Minority Quasispecies of Drug‐Resistant HIV‐1 That Lead to Early Therapy Failure in Treatment‐Naive and ‐Adherent Patients

Article (PDF Available)inClinical Infectious Diseases 48(2):239-47 · January 2009with35 Reads
DOI: 10.1086/595703 · Source: PubMed
Abstract
Early virological failure of antiretroviral therapy associated with the selection of drug-resistant human immunodeficiency virus type 1 in treatment-naive patients is very critical, because virological failure significantly increases the risk of subsequent failures. Therefore, we evaluated the possible role of minority quasispecies of drug-resistant human immunodeficiency virus type 1, which are undetectable at baseline by population sequencing, with regard to early virological failure. We studied 4 patients who experienced early virological failure of a first-line regimen of lamivudine, tenofovir, and either efavirenz or nevirapine and 18 control patients undergoing similar treatment without virological failure. The key mutations K65R, K103N, Y181C, M184V, and M184I in the reverse transcriptase were quantified by allele-specific real-time polymerase chain reaction performed on plasma samples before and during early virological treatment failure. Before treatment, none of the viruses showed any evidence of drug resistance in the standard genotype analysis. Minority quasispecies with either the M184V mutation or the M184I mutation were detected in 3 of 18 control patients. In contrast, all 4 patients whose treatment was failing had harbored drug-resistant viruses at low frequencies before treatment, with a frequency range of 0.07%-2.0%. A range of 1-4 mutations was detected in viruses from each patient. Most of the minority quasispecies were rapidly selected and represented the major virus population within weeks after the patients started antiretroviral therapy. All 4 patients showed good adherence to treatment. Nonnucleoside reverse-transcriptase inhibitor plasma concentrations were in normal ranges for all 4 patients at 2 separate assessment times. Minority quasispecies of drug-resistant viruses, detected at baseline, can rapidly outgrow and become the major virus population and subsequently lead to early therapy failure in treatment-naive patients who receive antiretroviral therapy regimens with a low genetic resistance barrier.
HIV/AIDS CID 2009:48 (15 January) 239
HIV/AIDSMAJOR ARTICLE
Minority Quasispecies of Drug-Resistant HIV-1 That
Lead to Early Therapy Failure in Treatment-Naive
and -Adherent Patients
Karin J. Metzner,
1,a,b
Stefano G. Giulieri,
2,a
Stefanie A. Knoepfel,
1
Pia Rauch,
1
Philippe Burgisser,
3
Sabine Yerly,
4
Huldrych F. Gu¨nthard,
5
and Matthias Cavassini
2
1
Institute of Clinical and Molecular Virology, University of Erlangen-Nuremberg, Erlangen, Germany;
2
Infectious Diseases Service and
3
Laboratory
of Immunology and Allergy, Centre Hospitalier Universitaire Vaudois and University of Lausanne, Lausanne,
4
Laboratory of Virology, Division of
Infectious Diseases, University Hospital of Geneva, Geneva, and
5
Department of Medicine, Division of Infectious Diseases and Hospital
Epidemiology, University Hospital Zurich, Zurich, Switzerland
Background. Early virological failure of antiretroviral therapy associated with the selection of drug-resistant
human immunodeficiency virus type 1 in treatment-naive patients is very critical, because virological failure
significantly increases the risk of subsequent failures. Therefore, we evaluated the possible role of minority qua-
sispecies of drug-resistant human immunodeficiency virus type 1, which are undetectable at baseline by population
sequencing, with regard to early virological failure.
Methods. We studied 4 patients who experienced early virological failure of a first-line regimen of lamivudine,
tenofovir, and either efavirenz or nevirapine and 18 control patients undergoing similar treatment without viro-
logical failure. The key mutations K65R, K103N, Y181C, M184V, and M184I in the reverse transcriptase were
quantified by allele-specific real-time polymerase chain reaction performed on plasma samples before and during
early virological treatment failure.
Results. Before treatment, none of the viruses showed any evidence of drug resistance in the standard genotype
analysis. Minority quasispecies with either the M184V mutation or the M184I mutation were detected in 3 of 18
control patients. In contrast, all 4 patients whose treatment was failing had harbored drug-resistant viruses at low
frequencies before treatment, with a frequency range of 0.07%–2.0%. A range of 1–4 mutations was detected in
viruses from each patient. Most of the minority quasispecies were rapidly selected and represented the major virus
population within weeks after the patients started antiretroviral therapy. All 4 patients showed good adherence to
treatment. Nonnucleoside reverse-transcriptase inhibitor plasma concentrations were in normal ranges for all 4
patients at 2 separate assessment times.
Conclusions. Minority quasispecies of drug-resistant viruses, detected at baseline, can rapidly outgrow and
become the major virus population and subsequently lead to early therapy failure in treatment-naive patients who
receive antiretroviral therapy regimens with a low genetic resistance barrier.
The use of combination antiretroviral therapy (ART)
has remarkably reduced the morbidity and mortality of
subjects infected with HIV [1], but these benefits can
Received 15 July 2008; accepted 26 September 2008; electronically published
16 December 2008.
Presented in part: 17th International HIV Drug Resistance Workshop: Basic
Principles and Clinical Implications, Sitges, Spain, June 2008 (abstract 106).
a
K.J.M. and S.G.G. contributed equally to this work.
b
Present affiliation: Department of Medicine, Division of Infectious Diseases
and Hospital Epidemiology, University Hospital Zurich, Zurich, Switzerland.
Reprints or correspondence: Dr. Karin J. Metzner, University Hospital Zurich,
Dept. of Medicine, Div. of Infectious Diseases and Hospital Epidemiology,
Ra¨mistrasse 100, CH-8091 Zurich, Switzerland (Karin.Metzner@usz.ch).
Clinical Infectious Diseases 2009;48:239–47
2008 by the Infectious Diseases Society of America. All rights reserved.
1058-4838/2009/4802-0011$15.00
DOI: 10.1086/595703
be compromised by the development of drug resistance
[2]. Since the first reports of primary infection with
drug-resistant HIV-1, transmission of drug-resistant
HIV strains has been a growing concern [3–5].
Because primary infection with a resistant strain may
decrease the efficacy of initial therapy, resistance testing
before initiation of ART, in the context of recent and
even established HIV-1 infection, is recommended [6].
However, one major limitation of techniques such as
population sequencing is the inability to detect drug-
resistant minority quasispecies unless they represent
20%–25% of the total population [7]. Allele-specific
real-time PCR (AS-PCR) allows the detection of mi-
nority quasispecies with discriminatory abilities to de-
240 CID 2009:48 (15 January) HIV/AIDS
tect viral variants that represent as little as 0.01% of the pop-
ulation. Using this technique, we have shown that drug-resis-
tant HIV variants could be detected in 20% of acute serocon-
verters; the drug-resistant virus population was detected by
population sequencing in only one-half of those patients [8].
The clinical importance of minority quasispecies has yet to be
determined. To date, only a few observations have shown that
minority quasispecies of drug-resistant viruses can emerge as
major virus populations after initiation of salvage therapy in
pretreated patients [9–11].
Virological failure of ART significantly increases the risk of
clinical progression and, when associated with the appearance
of drug-resistant viruses, limits further treatment options [12,
13]. Therefore, early virological failure (eVF) within a few weeks
after ART initiation in treatment-naive patients is especially
troublesome. Several reasons have been identified for eVF as-
sociated with HIV-1 drug resistance, such as poor adherence
to treatment, drug combinations with low antiretroviral po-
tencies, or pharmacokinetics issues (e.g., malabsorption and
drug interactions) [14–17]. Here, we addressed the role of mi-
nority quasispecies of drug-resistant viruses involved in the eVF
of treatment-naive patients. Four patients experienced eVF de-
spite excellent adherence and adequate drug plasma levels dur-
ing treatment with a potent first-line nonnucleoside reverse-
transcriptase inhibitor (NNRTI)–based regimen that was cho-
sen after baseline resistance testing. Therefore, we conducted a
case-control analysis of baseline and on-treatment samples by
AS-PCR assays for reverse-transcriptase (RT) mutations K65R,
K103N, Y181C, M184V, and M184I, and we compared the
results with those of standard virtual phenotype analysis using
population sequencing performed on the same samples.
METHODS
Study design and patients. All patients were treated at the
University Hospital of Lausanne from March 2005 through
August 2006. We identified as case patients those who expe-
rienced eVF while receiving first-line NNRTI-based regimen
despite good adherence to treatment (as certified by directly
observed therapy or weekly community visits by a qualified
nurse), adequate antiretroviral drug plasma levels, and no HIV-
1 drug resistance at baseline (determined by population se-
quencing). Control patients were selected retrospectively on the
basis of characteristics as follows: no failure associated with
first-line NNRTI-based regimen within the first 9 months of
treatment, no resistance mutations at baseline, and HIV-1 sub-
types and baseline viral loads comparable to those of the case
patients. To confirm that case and control patients had no
resistance mutations at baseline by population sequencing, 2
investigators performed a blind review of all fluorograms of
the sequences. The baseline characteristics of case and control
patients are summarized in tables 1 and 2, respectively. Plasma
sampling took place before and during ART. All patients agreed
to plasma sampling and resistance testing.
HIV quantification and resistance testing. Plasma HIV-1
RNA was quantified using the Cobas AmpliPrep/Cobas TaqMan
HIV-1 Test (Roche Diagnostics), with a detection limit of 40
HIV-1 RNA copies/mL of plasma. Resistance testing by pop-
ulation sequencing was performed by using VirtualPhenotype
(Virco).
AS-PCR for the detection and quantification of minority
quasispecies of K65R, K103N, Y181C, M184V, and M184I
drug-resistant HIV-1 variants. Up to 2 blood samples ob-
tained before the start of ART, all follow-up samples obtained
until the start of second-line treatment for case patients, and
1 baseline sample from control patients were tested by AS-PCR
assays, which were performed blind. Evaluation of discrimi-
natory abilities and validation of the K103N and M184V AS-
PCR assays were described elsewhere [8, 18]. AS-PCRs of the
K65R, Y181C, and M184I mutations and their corresponding
wild-type variants are described in the Appendix.
Statistical analysis. To investigate the significance of dif-
ferences in the presence of minority quasispecies at baseline in
both groups of patients, statistical analysis was performed using
the 2-tailed Fisher’s exact probability test for binary data. P
values
!.05 were considered to be significant.
RESULTS
Case patients. Four treatment-naive patients received lami-
vudine, tenofovir, and nevirapine (3 patients) or efavirenz (1
patient) as their first ART regimen. Treatment for patient 3 was
switched from nevirapine to efavirenz after 8 weeks because of
gastrointestinal adverse effects. Patient characteristics are sum-
marized in table 1. For case patients, viral load at baseline had
a range of 430,000–1,440,000 HIV-1 RNA copies/mL of plasma.
Before initiation of ART, resistance testing was performed by
population sequencing. No evidence of drug resistance was
observed in any of the 4 patients (figure 1). All patients were
monitored with regard to plasma concentrations of the NNRTI.
Measurement of plasma NNRTI concentration after 2 weeks
of treatment and after 1–2 months showed values for efavirenz
in the upper range in patient 2 and at the 50th percentile for
nevirapine in patient 3. Nevirapine concentrations were within
normal ranges in patients 1 and 4. For all case patients, viral
load decrease at 4–7 weeks had a range of 0–1 log, and viral
load remained
1100,000 HIV-1 RNA copies/mL of plasma until
the start of second-line treatment. A second resistance test with
use of standard genotyping was performed 9–27 weeks after
starting the first-line regimen (figure 1). Viruses of all patients
harbored multiple mutations that conferred resistance to la-
mivudine, to NNRTIs, and, partly, to tenofovir. Salvage therapy
was initiated 15–31 weeks after the start of the first-line regi-
men. Second-line regimens included zidovudine (2 patients) or
Table 1. Characteristics of patients who experienced virological failure within the first weeks after starting first ART (case patients).
Patient Sex
Route of
infection
CDC
classification
HIV-1
subtype
Baseline
viral load,
HIV-1 RNA
copies/mL
of plasma
First-line
treatment
Viral load nadir
Salvage therapy
Duration of salvage
therapy to achieve
viral load, weeks
Week after
initiation of
first-line treatment
HIV-1 RNA,
copies/mL
of plasma
Start after
initiation of
first-line treatment,
weeks
Second-line
treatment
!400
HIV-1 RNA
copies/mL
of plasma
!40
HIV-1 RNA
copies/mL
of plasma
1 M IVDA C3 B 797,000 3TC, TDF, NVP 5 630,000 25 AZT, SQV, ATV 14 64
2 M Het B3 C 1,440,000 3TC, TDF, EFV 7 425,000 31 AZT, SQV, LPV 6 19
3 F Het B3 AG 510,000 3TC, TDF, NVP
a
4 82,900 15 D4T, ATV, LPV 12 71
4 F Het C3 CRF02_AG 430,000 3TC, TDF, NVP 0 430,000
b
15 3TC, D4T, SQV, ATV 10 20
NOTE. 3TC, lamivudine; ART, antiretroviral therapy; ATV, atazanavir (boosted with ritonavir); AZT, zidovudine; CDC, Centers for Disease Control and Prevention; D4T, stavudine; EFV, efavirenz; Het,
heterosexual sex; IVDA, injection drug abuse; LPV, lopinavir (boosted with ritonavir); NVP, nevirapine; SQV, saquinavir; TDF, tenofovir.
a
Patient 3 switched to EFV after 8 weeks because of gastrointestinal adverse effects.
b
Patient 4 never had a viral load decrease during first-line treatment.
Table 2. Characteristics of patients who did not experience virological failure within 9 months after starting first ART (control patients).
Patient Sex
Route of
infection
CDC
classification
HIV-1
subtype
Baseline
viral load,
HIV-1 RNA
copies/mL
of plasma
Time to
achieve
viral load
!40 copies/mL,
weeks
Baseline
RT resistance
mutations,
population
sequence
First-line
treatment
AS-PCR result SD at baseline, %
K65R K103N Y181C M184V M184I
5 F Het C3 F1 1,760,000 26 None 3TC, TDF, EFV !DL !DL !DL !DL !DL
6 M MSM A2 B 34,300 5 None 3TC, TDF, EFV
!DL !DL !DL !DL ND
7 M IVDA B2 CRF13_CPX 31,400 14 None 3TC, TDF, EFV !DL !DL !DL !DL ND
8 F Het A2 CRF14_BG 78,200 15 None 3TC, TDF, EFV
!DL !DL !DL !DL ND
9 M Het A2 CRF02_AG 14,900 21 None 3TC, TDF, EFV !DL !DL !DL 14.1 0.3 !DL
10 F Het B2 B 1,600,000 18 215D 3TC, TDF, EFV
!DL !DL !DL !DL 1.0 0.1
11 M Het A3 C 104,000 7 None 3TC, TDF, EFV !DL !DL !DL !DL !DL
12 M Het C3 B 272,000 20 None 3TC, TDF, EFV
!DL !DL !DL !DL !DL
13 M Unknown A2 B 213,000 21 None 3TC, TDF, NVP !DL !DL !DL !DL !DL
14 M MSM B3 B 496,000 41 None 3TC, TDF, EFV
!DL !DL !DL !DL !DL
15 F Het A2 AE 98,200 21 None 3TC, TDF, EFV !DL !DL !DL NA !DL
16 M MSM B3 B 85,400 30 None 3TC, TDF, EFV
!DL !DL !DL !DL !DL
17 M MSM C3 B 813,000 12 None 3TC, TDF, EFV !DL !DL !DL !DL 2.1 0.4
18 M Het A2 F1 183,000 27 None 3TC, TDF, EFV
!DL !DL !DL !DL !DL
19 M Het A2 CX 25,600 6 None 3TC, TDF, EFV !DL !DL !DL !DL ND
20 M IVDA B2 B 139,000 17 None 3TC, TDF, EFV
!DL !DL !DL !DL !DL
21 M Het B2 B 90,900 9 None 3TC, TDF, EFV !DL !DL !DL !DL !DL
22 F IVDA B3 B 435,000 12 None 3TC, TDF, EFV
!DL !DL !DL !DL !DL
NOTE. 3TC, lamivudine; ART, antiretroviral therapy; AS-PCR, allele-specific real-time PCR assay; CDC, Centers for Disease Control and Prevention; !DL, below detection limit; EFV, efavirenz; Het,
heterosexual sex; IVDA, injection drug abuse; MSM, men who have sex with men; NA, not applicable (because of negative results for both wild-type and mutant sequences); ND, not determined;
RT, reverse transcriptase; TDF, tenofovir.
HIV/AIDS CID 2009:48 (15 January) 243
Figure 1. Kinetics of viral load and quantification of minority quasispecies of drug-resistant viruses in patients who received their first antiretroviral
therapy (ART) and experienced early virological failure within the first weeks. HIV-1 RNA in plasma was measured using the Cobas AmpliPrep/Cobas
TaqMan HIV-1 Test, with a lower limit of 40 copies/mL of plasma (black circles). Genotype data are depicted (gray arrows) and were obtained by
population sequencing with use of the VirtualPhenotype analysis; “none” means that no mutations associated with drug resistance were detected in
the reverse transcriptase [19]. Quantification of drug-resistant variants carrying the K65R, K103N, Y181C, M184V, or M184I mutation and drug-susceptible
viruses was performed by allele-specific PCR. The percentage of the virus population carrying the specific mutation was used to calculate the absolute
HIV-1 RNA copies/mL of plasma of the drug-resistant quasispecies on the basis of the corresponding total viral load measurement. Copy numbers
representing the K65R variant (green circles), K103N variant (pink circles), Y181C variant (red circles), M184V variant (blue circles), and M184I variant
(yellow circles) are shown. The thin black line indicates the limit of the viral load and allele-specific PCR measurements (40 HIV-1 RNA copies/mL of
plasma). Percentages (SD) of each drug-resistant virus population are given. 3TC, lamivudine;
!DL, below detection limit; EFV, efavirenz; NA, not
applicable (because of negative results for both wild-type and mutant sequences); ND, not determined; NVP, nevirapine; TDF, tenofovir.
stavudine (2 patients) in combination with 2 boosted protease
inhibitors. After 6–14 weeks of salvage therapy, all patients
reached a viral load
!400 HIV-1 RNA copies/mL of plasma.
Undetectable levels (
!40 HIV-1 RNA copies/mL of plasma)
were achieved in all patients after 19–71 weeks of salvage ther-
apy (table 1).
Retrospectively, the key resistance mutations K65R, K103N,
Y181C, M184V, and M184I within the RT were further analyzed
244 CID 2009:48 (15 January) HIV/AIDS
by sensitive AS-PCR, which allowed the quantification of mi-
nority quasispecies of drug-resistant viruses. In all 4 patients,
1–4 drug resistance mutations were detected at frequencies of
0.07%–2.0% before initiation of first-line ART. The K103N
mutation was found in 1 patient; the Y181C and the M184V
or M184I variants were found in 3 patients (figure 1). Rapid
selection of those variants and the additional appearance of 1
or 2 of those mutations, which were not detectable at baseline,
were observed in all patients.
In patient 1, the K103N, Y181C, M184V, and M184I mu-
tations were detected as minority quasispecies at low fre-
quencies, with a range (SD) of to
0.07% 0.01% 2.0%
at baseline (figure 1). Five weeks after starting ART,
0.6%
of viruses already carried the Y181C mutation,
99.3% 0.0%
which remained at those levels through week 21. The K103N
mutation was temporarily selected; 37.7% of viruses harbored
the K103N mutation at week 5, 18.5% of viruses harbored the
mutation at week 18, and this frequency further decreased at
week 21, to (figure 1), which suggests that the
1.39% 0.25%
Y181C mutation alone was sufficient to confer resistance
against nevirapine. The K65R mutation was not detected before
ART; however, of viruses already harbored the
23.3% 1.3%
K65R mutation at week 5. This frequency increased to levels
199% at weeks 18 and 21. Both the M184V and the M184I
mutations were present in similar frequencies before ART was
initiated. The M184V mutation remained at low frequencies
(
!1% at weeks 5 and 18), and the M184I mutation was selected
and was represented in of the virus population
95.2% 0.6%
at week 18. The K65R, Y181C, and M184I mutations were also
detected by population sequencing at week 21 (figure 1).
In patient 2, the M184V and the M184I mutations were
present at baseline as minor variants at similar frequencies. For
this patient, the M184V mutation was consequently selected
during therapy failure, and the M184I mutation remained a
minority quasispecies at frequencies of 1%–2%. The K65R,
K103N, and Y181C mutations were not detectable as minority
quasispecies before ART. In addition, none of those mutations
were developed and selected in this patient. Of those 3 mu-
tations, only the K103N mutation was detected, at very low
levels, at week 27 ( ). The presence of the M184V
0.02% 0.00%
mutation as a major virus population was confirmed by pop-
ulation sequencing. For this patient, other mutations (K70E,
G190E/Q, and K219D/E/N)—in addition to the M184V mu-
tation—led to eVF (figure 1).
In patient 3, the Y181C mutation already represented in
of viruses before ART, increased to1.1% 0.1% 54.7%
at week 4, and remained at this level during the following2.0%
7 weeks. The K103N mutation was detectable for the first time
at week 7, at a frequency of , and increased2.03% 0.04%
rapidly during the following 4 weeks, to , after98.42% 0.58%
the switch from nevirapine to efavirenz at week 8. The K65R
mutation was undetectable at baseline; however, 28.5%
of viruses harbored this mutation at week 4. No further4.0%
selection was observed; the K65R mutation remained at fre-
quencies of 20%–22% at weeks 7 and 11. A similar pattern was
observed with regard to the M184I mutation. This variant was
undetectable at baseline and represented of the45.9% 4.6%
virus population at week 7 and represented at35.1% 3.3%
week 11. The M184V mutation was never detectable in this
patient.
In patient 4, after initiation of ART, we also observed a rapid
selection of the Y181C mutation, which was already present at
baseline at a frequency of . In addition, the K103N1.1% 0.0%
mutation was selected and was represented in 14.81%
of viruses at week 9, although it had not been detected3.88%
at baseline. As was observed in patient 1, viruses containing
the M184I mutation (which was present for patient 4 at baseline
at a frequency of ) were selected as a major virus1.0% 0.1%
population despite the presence of the M184V mutation as a
minority quasispecies at weeks 2 and 6 ( and0.8% 0.2%
, respectively) (figure 1). Thus, mutations that0.6% 0.1%
confer resistance against lamivudine and nevirapine were rap-
idly selected, but no mutation associated with resistance to
tenofovir was identified in this patient.
Control patients. Control patients suppressed virus repli-
cation to undetectable levels within 5–41 weeks after treatment
initiation (table 2). Genotypic resistance testing by population
sequencing was performed for all control patients before ART
initiation. No mutations associated with drug resistance were
identified. None of the mutations K65R, K103N, and Y181C
were present as minority quasispecies in the control group.
Control patients 10 and 17 harbored the M184I mutation (at
frequencies of and , respectively). In
1.0% 0.1% 2.1% 0.4%
patient 9, of viruses harbored the M184V mu-
14.1% 0.3%
tation before ART initiation (table 2); however, this did not
leadtoeVF.
Therefore, only 3 of 18 patients who efficiently suppressed
virus replication after starting ART harbored minority quasi-
species of viruses that carried either the M184V or the M184I
mutation at baseline. In contrast, 1–4 drug resistance mutations
were present as minority quasispecies at baseline in all 4 patients
who experienced eVF. With use of the 2-tailed Fisher’s exact
probability test for the calculation of significance, those dif-
ferences are significant on the basis of numbers of patient with
and without detectable minority quasispecies of drug-resistant
HIV-1 at baseline (3 of 18 patients vs. 4 of 4 patients; P p
)..005
DISCUSSION
Although the number of treatment-naive patients who expe-
rienced eVF within just weeks after starting ART is, fortunately,
low [20], eVF is particularly problematic for the patient and
HIV/AIDS CID 2009:48 (15 January) 245
the physician, especially when poor adherence can be excluded
as the reason for eVF. Further reasons for nonresponse to first-
line ART despite good adherence are currently not well un-
derstood. Here, we show that the presence of drug-resistant
viruses in low frequencies at baseline—that is, those not de-
tected by conventional genotypic testing—is associated with
eVF, because of rapid selection of those drug-resistant viruses
in 4 of 4 patients, despite well-documented, excellent adherence
and adequate drug plasma levels. We exclude nonadherence as
the reason for eVF among our patients for several reasons. Two
of 4 patients received directly observed therapy. One patient,
who lived in a refugee home, had weekly community surveil-
lance of drug intake by a nurse who used a weekly pill rack.
Drug concentrations in plasma were within normal ranges in
all 4 patients. In addition, all patients showed an optimal
(195%) adherence to the second-line regimen, which was sur-
veyed by medication event–monitoring systems.
Several studies have shown that minority quasispecies of
drug-resistant viruses can be found despite negative results of
standard genotyping. This was clearly demonstrated in women
after treatment with single-dose nevirapine to prevent mother-
to-child transmission of HIV-1 [21, 22], as well as in acute
seroconverters [8], patients undergoing structured treatment
interruptions [18], and patients experiencing virological failure
[10]. However, the clinical implications of minority quasispe-
cies of drug-resistant viruses are still unclear. Some observations
suggest that minority quasispecies of drug-resistant viruses can
emerge as major virus populations after initiation of salvage
therapy in pretreated patients [9–11, 23], but so far, only scarce
evidence exists that the minority quasispecies can affect the
outcome of first-line therapy. One case report demonstrated
the emergence of minority quasispecies of drug-resistant viruses
in a previously treatment-naive patient who initiated ART;
however, several other drug resistance mutations were detected
by population sequencing at baseline in this patient, which
suggests that drug-resistant HIV-1 had been transmitted [24].
Our own data from the Primary HIV-1 Infection Cohort in
Zurich, Switzerland, and a study in France showed no signif-
icant difference between the outcome of first-line therapy in
acutely or recently HIV-1 infected patients who carried mi-
nority quasispecies of drug-resistant viruses and those who did
not [25, 26]. In contrast to our current study, most of those
patients received 2 nucleoside reverse-transcriptase inhibitors
and a boosted protease inhibitor and, thus, ART regimens with
high genetic resistance barriers. Recently, Johnson et al. [27]
showed a correlation between the presence of minority qua-
sispecies of drug-resistant viruses at baseline and virological
failure in treatment-naive patients who received efavirenz-la-
mivudine and abacavir or zidovudine. Standard genotyping af-
ter treatment failure revealed the selection of those variants in
4 of 7 patients, which supports our results. However, no detailed
information is available with regard to adherence to treatment
by patients in that study. In a previous study [28], we observed
a rapid selection of drug-resistant HIV-1 variants in patients
who showed a slow decrease in viral load after starting their
first ART, independent of preexisting minority quasispecies of
drug-resistant viruses. However, few patients were treated with
an NNRTI, and the regimen was intensified within weeks for
all patients who experienced a slow decrease in viremia.
We show for the first time, to our knowledge, that patients
can experience eVF despite good adherence; no evidence, by
population sequencing, of transmission of drug-resistant HIV-
1; and a potent ART regimen, as evidenced by the presence of
minority quasispecies of drug-resistant viruses before the start
of ART and subsequent rapid selection of those variants. Al-
though the number of patients was small and the study was
performed retrospectively, all patients were treated with a sim-
ilar regimen and during the same time period. One limitation
of our study is the small proportion of nevirapine-based reg-
imens used to treat control patients. The issue of a higher
efficacy of efavirenz over nevirapine is still a matter of debate
[29]. However, the largest randomized, controlled trial that
compared efavirenz with nevirapine (2NN study [30]) did not
reveal a statistically significantly higher virological failure rate
in the nevirapine arm. In addition, the AS-PCR analyses were
performed blind. Therefore, our data strongly support the hy-
pothesis that minority quasispecies of drug-resistant viruses
have clinical implications in certain settings. In this context, it
has to be emphasized that all 4 patients were treated with a
first-line regimen that was characterized by low genetic barrier
to resistance. Especially with regard to first-line regimens con-
taining efavirenz or nevirapine, it might be possible to identify
patients at risk of failure by more-sensitive methods, such as
AS-PCR.
The pattern of drug-resistant minority quasispecies found in
our patients deserves another important consideration. The
impact of minority quasispecies of drug-resistant viruses at
baseline appears to be dependent on the specific mutation de-
tected. Both the M184V and the M184I mutations were found
at baseline at similar frequencies in 3 patients who experienced
eVF. Interestingly, the M184V mutation was selected in 1 of
those patients, whereas the M184I mutation was rapidly selected
in 2 other patients and contributed to eVF. This is in contrast
with the observation that viruses harboring the M184V mu-
tation are more replication competent than are viruses har-
boring the M184I mutation [31]. Moreover, the M184V and
M184I mutations were also found in 3 control patients for
whom the presence of those mutations at baseline did not lead
to eVF. This shows that a mutation at codon 184 of the RT
alone is not necessarily associated with therapy failure and sug-
gests that the addition of other mutations in drug-resistant
minority quasispecies may be required to develop failure [32].
246 CID 2009:48 (15 January) HIV/AIDS
In contrast, all 3 patients who harbored minority quasispecies
with the Y181C mutation rapidly selected this virus population,
which led to eVF. We found the K103N mutation at baseline
in 1 patient, but the frequency remained low, and only the
Y181C mutation was detected by conventional genotyping per-
formed 21 weeks after initiation of first ART. The selection of
the Y181C mutation rather than K103N variants may be ex-
plained by the regimen, which contained nevirapine in these 3
patients. Nevirapine has been associated more frequently with
the selection of the Y181C mutation in patients who experience
failure of ART [2]. Taken together, these observations suggest
that drug-resistant quasispecies have different implications with
regard to the dynamics of virological failure. The Y181C mu-
tation appears to have a major role, whereas the presence of
the M184V mutation or the M184I mutation does not nec-
essarily lead to virological failure. This is consistent with clinical
observations and is probably related to the fitness characteristic
of the mutations [33]. In addition, the number or composition
of different drug resistance mutations that are detectable as
minority quasispecies at baseline might be important.
Notwithstanding great advances in the treatment of HIV
infection and the availability of increasing possibilities for drug
combinations, virological success of the first-line regimen re-
mains crucial for a good long-term prognosis [12, 13]. By using
AS-PCR, we were able to show a rapid outgrow of minority
quasispecies of drug-resistant viruses, undetected at baseline by
conventional genotyping, that led to eVF despite excellent ad-
herence and a potent standard regimen of lamivudine, teno-
fovir, and either efavirenz or nevirapine. Further studies to
confirm the clinical benefit of the detection of minority qua-
sispecies of drug-resistant viruses before starting ART in treat-
ment-naive patients are warranted, especially in the context of
ART regimens with low genetic barriers to resistance.
Acknowledgments
We are grateful to all the patients who participated in this study. We
thank Bernhard Fleckenstein for his constant support. Moreover, we thank
Marica Gallazzo, Laboratory of Immunology, Centre Hospitalier Univer-
sitaire (Lausanne, Switzerland), for technical support, and we thank the
Swiss HIV Cohort Study for some of the blood samples.
Financial support. Deutsche Forschungsgemeinschaft (Graduierten-
kolleg 1071) and the Erlanger Leistungsbezogene Anschubfinarzierung und
Nachwuchsfo¨rderung foundation (07.07.09.1). The development and val-
idation of the K65R AS-PCR assay was sponsored by Gilead.
Potential conflicts of interest. K.J.M. has received travel grants and
honoraria from Gilead, Roche Diagnostics, GlaxoSmithKline, Bristol-Myers
Squibb, and Abbott and has received a research grant from Gilead. S.G.G.
has received travel grants from Bristol-Myers Squibb and GlaxoSmithKline.
S.Y. has participated on the advisory board of Bristol-Myers Squibb and
has received travel grants from GlaxoSmithKline and Merck Sharp &
Dohme. H.F.G. has been an adviser and/or consultant for GlaxoSmithKline,
Abbott, Novartis, Boehringer Ingelheim, Roche, Tibotec, and Bristol-Myers
Squibb and has received unrestricted research and educational grants from
Roche, Abbott, Bristol-Myers Squibb, GlaxoSmithKline, and Merck Sharp
& Dohme. M.C. has received travel grants from Boehringer-Ingelheim,
Roche, and Abbott. All other authors: no conflicts.
APPENDIX
ALLELE-SPECIFIC REAL-TIME PCR (AS-PCR)
FOR THE DETECTION AND QUANTIFICATION
OF MINORITY QUASISPECIES OF K65R,
Y181C, AND M184I DRUG-RESISTANT HIV-1
VARIANTS
AS-PCRs of the K65R, Y181C, and M184I mutations and their
corresponding wild-type variants were designed and tested fol-
lowing the same procedures as described elsewhere [8, 18].
Plasma sampling, HIV-1 RNA isolation, and viral cDNA syn-
thesis and amplification were performed as described elsewhere
[8, 18]. In brief, 4 separate short-cycle first PCRs were per-
formed to optimize the primer binding sites with use of the
following primers: (1) K103 EP1 [8], M184 EP1 [18], K103
EP2 [8], and M184 EP2 [18] in a multiplex PCR; (2) K65 EP1
5
-ACTCCAGTATTTGCCATAAAG-3
(nucleotides [nt] 2721–
2741; nt positions are based on the reference strain HXB2) and
K103 EP2 [8]; (3) Y181 EP1 5
-TCAGTACAATGTGCTTC-
CAC-3
(nt 2981–3000) and Y181 EP2 5
-CATACAAATCATC-
CATGTATTG-3
(nt 3
093–3114); and (4) [M184I EP1 5
-TAT-
CAGTACAATGTGCTTCCAC-3
(nt 2979–3000) and M184I
EP2 5
-GTCAGATCCTACATACAAATCAT-3
(nt 3103–3125).
PCR conditions and amplicon purification are described else-
where [8, 18].
AS-PCR was performed using the purified PCR products and
the primers IN K65 5
-TCCAGTATTTGCCATAAAGIA-3
(nt
2723–2743) or IN K65R 5
-CCAGTATTTGCCATAAAGIG-3
(nt 2724–2743) and pol 3002 rc 5
-CTGTGGAAGCACATTGT-
ACTG-3
(nt 2812–2835) for the K65R AS-PCR, IN Y181 5
-
CATACAAATCATCCATGTATTGIT-3
(nt 3091–3114) or IN
Y181C 5
-ATACAAATCATCCATGTATTGIC-3
(nt 3091–3115)
and pol 2981 5
-TCAGTACAATGTGCTTCCACAGG-3
(nt
2981–3003) for the Y181C AS-PCR, and IN M184wt 5
-AGAT-
CCTACATACAAATCATIC-3
(nt 3101–3122) or IN M184I 5
-
CAGATCCTACATACAAATCATIT-3
(nt 3101–3123) and pol
2981 for the M184I AS-PCR. Further details about the PCRs
and data analysis are described elsewhere [8, 18]. Each AS-PCR
assay has a detection limit of 10 HIV-1 DNA copies per reaction,
with a linear dynamic range of
16 logs. The estimated discrim-
inatory abilities of the different drug-susceptible and drug-re-
sistant sequences are as follows: 0.01% for detection of the
K103N mutation; 0.2% for detection of the Y181C, M184V,
and M184I mutations; and 0.4% for detection of the K65R
mutation as minority quasispecies. For each patient sample, an
individual cutoff was estimated on the basis of the viral load
as described elsewhere, because low viral loads diminish the
discriminatory ability of each assay [18]. Nonspecific amplifi-
cation by AS-PCR with use of SYBR green for detection of
double-stranded DNA was excluded by melting-curve analysis.
HIV/AIDS CID 2009:48 (15 January) 247
References
1. Egger M, Hirschel B, Francioli P, et al. Impact of new antiretroviral
combination therapies in HIV infected patients in Switzerland: pro-
spective multicentre study. Swiss HIV Cohort Study. BMJ 1997; 315:
1194–9.
2. Clavel F, Hance AJ. HIV drug resistance. N Engl J Med 2004;350:
1023–35.
3. Yerly S, Kaiser L, Race E, Bru JP, Clavel F, Perrin L. Transmission of
antiretroviral-drug-resistant HIV-1 variants. Lancet 1999; 354:729–33.
4. Little SJ, Holte S, Routy JP, et al. Antiretroviral-drug resistance among
patients recently infected with HIV. N Engl J Med 2002; 347:385–94.
5. Yerly S, von Wyl V, Ledergerber B, et al. Transmission of HIV-1 drug
resistance in Switzerland: a 10-year molecular epidemiology survey.
AIDS 2007; 21:2223–9.
6. Hirsch MS, Brun-Vezinet F, Clotet B, et al. Antiretroviral drug resis-
tance testing in adults infected with human immunodeficiency virus
type 1: 2003 recommendations of an International AIDS Society–USA
Panel. Clin Infect Dis 2003; 37:113–28.
7. Schuurman R, Demeter L, Reichelderfer P, Tijnagel J, de Groot T,
Boucher C. Worldwide evaluation of DNA sequencing approaches for
identification of drug resistance mutations in the human immuno-
deficiency virus type 1 reverse transcriptase. J Clin Microbiol 1999;37:
2291–6.
8. Metzner KJ, Rauch P, Walter H, et al. Detection of minor populations
of drug-resistant HIV-1 in acute seroconverters. AIDS 2005;19:
1819–25.
9. Kapoor A, Jones M, Shafer RW, Rhee SY, Kazanjian P, Delwart EL.
Sequencing-based detection of low-frequency human immunodefi-
ciency virus type 1 drug-resistant mutants by an RNA/DNA hetero-
duplex generator-tracking assay. J Virol 2004; 78:7112–23.
10. Lecossier D, Shulman NS, Morand-Joubert L, et al. Detection of mi-
nority populations of HIV-1 expressing the K103N resistance mutation
in patients failing nevirapine. J Acquir Immune Defic Syndr 2005;38:
37–42.
11. Roquebert B, Malet I, Wirden M, et al. Role of HIV-1 minority pop-
ulations on resistance mutational pattern evolution and susceptibility
to protease inhibitors. AIDS 2006;20:287–9.
12. Kaufmann GR, Khanna N, Weber R, et al. Long-term virological re-
sponse to multiple sequential regimens of highly active antiretroviral
therapy for HIV infection. Antivir Ther 2004; 9:263–74.
13. Nicastri E, Chiesi A, Angeletti C, et al. Clinical outcome after 4 years
follow-up of HIV-seropositive subjects with incomplete virologic or
immunologic response to HAART. J Med Virol 2005; 76:153–60.
14. Delaunay C, Brun-Vezinet F, Landman R, et al. Comparative selection
of the K65R and M184V/I mutations in human immunodeficiency
virus type 1–infected patients enrolled in a trial of first-line triple-
nucleoside analog therapy (Tonus IMEA 021). J Virol 2005;79:9572–8.
15. Gallant JE, Rodriguez AE, Weinberg WG, et al. Early virologic non-
response to tenofovir, abacavir, and lamivudine in HIV-infected an-
tiretroviral-naive subjects. J Infect Dis 2005; 192:1921–30.
16. Podzamczer D, Ferrer E, Gatell JM, et al. Early virological failure with
a combination of tenofovir, didanosine and efavirenz. Antivir Ther
2005; 10:171–7.
17. Sethi AK, Celentano DD, Gange SJ, Moore RD, Gallant JE. Association
between adherence to antiretroviral therapy and human immunode-
ficiency virus drug resistance. Clin Infect Dis 2003; 37:1112–8.
18. Metzner KJ, Bonhoeffer S, Fischer M, et al. Emergence of minor pop-
ulations of human immunodeficiency virus type 1 carrying the M184V
and L90M mutations in subjects undergoing structured treatment in-
terruptions. J Infect Dis 2003; 188:1433–43.
19. Johnson VA, Brun-Vezinet F, Clotet B, et al. Update of the drug re-
sistance mutations in HIV-1: 2007. Top HIV Med 2007; 15:119–25.
20. von Wyl V, Yerly S, Boni J, et al. Emergence of HIV-1 drug resistance
in previously untreated patients initiating combination antiretroviral
treatment: a comparison of different regimen types. Arch Intern Med
2007; 167:1782–90.
21. Flys T, Nissley DV, Claasen CW, et al. Sensitive drug-resistance assays
reveal long-term persistence of HIV-1 variants with the K103N nevi-
rapine (NVP) resistance mutation in some women and infants after
the administration of single-dose NVP: HIVNET 012. J Infect Dis
2005; 192:24–9.
22. Johnson JA, Li JF, Morris L, et al. Emergence of drug-resistant HIV-
1 after intrapartum administration of single-dose nevirapine is sub-
stantially underestimated. J Infect Dis 2005; 192:16–23.
23. Svarovskaia ES, Margot NA, Bae AS, et al. Low-level K65R mutation
in HIV-1 reverse transcriptase of treatment-experienced patients ex-
posed to abacavir or didanosine. J Acquir Immune Defic Syndr 2007;46:
174–80.
24. Van Laethem K, De Munter P, Schrooten Y, et al. No response to first-
line tenofovir+lamivudine+efavirenz despite optimization according to
baseline resistance testing: impact of resistant minority variants on
efficacy of low genetic barrier drugs. J Clin Virol 2007; 39:43–7.
25. Metzner KJ, Rauch P, von Wyl V, et al. Prevalence of minority qua-
sispecies of drug-resistant HIV-1 in patients with primary HIV-1 in-
fection in Zurich in the years 2002–2006 [abstract 40]. In: Program
and abstracts of the 16th International HIV Drug Resistance Workshop
2007 (Barbados). Antiviral Therapy 2007; 12:S24.
26. Peuchant O, Thiebaut R, Capdepont S, et al. Transmission of HIV-1
minority-resistant variants and response to first-line antiretroviral ther-
apy. AIDS 2008; 22:1417–23.
27. Johnson JA, Li JF, Wei X, et al. Minority HIV-1 drug resistance mu-
tations are present in antiretroviral treatment-naive populations and
associate with reduced treatment efficacy. PLoS Med 2008; 5:e158.
28. Metzner KJ, Allers K, Rauch P, Harrer T. Rapid selection of drug-
resistant HIV-1 during the first months of suppressive ART in treat-
ment-naive patients. AIDS 2007; 21:703–11.
29. Waters L, John L, Nelson M. Non-nucleoside reverse transcriptase
inhibitors: a review. Int J Clin Pract 2007;61:105–18.
30. van Leth F, Phanuphak P, Ruxrungtham K, et al. Comparison of first-
line antiretroviral therapy with regimens including nevirapine, efavi-
renz, or both drugs, plus stavudine and lamivudine: a randomised
open-label trial, the 2NN Study. Lancet 2004; 363:1253–63.
31. Back NK, Nijhuis M, Keulen W, et al. Reduced replication of 3TC-
resistant HIV-1 variants in primary cells due to a processivity defect
of the reverse transcriptase enzyme. EMBO J 1996; 15:4040–9.
32. Miller V, Stark T, Loeliger AE, Lange JM. The impact of the M184V
substitution in HIV-1 reverse transcriptase on treatment response. HIV
Med 2002; 3:135–45.
33. Iglesias-Ussel MD, Casado C, Yuste E, Olivares I, Lopez-Galindez C.
In vitro analysis of human immunodeficiency virus type 1 resistance
to nevirapine and fitness determination of resistant variants. J Gen
Virol 2002; 83:93–101.
    • "Recent studies have demonstrated that some low level DRMs (> 1%) can become dominant variants rapidly under drug selected pressure and lead to virologic failure (VF) [10,[12][13][14][15][16] . However, these low level DRMs can be detected by more sensitive technologies like deep sequencing (DS) [17][18][19][20][21][22][23][24]. In this study, we define ''low-level " DRMs as mutations detected at <20% frequency levels of the viral quasi-species by DS. "
    [Show abstract] [Hide abstract] ABSTRACT: Objective: Determine HIV drug resistance mutations (DRMs) prevalence at low and high levels in ART-experienced patients experiencing virologic failure (VF). Methods: 29 subjects from 18 counties in Hunan Province that experienced VF were evaluated for the prevalence of DRMs (Stanford DRMs with an algorithm value ≥15, include low-, intermediate and high-level resistance) by both Sanger sequencing (SS) and deep sequencing (DS) to 1% frequency levels. Results: DS was performed on samples from 29 ART-experienced subjects; the median viral load 4.95×104 c/ml; 82.76% subtype CRF01_AE. 58 DRMs were detected by DS. 18 DRMs were detected by SS. Of the 58 mutations detected by DS, 40 were at levels <20% frequency (26 NNRTI, 12 NRTI and 2 PI) and the majority of these 95.00% (38/40) were not detected by standard genotyping. Of these 40 low-level DRMs, 16 (40%) were detected at frequency levels of 1-4% and 24 (60%) at levels of 5-19%. SS detected 15 of 17 (88.24%) DRMs at levels ≥ 20% that were detected by DS. The only variable associated with the detection of DRMs by DS was ART adherence (missed doses in the prior 7 days); all patients that reported missing a dose in the last 7 days had DRMs detected by DS. Conclusions: DS of VF samples from treatment experienced subjects infected with primarily AE subtype frequently identified Stanford HIVdb NRTI and NNRTI resistance mutations with an algorithm value 15. Low frequency level resistant variants detected by DS were frequently missed by standard genotyping in VF specimens from antiretroviral-experienced subjects.
    Full-text · Article · Feb 2016
    • "In effect, the natural tendency to errors of the reverse transcriptase, combined with the high viral replication activity, result in the generation of genetically related viral variations called quasispecies with important implications on the dynamics of the infection[17]. Moreover, one of the major limitations of standard genotyping tests is their inability to detect quasispecies that occur in less than 20–25% of the circulating viral population in a patient[10]. These subpopulations in low-abundance can lead to mutations associated with antiretroviral resistance and can develop rapidly to become predominant under conditions of selective pressure which eventually lead to therapeutic failure[18]. "
    Full-text · Dataset · Jan 2016 · PLoS ONE
    • "In effect, the natural tendency to errors of the reverse transcriptase, combined with the high viral replication activity, result in the generation of genetically related viral variations called quasispecies with important implications on the dynamics of the infection [17] . Moreover, one of the major limitations of standard genotyping tests is their inability to detect quasispecies that occur in less than 20–25% of the circulating viral population in a patient [10]. These subpopulations in low-abundance can lead to mutations associated with antiretroviral resistance and can develop rapidly to become predominant under conditions of selective pressure which eventually lead to therapeutic failure [18]. "
    [Show abstract] [Hide abstract] ABSTRACT: Although Structured Treatment Interruptions (STI) are currently not considered an alternative strategy for antiretroviral treatment, their true benefits and limitations have not been fully established. Some studies suggest the possibility of improving the quality of life of patients with this strategy; however, the information that has been obtained corresponds mostly to studies conducted in adults, with a lack of knowledge about its impact on children. Furthermore, mutations associated with antiretroviral resistance could be selected due to sub-therapeutic levels of HAART at each interruption period. Genotyping methods to determine the resistance profiles of the infecting viruses have become increasingly important for the management of patients under STI, thus low-abundance antiretroviral drug-resistant mutations (DRM's) at levels under limit of detection of conventional genotyping (<20% of quasispecies) could increase the risk of virologic failure. In this work, we analyzed the protease and reverse transcriptase regions of the pol gene by ultra-deep sequencing in pediatric patients under STI with the aim of determining the presence of high- and low-abundance DRM's in the viral rebounds generated by the STI. High-abundance mutations in protease and high- and low-abundance mutations in reverse transcriptase were detected but no one of these are directly associated with resistance to antiretroviral drugs. The results could suggest that the evaluated STI program is virologically safe, but strict and carefully planned studies, with greater numbers of patients and interruption/restart cycles, are still needed to evaluate the selection of DRM's during STI.
    Full-text · Article · Jan 2016
Show more

  • undefined · undefined
  • undefined · undefined
  • undefined · undefined