ArticlePDF Available

Phylogenetic Relationships of Species of Hypselobarbus (Cypriniformes: Cyprinidae): An Enigmatic Clade Endemic to Aquatic Systems of India

Authors:

Abstract and Figures

Very little is known about the diversity and systematics of the genus cypriniform genus Hypselobarbus. Currently, the genus includes at least eleven species, all endemic to freshwater systems of Peninsular India. While these species are commonly known in India and are frequently used as a food source, little is known about the morphological diversity within and between species and nothing is known regarding intraspecific genetic diversity or species relationships. Herein, we examine the genetic diversity in the genus for 11 mitochondrial genes for eleven populations representing nine of the known 11 species. Hypselobarbus is resolved as monophyletic, with the inclusion of P. carnaticus, and species relatioships are very strongly supported. Because of the unambiguous relationships strongly supported B. carnaticus is allocated to Hypselobarbus. This research and ongoing morphological and molecular work with the genus supports the existence of additional new species in peninsular India in need of further molecular and morphological study. Genetic diversity in the genus is high; for the two species wherein more than one sample, and the two of each are suspected to represent undescribed taxa, these populations exhibited greater genetic divergence than that observed between any two of the other currently recognized species, corroborating our hypothesis based on morphological evidence. Clearly the genus warrants more thorough geographic sampling and examination of morphological and molecular data/analyses to reveal the natural lineages existing in this endemic and enigmatic genus.
Content may be subject to copyright.
Accepted by M.T. Craig: 7 Feb. 2012; published: 27 Sept. 2012
ZOOTAXA
ISSN 1175-5326 (print edition)
ISSN 1175-5334 (online edition)
Copyright © 2012 · Magnolia Press
Zootaxa 3499: 6373 (2012)
www.mapress.com/zootaxa/Article
63
urn:lsid:zoobank.org:pub:D835B596-40BF-40CD-923F-0C6975FBEA64
Phylogenetic Relationships of Species of Hypselobarbus (Cypriniformes:
Cyprinidae): An Enigmatic Clade Endemic to Aquatic Systems of India
M. ARUNACHALAM1, M. RAJA1, M. MURALIDHARAN1 & RICHARD L. MAYDEN2, 3
1Sri Paramakalyani Centre for Environmental Sciences, Manonmaniam Sundaranar University, Alwarkurichi 627412 Tamilnadu,
India
2Department of Biology, 3507 Laclede Ave, Saint Louis University, St. Louis, MO, 63103 USA
3 Corresponding Author. Please send all correspondence pertinent to this manuscript to this author at cypriniformes@gmail.com
Abstract
Very little is known about the diversity and systematics of the genus cypriniform genus Hypselobarbus. Currently, the genus
includes at least eleven species, all endemic to freshwater systems of Peninsular India. While these species are commonly
known in India and are frequently used as a food source, little is known about the morphological diversity within and between
species and nothing is known regarding intraspecific genetic diversity or species relationships. Herein, we examine the genetic
diversity in the genus for 11 mitochondrial genes for eleven populations representing nine of the known 11 species.
Hypselobarbus is resolved as monophyletic, with the inclusion of P. carnaticus, and species relatioships are very strongly
supported. Because of the unambiguous relationships strongly supported B. carnaticus is allocated to Hypselobarbus. This
research and ongoing morphological and molecular work with the genus supports the existence of additional new species in
peninsular India in need of further molecular and morphological study. Genetic diversity in the genus is high; for the two
species wherein more than one sample, and the two of each are suspected to represent undescribed taxa, these populations
exhibited greater genetic divergence than that observed between any two of the other currently recognized species,
corroborating our hypothesis based on morphological evidence. Clearly the genus warrants more thorough geographic
sampling and examination of morphological and molecular data/analyses to reveal the natural lineages existing in this endemic
and enigmatic genus.
Key words: mtDNA sequences, species, genetic divergence, Western Ghats
Introduction
The genus Hypselobarbus Bleeker, 1860 (Figs. 1–3) is endemic to rivers of peninsular India, with most species occur-
ring in rivers, streams, and reservoirs of the Western Ghats or lower reaches of rivers in the range. Currently, the
genus includes 11 species, with H. curmuca (Hamilton, 1807) (Fig. 2), H. dobsoni (Day, 1876), H. dubius (Day, 1867)
(Fig. 1), H. micropogon (Valenciennes, 1842) (Fig. 1), H. jerdoni (Day, 1870) (Fig. 2), H. kolus (Sykes, 1839) (Fig.
3), H. kurali Menon & Rema Devi, 1995 (Fig. 2), H. lithopidos (Day, 1874), H. periyarensis (Raj, 1941) (Fig. 3), H.
pulchellus (Day, 1870), and H. thomassi (Day, 1874). Barbodes carnaticus (Fig. 1) and Puntius sarana (Fig. 3), while
currently placed in other genera, based on morphological similarities and hypothesized unpublished morphological
synapomorphies, have been suspected to be related to Hypselobarbus by the authors. The genus is currently under
morphological revision by the authors and include at least two undescribed species (Figs. 1, 3).
Where known, these species are typically potandromous, migrating from lower reaches of rivers into more
upland, small tributaries to spawn during the monsoon season or shortly thereafter, and have an omnivorous diet.
Given the size of these species, ranging from about 25–100 cm total length, they often serve as an important protein
source and are known to be used in aquacultural practices in India. Of the species, H. jerdoni and H. micropogon,
H. dubius, H. periyarensis, H. kurali, H. kolus, and H. curmuca are endangered in India. Hypselobarbus lithopidos
is thought extinct, and H. pulchellus and H. thomassi are data deficient (Molur et al. 2011)
ARUNACHALAM ET AL.
64 · Zootaxa 3499 © 2012 Magnolia Press
FIGURE 1. Described and undescribed species of the genus Hypselobarbus from India. A) Hypselobarbus sp. 1 (location is
Shimoga fish farm), 165.82 mm SL; B) H. dubius, 141.44 mm SL; C) H. carnaticus, 128.69 mm SL; D) H. micropogon,
138.44 mm SL.
Zootaxa 3499 © 2012 Magnolia Press · 65
PHYLOGENETICS OF HYPSELOBARBUS
FIGURE 2. Species of the genus Hypselobarbus, including two species within H. kurali, from India. A) Hypselobarbus kurali,
Rosemalai, 126.45 mm SL; B) Hypselobarbus kurali, Peryiar Tiger Reserve, 133.42 mm SL; C) Hypselobarbus jerdoni, 95.26
mm SL; D) H. curmuca, 128.90 mm SL.
ARUNACHALAM ET AL.
66 · Zootaxa 3499 © 2012 Magnolia Press
FIGURE 3. Described and undescribed species of the genus Hypselobarbus, and similar Puntius sarana from India. A)
Hypselobarbus sp. 2 (location is Rosemalai), 145.66 mm SL; B) H. kolus, 165.66 mm SL; C) H. periyarensis, 168.14 mm
SL; D) Puntius sarana, 151.28 mm SL.
Zootaxa 3499 © 2012 Magnolia Press · 67
PHYLOGENETICS OF HYPSELOBARBUS
Since its original description Hypselobarbus has never been revised or evaluated for their sister group relation-
ships. Most references to the genus are by Rainboth (1986, 1989), but only in comparisons to and diagnoses from
newly described genera or species from Asia. Rainboth (1986) considered these species to belong to the genus
Gonoproktopterus Bleeker, 1859, but further evaluation of illustrated materials supported the continued recognition
of Hypselobarbus for this group, not Gonoproktopterus, as a genus diagnosed on the basis of morphological char-
acteristics. Interestingly, Rainboth never examined any specimens of Hypselobarbus in all of the references made
to and compared with the genus.
Hypselobarbus has never been examined for their phylogenetic relationships among species. Most references
to the genus are by Rainboth (1986, 1989), but only in comparisons to and diagnoses from newly described genera
or species from Asia. Thus, the genus is diagnosable from other genera from Asia and has been determined to be
endemic to India. The genus does have a somewhat interesting taxonomic history. Rainboth (1986) considered the
species to in the genus Gonoproktopterus Bleeker, 1859, but further evaluation of types and illustrated materials,
but later by Rainboth (1989), resulted in his hypothesis for the continued recognition of Hypselobarbus as the
genus-group name, not Gonoproktopterus, as a genus diagnosed on the basis of morphological characteristics.
Herein we provide the first phylogenetic hypothesis of relationships of eight of the 11 known species of
Hypselobarbus based on DNA sequences (6,836 bp) of eleven mitochondrial genes. Relationships of this genus to
other genera within the Cyprinidae and species representing the great diversity found in Cyprinoidea is beyond the
scope of this paper. However, the phylogenetic placement and sister group relationships of Hypselobarbus within
Cyprinoidea is the focus of an ongoing investigation by the current authors and collaborators within the Cyprini-
formes Tree of Life initiative and the PBI All Cypriniformes initiative (www.cypriniformes.org).
Methods
DNA Amplification and Sequencing
Tissues were obtained by Dr. Arunachalam and members of his laboratory; genetic work was conducted in his
laboratory at Sri Paramakalyani Centre for Environmental Sciences. Genomic extractions were taken from muscle
tissue or fin clips either frozen at –80˚C or preserved in >95% ethanol using DNeasy Blood & Tissue Kits (Qiagen;
Delhi, INDIA). Genomic DNA was amplified using PCR (Saiki et al. 1985) and the primers listed in Table 1. Tar-
get loci included the complete cytochrome b (cytb), and complete contiguous NADH dehydrogenase subunits 4
and 5 (nad4 and nad5) genes (with intervening tRNA-His, tRNA-Ser, and tRNA-Leu), and fragments of 12S, 16S,
cytochrome c oxidase subunit I (COI), NADH dehydrogenase subunits 4L and 6 (nad4l and nad6). Amplification
of the contiguous fragment of ND4L through ND6 required the use of long PCR, followed by a series of nested
PCRs, in accordance with the protocols outlined in Miya et al. (2006). Amplification of the remaining loci used the
following thermal cycling profiles: 94˚C denaturing (30–60 sec), 40–55˚C annealing (30–60 sec), and 72˚C exten-
sion (2 min 30 sec), for 30–40 cycles; some profiles included an initial heating step at 94˚C for 30–60 sec preced-
ing cycling and/or a final extension step at 72˚C for 2–5 min after cycling was complete. Amplified PCR products
were purified using AMPure (Agencourt Bioscience, Delhi, INDIA) Direct; automated di-deoxy sequencing was
completed by Macrogen (Korea) cycle sequencing, using the primers listed in Table 1. Both strands were
sequenced for all targeted gene regions and a consensus light strand sequence was assembled from complementary
sequences with BioEdit 7.09 (Hall 1999) and Se-Al 2.0a11 (Rambaut 1996). All sequences produced by this study
have been deposited with GenBank (Table 2).
Phylogenetic Analyses
Protein-coding genes were aligned based on their codon positions; alignment was straightforward. For the
other loci, an initial alignment was performed by Clustal X (Thompson et al. 1997) and was followed by minor
manual adjustments by eye. Initial outgroups included four species, Barbus barbus, Puntius tetrazona, P. sarana,
and P. carnaticus. Sequence data from complete mitochondrial genomes of Barbus barbus (AB238965) and Pun-
tius tetrazona (EU287909) were downloaded from GenBank. Puntius sarana sequences were generated as part of
the Cypriniformes Tree of Life initiative; sequences for Barbodes carnaticus were provided by the first author.
Barbodes carnaticus and Puntius sarana were initially considered outgroup taxa and included to determine their
relationship to Hypselobarbus relative to the other two more distant outgropus. Maximum likelihood searches
were conducted with RAxML 7.03 (Stamatakis 2006). The GTR+I+Γ model was applied to each gene partition as
ARUNACHALAM ET AL.
68 · Zootaxa 3499 © 2012 Magnolia Press
determined by ModelTest (Posada and Crandall, 1998). Ten independent searches were conducted, each with a
random starting tree. The topology with the best log likelihood score was retained. Bootstrap values were calcu-
lated from 1000 bootstrap replicates, using the -f i option of RAxML. Maximum parsimony searches were per-
formed using 20 random addition sequence replicates with TBR branch swapping in PAUP* 4.0b10 (Swofford
2002); bootstrap support values were calculated from 1000 bootstrap replicates.
TABLE 1. Primers and primer sequences used in this study of Hypselobarbus.
Results
Sequence analyses and divergence
Complete sequences were obtained for the mitochondrial genes 12s, 16s, COI, ND4L, ND4, tRNA-Ser, tRNA-
His, tRNA-Leu, Cyt b, ND5, and ND6. Plots of transitions and transversions against uncorrected genetic distance
indicated an absence of nucleotide saturation in these genes (not shown). Maximum- and minimum- uncorrected p
distances amongst species of Hypselobarbus and within H. kurali and H. lithopidos for each gene region is pro-
vided in Table 3. For each gene the number of sites sequenced and numbers of variable and phylogenetically infor-
mative sites (for protein-coding genes completed using codon position ) is provided in Table 4.
Primer name Sequence (5' to 3') Source
12S
12Sd-L GGGTTGGTAAATCTCGTGC Wiley et al. (1998)
12Sb-H AGGAGGGTGACGGGCGGTGTGT Wiley et al. (1998)
16S
16Sa-L CGCCTGTTTACCAAAAACATCGCCT Palumbi (1996)
16Sb-H CCGGTCTGAACTCAGATCACGT Palumbi (1996)
Cytochrome b
LA-danio GACTYGAARAACCACYGTTG Mayden et al. (2007)
HA-danio CTCCGATCTTCGGATTACAAG Mayden et al. (2007)
Cytochrome c oxidase subunit I
LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994)
HCO2198 TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994)
ND4L through ND6
L10474-Arg-C GGTTWGAKTCCGYGGTTCCCTTATGAC Miya et al. (2006)
L10681-ND4-C GCKTTTTCTGCKTGTGARGC Miya et al. (2006)
L11427-ND4-C CCWAAGGCSCATGTWGARGC Miya et al. (2006)
L12328-Leu-C AACTCTTGGTGCAAMTCCAAG Miya et al. (2006)
L13058-ND5-C TCKGCTATGGAGGGYCCKAC Miya et al. (2006)
L13559-ND5-C TCKTATCTKAACGCCTGRGC Miya et al. (2006)
H11618-ND4-C TGGCTKACKGAKGAGTAKGC Miya et al. (2006)
H12296-Leu-C CAAGAGTTTTTGGTTCCTAAG Miya et al. (2006)
H13393-ND5-C CCTATTTTKCGGATGTCTTGYTC Miya et al. (2006)
H13721-ND5-C ATGCTTCCTCAGGCRAGKCG Miya et al. (2006)
H14473-ND6-C GCGGCWTTGGCKGCKGAGCC Miya et al. (2006)
H14710-Glu-C CTTGTAGTTGAATWACAACGGTGGTTYTTC Miya et al. (2006)
Zootaxa 3499 © 2012 Magnolia Press · 69
PHYLOGENETICS OF HYPSELOBARBUS
TABLE 2. Genes and Genbank Numbers for Species of Hypselobarbus examined in this study. L, ND4, tRNA-His, tRNA-
Ser, tRNA-Leu, ND5, and ND6 are all included in the genbank records under ND4+5 below.
Sequence divergence within and between species of Hypselobarbus was not predictable based on the current
classification and species diversity; divergence within both H. kurali and H. lithopidos was often greater than that
observed between the other species of Hypselobarbus examined (Table 3). Between-species divergences for most
genes was quite high, varying from 3.3% to 11.7% (Table 3); however, some species were identical or nearly iden-
tical for every gene or tRNA with 0.0 % divergence. Interestingly, for all genes examined the divergence between
populations of H. kurali and/or H. lithopidos was greater than the minimal divergence between any two species
raising questions as to the diversity withing each of these species.
Across all genes the number of variable sites per gene ranged from 14.5% (10 of 69) in tRNA-His to 53.6% (37
of 69) in tRNA-Ser. Excluding tRNAs variable sites ranged from 18.7% (118 of 630) in 16S to 44.7% (131 of 293)
in ND6 (Table 4). Of the variable sites, the number of phylogenetically informative sites ranged from 10% (1) in
tRNA-Leu to 80% (8) in tRNA-His. Excluding tRNAs phylogenetically informative sites ranged from 47.1% (8)
in ND4L or 47.5 (56) in 16S to 64.6% (135) in COI (Table 4).
Monophyly and species relationships
In neither parsimony nor ML analyses the genus Hypselobarbus as currently recognized, was resolved as
monophyletic. A monophyletic Hypselobarbus was resolved as a well-supported group (only ML tree shown; par-
simony tree with identical relationships; Fig. 1) but only with ”Barbus” carnaticus included. Hypselobarbus car-
naticus formed the basal sister group to all other Hypselobarbus. Above H. carnaticus, H. periyarensis formed the
sister group to remaining members. This latter clade was composed of three smaller clades. One clade included H.
jerdoni and a paraphylectic H. lithopidos; one population of the latter species was more closely related to H. jer-
doni than to the other conspecific population. This latter clade was sister to a well-supported clade consisting of
two sister clades of species groups. One clade included H. curmuca sister to H. dubius plus H. micropogon. The
final clade included H. kolus sister to a clade inclusive of two populations of H. kurali. The paraphyly of H. lith-
opidos and the high bootstrap support for the node uniting one population with H. jerdoni was also reflected in the
high genetic divergences between these populations (Table 3).
Genes
Taxon Identifier 12S 16S COI Cyt b ND4+5
Hypselobarbus curmuca CTOL03231 HM010685 HM010696 HM010708 HM010720 HM010732
Hypselobarbus dubius CTOL03232 HM010686 HM010697 HM010709 HM010721 HM010733
Hypselobarbus jerdoni CTOL03233 --- HM010698 HM010710 HM010722 HM010734
Hypselobarbus kolus CTOL03234 HM010687 HM010699 HM010711 HM010723 HM010735
Hypselobarbus kurali CTOL03239 HM010692 HM010704 HM010716 HM010728 HM010740
Hypselobarbus kurali CTOL03242 HM010695 HM010707 HM010719 HM010731 HM010743
Hypselobarbus lithopidos CTOL03235 HM010688 HM010700 HM010712 HM010724 HM010736
Hypselobarbus lithopidos CTOL03238 HM010691 HM010703 HM010715 HM010727 HM010739
Hypselobarbus micropogon CTOL03241 HM010694 HM010706 HM010718 HM010730 HM010742
Hypselobarbus periyarensis CTOL03240 HM010693 HM010705 HM010717 HM010729 HM010741
Puntius sarana CTOL03237 HM010690 HM010702 HM010714 HM010726 HM010738
Puntius carnaticus CTOL03236 HM010689 HM010701 HM010713 HM010725 HM010737
ARUNACHALAM ET AL.
70 · Zootaxa 3499 © 2012 Magnolia Press
TABLE 3. Interspecific and intraspecific genetic distances (uncorrected p) for species of Hypselobarbus.
* 1—from Shimoga fish farm, 2—from Rusewalai fish farm
Discussion
The monophyly of and species relationships within Hypselobarbus, at least for the currently recognized species
available for analysis, were strongly supported. Relationships of species of Hypselobarbus, together with the cur-
rently classified Barbodes carnaticus necessitates allocation of this species to Hypselobarbus. At least four major
lineages are recognized within the genus with H. carnaticus forming the basal-most lineage in the genus, followed
by H. periyarensis sister to remaining species. The other three clades include the H. lithopidos-H. jerdoni clade,
the H. curmuca-H. dubius-H. micropogon clade, and the H. kolus-H. kurali clade. Within both H. kurali and H.
lithopidos significantly high genetic variance existed between the two populations representing each of these spe-
Gene Highest Lowest Intraspecific Divergence
Divergence Divergence H. kuralis H. lithopidos
12S 5.710
H. periyarensis vs H. curmuca 0.00
H. micropogon vs H. dubius 1.292 2.925
16S 5.350
H. periyarensis vs H. jerdoni
H. periyarensis vs H. lithopidos (1)
0.00
H. lithopidos (1) vs H. jerdoni
0.02163
H. lithopidos (2) vs H. jerdoni
H. micropogon vs H. dubius
1.154 2.162
COI 11.404
H. periyarensis vs H. jerdoni 0.00
H. lithopidos vs H. jerdon 1.898 8.321
ND4L 11.404
H. periyarensis vs H. kolus
H. periyarensis vs H. kurali
0.00
H. lithopidos vs H. jerdon 3.704 3.704
ND4 11.658
H. lithopidos (1) vs H. curmuca 0.00
H. lithopidos (1) vs H. jerdoni 2.462 6.589
tRNA-Ser 5.797
H. dubius vs H. jerdoni
H. dubius vs H. lithopidos
H. dubius vs H. periyarensis
H. jerdoni vs H. periyarensis
H. jerdoni vs H. micropogon
H. lithopidos vs H. periyarensis
H. lithopidos vs H. micropogon
H. periyarensis vs H. micropogon
0.00
H. kolus vs H. curmuca
H. micropogon vs H. dubius
H. jerdoni vs H. lithopidos (1)
1.449 0.00
tRNA-Leu 10.714
H. micropogon vs H. lithopidos
H. kurali vs H. lithopidos
0.00
H. curmuca vs H. dubius
H. curmuca vs H. kolus
H. curmuca vs H. kurali (3239)
H. dubius vs H. kolus
H. dubius vs H. kurali (3239)
H. kolus vs H. kurali (3239)
3.571 7.143
Cyt b 3.330
H. micropogon vs H. curmuca
H. dubius vs H. curmuca
0.00
H. dubius vs H. curmuca 2.980 6.310
ND5 11.732
H. kurali vs H. periyarensis 0.187
H. jerdoni vs H. lithopidos 3.070 7.604
ND6 15.017
H. periyarensis vs H. kurali 0.0000
H. lithopidos vs H. jerdoni 4.096 7.167
Zootaxa 3499 © 2012 Magnolia Press · 71
PHYLOGENETICS OF HYPSELOBARBUS
cies across the multiple genes examined. This variation was greater for each of the genes than observed in compar-
isons between currently recognized species. Undescribed diversity clearly exists within the species recognized
tody as H. lithopidos. Additional sampling of species of Hypselobarbus in future analyses may reveal one of the
three remaining species to be examined more closely related to one of the two forms identified herein of H. kurali.
FIGURE 4. Phylogenetic relationships (phylogram of best ML tree) of species of Hypselobarbus reconstructed using RaxML
and 11 mitochondrial genes. General information is provided in text and outlined in Table 4. Numbers at nodes represent boot-
strap values for ML. *R—from Rusewalai fish farm, *S—from Shimoga fish farm.
The Western Ghats is one of the world’s most diverse regions and harbors several of the species of Hypselobar-
bus. Given the difficulty in accessing and sampling rivers in this mountainous region, it would not be surprising to
find undescribed diversity of Hypselobarbus as well as other genera and species of Cypriniformes within this bio-
diversity hot spot. Once the remaining described species of Hypselobarbus are examined for these genes a more
complete picture of the evolution of the species will be possible, along with molecular dating of species diver-
gences within the lineage. The availability of this phylogeny, together with more thorough sampling and morpho-
logical studies of variation, will also permit researchers to hypothesize and describe suspected new species in the
genus. Together, the distributions of species of Hypselobarbus, a calibrated phylogeny of divergences, and the
known geological history of this region will be fundamental in helping to reveal the evolutionary history of the
aquatic faunas of rivers of the Western Ghats.
ARUNACHALAM ET AL.
72 · Zootaxa 3499 © 2012 Magnolia Press
Table 4. Genes examined in phylogenetic analysis of species relationships of Hypselobarbus, numbers of variable and phylogenetically informative sites
(by position for protein coding genes and percent contribution of each of the gene regions towards resolving relationships. * Percentages are
calculated only on number of variable sites in protein coding genes.
Cyt b 12S 16S COI ND4L ND4
tRNA-
His
tRNA-
Ser
tRNA-
Leu ND5 ND6 Total
Total number of sites 1141 627 630 685 54 1381 69 69 63 1824 293 6836
No. of variable sites 388 135 118 209 17 502 10 37 10 698 131 2255
% variable sites 34 21.5 18.7 30.5 31.5 36.4 14.5 53.6 15.9 38.3 44.7 44.7
No. first postion 83 - - 24 3 117 - - - 171 33 431
% first position 7.27% - - 3.50% 5.56% 8.47% - - - 9.38% 11.26% 22.16%
No. second position 23 - - 0 1 33 - - - 72 20 149
% second position 2.02% - - 0.00% 1.85% 2.39% - - - 3.95% 6.83% 7.66%
No. third position 282 - - 185 13 352 - - - 455 77 1364
% third position 24.72% - - 27.01% 24.07% 25.49% - - - 24.95% 26.28% 70.13%
No. of phylogenetic informative sites 233 69 56 135 8 308 8 13 1 406 72 1309
% phylogenetically informative 60.1 51.1 47.5 64.6 47.1 61.4 80.0 35.1 10.0 58.2 55.0 58.0
No. first postion 47 - - 9 0 63 - - - 80 10 209
% first position 4.12% - - 1.31% 0.00% 4.56% - - - 4.39% 3.41% 17.99%*
No. second position 10 - - 0 0 11 - - - 29 6 56
% second position 0.88% - - 0.00% 0.00% 0.80% - - - 1.59% 2.05% 4.82%*
No. third position 176 - - 126 8 234 - - - 297 55 896
% third position 15.43% - - 18.39% 14.81% 16.94% - - - 16.28% 18.77% 77.11%*
Zootaxa 3499 © 2012 Magnolia Press · 73
PHYLOGENETICS OF HYPSELOBARBUS
Acknowledgments
We wish to thank Drs. Kevin Tang and Lei Yang for providing assistance. Funding for this project was provided by
NSF EF 0431326, DEB-1021840 and DBI-0956370 to Mayden.
Literature Cited
Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. (1994) DNA primers for amplification of mitochondrial cyto-
chrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3,
294–299.
Hall, T.A. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT.
Nucleic Acids Symposium Series, 41, 95–98.
Mayden, R.L., Tang, K.L, Conway, K.W., Freyhof, J., Chamberlain, S., Haskins, M., Schneider, L., Sudkamp, M., Wood, R.
M., Agnew, M., Bufalino, A., Sulaiman, Z., Miya, M., Saitoh, K. & He, S.P. (2007) Phylogenetic relationships of Danio
within the order Cypriniformes: a framework for comparative and evolutionary studies of a model species. Journal of
Experimental Zoology Part B: Molecular and Developmental Evolution, 308B, 642–654.
Miya, M., Saitoh, K., Wood, R. M., Nishida, M. & Mayden, R.L. (2006) New primers for amplifying and sequencing the mito-
chondrial ND4/ND5 gene region of the Cypriniformes (Actinopterygii: Ostariophysi). Ichthyological Research, 53, 75–81.
Molur, S., Smith, K.G., Daniel, B.A. & Darwall, W.R.T. (Compilers). (2011) The status and distribution of freshwater biodi-
versity in the Western Ghats, India. IUCN and Coimbatore, India: 200 Outreach Organization. Cambridge, U. K. and
Gland, Switzerland. 116 pp.
Palumbi, S.R. (1996) Nucleic acids II: the polymerase chain reaction, pp. 205–247. In: Molecular Systematics, 2nd ed. D. M.
Hillis, C. Moritz, and B. K. Mable (eds.). Sinauer Associates, Sunderland, MA.
Posada, D & Crandall, KA (1998) MODELTEST: testing the model of DNA substitution. Bioinformatics,14, 817–818.
Rainboth, W.J. (1986) Fishes of the Asian cyprinid genus Chagunius. Occasional papers of the Museum of Zoology, University
of Michigan. 712, 1–17.
Rainboth, W.J. (1989) Discherodontus, a new genus of cyprinid fishes from southeastern Asia. Occasional papers of the
Museum of Zoology, University of Michigan. 718, 1–31.
Rainboth, M. (1985) Neolissochilus, a new genus of South Asian cyprinid fishes. Beaufortia, 35, 25–35.
Rambaut, A. (1996) Se-Al: Sequence Alignment Editor. Department of Zoology, University of Oxford, Oxford. Available from
http://tree.bio.ed.ac.uk/software/seal/.
Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B. , Horn, G.T., Erlich, H.A. & Arnheim, N. (1985) Enzymatic amplification of
beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science, 230, 1350–1354.
Stamatakis, A. (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed
models. Bioinformatics, 22, 2688–2690.
Swofford, D.L. (2002) PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Sinauer Associates, Sunder-
land, MA.
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. & Higgins, D.G. (1997) The CLUSTAL_X windows interface: flex-
ible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research, 25, 4876–4882.
Wiley, E.O., Johson, G.D. & Dimmick, W.W. (1998) The phylogenetic relationships of lampridiform fishes (Teleostei: Acan-
thomorpha), based on a total-evidence analysis of morphological and molecular data. Molecular Phylogenetics and Evolu-
tion, 10, 417–425.
... The barbs of the genus Hypselobarbus (Family: Cyprinidae) comprising about 22 species endemic to the streams and rivers WG of India (Arunachalam et al., 2012;Arunachalam et al., 2016, Arunachalam et al., 2016a, 2016b, 2016cKnight et al., 2013;Knight et al., 2016). The species is large sized (25-100 cm), long lived and potamodromous showing spawning migration from lower reaches to upper reaches in rivers during the monsoon season (Arunachalam et al., 2012). ...
... The barbs of the genus Hypselobarbus (Family: Cyprinidae) comprising about 22 species endemic to the streams and rivers WG of India (Arunachalam et al., 2012;Arunachalam et al., 2016, Arunachalam et al., 2016a, 2016b, 2016cKnight et al., 2013;Knight et al., 2016). The species is large sized (25-100 cm), long lived and potamodromous showing spawning migration from lower reaches to upper reaches in rivers during the monsoon season (Arunachalam et al., 2012). These group of species are indiscriminately exploited in their native ranges of WG for both consumption and aquarium fish trade leading to drastic decline of their natural population and many species of Hypselobarbus are assessed as 'threatened category' in the International Union for Conservation of Nature (IUCN) Red List . ...
Article
The Western Ghats region (part of Western Ghats-Sril Lanka biodiversity hotspot) in India, is known not only for its rich ichthyodiversity and endemism but also as a region that continues to face various human pressure on its freshwater ecosystem through over-exploitation, habitat destruction and alien fish invasion. Insufficient data regarding the demographics and exploitation pattern of threatened freshwater fishes in the Western Ghats (WG) region serves as a barrier to effectively managing and conserving these species in a sustainable manner. In this study, growth, mortality and exploitation level of an endemic and threatened cyprinid, Hypselobarbus kolus were investigated based on the specimen collected by tribal fishers through small-scale fishery in Poringalkuthu Reservoir, Chalakudy River, WG, India. The asymptotic length (L∞) and growth rate (K) (growth parameters) of H. kolus were estimated as 341.25 mm and 0.64 year−1 respectively. The potential longevity (tmax) and length at first capture (Lc) were found to be 4.69 years and 249.34 mm respectively. The fishing mortality (F = 1.20 year−1) of H. kolus was higher than the natural mortality (M =.65 year−1) suggesting an unsustainable level of exploitation for the species within the present study area. Current exploitation rate is greater than E50 and 68% of the predicted maximum exploitation (Emax) points out the possibility of uncertain future of the stock under current exploitation rate. An integrative conservation approach, including fishing closure during spawning seasons, mesh size regulation, quotas system for local tribes and fishermen will ensure to sustainable harvesting for the species in the WG hotspot
... Tis particular genus contains economically important ornamental, as well as food fshes that are sold in local markets [9]. Tese omnivorous, medium-sized fsh showing potamodromous migration, i.e., migrate upstream for spawning during the rainy season [10]. Furthermore, the natural population of Hypselobarbus species is drastically declining as a result of the indiscriminate use of these species for aquarium and edible purposes in their native regions [11]. ...
Article
Full-text available
A 60-day feeding trial has been carried out to access the optimal dietary crude protein (DCP) requirement of juvenile Jerdon’s carp, Hypselobarbus jerdoni. Six isoenergetic (around 400 Kcal DE/100 g), isolipidic (60.80 g/kg), and heteronitrogenous diets were prepared with graded levels of protein, viz., 200, 250, 300, 350, 400, and 450 g/kg (TCP 20-TCP 45 with 50 g/kg incremental level). A completely randomised design (CRD) was used to distribute 270 Jerdon’s carp juveniles (6.12–6.18 g) in six experimental groups in triplicates (15 fish/tank, 200 l water capacity). After 60 days, the fishes of the TCP30 group showed signifcantly higher weight gain, fnal body weight, and percentage weight gain (WG%). The fish of the TCP30 group exhibited a signifcantly higher feed efciency ratio and specifc growth rate. On the other hand, a signifcantly lower feed conversion ratio is recorded in the TCP30 and TCP35 groups. The protein efficiency ratio of fsh was reduced signifcantly with the elevated DCP level. Whole-body moisture, lipid, and total ash contents of H. jerdoni were remain unafected by DCP levels. However, DCP levels signifcantly infuenced the whole-body protein of H. jerdoni juveniles, with signifcantly higher values noticed in the TCP30 and TCP35 groups. The TCP35, TCP40, and TCP45 groups exhibited signifcantly higher (p < 0.05) protease activity, and the amylase activity showed a decreasing trend in response to dietary protein levels. A signifcantly (p < 0.05) higher SOD and CAT activity were observed in the TCP20 and TCP25 groups. However, lower hepatic glutamate pyruvate transaminase and glutamic-oxaloacetic transaminase activity were observed in the TCP30 and TCP35 groups, respectively. Furthermore, based on broken-line linear and second-order polynomial regression with respect to WG%, the optimal dietary crude protein requirement of H. jerdoni cultured for 60 days was found to be 309.72 and 316.40 g/kg.
... (Fig. 3) H. thomassi (1.12 t) were the species reported in the present study. They are endemic to rivers of Western Ghats occurring in rivers, streams, and reservoirs or even in lower reaches of rivers in the range (Arunachalam et al., 2012). Secondary freshwater fishes, viz., C. chanos (2.09 t), M. cyprinoides (1.01 t) and Mugil cephalus (0.94 t) accounted for 24.32% in the landing. ...
Article
Full-text available
Kallada is one of the significant Western Ghats river systems of Kerala with a total length of 121 km and a catchment area of 1654 km 2. The present study assessed the exploited fisheries resources of the Kallada River during 2009-2010. A total of 21 fish species belonging six orders and 17 genera were recorded from the fishery. Family Cyprinidae dominated with six species followed by Cichlidae and Channidae (three species each). The landings were represented by one Critically Endangered (Hypselobarbus thomassi), and three vulnerable (Hypselobarbus kolus, Horabagrus brachysoma and Channa diplogramma) species. The average annual fish production from Kallada River was estimated to be 16.58 t. Highest landings were recorded during the pre-monsoon season (9.3 t) and the lowest during monsoon (1.88 t). Hypselobarbus kurali (4.75 t), H. thomassi (1.12 t) and H. kolus (0.42 t) were the abundant species in the landings. Between the landing centres, Kunnathoor contributed 52.36% to the total landing followed by Neduvannorkadavu (46.84%). Gill net was the major gear used in the river accounting for 99% of the total catch. Catch per unit effort (CPUE) recorded in the gill net for H. kurali (0.28 kg h-1), Chanos chanos (0.10 kg h-1), H. thomassi (0.07 kg h 1) and Tor khudree (0.06 kg h-1).
... Hypselobarbus kurali (4.75 t), H. kolus (0.42 t) and H. thomassi (1.12 t) were the species reported in the present study. They are endemic to rivers of Western Ghats occurring in rivers, streams, and reservoirs or even in lower reaches of rivers in the range (Arunachalam et al., 2012). Secondary freshwater fishes, viz., C. chanos (2.09 t), M. cyprinoides (1.01 t) and Mugil cephalus (0.94 t) accounted for 24.32% in the landing. ...
Book
Full-text available
Special issue of the Journal of Aquatic Biology and Fisheries based on the papers presented in the International Conference on Rivers for Future organised by University of Kerala
Article
Full-text available
Background Fish with vertebral monstrosities are very rare in the wild, as those individuals in the natural populations tend to perform poorly to survive in any ecosystem. Species of the fish genus Hypselobarbus as reported (Bleeker in De visschen van den Indischen Archipel, Lange, 1860) are freshwater endemic barbs of Western Ghats and peninsular India. Four species of the genus, namely Hypselobarbus dobsoni (Krishna carp), H. jerdoni (Jerdon’s Carp), H. lithopidos (Canara barb) and H. thomassi (Red Canarese barb), were collected from three different river systems of the Western Ghats biodiversity hotspot of India. Some individuals were found to be different from normal specimens, with extremely large body depth compared to normal specimens. The study was initiated with the aim of bringing an understanding on monstrosities of these four species along with identifying the normal and abnormal individuals in an integrated approach; employing traditional morphometry, X-ray imaging and barcoding mtDNA COI X-ray imaging could elucidate the vertebral monstrosities, which are discussed in detail. The mtDNA COI gene sequences generated were used to draw conclusions on identity of both normal and deformed individuals. Results The phenotypic deformities have led to deepening of the body with a more robust and reduced length which is evident from the morphometric comparison of normal specimens with deformed ones. The radiographic images revealed reduced intra-vertebral space in comparison with the normal vertebrae, deformed vertebrae were between 25 and 32, showing significantly altered intra-vertebral space. Slight genetic divergence of 1.1% between normal and deformed specimens in mitochondrial DNA COI gene of H. lithopidos and H. thomassi and no divergence in H. dobsoni and H. jerdoni were also observed . Conclusion The specimens were collected from areas with high anthropogenic stresses, abate water quality, and habitat, which could be possible reasons of appearance of individuals with deformed vertebrae. Several environmental and genetic factors might have influenced the development of these robust short-bodied phenotypes in these rivers and possess slight genetic divergence from normal specimens. However, these deformities may also be the result of the stress during embryonic and early life stages in the wild.
Article
Full-text available
Fish of the genus Hypselobarbus (Bleeker 1860) are widely dispersed in the rivers of the Western Ghats in India and endemic to southern Indian peninsular freshwaters. These are small- to medium-sized fishes of the family Cyprinidae. Although fish with deformed bodies or body parts are rare in natural waters, this article deals with four abnormal specimens of Hypselobarbus curmuca (Hamilton 1807) collected from the rivers Tunga, Bhadra, and Kali during 2022. The abnormalities observed in four different individuals are pughead deformity, pelvic fin deformity, pectoral fin deformity, and enlarged scales. The morphological comparison of normal individuals of Hypselobarbus curmuca (Hamilton 1807) with abnormal specimens revealed variation. Using the MT-COI gene, species identity was confirmed and the mean genetic divergence between the normal and abnormal specimens was estimated to be less than 1%.
Preprint
Full-text available
The vertebral deformity in four fish species of genus Hypselobarbus (Bleeker 1860), collected from three different river systems of the Western Ghats, biodiversity hotspot of India, are reported here. The radiographic images revealed reduced intra-vertebral space in comparison with the normal vertebrae. The phenotypic deformities have led to the deepening of the body with a more robust and reduced length. The deformed vertebrae were between 25 and 32. Slight genetic divergence of 1.1% between normal and deformed specimens in Mitochondrial cytochrome oxidase subunit 1 gene of Hypselobarbus lithopidos and H. thomassi and no divergence in H. dobsoni and H. jerdoni was observed . Several environmental and genetic factors might have influenced the development of these robust short-bodied phenotypes in these rivers and possess slight genetic divergence from normal specimens. The specimens were collected from areas with high anthropogenic stresses, abate water quality, and habitat, which could also be a possible reason. However, these deformities may also be the result of the stress during embryonic and early life stages.
Article
The present study was undertaken to generate first time information on the optimal stocking density for fry to fingerling rearing of Hypselobarbus pulchellus. Rearing was carried out for 90 days at stocking densities of 15, 30, 45, 60, 75, 90, 105 and 120 fish/m² in 24 m² cement tanks. While the length of fish at harvest ranged from 3.42 cm in 120/m² to 6.11 cm in 15/m² densities, the weight ranged from 0.41 g in 120/m² to 2.62 g in 15/m². The final length and weight were inversely related to the stocking density. However, no significant variation (p > 0.05) in length was observed among the stocking densities of 15, 30, 45 and 60/m². Similarly, the final weight of the fingerlings also did not differ (p > 0.05) between the stocking densities 15, 30 and 45/m². Further, increase in stocking densities resulted in significant reduction in final length and weight, with the highest stocking density of 120/m² recording the lowest values. The condition factor varied between 0.95 and 1.17 with no difference (p > 0.05) among the stocking densities. The survival of fingerlings at harvest ranged between 81 and 90%, but was not statistically different. The growth in terms of length and weight of H. pulchellus was superior under stocking densities 15, 30 and 45 fish/m² compared to higher densities. Hence, the stocking density of 45 fish /m² is recommended as the optimum for fry to fingerling rearing of H. pulchellus.
Article
The study provides new information on the reproductive biology of Hypselobarbus thomassi (Day, 1874) an endemic cyprinid fish in the Western Ghats–a biodiversity hotspot of India. A total of 384 specimens (males = 244 and females = 140) were collected monthly from April 2009 to March 2011 from Kallada River of Southern part of Western Ghats, India. Monthly sex ratio indicated that males predominated in the fishery, and an overall sex ratio was significantly different from the expected value of 1:1 (male:female = 1:0.57, x2 = 28.17, p < .01). Based on the monthly analysis of gonadosomatic index (GSI) and the proportion of mature individuals, the spawning season of H. thomassi occurred between May to October with a peak in June to August. The length at first maturity (L50) recorded was 290 mm TL in males and 330 mm TL in females. The absolute fecundity ranged between 305 (234 mm TL) to 1,089 (414 mm TL) and relative fecundity oscillated between 77.3–220.69 oocytes/g of fish. The fecundity established a linear relationship with total length, body weight and ovary weight. The findings of this study would be very effective to impose sustainable conservation plan for this threatened species in Kallada River and other Western Ghats river systems.
Thesis
Free download at: http://publikationen.ub.uni-frankfurt.de/files/45041/Dissertation_Borkenhagen_ohne_CV.pdf --Fishes of the tribe Torini Karaman, 1971 (Teleostei: Cyprinidae) are a diverse group of primary freshwater fishes, distributed in Africa, the Middle East, and Indomalaya. They are an important component of the native freshwater-fish fauna of the Middle East and North Africa, and occur in most large river systems of the Levant, Arabia, Mesopotamia, southern Iran, and Morocco. They belong to the subfamily Cyprininae, are characterised by being tetraploid or hexaploid, having large scales, and a smooth and ossified last unbranched ray in the dorsal fin. As primary freshwater fishes they are not able to tolerate marine conditions and depend on direct freshwater connections for their dispersal. This makes them an ideal model for zoogeographic studies. Prior to this study, the diversity of the Torini species in the Middle East and North Africa was not well understood. The validity of several genera and species was unclear, and the generic assignment of several species changed frequently. In this PhD project the taxonomy, phylogeny, and zoogeography of the Torini of the Middle East and North Africa were investigated with morphological, as well as molecular methods. More than 1550 fish specimens were examined morphologically. Some of the specimens, including the types of most nominal species, were already available from museum collections. The remaining specimens were collected during expeditions to Ethiopia, Iran, Jordan, Morocco and Syria. Tissue samples were collected for molecular genetic analyses. The mitochondrial genes for cytochrome b, NADH dehydrogenase subunit 4 and the tRNAs for serine and histidine were sequenced from more than 120 specimens, representing 20 species of Torini and two small, diploid African barbs (Cyprinidae, tribe Smiliogastrini). Molecular data were analysed with Bayesian inference and other methods. The analyses confirmed that the hexaploid Torini of Africa and the Middle East form a monophyletic group. In the Middle East and North Africa the Torini are represented by the genera Arabibarbus, Carasobarbus, Mesopotamichthys, and Pterocapoeta. These genera are each morphologically diagnosable, monophyletic, and genetically distinct. The species 'Labeobarbus' reinii cannot be assigned to any of these genera, because it is morphologically dissimilar and genetically clearly separated from each of them. A generic name for this species is presently not available and until the description of a new genus it is preliminarily assigned to the genus 'Labeobarbus'. Out of the 28 species-group taxa described from the Middle East and North Africa until now, 15 are valid: Arabibarbus arabicus, A. grypus, A. hadhrami, Carasobarbus apoensis, C. canis, C. chantrei, C. exulatus, C. fritschii, C. harterti, C. kosswigi, C. luteus, C. sublimus, Mesopotamichthys sharpeyi, Pterocapoeta maroccana, and 'Labeobarbus' reinii. The phylogenetic relationships between the Middle Eastern and North African Torini are well resolved, based on the analysis of mitochondrial DNA sequences from nearly all relevant species. The interspecific and intraspecific morphological and genetic diversity is shaped by the zoogeographic history. Conclusions can be drawn about the events that shaped the evolution of this group. The Torini originated in the Indomalayan biogeographical realm and colonised the Middle East and Africa during the Miocene via the Gomphotherium landbridge. The Indomalayan Torini are tetraploid, whereas those of the Middle East and Africa are hexaploid. Molecular phylogenetic analyses showed that the hexaploid Torini cluster within the tetraploid Torini. This makes the tetraploid Torini a paraphyletic group with respect to the hexaploid Torini. Morocco was colonised in two independent waves. The first came from sub-Saharan Africa and is represented by Pterocapoeta maroccana. The second originated in the Middle East and gave rise to C. fritschii, C. harterti, and probably 'L.' reinii. The Tigris-Euphrates system is the largest freshwater system in the Middle East. Its central position between the Orontes River and Jordan River in the West, the Iranian tributaries to the Persian Gulf in the East, and the Arabian Peninsula in the South made it an important crossroad for the colonisation of the Middle East by Torini and other freshwater biota. During the Miocene the predecessors of the Jordan and Orontes rivers were connected to the Tigris-Euphrates system. The Jordan River was separated from the Euphrates before the Orontes. Arabia was colonised in two waves. The first (A. arabicus, A. hadhrami, C. exulatus) dates to the Pliocene, whereas the second (C. apoensis) ended as recently as the late Pleistocene or early Holocene.
Article
Full-text available
We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.
Article
Full-text available
CLUSTAL X is a new windows interface for the widely-used progressive multiple sequence alignment program CLUSTAL W. The new system is easy to use, providing an integrated system for performing multiple sequence and profile alignments and analysing the results. CLUSTAL X displays the sequence alignment in a window on the screen. A versatile sequence colouring scheme allows the user to highlight conserved features in the alignment. Pull-down menus provide all the options required for traditional multiple sequence and profile alignment. New features include: the ability to cut-and-paste sequences to change the order of the alignment, selection of a subset of the sequences to be realigned, and selection of a sub-range of the alignment to be realigned and inserted back into the original alignment. Alignment quality analysis can be performed and low-scoring segments or exceptional residues can be highlighted. Quality analysis and realignment of selected residue ranges provide the user with a powerful tool to improve and refine difficult alignments and to trap errors in input sequences. CLUSTAL X has been compiled on SUN Solaris, IRIX5.3 on Silicon Graphics, Digital UNIX on DECstations, Microsoft Windows (32 bit) for PCs, Linux ELF for x86 PCs, and Macintosh PowerMac.
Article
Full-text available
The program MODELTEST uses log likelihood scores to establish the model of DNA evolution that best fits the data. AVAILABILITY: The MODELTEST package, including the source code and some documentation is available at http://bioag.byu. edu/zoology/crandall_lab/modeltest.html.
Book
— We studied sequence variation in 16S rDNA in 204 individuals from 37 populations of the land snail Candidula unifasciata (Poiret 1801) across the core species range in France, Switzerland, and Germany. Phylogeographic, nested clade, and coalescence analyses were used to elucidate the species evolutionary history. The study revealed the presence of two major evolutionary lineages that evolved in separate refuges in southeast France as result of previous fragmentation during the Pleistocene. Applying a recent extension of the nested clade analysis (Templeton 2001), we inferred that range expansions along river valleys in independent corridors to the north led eventually to a secondary contact zone of the major clades around the Geneva Basin. There is evidence supporting the idea that the formation of the secondary contact zone and the colonization of Germany might be postglacial events. The phylogeographic history inferred for C. unifasciata differs from general biogeographic patterns of postglacial colonization previously identified for other taxa, and it might represent a common model for species with restricted dispersal.
Article
We provide 15 new primers for amplifying and sequencing the mitochondrial ND4/ND5 gene region of the Cypriniformes in an attempt to resolve relationships of this diverse group of freshwater fishes with extensive taxonomic sampling. Sequences from this region have the following desirable characteristics for phylogenetic analyses, some of which are lacking from the more commonly used cyt b and 12S/16S rRNA genes: they are (1) easy to align, (2) relatively long (ca. 3.4 kb), and (3) contain more phylogenetically informative variation at 1st and 2nd codon positions. Moreover, the ND4/ND5 gene region is easy to amplify and sequence when employing the protocol suggested herein.
Article
Two new methods were used to establish a rapid and highly sensitive prenatal diagnostic test for sickle cell anemia. The first involves the primer-mediated enzymatic amplification of specific beta-globin target sequences in genomic DNA, resulting in the exponential increase (220,000 times) of target DNA copies. In the second technique, the presence of the beta A and beta S alleles is determined by restriction endonuclease digestion of an end-labeled oligonucleotide probe hybridized in solution to the amplified beta-globin sequences. The beta-globin genotype can be determined in less than 1 day on samples containing significantly less than 1 microgram of genomic DNA.