Content uploaded by Alan Fong
Author content
All content in this area was uploaded by Alan Fong
Content may be subject to copyright.
Content uploaded by W N Tiong
Author content
All content in this area was uploaded by W N Tiong
Content may be subject to copyright.
Increased serum levels of interleukin-6 and von
Willenbrand Factor in early phase of acute coronary
syndrome in a young and multiethnic Malaysian
population
Wen Ni Tiong,
1,2
Alan Yean Yip Fong,
1,3
Edmund Ui Hang Sim,
2
Hiang Chuan Chan,
4
Tiong Kiam Ong,
3
Boon Cheng Chang,
3
Kui Hian Sim
3
1
Clinical Research Centre,
Sarawak General Hospital, Jalan
Tun Ahmad Zaidi Adruce,
Kuching, Sarawak, Malaysia
2
Department of Molecular
Biology, University Malaysia
Sarawak, Kota Samarahan,
Sarawak, Malaysia
3
Department of Cardiology,
Sarawak General Hospital, Jalan
Tun Ahmad Zaidi Adruce,
Kuching, Sarawak, Malaysia
4
Accident and Emergency
Department, Sarawak General
Hospital, Jalan Tun Ahmad Zaidi
Adruce, Kuching, Sarawak,
Malaysia
Correspondence to
Wen Ni Tiong, Clinical Research
Centre, Sarawak General
Hospital, Jalan Tun Ahmad Zaidi
Adruce, 93586, Kuching,
Sarawak, Malaysia;
tiongwn@crc.gov.my
Accepted 12 September 2012
ABSTRACT
Objective Interleukin-6 (IL6; proinflammatory marker),
von Willebrand Factor (vWF; endothelial dysfunction
marker) and P-selectin (platelet activation marker), may
play important roles in defining the pathogenesis of
vulnerable plaques in acute coronary syndrome (ACS).
This study aims to investigate the expression and
relationship of these markers in early phases of ACS in a
young and multiethnic Malaysian population.
Design Peripheral whole blood mRNA, and serum levels
of IL6, vWF and P-selectin were measured in 22 patients
with ACS, and in 28 controls with angiographically
significant coronary artery disease without previous ACS
events. Venous blood from ACS patients was obtained
within 1 h of hospital admission.
Results No significant differences of IL6, vWF and
P-selectin mRNA levels between ACS and controls were
seen. ACS patients had significantly higher serum levels
of IL6 and vWF ( p<0.001), compared with controls.
P-selectin correlated with IL6 (r=0.697, p=0.003) and
vWF (r=0.497, p=0.05) at mRNA levels, indicating a
possible association between these three indices of ACS
pathogenesis.
Conclusions Increased serum levels of IL6 and vWF
suggest that inflammation and endothelial dysfunction
may play a prominent role in the pathogenesis of the
disease during the early phase of ACS.
INTRODUCTION
Coronary artery disease (CAD), including its mani-
festation as acute coronary syndrome (ACS) is a well
established cause of morbidity and mortality among
adults in both developed and developing countries.
In recent years, there has been an alarming rise in
the incidence of ACS in the Malaysian population,
especially in younger age groups.
1
It has been
reported that Malaysian ACS patients had a median
age of 59 years, which was comparatively younger
than the Caucasian population, whose median age
was 66 years, as shown by the international multi-
centre GRACE Registry.
12
Atherosclerosis is the culprit behind the ACS
and stable CAD. The pathophysiology of athero-
sclerosis includes plaque formation and destabilisa-
tion (‘atherogenesis’), tendency to thrombus
formation (‘thrombogenesis’), and the loss of
endothelial cell integrity (‘endothelial dysfunc-
tion’) within the coronary arteries, as described by
Virchow’s vascular triad.
3
These processes are
intimately linked, and hence, provide a clue of
diagnosis of eventual ACS as early as in pathogen-
esis of disease based on composition and vulner-
ability of plaque.
4
Currently available cardiac markers for ACS diag-
nosis, such as troponin-T and creatine kinase–myo-
cardial band (CK-MB) isoenzyme, only detect
consequences of myocardial damage after ACS has
occurred, thus the information to identify patients
at risk of ACS in early phase is not available.
5
Much
interest has focused on identifying upstream
markers which can detect an individual at risk of
atherosclerotic plaque rupture leading to ACS. These
include markers of inflammation, interleukin 6
(IL6); endothelial dysfunction, von Willenbrand
Factor (vWF), and platelet activation, P-selectin.
Although each of these markers has been shown to
predict future cardiovascular events in stable CAD
patients, as well as recurrent events and death in
patients presenting with ACS,
6–8
their association
has yet to be studied in a young, multiethnic group
of the Malaysian population.
It now supports the concept that all types of
blood constituents appear to play a role in plaque
formation,
9
and the peripheral blood gene expression
may reflect pathophysiology in the vascular wall or
the extent of CAD.
10
With increasing awareness of
the practical limitations of collecting primary car-
diovascular disease tissue, temporal evaluation of
blood RNA profiles that are mechanistically asso-
ciated with disease processes could provide an add-
itional useful tool for screening for disease in an
at-risk population. Moreover, studying both tran-
scriptional and translational profiles of markers
could lead us to understand the in vivo molecular
pathway of atherogenesis, endothelial dysfunction
and platelet activation in patients with ACS.
By specifically choosing different aspects of the
pathophysiology of atherosclerotic plaque rupture,
the present study sought to investigate whether
IL6, vWF and P-selectin can be used as markers to
differentiate patients who had developed ACS,
compared with patients with stable CAD during
an early phase of hospitalisation.
MATERIALS AND METHODS
Study participants
Twenty-two ACS patients, who had transient
ST-segment or T-wave changes on a standard
12-lead electrocardiogram, or raised troponin-T
levels occurring with their typical symptom
onset, were recruited into this study between
146 Heart Asia 2012:146–150. doi:10.1136/heartasia-2012-010131
Original research
March 2009 and December 2010. Each ACS patients was
recruited within 1 h of hospital admission in the emergency
department of Sarawak General Hospital. Twenty-eight
patients with angiographically documented ≤50% coronary
stenosis, who had no previous history of an ACS event were
recruited as controls. These controls were screened between
March 2009 and March 2010 from an original group that had
conventional coronary angiography, or coronary angiography
by multislice CT of the coronary arteries. History of smoking,
diabetes, hypertension, hyperlipidaemia and family history of
CAD prior to the index date were ascertained by interview
with patients and control subjects, and retrieved from medical
records or discharge letters. Written, informed consent was
obtained from all subjects. This study was approved by the
medical research ethics committee of the Ministry of Health,
Malaysia.
Measurement of serum levels of CRP, IL6, vWF and P-selectin
Baseline serum samples were obtained from 5 ml of whole blood
stored in serum-separator tubes after clotting for 30 min, and
centrifuged at 1500×gfor 10 min at room temperature. Samples
were analysed by commercial kits of ELISA for high-sensitivity
C-reactive protein (CRP), (American Diagnostica, Stamford,
Connecticut, USA), IL6 (Invitrogen, Camarillo, California,
USA), vWF (AssayPro, St Charles, Missouri, USA), and soluble
P-selectin (R&D Systems, Minneapolis, Minnesota, USA).
The lower limit of detection by ELISA for each marker was
2.5 ng/ml, 2 pg/ml, 5 ng/ml and 0.5 ng/ml, respectively.
Intra-assay and interassay coefficient variations were less than
8% and 10%, respectively. The final results were presented as
mg/ml (CRP and vWF), pg/ml (IL6) and ng/ml (P-selectin).
RNA isolation, DNases treatment and cDNA synthesis
Total RNA from 5 ml of whole blood was extracted by using
TRI-reagent RT-blood reagent (Molecular Research Centre Inc,
Cincinnati, Ohio, USA) and further cleaned up using RNeasy
mini spin column kit (Qiagen, Hilden, Germany) as per manu-
facturer’s instructions, with slight modification. Following RNA
isolation, DNases treatment was performed (RQ1 DNases I,
Promega, Madison, Wisconsin, USA) to eliminate contamination
of genomic DNA in RNA samples, and then reverse-transcribed
to cDNA by using Moloney Murine Leukemia Virus (MMLV)
reverse transcriptase (Promega, Madison, Wisconsin, USA).
Real-time PCR
Gene expressions of IL6, vWF and P-selectin at mRNA level in
whole blood samples were quantified by delta-delta C
T
(ΔΔC
T
)
relative quantification method using the Rotor-Gene 6000
thermal cycler (Corbett Research, Mortlake, NSW, Australia).
Human β-actin primer sets were used as reference gene. All
primer sequences were retrieved from online PrimerBank data-
base
11
(IL6 and P-selectin) or qPrimerDepot database
12
(vWF
and β-actin), respectively, as listed in table 1.
For real-time PCR reaction, the following reaction compo-
nents was prepared: 12.5 ml Rotor-Gene SYBR Green I master-
mix (Qiagen, Hilden, Germany), 2.5 ml forward primer (10 mM),
2.5ml reverse primer (10 mM), 6.5 ml nuclease-free water and 1 ml
cDNA template to make up total reaction of 25 ml. The follow-
ing PCR-run protocol was performed: denaturation programme
(95°C, 5 min), amplification and quantification programme
repeated 40 times (95°C for 5 s, 60°C for 10 s), followed by
melting dissociation curve programme. First-choice Human
Breast Total RNA (Ambion, Austin, Texas, USA) was used as
calibrator, and all the samples were run in duplicate. The final
mRNA expression levels were presented as the normalised mean
value of mRNA fold change relative to calibrator.
Statistical analysis
Statistical analyses were carried out using the statistical pro-
gramme SPSS 16.0 for Windows (SPSS, Chicago, Illinois, USA).
Parametric results are expressed as mean with SD, and differ-
ences between groups were compared by using one-way ana-
lysis of variance (ANOVA). Non-categorical data were
compared by the χ
2
test. Non-parametric results are expressed
as medians with IQR, and were compared using Mann–
Whitney test. Correlations were examined using Spearman’s
rank correlation. All comparisons were considered significant at
p<0.05.
RESULTS
The demographic and baseline biochemical data from all
study subjects are shown in table 2. Among 22 ACS patients, 17
had ST-segment elevation myocardial infarction, four had
non-ST-segment elevation myocardial infarction and one
had unstable angina. The median duration of chest pain for ACS
patients was 61.32 (52.25) min. Among all the study subjects, the
prevalence of those with at least one of the five conventional car-
diovascular risk factors was 95.4% and 100% in ACS and controls,
respectively. The majority of ACS patients had risk factors of
smoking and higher admission diastolic blood pressure, heart rate
and total white blood cells than the controls (p<0.005).
Table 1 Forward and reverse primer sequences used in this study
Gene Forward sequence (50
–30) Reverse sequence (50
–30)
IL6 CAATCTGGATTCAATGAGGAGAC CTCTGGCTTGTTCCTCACTACTC
von Willebrand
Factor
TTTCCCCAGAGGAGATGTTG TCGGACCCTTATGACTTTGC
P-selectin CTGCTGCAAGGCGTTCTACT GGACAGGTTCCCCATGTTGG
β-Actin CCTTGCACATGCCGGAG GCACAGAGCCTCGCCTT
Table 2 Baseline demographic and biochemical data in ACS and
control subjects
Baseline characteristics ACS (n=22) Controls (n=28) p Value
Age (years) 55.2±10.4 53.5±8.4 0.539
Male, n (%) 18 (81.8%) 24 (85.7) 0.709
Risk factor, n (%)
Current smoking 11 (50) 6 (21.4) 0.017
Hypertension 16 (72.7) 17 (60.7) 0.373
Dyslipidaemia 9 (40.9) 26 (92.9) <0.001
Diabetes 9 (40.9) 8 (28.6) 0.361
Family history of CAD 11 (50) 16 (57.1) 0.615
Systolic blood pressure (mm Hg) 155.00 (41.75) 130.50 (29.50) 0.091
Diastolic blood pressure (mm Hg) 93.00 (23.25) 81.00 (8.50) 0.004
Heart rate (bpm) 87.00 (26.50) 70.50 (22.25) 0.001
Total white blood cells (10
3
/ml) 11.35 (5.03) 6.29 (2.04) <0.001
Haemoglobin (g/dl) 14.84±1.37 14.58±1.23 0.481
Platelet count (10
3
/ml) 250.82±77.49 240.43±41.94 0.547
Creatinine (mmol/l) 98.14±21.96 89.07±17.97 0.115
Total cholesterol (mmol/l) 5.37 (1.58) 4.62 (1.86) 0.190
Triglycerides (mmol/l) 1.57 (0.67) 1.57 (1.26) 0.822
Low density lipoprotein (mmol/l) 1.12 (0.25) 1.30 (0.47) 0.137
High density lipoprotein (mmol/l) 3.19 (1.11) 2.66 (1.31) 0.091
ACS, acute coronary syndrome; CAD, coronary artery disease.
Original research
Heart Asia 2012:146–150. doi:10.1136/heartasia-2012-010131 147
Serum protein levels of CRP, IL6, vWF and P-selectin in ACS
and control subjects
Serum levels of CRP, IL6, vWF and P-selectin are presented in
table 3. All markers were increased in patients with ACS com-
pared with the controls, except for P-selectin. Univariate ana-
lysis showed that there was no correlation among the serum
levels of all tested markers in the control group. A moderate
correlation was found between IL6 and CRP levels in the ACS
group (r=0.474, p=0.026).
mRNA expression levels of IL6, vWF and P-selectin in ACS
and control subjects
In this part of the study, only some samples were selected for
mRNA expression analysis for each gene. Samples which
showed primer dimer, or had poor RNA quality, were excluded
from further analysis. No significant difference of IL6, vWF and
P-selectin mRNA levels was found in ACS subjects and controls
(table 4). With the limitation of small sample size, and assump-
tion of both ACS and stable CAD which shared similar patho-
genesis of atherosclerosis, we combined both groups in order to
understand the integral relationship of IL6, vWF and P-selectin
at transcriptional level. The correlation test showed that
mRNA level of P-selectin was significantly associated with IL6
(r=0.697, p=0.003) and vWF (r=0.497, p=0.050).
Comparison of mRNA and serum protein expression levels
Theoretically, the changes in mRNA level could be reflected in
the level of protein expression of one gene. A correlation test
was therefore performed to check the relationship between
mRNA and serum level of each gene in order to understand
their possible molecular pathogenic role in development of
atherosclerosis. In the present study, we observed a large dis-
crepancy between mRNA and serum protein expression levels
of IL6 and vWF, but not P-selectin in our patients (IL6:
r=−0.03, p=0.891; vWF: r=−0.002, p=0.991; P-selectin:
r=0.358, p=0.048).
Influence of changes in cardiovascular risk factors
Despite the discrepancy between mRNA and protein level, it is
most probably the measurement of protein levels of each gene
that is the ideal clinical source of information to differentiate
patients at risk of ACS. However, the changes in protein level
could be influenced by other confounding factors. We therefore
performed additional analyses to assess whether the changes in
the serum levels of each marker were associated with changes
in the conventional cardiovascular risk factor. Only soluble
P-selectin was found correlated with smoking (r=−0.438,
p=0.041) and diabetes mellitus (r=0.462, p=0.030) in ACS
patients.
DISCUSSION
The strengths of this study include the availability of whole
blood and serum samples at a very early phase of ACS, with a
median duration of chest pain of approximately 60 min before
acute pharmacotherapy was fully established. Another aspect is
the ethnic diversity of the ACS cases and controls. To date, no
study has examined the association of whole blood gene expres-
sion and serum levels of markers of inflammation—IL6, endo-
thelial dysfunction, vWF and platelet activation—P-selectin in
this combination, in a multiethnic Malaysian population
during early onset of ACS. The present study affirmed higher
serum levels of IL6 and vWF,
13 14
but not P-selectin in ACS
patients compared with controls.
Evidence, to date, suggests that systemic inflammation origi-
nates from local inflammatory processes within the arterial
wall after plaque disruption is often an index of further events
of ACS.
15
CRP is a valuable marker for underlying systemic
inflammation, and its release is largely mediated by cascade
response of proinflammatory cytokines including IL6 and
TNF-α.
16
Though TNF-αis the main determinate of IL6 syn-
thesis and has been widely studied, it was observed that the
IL6 could be a stronger predictor of coronary mortality than
TNF-αin unstable angina patients.
17
In the present study, IL6
found closely associated with CRP affirmed that IL6 is a
primary stimulant for hepatic production of CRP.
16
Although
this may signify an increase of systemic inflammation after vas-
cular injury at the site of the lesion, we lack the prognosis
value of IL6 and CRP as a combining marker strategy to predict
for future events after an ACS event in our population.
In addition, the increased serum level of vWF indicates the
extent of damage in the vascular endothelium, or simply the
reaction of acute-phase reactant to various stimuli, such as
hypoxia and inflammatory cytokines.
18
A recent report has
shown that ACS patients were found to have higher oxidative
stress compared with healthy controls, and that oxidation
process during haemostasis could induce the release of vWF
from the endothelium.
19
As an endothelial dysfunction marker,
the causative role of vWF in the process of atherosclerosis
process is to support platelet adhesion to the injured vessel
walls to promote platelet aggregation and fibrin clot forma-
tion.
18
Our data further suggest that vWF can be a strong indi-
cator of existence of any kind of ACS.
19
The evaluation of gene expression of heterogenous whole
blood cell population may better elucidate the true biology of
inflammation,
20
however, the difference in serum protein level
we observed was not reflected at mRNA level of IL6 and vWF.
The poor correlations between mRNA and protein levels of
markers may be attributed to the complicated biological pro-
cesses, such as post-transcriptional splicing, translational modi-
fications, and so on.
21
In a complex inflammatory process, such
Table 3 Serum levels of CRP, IL6, vWF and P-selectin in ACS and
control subjects
Marker ACS Controls p Value
CRP, mg/ml, median (IQR) 4.90 (10.11) 0.55 (1.09) <0.001
IL6, pg/ml, median (IQR) 7.95 (22.28) 0.00 (1.23) <0.001
vWF, mg/ml, median (IQR) 16.85 (14.51) 8.38 (5.54) <0.001
P-selectin, ng/ml, median (IQR) 79.42 (50.43) 68.63 (45.09) 0.082
ACS, acute coronary syndrome; CRP, C-reactive protein; vWF, von Willebrand Factor.
Table 4 mRNA levels of IL6, vWF and P-selectin in ACS and control
subjects
Marker ACS Controls p Value
IL6, median (IQR)* 0.13 (0.24) 0.16 (0.31) 0.536
vWF, median (IQR)†0.040 (0.01) 0.0025 (0.01) 0.227
P-selectin, median (IQR)‡388.30 (479.24) 373.34 (403.65) 0.675
Due to consideration of sample qualities, a varying total number of samples to be
analysed for relative mRNA fold change in IL6, vWF and P-selectin were taken. Some
samples were also excluded for further analysis as only one replicate recorded a positive
C
T
, and the other was negative (undetected), or showed primer dimer.
*IL6: 12 ACS versus 7 controls.
†vWF: 17 ACS versus 12 controls.
‡P-selectin: 19 ACS versus 12 controls.
ACS, acute coronary syndrome; vWF, von Willebrand Factor.
Original research
148 Heart Asia 2012:146–150. doi:10.1136/heartasia-2012-010131
as angiogenesis, which is tightly regulated both spatially and
temporally, the mRNA content of some specific genes may be
‘switched off’after translated into functional protein
product.
22
Since IL6 and vWF are involved in proinflammatory
or atherogenesis activities, their mRNA content may be termi-
nated quickly or translated into proteins as a consequence of
excessive immune response.
23
As a result, the mRNA content
will be degraded, and the translated protein product might be
released quickly into blood circulation to be detected as
markers of disease or as mediators of subsequent inflammatory
processes.
There were no significant elevations of P-selectin level in ACS
patients in contrast with previous studies,
14 24
P-selectin was
found to be correlated with IL6 and vWF at mRNA level in
both ACS and control patients. P-selectin may have its
enhanced effects in platelet activation only after being upregu-
lated through exposure to other inflammatory mediators, par-
ticularly CD40 ligand.
25
It is unclear to us whether P-selectin
expression will be upregulated through exposure to IL6 or vWF,
however, the correlation between these markers at mRNA
levels suggested a possible association between processes of
inflammation, endothelial damage and platelet activation—that
inflammation and endothelial dysfunction take precedence over
platelet activation, and the degree of rise could be indicative of
the severity of ACS.
The consistent pattern in P-selectin level in ACS patients
could be due to the uses of serum instead of plasma sample for
measurement. It was reported that the difference in P-selectin
level between diseased and healthy patients was significantly
found only in the plasma sample, as the serum samples may
not truly reflect the in vivo platelet activation activity of
P-selectin.
26
The detection of P-selectin level in serum samples
may be due to excess P-selectin released from activated platelets
or by the process of coagulation and clot formation.
26
Nonetheless, it was reported that although P-selectin levels are
significantly higher in serum compared with plasma, the abso-
lute concentration of P-selectin remain significantly and moder-
ately correlated in both serum and plasma. This suggests that
qualitatively similar results are likely to be obtained, irrespect-
ive of which sample is used to measure P-selectin level.
27
In the present study, all ACS patients were enrolled during
their early phase of hospitalisation. It is therefore believed that
the P-selectin may have a late time frame to be elevated.
24
Experimental evidence suggests that P-selectin is expressed after
interaction between CD40 and CD40 ligand to enhance platelet
activation activity to facilitate plaque destabilisation and
thrombus formation.
26
Moreover, P-selectin levels were asso-
ciated with diabetes
28
and smoking.
8
Although it can be con-
strued that the measurement of circulating P-selectin level may
not be a suitable marker specifically for ACS detection, the
unexpected finding of negative correlation between P-selectin
and smoking could be due to the impact of small sample size
in the present study. Nevertheless, we assume that if an ele-
vated P-selectin level detected during the ACS presentation
could indicate significant systemic platelet activation and/or
delayed presentation of ACS, this may also carry prognostic
value.
The correlation test showed that serum levels of IL6 and
vWF could be used as independent markers to study the patho-
genesis of ACS independent of conventional cardiovascular risk
factors, however, the relevance of this observation needs to be
interpreted carefully as the current study only relied on a single
baseline sample. The exact time frame of peak elevations of IL6
and vWF and their prognostic values to detect ACS are yet to
be evaluated in this study. Hence, prospective studies are
needed to fully evaluate IL6 and vWF as potential mechanisms/
markers of specific detection and poor cardiovascular outcome
in ACS.
Study limitations
One of the main goals of this study was to evaluate the poten-
tial of blood as surrogate marker of risk of ACS, yet evidence
indicates that in vivo expression of IL6 and vWF is found abun-
dantly in atherosclerotic plaque.
29 30
Hence, evaluation of per-
ipheral whole blood gene expression alone may have provided
reports of results with diminished value since the heterogenous
cell population of whole blood may reflect only one aspect of a
complex pathophysiology.
10
In addition, the assessments of coronary stenosis used as
parameters to define controls of this study were evaluated
using conventional visual estimation at our centre. However,
this type of assessment may underestimate or overestimate the
degree of stenosis, and it is difficult to tell whether these coron-
ary plaques are prone to rupture (ie, ‘the vulnerable plaque’). It
is possible that among these controls that are prone to plaque
rupture, they could have an increased level of inflammatory
responses, thus, higher the risk of getting ACS in the future.
This study also involved a relatively small number of patients
which could have compromised the statistical validity of our
results. Nevertheless, to our knowledge, this is the first study
reporting the relationship of inflammation, endothelial dys-
function, and platelet activation markers in early phase of ACS
in a Malaysian population, suggesting the potential use of
these markers as diagnosis tools. The current study did not
involve the clinical outcomes follow-up of patients, thus it
would be interesting to incorporate this consideration into
future study to investigate the prognosis value of IL6 and vWF
as predictor of the risk of adverse cardiac events, particularly in
control patients.
CONCLUSIONS
Our findings suggest that elevated markers of inflammation
and endothelial dysfunction, rather than platelet activation,
puts an individual at a higher risk of developing ACS. Hence,
IL6 and vWF might be useful markers in the early assessment
of the risk of ACS in a young, multiethnic, Malaysia popula-
tion, as well as to target subjects who may benefit from anti-
atherosclerotic or antithrombotic strategies aimed to reduce IL6
and vWF levels. In the future, we may consider large multicen-
tre studies to validate the true relationship between IL6, vWF
and P-selectin, as well as their prognostic value, to detect ACS.
Acknowledgements We thank the teams at the Sarawak General Hospital and
Universiti Malaysia Sarawak for their efforts in providing samples, clinical information
and laboratory supports. We also would like to thank Prof Nathan Wong from
University of California, San Francisco for his review of this manuscript.
Contributors All listed authors are justifiably credited with authorship, according to
the authorship criteria. WNT: conduct experiments, data analysis and interpretation,
drafting of the manuscript; AYYF: study design, patient recruitment, data
interpretation and drafting of manuscript; EUHS: acquisition of data and critical
revision of manuscript; HCC: study design, patient recruitment and acquisition of
data; BCC: study design, patient recruitment and acquisition of data; TKO: study
design and critical revision of manuscript.
Funding This project is supported by National Institutes of Health, Ministry of
Health, Malaysia.
Competing interest None.
Ethics approval Medical research ethics committee of Ministry of Health, Malaysia.
Provenance and peer review Not commissioned; externally peer reviewed.
Original research
Heart Asia 2012:146–150. doi:10.1136/heartasia-2012-010131 149
REFERENCES
1. Wan Ahmad WA, Sim KH. Annual report of the NCVD-ACS registry Malaysia 2006.
National Cardiovascular Disease Database 2006.
2. Granger CB, Goldberg RJ, Dabbous O, et al. Predictors of hospital
mortality in the global registry of acute coronary events. Arch Intern Med
2003;163:2345–53.
3. Lip GYH, Blann AD. Thrombogenesis, atherogenesis and angiogenesis in vascular
disease: a new ’vascular triad. Ann Med 2004;36:119–25.
4. Makin A. Peripheral vascular disease and Virchow’s triad for thrombogenesis.
Q J Med 2002;95:199–210.
5. Panteghini M. Role and importance of biochemical markers in clinical cardiology.
Eur Heart J 2004;25:1187–96.
6. Ridker PM, Rifa N, Stampfer MJ, et al. Plasma concentration of interleukin-6 and
the risk of future myocardial infarction among apparently healthy men. Circulation
2000;101:1767–72.
7. Montalescot G, Collet JP, Choussat R, et al. Arise of troponin and/or von
Willebrand factor over the first 48 h is associated with a poorer 1-year outcome in
unstable angina patients. Int J Cardiol 2000;72:293–4.
8. Ridker PM, Buring JE, Rifai N. Soluble P-selectin and the risk of future
cardiovascular events. Circulation 2001;103:491–5.
9. Eriksson EE, Xie X, Werr J, et al. Direct viewing of atherosclerosis in vivo: plaque
invasion by leukocytes is initiated by the endothelial selectin. FASEB J
2001;15:1149–57.
10. Wingrove JA, Daniels SE, Sehnert AJ, et al. Correlation of peripheral blood gene
expression with the extent of coronary artery stenosis. Circ Cardiovasc Genet
2008;1:31–8.
11. Wang XW, Seed B. A PCR primer bank for quantitative gene expression analysis.
Nucleic Acids Res 2003;31:e154.
12. Cui W, Taub DD, Gardner K. qPrimerDepot: a primer database for quantitative real
time PCR. Nucleic Acids Res 2007;35:D805–9.
13. Lee KW, Blann AD, Lip GY. Inter-relationships of indices of endothelial damage/
dysfunction (circulating endothelial cells, von Willebrand factor and flow-mediated
dilatation) to tissue factor and interleukin-6 in acute coronary syndromes. Int J
Cardiol 2006;111:302–8.
14. Zhang SZ, Jin YP, Qin GM, et al. Association of platelet-monocyte aggregates with
platelet activation, systemic inflammation, and myocardial injury in patients with
non-st elevation acute coronary syndromes. Clin Cardiol 2007;30:26–31.
15. Toss H, Lindahl B, Siegbahn A, et al. Prognostic influence of increased
fibrinogen and C-reactive protein levels in unstable coronary artery disease: FRISC
study group (fragmin during instability in coronary artery disease). Circulation
1997;96:4204–10.
16. Correale M, Brunnetti ND, De Gennaro L, et al. Acute phase proteins in
atherosclerosis (acute coronary syndrome). Cardiovasc Hematol Agents Med Chem
2008;6:272–7.
17. Koukkunen H, Penttilä K, Kemppainen A, et al. C-reactive protein, fibrinogen,
interleukin-6 and tumour necrosis factor-alpha in the prognostic classification of
unstable angina pectoris. Ann Med 2001;33:37–47.
18. Hoshiba Y, Hatakeyama K, Tanabe T, et al. Co-localization of von Willebrand factor
with platelet thrombi, tissue factor and platelets with fibrin, and consistent presence
of inflammatory cells in coronary thrombi obtained by an aspiration device from
patients with acute myocardial infarction. J Thromb Haemost 2006;4:114–20.
19. Koprivica Z, Djordjevic D, Vuletic M, et al. Von Willebrand factor and oxidative stress
parameters in acute coronary syndromes. Oxid Med Cell Longev 2011;2011:918312.
20. Fannin RD, Auman JT, Bruno ME, et al. Differential gene expression profiling in
whole blood during acute systemic inflammation in lipopolysaccharide-treated rats.
Physiol Genomics 2005;21:92–104.
21. Guo Y, Xiao P, Lei S, et al. How is mRNA expression predictive for protein
expression? A correlation study on human circulating monocytes. Acta Biochim
Biophys Sin (Shanghai) 2008;40:426–36.
22. Williams JL, Weichert A, Zakrzewicz A, et al. Differential gene and protein
expression in abluminal sprouting and intraluminal splitting forms of angiogenesis.
Clin Sci (Lond) 2006;110:587–95.
23. Sluimer JC, Kisters N, Cleutjens KB, et al. Dead or alive: gene expression profiles
of advanced atherosclerotic plaques from autopsy and surgery. Physiol Genomics
2007;30:335–41.
24. Liu WH, Yang CH, Yeh KH, et al. Circulating levels of soluble P-selectin in patients
in the early and recent phases of myocardial infarction. Chang Gung Med J
2005;28:613–20.
25. Inwald DP, McDowall A, Peters MJ, et al. CD40 is constitutively expressed on
platelets and provides a novel mechanism for platelet activation. Circ Res
2003;92:1041–8.
26. Caine GJ, Blann AD. Soluble p-selectin should be measured in citrated plasma, not
in serum. Br J Haematol 2003;121:530–2.
27. Thom J, Gilmore G, Yi Q, et al. Measurement of soluble P-selectin and soluble
CD40 ligand in serum and plasma. J Thromb Haemost 2004;2:2067–9.
28. Nomura S, Kanazawa S, Fukuhara S. Effects of efonidipine on platelet and
monocyte activation markers in hypertensive patients with and without type 2
diabetes mellitus. J Hum Hypertens 2002;16:1345–9.
29. Rus HG, Vlaicu R, Niculescu F. Interleukin-6 and interleukin-8 protein and gene
expression in human arterial atherosclerotic wall. Atherosclerosis 1996;127:263–71.
30. Methia N, André P, Denis CV, et al. Localized reduction of atherosclerosis in von
Willebrand factor-deficient mice. Blood 2001;98:1424–8.
Original research
150 Heart Asia 2012:146–150. doi:10.1136/heartasia-2012-010131
