymal fat depot weights (g per 100 g body weight) measured in control diet-fed mice (CT), control diet-fed mice treated with prebiotics (CT-Pre), HF diet-
fed mice (HF), and HF diet-fed mice treated with prebiotics (HF-Pre) (n=10). (B) Final fat mass expressed in percentage of nal body weight and measured by
time-domain NMR (n=10). (C) Final body weight (n=10). (D) Pearsons correlation between adipose tissue CD11c mRNA levels and A. muciniphila abundance
(log
10
of bacteria per g of cecal content) measured in the cecal content; (Inset) Pearsons correlation coefcient (r) and the corresponding Pvalue. (E) Pearsons
correlation between adipose tissue mass gain and cecal content of A. muciniphila (log
10
of bacteria per g of cecal content); (Inset) Pearsons correlation co-
efcient (r) and the corresponding Pvalue. Data are shown as means ±SEM. Data with different superscript letters are signicantly different (P<0.05) ac-
cording to post hoc ANOVA one-way statistical analysis.
Everard et al. www.pnas.org/cgi/content/short/1219451110 2of5
Fig. S2. Daily oral gavage with A. muciniphila restored A. muciniphila to basal levels in the cecal content without modifying gut microbiota composition. (A)
A. muciniphila abundance (log
10
of bacteria per g of cecal content) measured in the cecal content of mice treated with a daily oral gavage containing
A. muciniphila (2.10
8
bacterial cells suspended in 200 μL of sterile anaerobic PBS) and fed a control (CT-Akk) or HF diet (HF-Akk), compared with mice fed
a control (CT) or HF diet (HF) that were treated with a daily oral gavage containing an equivalent volume of sterile anaerobic PBS for 4 wk (n=10). (B)
Dendrogram clustering of the MITChip phylogenetic ngerprints of the gut microbiota. (C) Representational difference analysis (RDA) plot based on MITChip
phylogenetic ngerprints of the gut microbiota; CT-Akk is noted as CTA, and HF-fed mice that received A. muciniphila are noted as HFA. Data are shown as
means ±SEM. Data with different superscript letters are signicantly different (P<0.05) according to post hoc ANOVA one-way statistical analysis.
Everard et al. www.pnas.org/cgi/content/short/1219451110 3of5
Fig. S3. A. muciniphila treatment reduced s.c., mesenteric, and epididymal fat mass, body weight, and insulin resistance in mice on an HF diet without af-
fecting food intake. (A) s.c., mesenteric, and epididymal fat depot weights (g per 100 g body weight) measured in mice treated daily with an oral gavage of
A. muciniphila and fed a control (CT-Akk) or HF diet (HF-Akk) or mice fed a control (CT) or HF diet and treated daily with an oral gavage of sterile anaerobic PBS
(n=10). (B) Final body weight (n=10). (C) Final fat and lean mass expressed in percentage of nal body weight and measured by time-domain NMR (n=10).
(D) Cumulative food intake (g) over the 4 wk of treatment. (E) Insulin resistance index was determined by multiplying the area under the curve (from 0 min to
15 min) of blood glucose and plasma insulin that were obtained after an oral glucose load (2 g glucose per kg of body weight) after 4 wk of treatment (n=10).
Data are shown as means ±SEM. Data with different superscript letters are signicantly different (P<0.05) according to post hoc ANOVA one-way
statistical analysis.
Fig. S4. A. muciniphila treatment exerted minor effects on antibacterial peptide contents in the ileum and IgA levels in the feces. Antibacterial peptide mRNA
expression: (A) regenerating islet-derived 3-γ(RegIIIγ, encoded by Reg3g), (B) phospholipase A2 group IIA (encoded by Pla2g2a), (C)α-defensins (encoded by
Defa), and (D) lysozyme C (encoded by Lyz1) measured in the ileum of mice treated daily with an oral gavage of A. muciniphila (2.10
8
bacterial cells suspended
in 200 μL of sterile anaerobic PBS) and fed a control (CT-Akk) or HF-diet (HF-Akk) or mice fed a control (CT) or HF diet and treated daily with an oral gavage of
an equivalent volume of sterile anaerobic PBS for 4 wk (n=10). (E) Fecal IgA levels (μg/g of feces). Data are shown as means ±SEM. Data with different
superscript letters are signicantly different (P<0.05) according to post hoc ANOVA one-way statistical analysis.
Fig. S5. Heat-Killed A. muciniphila did not reduce s.c., mesenteric, and epididymal fat mass and did not increase colon antimicrobial peptides in mice on an HF
diet. (A) s.c., mesenteric, and epididymal fat depot weights (g per 100 g body weight) measured in control mice fed a control (CT) or HF diet (HF) and treated
with a daily oral gavage containing sterile anaerobic PBS and glycerol for 4 wk daily. Treated mice received an oral gavage of alive A. muciniphila (HF-Akk) or
killed A. muciniphila (HF-K-Akk) (2.10
8
bacterial cells suspended in 200 μL of sterile anaerobic PBS) and fed a HF diet (n=8). (B) mRNA expression of colon
RegIIIγ(encoded by Reg3g) mRNA expression (n=818); data represent the results from the two A. muciniphila studies. Data are shown as means ±SEM. Data
with different superscript letters are signicantly different (P<0.05) according to post hoc ANOVA one-way statistical analysis.
Everard et al. www.pnas.org/cgi/content/short/1219451110 4of5
Fig. S6. L. plantarum did not reduce fat mass and did not improve adipose tissue metabolism and gut barrier function in diet-induced obese mice. Control
mice were fed a control (CT) or HF diet (HF) and treated with a daily oral gavage containing sterile anaerobic PBS and glycerol for 4 wk daily. Treated mice
received an oral gavage of L. plantarum (HF-LP) (2.10
8
bacterial cells suspended in 200 μL of sterile anaerobic PBS) and fed a HF diet (n=78). (A) Final fat mass
measured by time-domain NMR (n=78). s.c., mesenteric, and epididymal fat depot weights (g per 100 g body weight) (n=78). (B) mRNA expression of
markers of adipocyte differentiation (Cebpa), lipogenesis (Acc1;Fasn), and lipid oxidation (Cpt1; Acox1;Pgc1a; and Ppara) was measured in visceral fat depots
(mesenteric fat) (n=78). (C) Thickness of the mucus layer measured by histological analyses after alcian blue staining (n=46). (D) Portal vein serum LPS levels
(n=67). (E) mRNA expression of colon RegIIIγ(encoded by Reg3g) mRNA expression (n=818). Data are shown as means ±SEM. Data with different su-
perscript letters are signicantly different (P<0.05) according to post hoc ANOVA one-way statistical analysis.
Table S1. Primer sequences
Primer Forward sequence Reverse sequence
RPL-19 GAAGGTCAAAGGGAATGTGTTCA CCTGTTGCTCACTTGT
Reg3g TTCCTGTCCTCCATGATCAAA CATCCACCTCTGTTGGGTTC
Lyz1 GCCAAGGTCTACAATCGTTGTGAGTTG CAGTCAGCCAGCTTGACACCACG
Pla2g2a AGGATTCCCCCAAGGATGCCAC CAGCCGTTTCTGACAGGAGTTCTGG
CD11cc ACGTCAGTACAAGGAGATGTTGGA ATCCTATTGCAGAATGCTTCTTTACC
Defa GGTGATCATCAGACCCCAGCATCAGT AAGAGACTAAAACTGAGGAGCAGC
Fasn TTCCAAGACGAAAATGATGC AATTGTGGGATCAGGAGAGC
Cpt1a AGACCGTGAGGAACTCAAACCTAT TGAAGAGTCGCTCCCACT
Pgc1a AGCCGTGACCACTGACAACGAG GCTGCATGGTTCTGAGTGCTAAG
Ppara CAACGGCGTCGAAGACAAA TGACGGTCTCCACGGACAT
Acox1 CTATGGGATCAGCCAGAAAGG AGTCAAAGGCATCCACCAAAG
Acc1 TGTTGAGACGCTGGTTTGTAGAA GGTCCTTATTATTGTCCCAGACGTA
Cebpa GAGCCGAGATAAAGCCAAACA GCGCAGGCGGTCATTG
G6pc AGGAAGGATGGAGGAAGGAA TGGAACCAGATGGGAAAGAG
Everard et al. www.pnas.org/cgi/content/short/1219451110 5of5
... Obesity and poor metabolic health status correlate with lower abundance of Akkermansia muciniphila (Verrucomicrobia phylum) in the gut [81,82]. A. muciniphila is a Gram-negative bacterium, present in 90% of people and constitutes between 1 and 5% of total colon microbiota composition [83]. ...
... Certain components of gut microbiota, particularly the presence of A. muciniphila, not only exert a strong impact on the metabolism on the cellular level but are also able to change the systemic energy expenditure, which translates to the level of adiposity and body composition. In obese individuals or in HFD-fed obese mice, the progressive dysbiosis leads to a decreased percentage of A. muciniphila in gut microbiota [82]. The restoration of the diminished population of this bacterial species in obese mice increased the expression of PPARα-driven genes involved in the fatty acid catabolic program, i.e., PPARα, CPT1A, PGC-1 α and ACOX in adipocytes, which resulted in the improvement of the fat mass to lean mass ratio [82] (Table 2). ...
... In obese individuals or in HFD-fed obese mice, the progressive dysbiosis leads to a decreased percentage of A. muciniphila in gut microbiota [82]. The restoration of the diminished population of this bacterial species in obese mice increased the expression of PPARα-driven genes involved in the fatty acid catabolic program, i.e., PPARα, CPT1A, PGC-1 α and ACOX in adipocytes, which resulted in the improvement of the fat mass to lean mass ratio [82] (Table 2). In this study, the metabolic effects were accompanied by the recovery of the intestinal mucus layer thickness and were evoked only by live, but not heat killed (autoclaved) A. miciniphila [82]. ...
Article
Full-text available
Citation: Grabacka, M.; Płonka, P.M.; Pierzchalska, M. The PPARα Regulation of the Gut Physiology in Regard to Interaction with Microbiota, Intestinal Immunity, Metabolism, and Permeability. Int. J. Mol. Sci. 2022, 23, 14156. https:// Abstract: Peroxisome proliferator-activated receptor alpha (PPARα) is expressed throughout the mammalian gut: in epithelial cells, in the villi of enterocytes and in Paneth cells of intestinal crypts, as well as in some immune cells (e.g., lamina propria macrophages, dendritic cells) of the mucosa. This review examines the reciprocal interaction between PPARα activation and intestinal microbiota. We refer to the published data confirming that microbiota products can influence PPARα signaling and, on the other hand, PPARα activation is able to affect microbiota profile, viability, and diversity. PPARα impact on the broad spectrum of events connected to metabolism, signaling (e.g., NO production), immunological tolerance to dietary antigens, immunity and permeability of the gut are also discussed. We believe that the phenomena described here play a prominent role in gut homeostasis. Therefore, in conclusion we propose future directions for research, including the application of synthetic activators and natural endogenous ligands of PPARα (i.e., endocannabinoids) as therapeutics for intestinal pathologies and systemic diseases assumed to be related to gut dysbiosis.
... Furthermore, oral administration of live and pasteurised Akkermansia and its extracellular vesicles could normalise the composition of the gut microbiota, ameliorate intestinal permeability, regulate inflammatory responses, and subsequently prevent liver injury in highfat diet (HFD)-and carbon tetrachloride (CCl4)-treated mice [77]. However, some studies have shown that Akkermansia does not improve the composition of the gut microbiota [78,79]. ...
... In addition to mucin degradation, Akkermansia has been found to stimulate mucin production. In animal models, Akkermansia restores the thickness of the intestinal mucus layer [78], increases the number of goblet cells [72] and enhances the expression of tight junction proteins (Occludin and ZO-1) in the intestinal mucosa [70]. Our study showed that supplementation with Akkermansia also significantly improved the intestinal mucosal barrier and permeability and reduced LPS infiltration into the systemic circulation. ...
... In previous studies, inactivated Akkermansia was found to improve intestinal barrier functions owing to an interaction between toll-like receptor 2 (TLR2) and Amuc_1100, a specific protein in the outer membrane of Akkermansia [71]. Nevertheless, no similar protective effects were observed from heat-killed Akkermansia in our study, which conforms to previous research findings [78]. A possible reason for the results in our study is that Akkermansia promotes the growth of beneficial microbiota producing SCFAs, improves the intestinal barrier, prevents LPS from penetrating the blood circulation to a certain extent and reduces inflammation. ...
Article
Full-text available
Background Vascular calcification is a major cause of the high morbidity and mortality of cardiovascular diseases and is closely associated with the intestinal microbiota. Short-chain fatty acids (SCFAs) are derived from the intestinal microbiota and can also regulate intestinal microbiota homeostasis. However, it remains unclear whether exogenous supplementation with propionate, a SCFA, can ameliorate vascular calcification by regulating the intestinal microbiota. This study was conducted to explore the roles of propionate and the intestinal microbiota in the process of vascular calcification. Methods In total, 92 patients were enrolled consecutively as the observational cohort to analyse the relationship between SCFAs and vascular calcification in both blood and faecal samples. A rat model of vascular calcification was induced by vitamin D3 and nicotine (VDN) to validate the effect of propionate. Differences in the intestinal microbiota were analysed by 16S ribosomal RNA gene sequencing. Faecal microbiota transplantation and Akkermansia muciniphila transplantation experiments were performed to evaluate the functions of the intestinal microbiota. Results The results of the observational cohort study revealed that the levels of SCFAs (particularly propionate) in both blood and faecal samples independently correlated negatively with calcification scores ( P < 0.01). To verify the activities of propionate, it was provided to VDN-treated rats, and oral or rectal propionate delivery reshaped the intestinal microbiota, resulted in elevated SCFA production, improved intestinal barrier function and alleviated inflammation, ultimately ameliorating vascular calcification. Furthermore, we demonstrated that transplantation of the propionate-modulated intestinal microbiota induced beneficial outcomes similar to those with oral or rectal propionate administration. Interestingly, linear discriminant analysis (LDA) effect size (LEfSe) revealed that oral or rectal propionate administration and propionate-modulated intestinal microbiota transplantation both enriched primarily Akkermansia . Subsequently, we demonstrated that Akkermansia supplementation could ameliorate VDN-induced vascular calcification in rats. Conclusions Propionate can significantly ameliorate vascular calcification in VDN-treated rats, and this effect is mediated by intestinal microbiota remodelling. The findings in our study indicate that the intestinal tract-vessel axis is a promising target for alleviating vascular calcification.
... Our study has shown the breakthrough result that tumor development is normally suppressed by antibiotics but not in an obesity model. Margaret et al. reported that changes in the gut microbiome associated with inflammation directly contributed to tumorigenesis and that interventions to change the composition of the microbiome might prevent CRC development (Amandine et al. 2013;Cho et al. 2014). Unfortunately, the results of our experiment confirmed that the gut microbiome might not be involved in the tumorigenesis of obesity-related CRC in KKAy mice, although this was not the case in WT mice. ...
... KKAy obese mouse model, WT wild type of WT, and it cannot be said unconditionally that butyric acid production is correlated with these three species. It has also been reported that Akkermansia muciniphila is increased in human CRC, although this phenomenon may be a result of CRC development (Amandine et al. 2013;Weir et al. 2013). One hypothesis is that "driver bacteria" and "passenger bacteria" could correlate with this (Tjalsma et al. 2012). ...
Article
Full-text available
Purpose Obesity is a risk factor for colorectal cancer (CRC), and the intestinal microbiome is considered to contribute to CRC and obesity. Nonetheless, the role of the intestinal microbiome in obesity-related CRC is unclear. This study aimed to clarify the relationship between obesity-related CRC and the intestinal microbiome using a mouse model. Methods We compared an obese and insulin-resistant type 2 diabetes mouse model [KKAy] to wild-type mice (WT) [C57BL/6 J]. Azoxymethane was intraperitoneally injected to develop a mouse model CRC. At 26 weeks, we compared the number of tumors and the intestinal microbiome. We also compared them across two models, namely, antibiotic cocktail and co-housing. Results In all models, KKAy mice had a significantly greater number of tumors than WT mice. Analysis showed that the distribution of the intestinal microbiome changed in both models; however, no difference in tumor development was observed. Tumor expression was suppressed only in the antibiotic cocktail model of WT, whereas KKAy mice bore tumors (C57Bl/6 J: KKAy, 0/9:8/8; p < 0.001). KKAy mice remained predominantly tumor-bearing in all treatments. Conclusion Based on the results, the intestinal microbiome may not be associated with tumorigenesis in obesity-related CRC. It may be necessary to think of other facts linked to obesity-related CRC.
... We observe that in the SI, $15% of microbes oscillate on RC, many of which are eliminated by HF ( Figure 2E), corroborating previous findings in the distal GI tract (Leone et al., 2015;Thaiss et al., 2014;Zarrinpar et al., 2014). We reveal that diet-induced obesity is not only associated with decreased small intestinal Reg3g expression (Everard et al., 2013(Everard et al., , 2014Vaishnava et al., 2011) but also HF-induced gut dysbiosis suppresses both its overall and rhythmic expression patterns (Figures 1B and 3A). Our work supports the idea that diet overwhelms genetics in shaping microbial SI membership, where HF elicits a greater influence than Reg3g genetic deletion (Figures 2, 5, and 6), confirming previous studies in the distal GI tract (Carmody et al., 2015;Devkota et al., 2012). ...
... The amount of viable Akkermansia muciniphila cells in the gut mucosal layer was reported to decrease in both obese and type 2 diabetic mice, as compared to healthy animals. In addition, treatment with A. muciniphila reversed the above conditions, caused by either high-fat diets or insulin resistance [169]. It is currently accepted that there is a crosstalk between the gut microbiota and dietary lipids, aggravating white adipose tissue inflammation in a process involving TLRs and chemokine CCL2 [165]. ...
Article
Full-text available
The microbiota present in the gastrointestinal tract is involved in the development or prevention of food allergies and autoimmune disorders; these bacteria can enter the gallbladder and, depending on the species involved, can either be benign or cause significant diseases. Occlusion of the gallbladder, usually due to the presence of calculi blocking the bile duct, facilitates microbial infection and inflammation, which can be serious enough to require life-saving surgery. In addition, the biliary salts are secreted into the intestine and can affect the gut microbiota. The interaction between the gut microbiota, pathogenic organisms, and the human immune system can create intestinal dysbiosis, generating a variety of syndromes including the development of food allergies and autoimmune disorders. The intestinal microbiota can aggravate certain food allergies, which become severe when the integrity of the intestinal barrier is affected, allowing bacteria, or their metabolites, to cross the intestinal barrier and invade the bloodstream, affecting distal body organs. This article deals with health conditions and severe diseases that are either influenced by the gut flora or caused by gallbladder obstruction and inflammation, as well as putative treatments for those illnesse
... The preparation and culture of Agathobaculum butyriciproducens SR79 T (SR79, DSM 100391 T ) have been described previously [22,23]. All procedures were performed under strict anaerobic conditions as previously described [22,29]. Briefly, the glycerol stock of SR79 was inoculated into a Hungate tube containing anaerobic DSM 104 medium (5 ml, DSMZ, Leibniz Institute, Germany) and incubated at 37°C for 1 day. ...
Article
Microfibrillated cellulose (MFC) is a valuable material with wide industrial applications, particularly for the food and cosmetics industries, owing to its excellent physiochemical properties. Here, we prepared high-solid microfibrillated cellulose (HMFC) from the centrifugation of Gelidium amansiiderived MFC right after fibrillation. Dispersion properties, morphology, and structural changes were monitored during processing. HMFC has a five-fold higher solid concentration than MFC without significant changes to dispersion properties. SEM images and FTIR spectra of HMFC revealed a stable surface and structure against centrifugal forces. HMFC exhibited 2,2'-azino-bis (3-ethylbenzothiazoline- 6-sulfonic acid) (ABTS) radical scavenging activity, although it could not scavenge 2,2-diphenyl-1- picrylhydrazyl (DPPH). Moreover, HMFC inhibited the generation of LPS-induced excessive nitrite and radial oxygen species in murine macrophage RAW264.7 cells. Additionally, HMFC suppressed LPS-induced Keap-1 expression in the cytosol but did not alter iNOS expression. HMFC also attenuated the UVB-induced phosphorylation of p38, c-Jun N-terminal kinase (JNK) 1/2, and extracellular-signal-regulated kinase (ERK) 1/2, as well as the phosphorylation of c-Jun in the immortalized human skin keratinocyte HaCaT cells. Therefore, the application of centrifugation is suitable for producing high-solid MFC as a candidate material for anti-inflammatory and antioxidative marine cosmeceuticals.
Article
Polysaccharides from Enteromorpha prolifera (EP) possess important benefits in the management of obesity and associated metabolic diseases, but to date, the underlying mechanism linking this alleviative effect of EP to gut microbiota remains obscure. This study aimed to investigate the effects of EP in improving lipid metabolism disorders and intestinal barrier disruption in mice with high-fat diet (HFD), and its association with modulation of gut microbiota. C57BL/6 mice were fed a control diet or a HFD with or without 5% EP for 12 weeks. Factors related to lipid metabolism, insulin signaling and intestinal barrier integrity, as well as the involvement of gut microbiota and metabolites, were measured. EP supplementation reduced HFD-induced adiposity and mitigated insulin resistance, hepatic steatosis and elevation of serum lipopolysaccharides (LPS). HFD impaired intestinal barrier integrity while improved due to EP. Moreover, EP administration ameliorated HFD-induced gut dysbiosis, as revealed by the increased short-chain fatty acid (SCFA)-producing bacteria (e.g., Bacteroides, Parabacteroides, Alloprevotella, and Ruminococcus) and gut barrier-protective Akkermansia muciniphila and decreased endotoxin-producing bacteria (e.g., Desulfovibrionaceae and Bilophila), accompanied by enrichment in intestinal SCFA content and reduction in circulating LPS level. The change of dominant bacterial genera is significantly correlated with improved metabolic profiles and intestinal permeability induced by EP. In conclusion, our results indicate that EP can attenuate HFD-induced metabolic disorders along with restoration of gut barrier integrity and lowering of circulating endotoxin, and these improvements are associated with modulation of gut microbiota composition and related metabolites. These data deepen mechanistic understanding of the anti-obesity and metabolic improving effects of EP.
Article
Full-text available
With the development of human genome sequencing and techniques such as intestinal microbial culture and fecal microbial transplantation, newly discovered microorganisms have been isolated, cultured, and researched. Consequently, many beneficial probiotics have emerged as next-generation probiotics (NGPs). Currently, “safety,” “individualized treatment,” and “internal interaction within the flora” are requirements of a potential NGPs. Furthermore, in the complex ecosystem of humans and microbes, it is challenging to identify the relationship between specific strains, specific flora, and hosts to warrant a therapeutic intervention in case of a disease. Thus, this review focuses on the progress made in NGPs and human health research by elucidating the limitations of traditional probiotics; summarizing the functions and strengths of Akkermansia muciniphila, Faecalibacterium prausnitzii, Bacteroides fragilis, Eubacterium hallii, and Roseburia spp. as NGPs; and determining the role of their intervention in treatment of certain diseases. Finally, we aim to provide a reference for developing new probiotics in the future.
Article
Full-text available
The largemouth bass Micropterus salmoides is a carnivorous fish species that is widely farmed in China using artificial compound feeds. Alterations from its natural diet affect intestinal microbiota structure and growth performance and can reduce disease and stress resistance. In this study, we examined growth performance, immunity, intestinal microflora, and resistance to Aeromonas veronii infections-fed prey fish (PF) and artificial compound feed (ACF). Weight gains in the PF group were 27% significantly (P < 0.05) greater than the ACF group. Antioxidant enzyme activities of superoxide dismutase, catalase, and glutathione peroxidase and mRNA expression of inducible nitric oxide synthase, transforming growth factor β1, and interleukin 10 were also significantly higher than for the ACF group. In contrast, levels of malondialdehyde were lower for the PF group consistent with the antioxidant activities. These results indicated that the commercial artificial compound diet reduced the immunity and anti-stress ability of the fish. Survival in against A. versonii infection were similar although the PF fish resisted the infection to a greater extent and succumbed at a slower rate. The gut microbiomes also differed between the PF and ACF feeding groups and operational taxonomic units were 1105.75 and 971.63, respectively. The high abundance of Verrucomicrobia were associated with weight gain and enhanced immunity for the PF group and were significantly (P < 0.05) higher than that in ACF group. Bacteroidetes abundance was closely related to weight loss in the ACF group. The results of this study suggest that the changes in intestinal microflora structure caused by dietary changes in largemouth bass affected its growth performance and reduce its immune and anti-stress abilities and provide a theoretical basis for the improvement of largemouth bass compound feeds.
Article
Full-text available
Assessment and characterization of gut microbiota has become a major research area in human disease, including type 2 diabetes, the most prevalent endocrine disease worldwide. To carry out analysis on gut microbial content in patients with type 2 diabetes, we developed a protocol for a metagenome-wide association study (MGWAS) and undertook a two-stage MGWAS based on deep shotgun sequencing of the gut microbial DNA from 345 Chinese individuals. We identified and validated approximately 60,000 type-2-diabetes-associated markers and established the concept of a metagenomic linkage group, enabling taxonomic species-level analyses. MGWAS analysis showed that patients with type 2 diabetes were characterized by a moderate degree of gut microbial dysbiosis, a decrease in the abundance of some universal butyrate-producing bacteria and an increase in various opportunistic pathogens, as well as an enrichment of other microbial functions conferring sulphate reduction and oxidative stress resistance. An analysis of 23 additional individuals demonstrated that these gut microbial markers might be useful for classifying type 2 diabetes.
Article
Full-text available
Associations have been made between obesity and reduced intestinal numbers of members of the phylum Bacteroidetes, but there is no direct evidence of the role these bacteria play in obesity. Herein, the effects of Bacteroides uniformis CECT 7771 on obesity-related metabolic and immune alterations have been evaluated. Adult (6-8 week) male wild-type C57BL-6 mice were fed a standard diet or a high-fat-diet HFD to induce obesity, supplemented or not with B. uniformis CECT 7771 for seven weeks. Animal weight was monitored and histologic, biochemical, immunocompetent cell functions, and features of the faecal microbiota were analysed after intervention. The oral administration of B. uniformis CECT 7771 reduced body weight gain, liver steatosis and liver cholesterol and triglyceride concentrations and increased small adipocyte numbers in HFD-fed mice. The strain also reduced serum cholesterol, triglyceride, glucose, insulin and leptin levels, and improved oral tolerance to glucose in HFD fed mice. The bacterial strain also reduced dietary fat absorption, as indicated by the reduced number of fat micelles detected in enterocytes. Moreover, B. uniformis CECT 7771 improved immune defence mechanisms, impaired in obesity. HFD-induced obesity led to a decrease in TNF-α production by peritoneal macrophages stimulated with LPS, conversely, the administration of B. uniformis CECT 7771 increased TNF-α production and phagocytosis. Administering this strain also increased TNF-α production by dendritic cells (DCs) in response to LPS stimulation, which was significantly reduced by HFD. B. uniformis CECT 7771 also restored the capacity of DCs to induce a T-cell proliferation response, which was impaired in obese mice. HFD induced marked changes in gut microbiota composition, which were partially restored by the intervention. Altogether, the findings indicate that administration of B. uniformis CECT 7771 ameliorates HFD-induced metabolic and immune dysfunction associated with intestinal dysbiosis in obese mice.
Article
Full-text available
Obesity is associated with metabolic alterations related to glucose homeostasis and cardiovascular risk factors. These metabolic alterations are associated with low-grade inflammation that contributes to the onset of these diseases. We and others have provided evidence that gut microbiota participates in whole-body metabolism by affecting energy balance, glucose metabolism, and low-grade inflammation associated with obesity and related metabolic disorders. Recently, we defined gut microbiota-derived lipopolysaccharide (LPS) (and metabolic endotoxemia) as a factor involved in the onset and progression of inflammation and metabolic diseases. In this review, we discuss mechanisms involved in the development of metabolic endotoxemia such as the gut permeability. We also discuss our latest discoveries demonstrating a link between the gut microbiota, endocannabinoid system tone, leptin resistance, gut peptides (glucagon-like peptide-1 and -2), and metabolic features. Finally, we will introduce the role of the gut microbiota in specific dietary treatments (prebiotics and probiotics) and surgical interventions (gastric bypass).
Article
Full-text available
Increasing evidence suggests that environmental factors changing the normal colonisation pattern in the gut strongly influence the risk of developing autoimmune diabetes. The aim of this study was to investigate, both during infancy and adulthood, whether treatment with vancomycin, a glycopeptide antibiotic specifically directed against Gram-positive bacteria, could influence immune homeostasis and the development of diabetic symptoms in the NOD mouse model for diabetes. Accordingly, one group of mice received vancomycin from birth until weaning (day 28), while another group received vancomycin from 8 weeks of age until onset of diabetes. Pyrosequencing of the gut microbiota and flow cytometry of intestinal immune cells was used to investigate the effect of vancomycin treatment. At the end of the study, the cumulative diabetes incidence was found to be significantly lower for the neonatally treated group compared with the untreated group, whereas the insulitis score and blood glucose levels were significantly lower for the mice treated as adults compared with the other groups. Mucosal inflammation was investigated by intracellular cytokine staining of the small intestinal lymphocytes, which displayed an increase in cluster of differentiation (CD)4(+) T cells producing pro-inflammatory cytokines in the neonatally treated mice. Furthermore, bacteriological examination of the gut microbiota composition by pyrosequencing revealed that vancomycin depleted many major genera of Gram-positive and Gram-negative microbes while, interestingly, one single species, Akkermansia muciniphila, became dominant. The early postnatal period is a critical time for microbial protection from type 1 diabetes and it is suggested that the mucolytic bacterium A. muciniphila plays a protective role in autoimmune diabetes development, particularly during infancy.
Article
Full-text available
2-Arachidonoyl-glycerol (2-Ara-Gl) has been isolated from various tissues and identified as an endogenous ligand for both cannabinoid receptors, CB1 and CB2. Here we report that in spleen, as in brain and gut, 2-Ara-Gl is accompanied by several 2-acyl-glycerol esters, two major ones being 2-linoleoyl-glycerol (2-Lino-Gl) and 2-palmitoyl-glycerol (2-Palm-Gl). These two esters do not bind to the cannabinoid receptors, nor do they inhibit adenylyl cyclase via either CB1 or CB2; however, they significantly potentiate the apparent binding of 2-Ara-Gl and its apparent capacity to inhibit adenylyl cyclase. Together these esters also significantly potentiate 2-Ara-Gl inhibition of motor behavior, immobility on a ring, analgesia on a hot plate and hypothermia caused by 2-Ara-Gl in mice. 2-Lino-Gl, but not 2-Palm-Gl, significantly inhibits the inactivation of 2-Ara-Gl by neuronal and basophilic cells. These data indicate that the biological activity of 2-Ara-Gl can be increased by related, endogenous 2-acyl-glycerols, which alone show no significant activity in any of the tests employed. This effect (`entourage effect') may represent a novel route for molecular regulation of endogenous cannabinoid activity.
Article
Full-text available
The human intestinal tract is colonized by a myriad of microbes that have developed intimate interactions with the host. In healthy individuals, this complex ecosystem remains stable and resilient to stressors. There is significant attention on the understanding of the composition and function of this intestinal microbiota in health and disease. Current developments in metaomics and systems biology approaches allow to probe the functional potential and activity of the intestinal microbiota. However, all these approaches inherently suffer from the fact that the information on macromolecules (DNA, RNA and protein) is collected at the ecosystem level. Similarly, all physiological and other information collected from isolated strains relates to pure cultures grown in vitro or in gnotobiotic systems. It is essential to integrate these two worlds of predominantly chemistry and biology by linking the molecules to the cells. Here, we will address the integration of omics- and culture-based approaches with the complexity of the human intestinal microbiota in mind and the mucus-degrading bacteria Akkermansia spp. as a paradigm.
Article
Full-text available
The human microbiome plays a key role in a wide range of host-related processes and has a profound effect on human health. Comparative analyses of the human microbiome have revealed substantial variation in species and gene composition associated with a variety of disease states but may fall short of providing a comprehensive understanding of the impact of this variation on the community and on the host. Here, we introduce a metagenomic systems biology computational framework, integrating metagenomic data with an in silico systems-level analysis of metabolic networks. Focusing on the gut microbiome, we analyze fecal metagenomic data from 124 unrelated individuals, as well as six monozygotic twin pairs and their mothers, and generate community-level metabolic networks of the microbiome. Placing variations in gene abundance in the context of these networks, we identify both gene-level and network-level topological differences associated with obesity and inflammatory bowel disease (IBD). We show that genes associated with either of these host states tend to be located at the periphery of the metabolic network and are enriched for topologically derived metabolic "inputs." These findings may indicate that lean and obese microbiomes differ primarily in their interface with the host and in the way they interact with host metabolism. We further demonstrate that obese microbiomes are less modular, a hallmark of adaptation to low-diversity environments. We additionally link these topological variations to community species composition. The system-level approach presented here lays the foundation for a unique framework for studying the human microbiome, its organization, and its impact on human health.
Article
This article provides an overview of how intestinal epithelial cells (IEC) recognize commensals and how they maintain host-bacterial symbiosis. Endocrine, goblet cells, and enterocytes of the intestinal epithelium express a range of pattern recognition receptors (PRR) to sense the presence of microbes. The best characterized are the Toll-like receptors (TLR) and nucleotide oligomerization domain-like receptors (NLR), which play a key role in pathogen recognition and the induction of innate effectors and inflammation. Several adaptations of PRR signaling have evolved in the gut to avoid uncontrolled and potentially destructive inflammatory responses toward the resident microbiota. PRR signaling in IEC serve to maintain the barrier functions of the epithelium, including the production of secretory IgA (sIgA). Additionally, IECs play a cardinal role in setting the immunosuppressive tone of the mucosa to inhibit overreaction against innocuous luminal antigens. This includes regulation of dendritic cells (DC), macrophage and lymphocyte functions by epithelial secreted cytokines. These immune mechanisms depend heavily on IEC recognition of microbes and are consistent with several studies in knockout mice that demonstrate TLR signaling in the epithelium has a profoundly beneficial role in maintaining homeostasis
Article
Background: Presence of intestinal microbes is a prerequisite for the development of ulcerative colitis (UC), although deviation of the normal intestinal microbiota composition, dysbiosis, is presumably implicated in the etiology of UC. Methods: The fecal microbiota of 30 UC samples obtained from 15 patients who were sampled twice and from 15 healthy control subjects originating from 2 geographic locations was analyzed using highly reproducible phylogenetic microarray that has the capacity for detection and quantification of more than 1000 intestinal bacteria in a wide dynamic range. Results: The fecal microbiota composition is not significantly influenced by geographic location, age, or gender, but it differs significantly between the patients with UC and the control subjects (P = 0.0004). UC-associated microbiota is stable during remission and similar among all patients with UC. Significant reduction of bacterial diversity of members of the Clostridium cluster IV and significant reduction in the abundance of bacteria involved in butyrate and propionate metabolism, including Ruminococcus bromii et rel. Eubacterium rectale et rel., Roseburia sp., and Akkermansia sp. are markers of dysbiosis in UC. Increased abundance of (opportunistic) pathogens including Fusobacterium sp., Peptostreptococcus sp., Helicobacter sp., and Campylobacter sp. as well as Clostridium difficile were found to be associated with UC. Conclusions: Dysbiosis in UC is stable in time and shared between patients from different geographic locations. The microbial alterations offer a mechanistic insight into the pathogenesis of the disease.
Article
The aim of this study was to investigate the gut microbiota in preschool children with and without overweight and obesity. Twenty overweight or obese children and twenty children with body mass index within the normal range (age: 4-5 years) were recruited from the south of Sweden. The gut microbiota was accessed by quantitative polymerase chain reactions and terminal restriction fragment length polymorphism and calprotectin was measured in faeces. Liver enzymes were quantified in obese/overweight children. The concentration of the Gram-negative family Enterobacteriaceae was significantly higher in the obese/overweight children (P=0.036) while levels of Desulfovibrio and Akkermansia muciniphila-like bacteria were significantly lower in the obese/overweight children (P=0.027 and P=0.030, respectively). No significant differences were found in content of Lactobacillus, Bifidobacterium or the Bacteroides fragilis group. The diversity of the dominating bacterial community tended to be less diverse in the obese/overweight group, but the difference was not statistically significant. Concentration of Bifidobacterium was inversely correlated to alanine aminotransferase in obese/overweight children. The faecal levels of calprotectin did not differ between the study groups. These findings indicate that the gut microbiota differed among preschool children with obesity/overweight compared with children with body mass index within the normal range.