ArticlePDF Available

Environmental Oxygen Tension Regulates the Energy Metabolism and Self-Renewal of Human Embryonic Stem Cells

Authors:

Abstract and Figures

Energy metabolism is intrinsic to cell viability but surprisingly has been little studied in human embryonic stem cells (hESCs). The current study aims to investigate the effect of environmental O2 tension on carbohydrate utilisation of hESCs. Highly pluripotent hESCs cultured at 5% O2 consumed significantly more glucose, less pyruvate and produced more lactate compared to those maintained at 20% O2. Moreover, hESCs cultured at atmospheric O2 levels expressed significantly less OCT4, SOX2 and NANOG than those maintained at 5% O2. To determine whether this difference in metabolism was a reflection of the pluripotent state, hESCs were cultured at 5% O2 in the absence of FGF2 for 16 hours leading to a significant reduction in the expression of SOX2. In addition, these cells consumed less glucose and produced significantly less lactate compared to those cultured in the presence of FGF2. hESCs maintained at 5% O2 were found to consume significantly less O2 than those cultured in the absence of FGF2, or at 20% O2. GLUT1 expression correlated with glucose consumption and using siRNA and chromatin immunoprecipitation was found to be directly regulated by hypoxia inducible factor (HIF)-2α at 5% O2. In conclusion, highly pluripotent cells associated with hypoxic culture consume low levels of O2, high levels of glucose and produce large amounts of lactate, while at atmospheric conditions glucose consumption and lactate production are reduced and there is an increase in oxidative metabolism. These data suggest that environmental O2 regulates energy metabolism and is intrinsic to the self-renewal of hESCs.
Content may be subject to copyright.
Environmental Oxygen Tension Regulates the Energy
Metabolism and Self-Renewal of Human Embryonic Stem
Cells
Catherine E. Forristal, David R. Christensen, Fay E. Chinnery, Raffaella Petruzzelli, Kate L. Parry,
Tilman Sanchez-Elsner, Franchesca D. Houghton*
Centre for Human Development, Stem Cells and Regeneration, Faculty of Medicine, University of Southampton, Southampton, United Kingdom
Abstract
Energy metabolism is intrinsic to cell viability but surprisingly has been little studied in human embryonic stem cells (hESCs).
The current study aims to investigate the effect of environmental O
2
tension on carbohydrate utilisation of hESCs. Highly
pluripotent hESCs cultured at 5% O
2
consumed significantly more glucose, less pyruvate and produced more lactate
compared to those maintained at 20% O
2
. Moreover, hESCs cultured at atmospheric O
2
levels expressed significantly less
OCT4, SOX2 and NANOG than those maintained at 5% O
2
. To determine whether this difference in metabolism was a
reflection of the pluripotent state, hESCs were cultured at 5% O
2
in the absence of FGF2 for 16 hours leading to a significant
reduction in the expression of SOX2. In addition, these cells consumed less glucose and produced significantly less lactate
compared to those cultured in the presence of FGF2. hESCs maintained at 5% O
2
were found to consume significantly less
O
2
than those cultured in the absence of FGF2, or at 20% O
2
. GLUT1 expression correlated with glucose consumption and
using siRNA and chromatin immunoprecipitation was found to be directly regulated by hypoxia inducible factor (HIF)-2aat
5% O
2
. In conclusion, highly pluripotent cells associated with hypoxic culture consume low levels of O
2
, high levels of
glucose and produce large amounts of lactate, while at atmospheric conditions glucose consumption and lactate
production are reduced and there is an increase in oxidative metabolism. These data suggest that environmental O
2
regulates energy metabolism and is intrinsic to the self-renewal of hESCs.
Citation: Forristal CE, Christensen DR, Chinnery FE, Petruzzelli R, Parry KL, et al. (2013) Environmental Oxygen Tension Regulates the Energy Metabolism and Self-
Renewal of Human Embryonic Stem Cells. PLoS ONE 8(5): e62507. doi:10.1371/journal.pone.0062507
Editor: Majlinda Lako, University of Newcastle upon Tyne, United Kingdom
Received October 26, 2011; Accepted March 25, 2013; Published May 6, 2013
Copyright: ß2013 Forristal et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was funded by the Gerald Kerkut Charitable Trust (http://www.soton.ac.uk/
˜gktrust/) and the UK Medical Research Council, grant number
G0701153 (www.mrc.ac.uk/). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: F.D.Houghton@soton.ac.uk
Introduction
Human embryonic stem cells (hESCs) are pluripotent cells
derived from the inner cell mass (ICM) of the blastocyst, the final
stage of preimplantation embryo development. They proliferate
through self-renewal and provide an excellent model to investigate
developmental mechanisms since they have the potential to
differentiate into all cells of the body [1]. However, if these cells
are to be of therapeutic use it is imperative to ensure that a highly
pluripotent population of hESCs are maintained which can then
be directed down specific lineage pathways.
hESCs are notoriously difficult to maintain in vitro as the
colonies have a propensity to spontaneously differentiate sugges-
tive of suboptimal culture conditions; an effect which may be
circumvented by the use of low environmental O
2
tensions [2].
Culture under atmospheric O
2
tensions has been found to
decrease hESC proliferation and reduce pluripotency marker
expression compared to culture under low (2–5%) O
2
tensions
[3,4,5], an effect regulated by hypoxia inducible factors (HIFs),
specifically HIF-2a[5]. This promotion of an immature, stem cell
like phenotype has also been observed in both malignant and non-
malignant cells cultured under hypoxic conditions [6]. Despite
these encouraging data, many of the biochemical and physiolog-
ical implications of hypoxic culture on hESCs remain to be
elucidated.
Among the ,200 genes regulated by HIFs, metabolic genes
feature extensively [7] suggesting that environmental O
2
tensions
may also have a significant impact on hESC metabolism.
However, the metabolic status of hESCs and the impact of
environmental O
2
tension have received remarkably little atten-
tion. Significantly, our previous work has shown that metabolic
activity is a central regulator of the phenotype and developmental
potential of human preimplantation embryos [8,9] and highlights
metabolism as a fundamental regulator of cellular function.
Morphologically, hESCs share many characteristics with ICM
cells; a high nuclear to cytoplasmic ratio, low mitochondrial
number, and expression of the same surface antigens
[10,11,12,13]. It is therefore likely that the nutrition of the ICM
may inform on the metabolism of hESCs. In terms of glucose
utilisation, the murine ICM is wholly glycolytic compared to the
differentiated trophectoderm where only 55% of the glucose
consumed may be accounted for by lactate production [14].
Moreover, the ICM is also metabolically relatively quiescent in
terms of mitochondrial activity, O
2
consumption and ATP
production compared to the trophectoderm [15]. Knowledge of
the metabolism of hESCs is still in its infancy but it has been
PLOS ONE | www.plosone.org 1 May 2013 | Volume 8 | Issue 5 | e62507
shown that pluripotency may be enhanced by inhibiting the
mitochondrial respiratory chain [16]. This data was further
supported by confirmation that hESCs and induced pluripotent
stem cells rely on glycolysis for their energy requirements
[17,18,40].
This study aims to investigate how environmental O
2
tension
affects the regulation and energy metabolism of hESCs in terms of
O
2
, glucose and pyruvate consumption and lactate production.
Moreover, the effect of early hESC differentiation as demonstrated
by the short term removal of FGF2 on hESC metabolism and
pluripotency marker expression has also been investigated. These
data suggest that environmental O
2
regulates glucose utilisation
and is intrinsic to the energy metabolism and self-renewal of
hESCs.
Materials and Methods
hESC Culture
Hues7 (D. Melton, Howard Hughes Medical Institute/Harvard
University) [41] and Shef3 (Supplied by the UK Stem Cell Bank)
hESCs were cultured at 20% O
2
in Knockout DMEM (Invitrogen)
supplemented with 15% knockout serum replacement (Invitrogen),
100 mg/ml penicillin streptomycin (Invitrogen), 1 mM L-gluta-
mine (Invitrogen), 16non-essential amino acids (Invitrogen),
0.1 mM 2-mercaptoethanol and 10 ng/ml FGF2 (Peprotech) on c
irradiated mouse embryonic fibroblasts (MEFs; a primary source
derived in institutional facilities following University of South-
ampton ethical review committee approval and in accordance with
UK Home Office regulations). hESCs were then transferred to
Matrigel (BD Biosciences) coated plates and cultured in MEF-
conditioned medium at both 20% and 5% O
2
. They were
maintained for a minimum of 3 passages on Matrigel at both O
2
tensions prior to use.
Measurement of Carbohydrate Utilisation
hESCs were passaged on to 12-well Matrigel coated plates and
cultured in MEF conditioned medium. On day 2, 3 and 4 post-
passage hESCs were pre-incubated in a defined metabolic medium
[8] containing 1 mM glucose, 5 mM lactate, 0.47 mM pyruvate,
0.5% human serum albumin and amino acids [19] for 30 mins.
The medium was then replaced with pre-determined quantities
(300–500 ml) of defined medium for 1.5–3.5 h. At the end of the
incubation period, all but 100 ml of medium was removed from
each well and stored at 280uC prior to analysis of carbohydrate
content and the number of cells in each well was determined using
a haemocytometer. In subsequent experiments, the effect of
removing FGF2 for 16 hours on hESC metabolism was
monitored. FGF2 was removed from the medium prior to MEF
conditioning and used to replace regular, MEF conditioned
medium containing FGF2 on day 2 post-passage. Enzyme linked
biochemical assays were used to measure the concentration of
pyruvate, glucose and lactate in 180 ml of spent medium using a
Konelab 20 autoanalyser (Thermo Scientific). The concentration
of carbohydrates in cell containing wells was compared to cell-free
control wells and the consumption of pyruvate and glucose and the
production of lactate by hESCs calculated in pmol/cell/h.
O
2
Assay
A 96-well O
2
biosensor plate (BD Biosciences) containing 3
wells of 200 mM sodium sulphite (0% O
2
control) and 3 wells of a
defined metabolic medium (20% O
2
control) was incubated at
37uC in a fluorescence plate reader (BMG Labtech) for 30 mins.
Hues7 hESCs on day 3 post-passage were pre-incubated with
metabolic medium for 30 mins, harvested into 310 ml of fresh, pre-
warmed metabolic medium, added to a well of the O
2
biosensor
plate and sealed using an adhesive PCR foil (Thermo Fisher) with
care taken to ensure the absence of air bubbles. The fluorescence
(excitation 485 nm and emission 612 nm) of each well was
recorded every 2 minutes over a two hour period. After the final
measurement, the protein content of each well was determined
using the Bradford assay. O
2
consumption was calculated as ml
O
2
/mg protein/h.
RT-qPCR
RNA was isolated from Hues7 hESCs cultured under feeder-
free conditions on Matrigel on day 3 post-passage using
TriReagent (Sigma) and 2 mg reverse transcribed to cDNA using
MMLV-reverse transcriptase (Promega). cDNA (4 mg) was ampli-
fied in 20 ml reactions containing 1 ml probes and primer mix
(OCT4: Hs01895061_u1; SOX2: Hs00602736_s1; NANOG:
Hs02387400_g1; GLUT1: Hs00197884_m1; UBC
Hs00824723_m1) and 10 ml26Taqman Universal PCR Master
Mix (Applied Biosystems) using an ABI 7500 real time PCR
system. The conditions used were 2 mins at 50uC, 10 mins at
95uC followed by 45 cycles of 95uC for 15 secs and 60uC for
1 min. Placental cDNA (0–10 ng) was used to produce a standard
curve for each gene of interest as well as the endogenous control,
UBC and used to quantify gene expression. All genes were
analysed in duplicate and normalised to UBC.
siRNA
siRNA was used to silence either HIF-1a,HIF-2aor HIF-3ain
Hues7 hESCs cultured on Matrigel coated plates at 5% O
2
. The
cells were passaged and the following day 50 nM siRNA (HIF-1a:
Hs_HIF1A_5; HIF-2a: Hs_EPAS1_5; or HIF-3a: Hs_HIF3A_1),
12 ml HiPerfect transfection reagent (Qiagen) and 200 ml knockout
DMEM were mixed, incubated at room temperature for 10 mins
and added in a drop wise manner to hESCs. Allstars negative
control siRNA (Qiagen) was used as a negative control. The ability
of these siRNA to silence individual HIF-aisoforms has previously
been validated [5]. The cells were harvested 48 h post-transfection
and GLUT1 mRNA quantified as above.
Western Blotting
Protein was isolated from Hues7 hESCs cultured on Matrigel
on day 3 post-passage by incubating in ice cold radio immuno-
precipitation assay (RIPA) buffer for 30 mins followed by
sonication for 30 secs. Protein (75 mg) was resolved on an 8%
SDS bisacrylamide gel, transferred to nitrocellulose membrane
and blocked in PBS containing 0.1% Tween-20 and 5% milk for
1 h at room temperature. The membrane was incubated in
primary antibody (OCT4 (Santa Cruz) 1:1000; SOX2 (Millipore)
1:1000; NANOG (Abcam) 1:1000) diluted in blocking buffer
overnight at 4uC. Membranes were washed and incubated in
horse radish peroxidase-conjugated secondary antibodies (anti-
mouse (GE Healthcare) 1:100,000 or anti-rabbit (GE Healthcare)
1:50,000) for 1 h at room temperature. The Enhanced chemilu-
minescence advanced Western blotting detection kit (GE Health-
care) was used to develop the membranes prior to imaging on the
Biorad Chemidoc XRS. Protein expression was quantified relative
to b-actin (mouse anti-b-actin peroxidise conjugated antibody
(Sigma) 1:50,000).
Chromatin Immunoprecipitation (ChIP) Assays
Hues7 hESCs cultured in normoxic (20% O
2
), or hypoxic (5%
O
2
) conditions were cross-linked with 1% formaldehyde for
10 min and the reaction blocked with 0.125 M glycine. ChIP
Energy Metabolism of Human Embryonic Stem Cells
PLOS ONE | www.plosone.org 2 May 2013 | Volume 8 | Issue 5 | e62507
experiments were performed with HIF-2a(Novus Biologicals) or
immunoglobulin G (IgG) antibody (Santa Cruz) as previously
described [20,21] except that immuno-complexes were washed
using high-salt buffers as followed: 10 times with 600 ml buffer A
(0.1% SDS, 2 mM EDTA, 20 mM Tris HCl pH8, 1% Triton X-
100, 500 mM NaCl), 8 times with 600 ml buffer B (0.1% SDS,
2 mM EDTA, 20 mM Tris HCl pH8, 1% Triton X-100, 1 M
NaCl), 3 times with 600 ml TE (10 mM Tris HCl H8, 1 mM
EDTA) buffer. Recovered DNA was amplified with custom
Taqman Assays (Applied Biosystems) spanning a predicted
hypoxia response element (HRE) site at 21691 bp of the GLUT1
proximal promoter (GLUT1 fwd: CAAATGTGTGGATGT-
GAGTTGC; GLUT1 rev: CCATCACGGTCCTTCTTCATG;
GLUT1 probe: AGGCTGAGCGTGTAAA). qPCR was per-
formed using an ABI 7900 HT Fast Real Time System (Applied
Biosystems) in a 384 well plate.
Statistical Analysis
All data were tested to determine whether they were normally
distributed using the Anderson Darling normality test. Any
differences in the utilisation of carbohydrates or glycolytic rate
with O
2
tension were analysed using a Student’s t-test. Differences
in mRNA expression were normalised to the endogenous control,
UBC and then to 1 for cells cultured at 5% O
2
, or to Allstars
transfection controls when genes were silenced. Differences in
protein expression were normalised to b-actin and then to 1 for
cells cultured at 5% O
2
. In both cases a one sample t-test was used
to determine significance from either 5% O
2
or transfection
controls. Differences in O
2
consumption between hESCs main-
tained at 5%, 20% and 5% O
2
in the absence of FGF2 was
determined using a one-way analysis of variance followed by a
Fisher’s test. Differences in binding of HIF-2ato the GLUT1
promoter with O
2
tension was expressed as a percentage of input
(non-immunoprecipitated chromatin) calculated using 10062
[Ct
(Input)-Ct (IP)]
for each sample and expressed as box and whisker
plots. All data represent at least 3 independent experiments and
are presented as mean 6SEM.
Results
Environmental O
2
Tension Regulates Carbohydrate
Utilisation
hESCs maintained at 5% O
2
display an increased proliferation
and expression of pluripotency markers compared to those
cultured at 20% O
2
[5]. The current study aimed to determine
the impact of environmental O
2
tension on the energy metabolism
of hESCs. Hues7 hESCs were cultured at either 5% or 20% O
2
and the consumption of glucose and pyruvate and the production
of lactate were analysed on days two to four post-passage.
Similarly, the effect of environmental O
2
tension on the depletion
of glucose and production of lactate by Shef3 hESCs on day 3
post-passage was also determined. Under each O
2
tension, glucose
was found to be the predominant energy substrate utilised.
Interestingly, both cell lines consumed almost twice as much
glucose (P,0.001) and produced approximately 2–3 times the
amount of lactate (P,0.01–P,0.001) when cultured at 5% O
2
compared to 20% O
2
(Fig. 1A–D). A similar, low level
(,0.1 pmol/cell/h) of pyruvate was consumed by Hues7 hESCs
on each day post-passage (Fig. 1 A–C).
Environmental O
2
and Short-term Removal of FGF2 Alters
hESC Energy Metabolism
To investigate whether the difference in energy substrate
utilisation between hESCs cultured at 5% and 20% O
2
was a
reflection of the degree of cell pluripotency, FGF2 was removed
from the medium used to culture cells at 5% O
2
for 16 hours.
Morphologically, there was no overt differentiation observed in
any of the treatment groups on day 3 post-passage (Fig. S1). This is
in agreement with previous observations of hESCs cultured at 5%
or 20% O
2
[5].
In terms of metabolism, removing FGF2 for 16 hours from
hESCs cultured at 5% O
2
resulted in a significant reduction in the
amount of glucose consumed in Hues7 cells and a near significant
reduction in Shef3 cells compared to those maintained in the
presence of FGF2 (Fig. 2A and B). However, in the absence of
FGF2, both cell lines displayed a significant reduction in the
amount of lactate produced. Interestingly, twice as much pyruvate
was consumed when Hues7 cells were cultured at 5% O
2
in the
absence of FGF2 for 16 hours compared to when FGF2 was
present (P,0.01; Fig. 2 A). This suggests that even the very early
stages of differentiation are associated with an increased reliance
on oxidative metabolism.
To determine the global ability of hESCs to produce energy, O
2
consumption was measured. Hues7 hESCs cultured at 20% O
2
were found to consume approximately 4 mlO
2
/mg protein/h,
which was significantly greater than hESCs cultured at both 5%
O
2
(P,0.001) and 5% O
2
where FGF2 was removed for 16 hours
(P,0.001; Fig. 2 C). Interestingly, the removal of FGF2 for 16
hours from hESCs cultured at 5% O
2
significantly increased O
2
consumption compared to those cultured in the presence of FGF2
(P,0.05). This suggests that hESCs maintained at 20% O
2
have a
greater energy requirement than those cultured at 5% O
2
in the
absence of FGF2. hESCs cultured at 5% O
2
in the presence of
FGF2 are the quietest metabolically having the lowest rate of O
2
consumption.
Environmental O
2
and Short Term FGF2 Removal
Regulates the Self-renewal of hESCs
In agreement with our previous report [5], OCT4 protein
expression was significantly decreased in Hues7 hESCs main-
tained at 20% O
2
compared to those cultured at 5% O
2
(P,0.05;
Fig. 3 A, B). A similar reduction in SOX2 (P,0.05) and NANOG
(P,0.05) expression was also observed at 20% O
2
(Fig. 3 C–F).
Interestingly, when FGF2 was removed for 16 hours from hESCs
cultured at 5% O
2
, SOX2 protein expression decreased signifi-
cantly while OCT4 and NANOG expression displayed a non-
significant reduction to levels comparable to hESCs cultured
under atmospheric O
2
tensions (Fig. 3A–F).
GLUT1 mRNA is Differentially Expressed Under Hypoxic
Conditions and Regulated by HIF-2a
To determine whether differences in glucose transport may be
responsible for the increased consumption observed by Hues7
hESCs maintained at 5% O
2
compared to 20% O
2
, the expression
of GLUT1 was investigated. GLUT1 mRNA expression was
significantly decreased in cells maintained at 20% O
2
compared to
those cultured at 5% O
2
(Fig. 4 A). This suggests a correlation
between the mRNA expression of GLUT1 and the uptake of
glucose in hESCs.
Since HIFs are important regulators of the hypoxic response,
siRNA was used to determine whether any of the HIFasubunits
were responsible for the increased GLUT1 expression in hESCs
cultured at 5% O
2
. GLUT1 mRNA expression was not affected
when either HIF-1aor HIF-3awere silenced but was significantly
reduced when HIF-2awas knocked down (P,0.001; Fig. 4 B).
This suggests that HIF-2ais an upstream regulator of GLUT1 in
hESCs cultured at 5% O
2.
Energy Metabolism of Human Embryonic Stem Cells
PLOS ONE | www.plosone.org 3 May 2013 | Volume 8 | Issue 5 | e62507
Figure 1. Hypoxic culture promotes glucose uptake and lactate production in hESCs. Glucose, pyruvate and lactate utilisation were non-
invasively measured in a defined hESC medium. More glucose was consumed and lactate produced by Hues7 hESCs cultured at 5% O
2
than at 20%
O
2
on (A) day 2 (B) day 3 and (C) day 4 post-passage. In contrast, less pyruvate was consumed by hESCs at 5% O
2
compared to 20% O
2
. The rate of
glucose consumption and lactate production was also greater on day 3 post-passage in Shef3 hESCs cultured at 5% O
2
compared to those
maintained at 20% O
2
(D). **P,0.01, ***P,0.001 significantly different to 5% O
2
(n = 12–23).
doi:10.1371/journal.pone.0062507.g001
Energy Metabolism of Human Embryonic Stem Cells
PLOS ONE | www.plosone.org 4 May 2013 | Volume 8 | Issue 5 | e62507
HIF-2aBinds Directly to the GLUT1 Promoter
To determine whether HIF-2abinds directly to a potential
HRE in the proximal promoter of GLUT1 ChIP assays were
performed on Hues7 hESCs. We compared the enrichment, using
qPCR, of the sequence corresponding to the GLUT1 proximal
promoter when precipitating with an antibody specific for HIF-2a,
compared to the IgG isotype control. A 4-fold enrichment over the
IgG control was observed in the chromatin isolated from hESCs
maintained at 5% O
2
(Fig. 4C). In contrast, no significant binding
of HIF-2awas observed in chromatin isolated from hESCs
maintained at 20% O
2
. This data reveals a specific HIF-2a
interaction with the GLUT1 proximal promoter only in hESCs
cultured under hypoxic conditions.
Discussion
hESC metabolism has received little attention, despite being
intrinsic to cellular function. Several studies have highlighted
beneficial effects of culturing hESCs at low O
2
tensions including
improved morphology, increased expression of pluripotency
markers, a reduction in chromosomal abnormalities and a higher
Figure 2. Short term removal of FGF2 at 5% O
2
alters hESC metabolism and promotes O
2
consumption. Removal of FGF2 for 16 hours
from Hues7 hESCs cultured at 5% O
2
(5% O
2
– FGF2) resulted in a reduction of glucose consumption and lactate production, whereas pyruvate
consumption dramatically increased (A). Shef3 hESCs cultured at 5% O
2
– FGF2 displayed a significant reduction in lactate production (B). **P,0.01,
***P,0.001 significantly different to 5% O
2
+FGF2 (n = 10–18). Hues7 hESCs cultured at 5% O
2
consumed less O
2
than when FGF2 was removed for 16
hours (C). hESCs maintained at 20% O
2
consumed the greatest amount of O
2
. Bars with the same superscript are significantly different; a, b, P,0.001,
c, P,0.05 (n = 7–8).
doi:10.1371/journal.pone.0062507.g002
Energy Metabolism of Human Embryonic Stem Cells
PLOS ONE | www.plosone.org 5 May 2013 | Volume 8 | Issue 5 | e62507
Figure 3. hESCs maintained at atmospheric O
2
levels express reduced levels of pluripotency markers compared to those cultured at
5% O
2
.Hues7 hESCs were cultured at either 5% O
2
,5%O
2
with FGF2 removed for 16 hours (5% O
2
– FGF2) or 20% O
2
. Protein was isolated and OCT4
(A and B), SOX2 (C and D) and NANOG (E and F) quantified using Western blotting. All data has been normalised to b-actin and to 1 for 5% O
2
.
*P,0.05, **P,0.01, ***P,0.001 significantly different from 5% O
2
(n = 3–4).
doi:10.1371/journal.pone.0062507.g003
Energy Metabolism of Human Embryonic Stem Cells
PLOS ONE | www.plosone.org 6 May 2013 | Volume 8 | Issue 5 | e62507
rate of proliferation [3,4,5,22] but the impact on cellular
metabolism is unknown. Thus, this study sought to investigate
the influence of environmental O
2
on the carbohydrate utilisation,
energy metabolism and self-renewal of hESCs.
Independent of O
2
tension, glucose was found to be the
predominant substrate utilised by hESCs. However, highly
pluripotent hESCs cultured under hypoxic conditions were found
to deplete significantly more glucose and produce higher levels of
lactate than cells maintained at atmospheric O
2
tensions. This was
intriguing and suggested a correlation between metabolism and
self-renewal. To investigate this further, FGF2, a factor required to
sustain self-renewal and support growth of undifferentiated hESCs
[23,24], was removed for just 16 hours from highly pluripotent
cells cultured at 5% O
2
. The removal of FGF2 resulted in a
reduced utilisation of glucose and significant decrease in the
amount of lactate produced. This was intriguing and highlights the
ability of hESC metabolism to adapt to changes in environmental
conditions. Moreover, the resultant rates of glucose utilisation and
lactate production observed in hESCs cultured in the absence of
FGF2 for 16 hours were similar to cells cultured at 20% O
2
. This
was interesting since cells maintained at 20% O
2
expressed
significantly less OCT4, SOX2 and NANOG than those cultured
under hypoxic conditions. A similar trend was also mirrored by
hESCs cultured at 5% O
2
in the absence of FGF2. These data
suggest that energy metabolism may represent a novel parameter
to quantify the self-renewal potential of hESC cultures.
The mechanism of how FGF2 regulates hESC energy
metabolism under hypoxic conditions is unknown but data from
adipocytes implicates the involvement of HIF-1a[25]. These
investigators found that the culture of adipocytes under hypoxic
conditions in the presence of FGF2 caused an increase in both
GLUT1 expression and lactate production through the induction
of HIF-1a. In hESCs HIF-1ais degraded after ,48 h of hypoxic
culture after which HIF-2ais stabilised [5]. Thus, it could be
speculated that the reduced amount of glucose consumed and
lactate produced by hESCs cultured at 5% O
2
in the absence of
FGF2 may be due to the destabilisation/degradation of HIF-2a
and the resultant decrease in expression of hypoxia responsive
genes.
Hues7 hESCs cultured at 5% O
2
consumed significantly lower
levels of O
2
and pyruvate than those maintained at either 20% O
2
or 5% O
2
in the absence of FGF2. Since O
2
consumption provides
the best global indication of the ability of a cell to produce energy,
this suggests that hESCs cultured at 5% O
2
are more metabolically
quiescent than those cultured at 5% O
2
in the absence of FGF2, or
at 20% O
2
. As OCT4, SOX2 and NANOG expression were also
significantly reduced in hESCs cultured at 20% O
2
compared to
5% O
2
, this suggests that as differentiation occurs a more active
metabolism ensues. These results are comparable to that in the
mouse blastocyst where the ICM was found to be metabolically
relatively quiescent consuming low levels of O
2
compared to the
differentiated trophectoderm [15].
Our data also suggest that hESCs display a glycolytic
metabolism consuming glucose and producing lactate. This is in
agreement with mouse ES cells and mesenchymal stem cells which
utilise glycolysis as a primary source of ATP production in the
undifferentiated state and switch to oxidative phosphorylation
upon differentiation [26,27]. Similarly, nuclear reprogramming
associated with induced pluripotent stem cells has been shown to
be associated with a shift from an oxidative metabolism to one
dependent on glycolysis [18,39]. Together with the current data,
this highlights the importance of glycolysis for maintaining the
pluripotent state.
hESCs cultured at 5% O
2
expressed significantly more GLUT1
than those maintained at 20% O
2
. Glucose transporter expression
is known to increase the amount of glucose taken up by cells and
Figure 4. GLUT1 expression parallels glucose utilisation and is
directly regulated by HIF-2aunder hypoxic conditions. RT-qPCR
was used to quantify GLUT1 mRNA expression in Hues7 hESCs cultured
at either 5% O
2
, or 20% O
2
on day three post-passage (A). All data has
been normalised to UBC and to 1 for 5% O
2
.*P,0.05 significantly
different to 5% O
2
(n = 3). Using siRNA to silence HIF-asubunits in
Hues7 hESCs cultured at 5% O
2
,GLUT1 mRNA was found to be
regulated by HIF-2a(B). All data has been normalised to UBC and to 1
for the transfection control. *P,0.05 significantly different to transfec-
tion control (n = 6). Using ChIP HIF-2awas found to bind to the
proximal promoter of GLUT1 only in hESCs cultured at 5% O
2
. ChIP
assays were performed with either a HIF-2aor IgG control antibody on
chromatin isolated from Hues7 hESCs cultured at either 20% O
2
or 5%
O
2
. DNA enrichment is expressed as a percentage of input (non-
immunoprecipitated chromatin). *P,0.05, **P,0.01, NS indicates no
significant difference (n = 5).
doi:10.1371/journal.pone.0062507.g004
Energy Metabolism of Human Embryonic Stem Cells
PLOS ONE | www.plosone.org 7 May 2013 | Volume 8 | Issue 5 | e62507
GLUT1 is thought to be the predominant transporter in many cell
types including mouse ESCs, brain, placenta, and retina
[28,29,30]. Our finding of an increase in GLUT1 expression
under hypoxic conditions is in agreement with that observed in
mouse ESCs [31]. As a HRE is present in the promoter region of
the GLUT1 gene [32,33] we were interested to determine whether
any of the 3 regulated HIF-asubunits were responsible for this
increased expression. Using siRNA, HIF-asubunits were silenced
individually and the effect on GLUT1 expression determined.
GLUT1 mRNA was down-regulated only when HIF-2awas
silenced, suggesting that HIF-2ais an upstream regulator of
GLUT1. The HIF family of transcription factors have also been
found to mediate the expression of GLUT1 in mouse ESCs, MEFs
and cardiomyocytes [34,35,36]. However, in these cell types, it
was HIF-1a, not HIF-2awhich regulated GLUT1 expression.
This represents a fundamental difference in the regulation of
GLUT1 between mouse and human ESCs.
Using ChIP, HIF-2awas found to bind directly to the region
containing a putative HRE in the proximal promoter of the
GLUT1 gene only in hESCs cultured at 5% O
2
. This was an
exciting finding since although GLUT1 has been extensively
studied as a hypoxia inducible gene, to the best of our knowledge
this is the first report of HIF-2abinding directly to GLUT1. It is
therefore possible that the increased expression of GLUT1
observed may be responsible for the greater uptake of glucose
into hESCs cultured at 5% O
2
. However, since many of the genes
involved in glucose metabolism including hexokinase, phospho-
fructokinase, glyceraldehyde-3-phosphate dehydrogenase, enolase,
pyruvate kinase and lactate dehydrogenase have also been shown
to be regulated by environmental O
2
, alternative mechanisms of
regulation remain a possibility [34,37,38].
Summary
These studies demonstrate that hESCs utilise glucose as a
predominant source of energy. Highly pluripotent hESCs cultured
at 5% O
2
have a low level of O
2
consumption, consume high levels
of glucose and produce large amounts of lactate. The onset of early
differentiation, through the removal of FGF2 for 16 hours in
hESCs cultured at 5% O
2
, or by maintaining cells at 20% O
2
leads
to a more oxidative metabolism, demonstrated by an increased
consumption of O
2
and a decreased uptake of glucose and
production of lactate. The rise in glucose uptake observed under
hypoxic conditions corresponds to an increased expression of
GLUT1 which is directly regulated by HIF-2a. This data provides
further metabolic support for maintaining hESCs under hypoxic
conditions, rather than culturing at atmospheric levels of O
2
.
Finally, our data highlights the intrinsic importance of energy
metabolism for hESC maintenance and may provide a novel
method for the assessment of self-renewal.
Supporting Information
Figure S1 Typical morphology of Shef3 hESCs on day 3
post-passage cultured at 5% O
2
(A), 5% O
2
in the
absence of FGF2 for 16 hours (5% O
2
– FGF2; B) and
20% O
2
.Scale bar = 100 mm.
(TIF)
Acknowledgments
We thank John Jackson for his help using the autoanalyser.
Author Contributions
Technical support: KLP. Conceived and designed the experiments: FDH
CEF. Performed the experiments: CEF DRC FEC RP. Analyzed the data:
CEF DRC FEC RP. Wrote the paper: FDH CEF TS RP DRC.
References
1. Thomson JA, Itskovitz-Eldor J, Shapiro SS, Waknitz MA, Swiergiel JJ, et al.
(1998) Embryonic stem cell lines derived from human blastocysts. Science 282:
1145–1147.
2. Ludwig TE, Levenstein ME, Jones JM, Berggren WT, Mitchen ER, et al. (2006)
Derivation of human embryonic stem cells in defined conditions. Nat Biotechnol
24: 185–187.
3. Ezashi T, Das P, Roberts RM (2005) Low O2 tensions and the prevention of
differentiation of hES cells. Proceedings of the National Academy of Sciences of
the United States of America 102: 4783–4788.
4. Westfall SD, Sachdev S, Das P, Hearne LB, Hannink M, et al. (2008)
Identification of oxygen-sensitive transcriptional programs in human embryonic
stem cells. Stem cells and development 17: 869–881.
5. Forristal CE, Wright KL, Hanley NA, Oreffo RO, Houghton FD (2010)
Hypoxia inducible factors regulate pluripotency and proliferation in human
embryonic stem cells cultured at reduced oxygen tensions. Reproduction 139:
85–97.
6. Lofstedt T, Fredlund E, Holmquist-Mengelbier L, Pietras A, Ovenberger M, et
al. (2007) Hypoxia inducible factor-2alpha in cancer. Cell Cycle 6: 919–926.
7. Hu CJ, Wang LY, Chodosh LA, Keith B, Simon MC (2003) Differential roles of
hypoxia-inducible factor 1alpha (HIF-1alpha) and HIF-2alpha in hypoxic gene
regulation. Mol Cell Biol 23: 9361–9374.
8. Houghton FD, Hawkhead JA, Humpherson PG, Hogg JE, Balen AH, et al.
(2002) Non-invasive amino acid turnover predicts human embryo developmen-
tal capacity. Hum Reprod 17: 999–1005.
9. Brison DR, Houghton FD, Falconer D, Roberts SA, Hawkhead J, et al. (2004)
Identification of viable embryos in IVF by non-invasive measurement of amino
acid turnover. Hum Reprod 19: 2319–2324.
10. Sathananthan H, Pera M, Trounson A (2002) The fine structure of human
embryonic stem cells. Reproductive biomedicine online 4: 56–61.
11. Van Blerkom J, Davis P, Mathwig V, Alexander S (2002) Domains of high-
polarized and low-polarized mitochondria may occur in mouse and human
oocytes and early embryos. Hum Reprod 17: 393–406.
12. Henderson JK, Draper JS, Baillie HS, Fishel S, Thomson JA, et al. (2002)
Preimplantation human embryos and embryonic stem cells show comparable
expression of stage-specific embryonic antigens. Stem Cells 20: 329–337.
13. Draper JS, Fox V (2003) Human embryonic stem cells: multilineage
differentiation and mechanisms of self-renewal. Arch Med Res 34: 558–564.
14. Hewitson LC, Leese HJ (1993) Energy metabolism of the trophectoderm and
inner cell mass of the mouse blastocyst. J Exp Zool 267: 337–343.
15. Houghton FD (2006) Energy metabolism of the inner cell mass and
trophectoderm of the mouse blastocyst. Differentiation 74: 11–18.
16. Varum S, Momcilovic O, Castro C, Ben-Yehudah A, Ramalho-Santos J, et al.
(2009) Enhancement of human embryonic stem cell pluripotency through
inhibition of the mitochondrial respiratory chain. Stem cell research 3: 142–156.
17. Varum S, Rodrigues AS, Moura MB, Momcilovic O, Easley CA, et al. (2011)
Energy metabolism in human pluripotent stem cells and their differentiated
counterparts. PLoS One 6: e20914.
18. Folmes CD, Nelson TJ, Martinez-Fernandez A, Arrell DK, Lindor JZ, et al.
(2011) Somatic oxidative bioenergetics transitions into pluripotency-dependent
glycolysis to facilitate nuclear reprogramming. Cell Metab 14: 264–271.
19. Tay JI, Rutherford AJ, Killick SR, Maguiness SD, Partridge RJ, et al. (1997)
Human tubal fluid: production, nutrient composition and response to adrenergic
agents. Hum Reprod 12: 2451–2456.
20. Petruzzelli R, Gaudino S, Amendola G, Sessa R, Puzone S, et al. (2010) Role of
the cold shock domain protein A in the transcriptional regulation of HBG
expression. Br J Haematol 150: 689–699.
21. Weinmann AS, Farnham PJ (2002) Identification of unknown target genes of
human transcription factors using chromatin immunoprecipitation. Methods 26:
37–47.
22. Forsyth NR, Musio A, Vezzoni P, Simpson AH, Noble BS, et al. (2006)
Physiologic oxygen enhances human embryonic stem cell clonal recovery and
reduces chromosomal abnormalities. Cloning Stem Cells 8: 16–23.
23. Amit M, Margulets V, Segev H, Shariki K, Laevsky I, et al. (2003) Human
feeder layers for human embryonic stem cells. Biology of reproduction 68: 2150–
2156.
24. Xu C, Inokuma MS, Denham J, Golds K, Kundu P, et al. (2001) Feeder-free
growth of undifferentiated human embryonic stem cells. Nature biotechnology
19: 971–974.
25. Kihira Y, Yamano N, Izawa-Ishizawa Y, Ishizawa K, Ikeda Y, et al. (2011) Basic
fibroblast growth factor regulates glucose metabolism through glucose
Energy Metabolism of Human Embryonic Stem Cells
PLOS ONE | www.plosone.org 8 May 2013 | Volume 8 | Issue 5 | e62507
transporter 1 induced by hypoxia-indu cible factor- 1alpha in adipocytes.
Int J Biochem Cell Biol 43: 1602–1611.
26. Kondoh H, Lleonart ME, Nakashima Y, Yokode M, Tanaka M, et al. (2007) A
high glycolytic flux supports the proliferative potential of murine embryonic stem
cells. Antioxid Redox Signal 9: 293–299.
27. Chen CT, Shih YR, Kuo TK, Lee OK, Wei YH (2008) Coordinated changes of
mitochondrial biogenesis and antioxidant enzymes during osteogenic differen-
tiation of human mesenchymal stem cells. Stem Cells 26: 960–968.
28. Flier JS, Mueckler M, McCall AL, Lodish HF (1987) Distribution of glucose
transporter messenger RNA transcripts in tissues of rat and man. J Clin Invest
79: 657–661.
29. Froehner SC, Davies A, Baldwin SA, Lienhard GE (1988) The blood-nerve
barrier is rich in glucose transporter. J Neurocytol 17: 173–178.
30. Kahn BB, Flier JS (1990) Regulation of glucose-transporter gene expression
in vitro and in vivo. Diabetes Care 13: 548–564.
31. Lee SH, Heo JS, Han HJ (2007) Effect of hypoxia on 2-deoxyglucose uptake and
cell cycle regulatory pr otein expression of mouse embryonic stem cells:
involvement of Ca
2+
/PKC, MAPKs and HIF-1alpha. Cell Physiol Biochem
19: 269–282.
32. Hayashi M, Sakata M, Takeda T, Yamamoto T, Okamoto Y, et al. (2004)
Induction of glucose transporter 1 expression through hypoxia-inducible factor
1alpha under hypoxic conditions in trophoblast-derived cells. J Endocrinol 183:
145–154.
33. Zelzer E, Levy Y, Kahana C, Shilo BZ, Rubinstein M, et al. (1998) Insulin
induces transcription of target genes through the hypoxia-inducible factor HIF-
1alpha/ARNT. The EMBO journal 17: 5085–5094.
34. Iyer NV, Kotch LE, Agani F, Leung SW, Laughner E, et al. (1998) Cellular and
developmental control of O
2
homeostasis by hypoxia-inducible factor 1 alpha.
Genes Dev 12: 149–162.
35. Seagroves TN, Ryan HE, Lu H, Wouters BG, Knapp M, et al. (2001)
Transcription factor HIF-1 is a necessary mediator of the pasteur effect in
mammalian cells. Mol Cell Biol 21: 3436–3444.
36. Wright G, Higgin JJ, Raines RT, Steenbergen C, Murphy E (2003) Activation of
the prolyl hydroxylase oxygen-sensor results in induction of GLUT1, heme
oxygenase-1, and nitric-oxide synthase proteins and confers protection from
metabolic inhibition to cardiomyocytes. J Biol Chem 278: 20235–20239.
37. Ryan HE, Lo J, Johnson RS (1998) HIF-1 alpha is required for solid tumor
formation and embryonic vascularization. EMBO J 17: 3005–3015.
38. Semenza GL, Jiang BH, Leung SW, Passantino R, Concordet JP, et al. (1996)
Hypoxia response elements in the aldolaseA,enolase1,andlactate
dehydrogenase A gene promoters contain essential binding sites for hypoxia-
inducible factor 1. J Biol Chem 271: 32529–32537.
39. Panopoulos AD, Yanes O, Ruiz S, Kida YS, Diep D, et al. (2012) The
metabolome of induced pluripotent stem cells reveals metabolic changes
occurring in somatic cell reprogramming. Cell Res 22: 168–177.
40. Prigione A, Fauler B, Lurz R, Lehrach H, Adjaye J (2010) The senescence-
related mitochondrial/oxidative stress pathway is repressed in human induced
pluripotent stem cells. Stem Cells 28: 721–733.
41. Cowan CA, Klimanskaya I, McMahon J, Atienza J, Witmyer J, et al. (2004)
Derivation of embryonic stem-cell lines from human blastocysts. N Engl J Med
350: 1353–1356.
Energy Metabolism of Human Embryonic Stem Cells
PLOS ONE | www.plosone.org 9 May 2013 | Volume 8 | Issue 5 | e62507
... HIF is one of the central regulators of glycolysis. hESCs cultured under hypoxic conditions were shown to consume less oxygen, utilize more glucose and less pyruvate, and produce more lactate, suggesting elevated levels of glycolysis [33]. Expression of glucose transporters GLUT1 and GLUT3 in hESCs are both upregulated under hypoxic conditions [5,21,33], suggesting increased glucose uptake under decreased oxygen tension. ...
... hESCs cultured under hypoxic conditions were shown to consume less oxygen, utilize more glucose and less pyruvate, and produce more lactate, suggesting elevated levels of glycolysis [33]. Expression of glucose transporters GLUT1 and GLUT3 in hESCs are both upregulated under hypoxic conditions [5,21,33], suggesting increased glucose uptake under decreased oxygen tension. Multiple metabolic enzymes have been shown to be regulated by HIF, including pyruvate dehydrogenase kinase [51], lactate dehydrogenase, hexokinase, and several other glycolytic enzymes [50,81,85,86]. ...
Article
Full-text available
All living organisms need energy to carry out their essential functions. The importance of energy metabolism is increasingly recognized in human pluripotent stem cells. Energy production is not only essential for cell survival and proliferation, but also critical for pluripotency and cell fate determination. Thus, energy metabolism is an important target in cellular regulation and stem cell applications. In this review, we will discuss key factors that influence energy metabolism and their association with stem cell functions.
... For example, human embryonic stem cells rely on glycolysis in a mildly hypoxic environment for selfrenewal. Upon exposure to oxygen, these cells increase oxidative phosphorylation and quickly lose pluripotency 8 . Inflammatory macrophages rely primarily on glycolysis and the PPP while repair macrophages utilize oxidative phosphorylation and switching in these cells activates distinct transcriptional profiles 9,10 . ...
... A metabolic shift to glucose metabolism is essential for regeneration Metabolic switching has been shown to play a key role in immune cell responses 24 , stem cell maintenance 8,25 , and cancer progression 26 . To understand if it also has a role in regeneration, we impaired either mitochondrial function or glucose metabolism during development and tail regeneration. ...
Article
Full-text available
Throughout their lifetime, fish maintain a high capacity for regenerating complex tissues after injury. We utilized a larval tail regeneration assay in the zebrafish Danio rerio, which serves as an ideal model of appendage regeneration due to its easy manipulation, relatively simple mixture of cell types, and superior imaging properties. Regeneration of the embryonic zebrafish tail requires development of a blastema, a mass of dedifferentiated cells capable of replacing lost tissue, a crucial step in all known examples of appendage regeneration. Using this model, we show that tail amputation triggers an obligate metabolic shift to promote glucose metabolism during early regeneration similar to the Warburg effect observed in tumor forming cells. Inhibition of glucose metabolism did not affect the overall health of the embryo but completely blocked the tail from regenerating after amputation due to the failure to form a functional blastema. We performed a time series of single-cell RNA sequencing on regenerating tails with and without inhibition of glucose metabolism. We demonstrated that metabolic reprogramming is required for sustained TGF-β signaling and blocking glucose metabolism largely mimicked inhibition of TGF-β receptors, both resulting in an aberrant blastema. Finally, we showed using genetic ablation of three possible metabolic pathways for glucose, that metabolic reprogramming is required to provide glucose specifically to the hexosamine biosynthetic pathway while neither glycolysis nor the pentose phosphate pathway were necessary for regeneration.
... Adaptation to a hypoxic milieu relies on a rapid, reversible metabolic switch from oxidative phosphorylation to anaerobic glycolysis (Abaci et al., 2010) (see also Section on Stem cell metabolism). The culture of hPSCs at 5% O 2 increases the flux of glucose to lactate (Forristal et al., 2013), whereas hPSCs maintained at atmospheric conditions exhibit reduced lactate production with increased oxidative metabolism. Oxygen also influences the use of amino acids by hPSCs, although there is no consistent pattern across hESC and hiPSC lines. ...
... In murine ESCs, the pluripotency marker Pou5f1 (Oct4) is upregulated by overexpression of HIF2a (Covello et al., 2006). Similarly, silencing of HIF2A significantly decreased hESC proliferation and expression of OCT4, NANOG, and SOX2 proteins (markers of pluripotency) (Sugimoto et al., 2018;Forristal et al., 2010Forristal et al., , 2013. Both HIF2A and HIF3A, which had nuclear localization in long-term culture at 5% O 2 , were significantly upregulated compared to cells cultured at 20% O 2 . ...
Chapter
In 2006, Takahashi and Yamanaka reported the generation of mouse and human induced pluripotent stem cells (iPS cells) by retroviral gene transduction of four transcription factors, famously known as Yamanaka factors (OCT4, SOX2, Klf4, and c-Myc) (Takahashi et al., 2007; Takahashi and Yamanaka, 2006). iPS cells show stemness properties (self-renewal and differentiation into three germ layers derivatives) that are comparable to the embryonic stem cells (ES cells). However, conventional iPS cells technique is not entirely safe because of its procedural difficulties, lower efficiency, and the risk of cancer formation (Luo et al., 2013; Rais et al., 2013). Meanwhile, several bacteria-mediated strategies have been identified that can reprogram differentiated cells into stem cell–like state and dedifferentiate into three germ layer derived cells. In 2012, Fuji et al. reported Helicobacter pylori bacteria can reprogram gastric epithelial cells into intestinal stem/progenitor-like cells in vivo by inducing homeobox transcription factors (CDX) during intestinal metaplasia (Fujii et al., 2012). In the same year, our group discovered that lactic acid bacteria (LAB) can reprogram human dermal fibroblast (HDF) into stem cell–like cells in vitro that can differentiate into all three germ layer derivatives (Ohta et al., 2012). Later, Masaki et al. reported that leprosy-causing bacterium Mycobacterium leprae reprograms adult Schwann cells into stem cell–like cells in vivo that differentiate into mesenchymal, skeletal, and smooth muscle cells facilitating infection dissemination (Masaki et al., 2013). In 2017, Ikeda et al. reported that Wolbachia pipientis bacterial proteins can accelerate traditional retroviral-mediated iPS cells generation process (Ikeda et al., 2017). All these studies substantiate the epigenetic potentials of bacteria or its material to induce stemness in differentiated cells. Such microbial potentials might be connected with the endosymbiotic theory, which states that eukaryotic cells are generated through endosymbiotic relationship between prokaryotes (Woese et al., 1990). In this chapter, we briefly discussed about several evidences of bacterial impact on cellular homeostasis and plasticity. We largely focused on LAB-mediated cell reprogramming of HDF cells as a potential technique for future iPS cells generation.
... Adaptation to a hypoxic milieu relies on a rapid, reversible metabolic switch from oxidative phosphorylation to anaerobic glycolysis (Abaci et al., 2010) (see also Section on Stem cell metabolism). The culture of hPSCs at 5% O 2 increases the flux of glucose to lactate (Forristal et al., 2013), whereas hPSCs maintained at atmospheric conditions exhibit reduced lactate production with increased oxidative metabolism. Oxygen also influences the use of amino acids by hPSCs, although there is no consistent pattern across hESC and hiPSC lines. ...
... In murine ESCs, the pluripotency marker Pou5f1 (Oct4) is upregulated by overexpression of HIF2a (Covello et al., 2006). Similarly, silencing of HIF2A significantly decreased hESC proliferation and expression of OCT4, NANOG, and SOX2 proteins (markers of pluripotency) (Sugimoto et al., 2018;Forristal et al., 2010Forristal et al., , 2013. Both HIF2A and HIF3A, which had nuclear localization in long-term culture at 5% O 2 , were significantly upregulated compared to cells cultured at 20% O 2 . ...
Chapter
In 2006, Takahashi and Yamanaka reported the generation of mouse and human induced pluripotent stem cells (iPS cells) by retroviral gene transduction of four transcription factors, famously known as Yamanaka factors (OCT4, SOX2, Klf4, and c-Myc) (Takahashi et al., 2007; Takahashi and Yamanaka, 2006). iPS cells show stemness properties (self-renewal and differentiation into three germ layers derivatives) that are comparable to the embryonic stem cells (ES cells). However, conventional iPS cells technique is not entirely safe because of its procedural difficulties, lower efficiency, and the risk of cancer formation (Luo et al., 2013; Rais et al., 2013). Meanwhile, several bacteria-mediated strategies have been identified that can reprogram differentiated cells into stem cell–like state and dedifferentiate into three germ layer derived cells. In 2012, Fuji et al. reported Helicobacter pylori bacteria can reprogram gastric epithelial cells into intestinal stem/progenitor-like cells in vivo by inducing homeobox transcription factors (CDX) during intestinal metaplasia (Fujii et al., 2012). In the same year, our group discovered that lactic acid bacteria (LAB) can reprogram human dermal fibroblast (HDF) into stem cell–like cells in vitro that can differentiate into all three germ layer derivatives (Ohta et al., 2012). Later, Masaki et al. reported that leprosy-causing bacterium Mycobacterium leprae reprograms adult Schwann cells into stem cell–like cells in vivo that differentiate into mesenchymal, skeletal, and smooth muscle cells facilitating infection dissemination (Masaki et al., 2013). In 2017, Ikeda et al. reported that Wolbachia pipientis bacterial proteins can accelerate traditional retroviral-mediated iPS cells generation process (Ikeda et al., 2017). All these studies substantiate the epigenetic potentials of bacteria or its material to induce stemness in differentiated cells. Such microbial potentials might be connected with the endosymbiotic theory, which states that eukaryotic cells are generated through endosymbiotic relationship between prokaryotes (Woese et al., 1990). In this chapter, we briefly discussed about several evidences of bacterial impact on cellular homeostasis and plasticity. We largely focused on LAB-mediated cell reprogramming of HDF cells as a potential technique for future iPS cells generation.
... The uterine environment is hypoxic 72 and the embryos analysed here were cultured under atmospheric oxygen conditions 36 (see Supplementary Data 1). This would predict lower glycolysis scores, as hypoxia of the embryo microenvironment would induce glycolytic metabolism 17,73 . However, we observed increased glycolytic scores for cynomolgus embryos cultured in vitro. ...
Article
Full-text available
Mammalian embryogenesis relies on glycolysis and oxidative phosphorylation to balance the generation of biomass with energy production. However, the dynamics of metabolic regulation in the postimplantation embryo in vivo have remained elusive due to the inaccessibility of the implanted conceptus for biochemical studies. To address this issue, we compiled single-cell embryo profiling data in six mammalian species and determined their metabolic dynamics through glycolysis and oxidative phosphorylation associated gene expression. Strikingly, we identify a conserved switch from bivalent respiration in the late blastocyst towards a glycolytic metabolism in early gastrulation stages across species, which is independent of embryo implantation. Extraembryonic lineages followed the dynamics of the embryonic lineage, except visceral endoderm. Finally, we demonstrate that in vitro primate embryo culture substantially impacts metabolic gene regulation by comparison to in vivo samples. Our work reveals a conserved metabolic programme despite different implantation modes and highlights the need to optimise postimplantation embryo culture protocols.
... Ces HIF se lient sur des éléments de réponse à l'hypoxie (Hypoxia Response Element ou HRE) qui modulent à leur tour l'expression d'autres gènes qui sont donc inductibles à l'hypoxie(Chang et al., 2018). Parmi ces gènes, on retrouve deux transporteurs cellulaires de glucose (Glucose Transporteur type 1/3 ou GLUT1 et GLUT3) ainsi que trois marqueurs de la pluripotence (octamer-binding transcription factor 4 ou OCT4, SRY-Box Transcription Factor 2 ou SOX2 et Nanog Homeobox ou NANOG), facteurs dont la surexpression a été décrite dans les cellules souches embryonnaires humaines (hESC) soumises à l'hypoxie(Christensen et al., 2015;Forristal et al., 2013) (Figure 20). L'hypoxie pourrait également participer à l'éclosion embryonnaire grâce à l'augmentation de la sécrétion de la prokinéticine 1 (PROK1)(Brouillet et al., 2012), qui stimulerait à son tour la production de la cyclooxygenase 2 (COX2)(Evans et al., 2008), puis l'expression des cathepsins qui participent à l'éclosion embryonnaire(Seshagiri et al., 2016). ...
Thesis
Le transfert d’un embryon compétent dans la cavité utérine pendant la fenêtre d’implantation est un objectif majeur pour garantir le succès en Fécondation in vitro (FIV). Mon travail de thèse contribue (i) à l’identification de nouveaux biomarqueurs d’évaluation de la réceptivité endométriale (ii) à la compréhension de la compétence embryonnaire en FIV.Concernant le premier axe, l’équipe a mis au point le Win-Test®, test d’évaluation de la réceptivité endométriale basé sur la recherche d’une signature transcriptomique spécifique au sein de biopsies endométriales prélevées chez des patientes pendant leur fenêtre théorique d'implantation. Le but de ce test est de déterminer le moment adéquat pour replacer l’embryon. Lorsque la période « réceptive » est identifiée, il permet d’adapter la date du transfert embryonnaire à la fenêtre implantatoire effective de la patiente, augmentant significativement le taux de grossesses après transfert personnalisé d’embryon(s) congelé(s) (Haouzi et al, 2020). A ce jour, ce test nécessite la réalisation de deux biopsies endométriales, et ne peut être réalisé que sur un transfert d’embryon congelé/décongelé. Pour tenter de s’affranchir de ces deux contraintes, l’objectif de ma thèse a été de participer à la mise au point d’une approche non-invasive de l’évaluation de la réceptivité endométriale en FIV. L’analyse des profils d’expression des microARNs issus de biopsies endométriales nous a permis d’identifier certains microARNs endométriaux associés à la réceptivité endométriale (« réceptif » versus « non réceptif ») ainsi qu'au succès de la tentative (« échec d'implantation » versus « implantation réussie » et « fausse couche » versus « naissance ») (Drissennek, Baron, et al, 2020). Mes résultats préliminaires indiquent que certains de ces microARNs sont détectés dans le sérum des patientes, ouvrant ainsi des perspectives intéressantes pour la mise au point d’un test non-invasif spécifique de la réceptivité endométriale.Le second axe de ma thèse a porté sur l’amélioration du développement et du potentiel implantatoire précoce des embryons humains. En effet, l’embryon évolue in vivo dans la trompe de Fallope jusqu’au stade morula et arrive dans l’utérus au stade de blastocyste vers J6 post-fécondation, dans un endomètre supposé réceptif qui pourra assurer l’implantation. Physiologiquement, il a été montré que le taux d’oxygène était de 5% dans les trompes de Fallope, puis de 2% dans l’utérus. A ce jour, la majorité des laboratoires de FIV dans le monde utilise pourtant 5% d’oxygène de J0 à J6 pour la culture in vitro des embryons humains. Nos résultats ont montré qu’une culture in vitro séquentielle à 5% d’oxygène de J0 à J3 puis à 2% d’oxygène de J3 à J5/J6 (mimant ainsi les concentrations physiologiques en oxygène) améliorerait significativement le développement embryonnaire humain et les taux de naissances vivantes en FIV. En utilisant une approche transcriptomique, nos résultats mettent en évidence la différentiation d’expression de 707 gènes selon que les embryons aient été cultivés à 5% d’oxygène ou à 5% puis 2% d’oxygène, avec une surexpression de la majorité (93,8%) des transcrits dérégulés dans les embryons cultivés en stratégie séquentielle (5-2% d’oxygène). L’analyse fonctionnelle a mis en évidence l’implication de ces ARNs dans des processus cellulaires clés de la croissance et du potentiel implantatoire embryonnaire ; tels que la prolifération, la réparation de l’ADN et le maintien de la pluripotence. Ces résultats ouvrent de nouvelles perspectives quant à l’amélioration des conditions de culture embryonnaire sous réserve de la confirmation sur une étude à plus large échelle.
... ESCs are usually cultured in a hypoxic environment. This is because higher oxygen concentrations can cause differentiation in hESCs (Forristal et al. (2013)). Part of the mechanism underlying this effect is the response of hypoxia inducible factor 1 (HIF1) to low oxygen availability, where the HIF complex assembles to bind to activate glycolytic genes. ...
Thesis
Early mammalian embryos undergo remarkable changes in their metabolism, with a global transition from oxidative phosphorylation to glycolysis as they transit out of pluripotency and begin to make the first cell fate decisions in preparation for gastrulation. In humans this transition can be modelled with pluripotent cells in culture which exist in a naive (more pluripotent) and a primed (epiblast like) state and show the same differences in metabolic regulation. These two cell states also show major differences in their epigenetic landscape including in DNA methylation, repressive histone modifications, and spatial organisation of chromatin. I am interested in studying this metabolic regulation and its potential interface with epigenetic modifiers. In order to study metabolic regulation and heterogeneity within populations of naive and primed cells, I have adapted an existing method of constraint-based modelling to using constraints based on single cell RNA-seq data. The implementation of single cell models allows us to directly investigate the effect of transcriptional variability on the metabolism of the cells. Analysis of these modelling results shows that PCA of all reaction fluxes reveals clear differences between naive and primed cells, but interestingly also reveals subgroups within each cell type which exhibit different metabolic landscapes, which has not been previously observed. Notably, we have identified two genes which clearly identify these subgroups: SLC15A1 and SLC15A2. These genes encode transporters which are involved in uptake of dietary peptides, and there is no documentation of their function in pluripotency. Here we use several experimental techniques, including single molecule RNA fluorescence in situ hybridisation, to identify if these subpopulations present as our model suggests; future investigation may lead to novel insights into the regulation of these genes and their previously unnoticed role in stem cell metabolism and pluripotency.
Article
Development of the human placenta takes place in contrasting oxygen concentrations at different stages of gestation, from ~20 mmHg during the first trimester rising to ~60 mmHg at the start of the second trimester before gradually declining to ~40 mmHg at term. In view of these changes the early placenta has been described as 'hypoxic'. However, placental metabolism is heavily glycolytic, supported by the rich supply of glucose from the endometrial glands, and there is no evidence of energy compromise. On the contrary, the trophoblast is highly proliferative, with the physiological low-oxygen environment promoting maintenance of stemness in progenitor populations. These conditions favour formation of the cytotrophoblastic shell that encapsulates the conceptus, and interfaces with the endometrium. Extravillous trophoblast cells on the outer surface of the shell undergo an epithelial-mesenchymal transition and acquire invasive potential. Experimental evidence suggests these changes may be mediated by the higher oxygen concentration present within the placental bed. Interpreting in vitro data is often difficult, however, due to the use of non-physiological oxygen concentrations and trophoblast-like cell lines or explant models. Trophoblast is more vulnerable to hyperoxia or fluctuating levels of oxygen than hypoxia, and some degree of placental oxidative stress likely occurs in all pregnancies towards term. In complications of pregnancy, such as early-onset pre-eclampsia, malperfusion generates high levels of oxidative stress, causing release of factors that precipitate the maternal syndrome. Further experiments are required using genuine trophoblast progenitor cells and physiological concentrations to fully elucidate the pathways by which oxygen regulates placental development.
Chapter
Human pluripotent stem cells (hPSCs) hold great promise as cellular therapeutics and in vitro models of disease. These applications require advances in hPSC biomanufacturing in scalable cultivation systems. Stirred suspension bioreactors (SSBs), which are commonly utilized for the production of biologics, afford real-time monitoring and tight control of the culture environment. Stem cell expansion has been demonstrated in this modality but knowledge is currently limited of how the bioreactor milieu influences hPSC physiology. Here, relevant findings are discussed on the effects of adjustable factors such as dissolved oxygen, hydrodynamic cues, and composition of media on the expansion of hPSCs. Greater understanding of the links between cultivation conditions and hPSC self-renewal and propensity for differentiation will be essential for the rational design of processes to robustly biomanufacture hPSC products for clinical use.
Chapter
Human embryonic stem cells (hESCs) are a biologically amenable working model with exceptional growth ability that holds an immense, prospective for advances in cell-dependent therapeutics, modeling of diseases, and development of personalized medicine. Discerning the mechanistic pathways involved and how the process of self-renewal and pluripotency are driven throughout the period of cellular existence will provide us with a proper overview of the regulation of the hESCs population during aging. This chapter describes a robust cellular, molecular, metabolic, and epigenetic processes to uncover the factors contributing to the physiological alterations of hESCs aging. It also highlights a plethora of ethical restrictions concerning the usage of hESCs and also focuses on the current therapies under development on age-associated degenerative disease employing hESCs.
Article
Full-text available
Background: IVF is limited by low success rates and a confounding high multiple birth rate contributing to prematurity, increased neonatal mortality and child handicap. These problems could be overcome if single embryos of known developmental competence could be selected for transfer on day 2/3 of development, but current methods, which rely on morphological appearance, are poor predictors of viability. Methods: We have measured non-invasively the depletion/appearance (i.e. turnover) of a physiological mixture of 18 amino acids by single human embryos during in-vitro culture using high performance liquid chromatography. Results: From the time of transfer (day 2/3), embryos with future competence to develop to the blastocyst stage (day 5/6) exhibit amino acid flux patterns distinct from those of embryos with similar morphological appearance which arrest. Significantly, the profiles of Ala, Arg, Gln, Met and Asn flux predict blastocyst potentiality at >95%. The amino acid most consistently depleted throughout development by those embryos which form blastocysts; was leucine. Of the amino acids which were produced, the most striking was alanine, which appeared in increasing amounts throughout development. Conclusions: Non-invasive amino acid profiling has the potential to select developmentally competent single embryos for transfer, thereby increasing the success rate and eliminating multiple births in IVF.
Article
Full-text available
Metabolism is vital to every aspect of cell function, yet the metabolome of induced pluripotent stem cells (iPSCs) remains largely unexplored. Here we report, using an untargeted metabolomics approach, that human iPSCs share a pluripotent metabolomic signature with embryonic stem cells (ESCs) that is distinct from their parental cells, and that is characterized by changes in metabolites involved in cellular respiration. Examination of cellular bioenergetics corroborated with our metabolomic analysis, and demonstrated that somatic cells convert from an oxidative state to a glycolytic state in pluripotency. Interestingly, the bioenergetics of various somatic cells correlated with their reprogramming efficiencies. We further identified metabolites that differ between iPSCs and ESCs, which revealed novel metabolic pathways that play a critical role in regulating somatic cell reprogramming. Our findings are the first to globally analyze the metabolome of iPSCs, and provide mechanistic insight into a new layer of regulation involved in inducing pluripotency, and in evaluating iPSC and ESC equivalence.
Article
Full-text available
Background Human pluripotent stem cells have the ability to generate all cell types present in the adult organism, therefore harboring great potential for the in vitro study of differentiation and for the development of cell-based therapies. Nonetheless their use may prove challenging as incomplete differentiation of these cells might lead to tumoregenicity. Interestingly, many cancer types have been reported to display metabolic modifications with features that might be similar to stem cells. Understanding the metabolic properties of human pluripotent stem cells when compared to their differentiated counterparts can thus be of crucial importance. Furthermore recent data has stressed distinct features of different human pluripotent cells lines, namely when comparing embryo-derived human embryonic stem cells (hESCs) and induced pluripotent stem cells (IPSCs) reprogrammed from somatic cells. Methodology/Principal Findings We compared the energy metabolism of hESCs, IPSCs, and their somatic counterparts. Focusing on mitochondria, we tracked organelle localization and morphology. Furthermore we performed gene expression analysis of several pathways related to the glucose metabolism, including glycolysis, the pentose phosphate pathway and the tricarboxylic acid (TCA) cycle. In addition we determined oxygen consumption rates (OCR) using a metabolic extracellular flux analyzer, as well as total intracellular ATP levels by high performance liquid chromatography (HPLC). Finally we explored the expression of key proteins involved in the regulation of glucose metabolism. Conclusions/Findings Our results demonstrate that, although the metabolic signature of IPSCs is not identical to that of hESCs, nonetheless they cluster with hESCs rather than with their somatic counterparts. ATP levels, lactate production and OCR revealed that human pluripotent cells rely mostly on glycolysis to meet their energy demands. Furthermore, our work points to some of the strategies which human pluripotent stem cells may use to maintain high glycolytic rates, such as high levels of hexokinase II and inactive pyruvate dehydrogenase (PDH).
Article
Hypoxia is an essential developmental and physiological stimulus that plays a key role in the pathophysiology of cancer, heart attack, stroke, and other major causes of mortality. Hypoxia inducible factor 1 (HIF-1) is the only known mammalian transcription factor expressed uniquely in response to physiologically relevant levels of hypoxia. We now report that in Hif1 alpha(-/-) embryonic stem cells that did not express the O-2-regulated HIF-1 alpha subunit, levels of mRNAs encoding glucose transporters and glycolytic enzymes were reduced, and cellular proliferation was impaired. Vascular endothelial growth factor mRNA expression was also markedly decreased in hypoxic Hif1 alpha(-/-) embryonic stem cells and cystic embryoid bodies. Complete deficiency of HIF-1 alpha resulted in developmental arrest and lethality by E11 of Hif1 alpha(-/-) embryos that manifested neural tube defects, cardiovascular malformations, and marked cell death within the cephalic mesenchyme. In Hif1 alpha(+/+) embryos, HIF-1 alpha expression increased between E8.5 and E9.5, coincident with the onset of developmental defects and cell death in Hif1 alpha(-/-)embryos. These results demonstrate that HIF-1 alpha is a master regulator of cellular and developmental O-2 homeostasis.
Article
Cell-surface antigens provide invaluable tools for the identification of cells and for the analysis of cell differentiation. In particular, stage-specific embryonic antigens that are developmentally regulated during early embryogenesis are widely used as markers to monitor the differentiation of both mouse and human embryonic stem (ES) cells and their malignant counterparts, embryonic carcinoma (EC) cells. However, there are notable differences in the expression patterns of some such markers between human and mouse ES/EC cells, and hitherto it has been unclear whether this indicates significant differences between human and mouse embryos, or whether ES/EC cells correspond to distinct cell types within the early embryos of each species. We now show that human ES cells are characterized by the expression of the cell-surface antigens, SSEA3, SSEA4, TRA-1-60, and TRA-1-81, and by the lack of SSEA1, and that inner cell mass cells of the human blastocyst express a similar antigen profile, in contrast to the corresponding cells of the mouse embryo.
Article
Hypoxia-inducible factor-1α (HIF-1α), which is a transcription factor that enhances glycolysis in cells in response to hypoxia, is induced in hypertrophied adipocytes in obesity. Recent studies have shown that growth factors are able to induce HIF-1α by mechanisms independent of hypoxia. Since basic fibroblast growth factor (bFGF), an angiogenic factor, is concentrated in expanding adipose tissue, the possible effects of bFGF on regulation of HIF-1α in adipocytes were investigated. Treatment of differentiated 3T3-L1 adipocytes with bFGF induced HIF-1α. Concomitantly, glucose transporter 1 (GLUT1), which is a target gene of HIF-1α, was induced at both mRNA and protein levels and was translocated to the plasma membrane. A chromatin immunoprecipitation assay and an RNA interference study indicated that bFGF-induced HIF-1α directly upregulates GLUT1. In addition, it was observed that bFGF increases lactate production of adipocytes. This result indicates that bFGF reprograms the metabolism toward glycolysis. Intraperitoneal injection of bFGF into mice upregulated HIF-1α and GLUT1 in adipose tissues, suggesting that bFGF regulates the metabolism of adipocytes via HIF-1α-GLUT1 regulation in vivo. We also found that bFGF inhibits insulin-induced phosphorylation of insulin receptor substrate-1 and Akt, suggesting that bFGF attenuates the insulin signal in adipocytes. Taken together, the findings suggest that bFGF has a harmful effect on the development of type 2 diabetes through metabolism reprogramming and attenuation of the insulin signal.
Article
The bioenergetics of somatic dedifferentiation into induced pluripotent stem cells remains largely unknown. Here, stemness factor-mediated nuclear reprogramming reverted mitochondrial networks into cristae-poor structures. Metabolomic footprinting and fingerprinting distinguished derived pluripotent progeny from parental fibroblasts according to elevated glucose utilization and production of glycolytic end products. Temporal sampling demonstrated glycolytic gene potentiation prior to induction of pluripotent markers. Functional metamorphosis of somatic oxidative phosphorylation into acquired pluripotent glycolytic metabolism conformed to an embryonic-like archetype. Stimulation of glycolysis promoted, while blockade of glycolytic enzyme activity blunted, reprogramming efficiency. Metaboproteomics resolved upregulated glycolytic enzymes and downregulated electron transport chain complex I subunits underlying cell fate determination. Thus, the energetic infrastructure of somatic cells transitions into a required glycolytic metabotype to fuel induction of pluripotency.
Article
Impaired switching from fetal haemoglobin (HbF) to adult globin gene expression leads to hereditary persistence of fetal haemoglobin (HPFH) in adult life. This is of prime interest because elevated HbF levels ameliorate β-thalassaemia and sickle cell anaemia. Fetal haemoglobin levels are regulated by complex mechanisms involving factors linked or not to the β-globin gene (HBB) locus. To search for factors putatively involved in the expression of the γ-globin genes (HBG1, HBG2), we examined the reticulocyte transcriptome of three siblings who had different HbF levels and different degrees of β-thalassaemia severity although they had the same ΗBA- and ΗΒB cluster genotypes. By mRNA differential display we isolated the cDNA coding for the cold shock domain protein A (CSDA), also known as dbpA, previously reported to interact in vitro with the HBG2 promoter. Expression studies performed in K562 and in primary erythroid cells showed an inverse relationship between HBG and CSDA expression levels. Functional studies performed by Chromatin Immunoprecipitation and reporter gene assays in K562 cells demonstrated that CSDA is able to bind the HBG2 promoter and suppress its expression. Therefore, our study demonstrated that CSDA is a trans-acting repressor factor of HBG expression and modulates the HPFH phenotype.
Article
The ability of stem cells to propagate indefinitely is believed to occur via the fine modulation of pathways commonly involved in cellular senescence, including the telomerase, the p53, and the mitochondrial/oxidative stress pathways. Induced pluripotent stem cells (iPSCs) are a novel stem cell population obtained from somatic cells through forced expression of a set of genes normally expressed in embryonic stem cells (ESCs). These reprogrammed cells acquire self-renewal properties and appear almost undistinguishable from ESCs in terms of morphology, gene expression, and differentiation potential. Accordingly, iPSCs exhibit alterations of the senescence-related telomerase and p53 signaling pathways. However, although treatments with antioxidants have been recently shown to enhance cellular reprogramming, detailed information regarding the state of the mitochondrial/oxidative stress pathway in iPSCs is still lacking. Mitochondria undergo specific changes during organismal development and aging. Thus, addressing whether somatic mitochondria within iPSCs acquire ESC-like features or retain the phenotype of the parental cell is an unanswered but relevant question. Herein, we demonstrate that somatic mitochondria within human iPSCs revert to an immature ESC-like state with respect to organelle morphology and distribution, expression of nuclear factors involved in mitochondrial biogenesis, content of mitochondrial DNA, intracellular ATP level, oxidative damage, and lactate generation. Upon differentiation, mitochondria within iPSCs and ESCs exhibited analogous maturation and anaerobic-to-aerobic metabolic modifications. Overall, the data highlight that human iPSCs and ESCs, although not identical, share similar mitochondrial properties and suggest that cellular reprogramming can modulate the mitochondrial/oxidative stress pathway, thus inducing a rejuvenated state capable of escaping cellular senescence.