Copy number variation in sulfotransferase isoform 1A1 (SULT1A1) is significantly associated with enzymatic activity in Japanese subjects

Article (PDF Available)inPharmacogenomics and Personalized Medicine 6(1):19-24 · March 2013with73 Reads
DOI: 10.2147/PGPM.S36579 · Source: PubMed
Abstract
Sulfotransferase isoform 1A1 (SULT1A1) plays a key role in the metabolism of a variety of endo- and xenobiotics and it's activity could influence response to drugs. Our previous studies have focused on the impact of genetic variants of SULT1A1 on enzymatic activity in Caucasians and African-Americans. However, the contribution of genetic variants to SULT1A1 activity in Asians has not been explored. In this study, we investigated the collective effects of both SULT1A1 copy number variants (CNVs) and single nucleotide polymorphisms (SNPs) in the promoter region, coding region, and 3' untranslated region on SULT1A1 activity in Japanese subjects. SNPs in the SULT1A1 promoter and 3' untranslated region were not associated with SULT1A1 activity (P > 0.05). SULT1A1*1/2 (Arg213His) was marginally associated with SULT1A1 activity (P = 0.037). However, SULT1A1 CNVs were strongly associated with SULT1A1 activity (trend test P = 0.008) and accounted for 10% of the observed variability in activity for Japanese subjects. In conclusion, SULT1A1 CNVs play a pivotal role in determination of SULT1A1 activity in Japanese subjects, highlighting the influence of ethnic differences in SULT1A1 genetic variants on drug metabolism and therapeutic efficacy.
© 2013 Yu et al, publisher and licensee Dove Medical Press Ltd. This is an Open Access article
which permits unrestricted noncommercial use, provided the original work is properly cited.
Pharmacogenomics and Personalized Medicine 2013:6 19–24
Pharmacogenomics and Personalized Medicine
Copy number variation in sulfotransferase
isoform 1A1 (SULT1A1) is signicantly associated
with enzymatic activity in Japanese subjects
Xinfeng Yu
1
Takahiro Kubota
2
Ishwori Dhakal
1
Setsuo Hasegawa
3
Suzanne Williams
1
Shogo Ozawa
4
Susan Kadlubar
1
1
Division of Medical Genetics, College
of Medicine, University of Arkansas
for Medical Sciences, Little Rock,
Arkansas, USA;
2
Chiba Institute of
Science, Chiba, Japan;
3
Sekino Clinical
Pharmacology Clinic, Tokyo, Japan;
4
Iwate Medical University, Iwate, Japan
Correspondence: Susan Kadlubar
University of Arkansas for Medical
Sciences. 4301 W Markham, #580,
Little Rock, AR, USA 72205
Tel +1 501 526 7957
Fax +1 501 686 6639
Email sakadlubar@uams.edu
Abstract: Sulfotransferase isoform 1A1 (SULT1A1) plays a key role in the metabolism of a
variety of endo- and xenobiotics and it’s activity could influence response to drugs. Our previous
studies have focused on the impact of genetic variants of SULT1A1 on enzymatic activity in
Caucasians and African-Americans. However, the contribution of genetic variants to SULT1A1
activity in Asians has not been explored. In this study, we investigated the collective effects of
both SULT1A1 copy number variants (CNVs) and single nucleotide polymorphisms (SNPs)
in the promoter region, coding region, and 3 untranslated region on SULT1A1 activity in
Japanese subjects. SNPs in the SULT1A1 promoter and 3 untranslated region were not associ-
ated with SULT1A1 activity (P . 0.05). SULT1A1*1/2 (Arg213His) was marginally associated
with SULT1A1 activity (P = 0.037). However, SULT1A1 CNVs were strongly associated with
SULT1A1 activity (trend test P = 0.008) and accounted for 10% of the observed variability in
activity for Japanese subjects. In conclusion, SULT1A1 CNVs play a pivotal role in determina-
tion of SULT1A1 activity in Japanese subjects, highlighting the influence of ethnic differences
in SULT1A1 genetic variants on drug metabolism and therapeutic efficacy.
Keywords: CNV, genotype, phenotype, SULT1A1, single nucleotide polymorphisms
Introduction
Sulfotransferase isoform 1A1 (SULT1A1) belongs to a family of phase II detoxification
enzymes that catalyze the transfer of the sulfonyl group from 3-phosphoadenosine
5-phosphosulfate to a variety of endogenous molecules (hormones, neurotransmit-
ters, etc) and xenobiotics.
1
Sulfation generally enhances the solubility and subsequent
excretion of substrates, but it can also catalyze the bio-activation of various carcinogens
and mutagens.
2,3
The growing field of pharmacogenomics seeks to predict both effi-
cacy and toxicity of therapeutic agents, many of which are substrates for SULT1A1.
SULT1A1 metabolizes many drugs, including tamoxifen,
4
fulvestrant,
5
and toremefine,
6
which are used for adjuvant hormonal therapy in breast cancer. Given the central role
that SULT1A1 plays in drug metabolism and carcinogenesis, elucidation of the genetic
determinants of SULT1A1 activity is essential in assessing the therapeutic efficacy of
drugs and estimating cancer risk.
Abnormal expression and/or enzymatic function of SULT1A1 resulting from natu-
rally occurring genetic changes, such as single nucleotide polymorphisms (SNPs) and
copy number variants (CNVs), may influence drug metabolism. A common SNP in
the coding region of SULT1A1 (638 G . A, SULT1A1*1/SULT1A1*2) is associated
with decreased platelet enzymatic activity and thermostability.
7,8
This SNP has been
investigated in relation to risk of cancer in various organs and tissues in different ethnic
Dovepress
submit your manuscript | www.dovepress.com
Dovepress
19
ORIGINAL RESEARCH
open access to scientific and medical research
Open Access Full Text Article
http://dx.doi.org/10.2147/PGPM.S36579
Number of times this article has been viewed
This article was published in the following Dove Press journal:
Pharmacogenomics and Personalized Medicine
5 March 2013
Pharmacogenomics and Personalized Medicine 2013:6
groups, with conflicting results in some instances.
9
The 638
G . A SNP has been associated with risk of lung cancer,
10
colorectal cancer,
11,12
urothelial cancer,
13
prostate cancer,
14
and breast cancer
15,16
in relation to smoking status and intake
of meat that is cooked well done. SULT1A1 638 G . A has
also been reported to influence overall survival in tamoxifen-
treated women.
17,18
Ning et al
19
described four common (-624
G . C, -396 A . G, -341 C . G, and -294 T . C) and one
rare SNPs (-358 A . C) in the proximal promoter region
and found that allele frequencies varied between Caucasians,
African-Americans, and Chinese subjects. These SNPs were
associated with platelet SULT1A1 enzymatic activity in
Caucasians and African-Americans, but platelets for activ-
ity analyses were not available for the Chinese population.
Thus, the association of the promoter SNPs with SULT1A1
activity in individuals of Asian descent was not explored.
We have recently reported that 902 A . G and 973 C . T
in the 3 untranslated region (3-UTR) and 1307 G . A in
the 3 flanking region play an important role in determination
of SULT1A1 activity in Caucasians and African-Americans.
These SNPs, in combination with SULT1A1 CNVs, account
for 21% of variability of activity observed in Caucasians.
20
In this study, DNA from 97 Japanese subjects was
screened for SULT1A1 638 G . A, promoter SNPs, 3-UTR,
and CNVs. Platelets were also obtained and enzymatic activ-
ity determined, and genotype–phenotype relationships were
examined. There was a significant ethnic difference in the
influence of genetic variants on SULT1A1 activity, with
copy number variation exhibiting the strongest influence.
Hence, pharmacogenomic studies of SULT1A1 substrates
should include SULT1A1 CNVs, particularly in Japanese
populations.
Materials, subjects, and methods
Materials
Histopaque
®
-1119 and -1077, 4-nitrophenyl sulfate, and
2-naphthol were obtained from Sigma-Aldrich (St Louis,
MO, USA). The 3-phosphoadenosine 5-phosphosulfate was
obtained from the University of Dayton Chemistry Depart-
ment (Dayton, OH, USA). Sequencing and polymerase chain
reaction (PCR) primers were purchased from Invitrogen
(Grant Island, NY, USA). All other chemicals used were of
reagent grade and obtained from Fisher Scientific (Houston,
TX, USA).
Study subjects
Whole blood specimens (10 mL) were obtained from 101
healthy Japanese subjects recruited at the Chiba Institute
of Science. The specimens were drawn using Vacutainer™
tubes (Becton Dickinson, Franklin Lakes, NJ, USA and Fisher
Scientific) containing ascorbate, citrate, and dextrose to pre-
vent platelet aggregation. Of the 101 specimens obtained,
97 were evaluable for SULT1A1 genotype–phenotype
analysis. There were 55 female and 42 male subjects (age
range 22–70 years old, mean 36.4 years). The Institutional
Review Board at Chiba Institute of Science approved these
study protocols (Ethics Committee approval No 22-8).
Preparation of platelet cytosols
and sulfotransferase activity assay
Immediately after collection, the whole blood samples were
layered on a discontinuous gradient of Histopaque-1077 and
Histopaque-1119, using a modification of the manufacturer’s
protocol,
8,21
then individual components were separated by
differential centrifugation. After separation, platelets were
suspended in buffer, membranes were disrupted by sonication,
and the cell homogenate was subjected to ultracentrifugation
at 100,000 g for 1 hour. Sulfotransferase activity was deter-
mined using a simple colorimetric procedure as described by
Mulder et al
22
with the modifications made by Frame et al.
21
Activity was reported as nmol/min/mg protein.
DNA extraction and genotyping
DNA was extracted from lymphocytes isolated from the
blood sample provided by the study participants using Qiagen
extraction kits according to the manufacturer’s instructions
(Valencia, CA, USA). Genotyping for SULT1A1*1/2, pro-
moter SNPs, and 3-UTR SNPs was performed as previously
described.
8,19
Copy number variation assay
SULT1A1 copy number was determined by real-time PCR in
an ABI PRISM Sequence Detection System 7900 Instrument
(Applied Biosystems, Foster City, CA, USA) using TaqMan
Gene Expression Absolute Quantification Assay (Applied
Biosystems, Foster City, CA, USA). The method has been
described by Yu et al.
20
Distal promoter SNP
identication and genotyping
The human SULT1A1 genomic sequence (GenBank
®
accession no U52852) was used to design three pairs of
primers (P1, P2, and P3) to produce overlapping ampli-
cons spanning from -165 to -2513 bp for distal promoter
mutation screening. After mutation screening, two common
SNPs, -1975 G . C and -1135 G . A, were identified and
submit your manuscript | www.dovepress.com
Dovepress
Dovepress
20
Yu et al
Pharmacogenomics and Personalized Medicine 2013:6
a new pair of primers (P4) was designed for sequencing
of -1975 G . C. The sequencing primer of P1 was used
to identify -1135 G . A. Primer sequences are shown in
Table 1. PCR was performed using JumpStart RED Taq-
Reaction Mix (Sigma-Aldrich) 5 µL in a total volume of
10 µL containing 3 ng genomic DNA and 0.5 µM each of
primers. PCR was amplified under the following thermal
cycling conditions: after initial denaturation at 95°C for
4 minutes, the samples were subjected to 35 cycles of 94°C
for 50 seconds, 64°C for 50 seconds, and 72°C for 1 minute,
followed by a final extension step of 10 minutes at 72°C.
Genotype was determined by direct sequencing using a
CEQDTCS-Quick Start Sequencing Kit and analyzed
on a CEQ 8800 Genetic Analysis System (both Beckman
Coulter, Brea, CA, USA).
Statistical analysis
Before data analysis, SNP data were examined for possible
genotyping errors by assessing deviation from the Hardy–
Weinberg equilibrium. Association of SULT1A1 activity
with demographic (age and sex) and genetic (SNPs and
copy number) variables was examined using analysis of
variance with SAS software (v 9.2; SAS institute, Cary,
NC, USA). The independent effects of functional SNPs
and copy number were further assessed in analysis of
variance and regression models adjusting for age and sex.
Individual and collective effects of SNPs and copy number
on SULT1A1 activity were assessed from partial sum square,
R
2
, β-coefficient, and P value. In the regression model, the
638 G . A homozygous variant genotype was combined
with heterozygous variant genotype due to small sample
size and the combined group was treated as a referent. In
addition, copy numbers $ 4 were combined in one category
in the analysis. Statistical significance was set at P , 0.05
(two-sided) and all the statistical analyses were performed
using SAS software.
Results
Mutation screening and allele frequency
We screened SNPs in the distal promoter of SULT1A1 in 101
Japanese subjects and identified two common SNPs, -1975
G . C and -1135 G . A (the numbering of bases was desig-
nated relative to translation start site). We further character-
ized four common SNPs, -624 G . C, -396 A . G, -341
C . G, and -294 T . C, in the proximal promoter. Allele
frequencies for -341 C . G were 0.5%, so we excluded
this rare SNP from further analysis. We then genotyped for
902 A . G and 973 C . T in the 3-UTR, 1307 G . A in the
3 flanking region, and SULT1A1*1/2 in the coding region.
The variant allele frequencies are shown in Table 2.
Association of SULT1A1 SNPs in the
promoter, 3-UTR, and SULT1A1*1/2
with platelet SULT1A1 enzymatic activity
To investigate whether SULT1A13-UTR SNPs can influ-
ence platelet SULT1A1 enzymatic activity in Japanese
subjects, we examined the association of individual SNPs
with SULT1A1 activity. In this population, 902 A . G, 973
C . T, and 1307 G . A were not associated with SULT1A1
activity (P . 0.05, Table 2). Similarly, neither the SNPs in
the proximal promoter (-624 G . C, -396 A . G, and -294
T . C) nor SNPs in the distal promoter (-1975 G . C
and -1135 G . A) were associated with SULT1A1 activity
(P . 0.05, Table 2). However, SULT1A1*1/2 was margin-
ally associated with SULT1A1 activity in Japanese subjects
(P = 0.037). The SULT1A1 activity in the AA/AG group was
lower than that in the GG group (Figure 1). In addition, there
was no significant difference in platelet SULT1A1 enzymatic
activity by sex or age in this population.
Table 1 Primers for genotyping single nucleotide polymorphisms
in the distal promoter of sulfotransferase isoform 1A1
Amplication primer
Sequence (5-3)
Orientation
P1 cagtcgtggctttggagatc Forward*
gtcgggctctaatgcggtg Reverse
P2 atgttgtgtctggttggtcg Forward*
gtgtgtgggcagagtgaag Reverse
P3 ctgtggagcctccttcaaac Forward*
acctgagctcttgggaacct Reverse
P4 tgggtccgacaggttgttac Forward*
ggaggctccacagacaagag
Reverse
Note: *Forward primers were used for sequencing.
Table 2 Univariate analysis of demographic and genetic factors
in relation to platelet sulfotransferase isoform 1A1 activity (nmol/
min/mg protein) among Japanese subjects
Variable rs number Allele frequency P
Age NA NA 0.22
Sex NA NA 0.54
-1975 G . C
rs9922110 0.366 0.22
-1135 G . A
rs2077412 0.381 0.87
-624 G . C
rs3760091 0.376 0.20
-396 A . G
rs750155 0.366 0.71
-294 T . C
rs4149382 0.490 0.56
902 A . G
rs6839 0.114 0.06
973 C . T
rs1042157 0.173 0.35
1307 G . A
rs4788068 0.198 0.75
638 G . A
rs9282861 0.109 0.037
Copy number NA NA 0.0009
Note: p values in bold were signicantly different compared to Caucasians.
Abbreviation: NA, not applicable.
submit your manuscript | www.dovepress.com
Dovepress
Dovepress
21
SULT1A1 copy number variation and SNPs in Japanese subjects
Pharmacogenomics and Personalized Medicine 2013:6
Discussion
Genetic variation in SULT1A1 is associated with functional
effects on enzymatic activity, thermal stability, cellular
phenotype, and protein degradation.
7,23,24
Associations
of genotype with phenotype have only been reported for
Caucasian and African-American populations, with the
magnitude of effect varying by ethnicity.
8
For this reason,
we sought to determine the impact of these genetic variants
on enzymatic activity in an Asian population. We genotyped
two SNPs in the SULT1A1 distal promoter, four SNPs in the
proximal promoter, two SNPs in the 3-UTR, one SNP in the
3 flanking region, and SULT1A1*1/2 in the coding region.
The correlation of SNPs, as well as copy number variation,
with variation of SULT1A1 platelet enzymatic activity in
Japanese subjects was investigated.
SULT1A1*1/2 has been reported to have frequencies of
0.332, 0.294, and 0.080 in Caucasian, African-American, and
1
0
GG (n = 78)
AA/AG (n = 19)
P = 0.037
−1
−2
−3
AA/AGGG
638 G > A
Log (platelet SULT1A1 activity (nmol/min/mg protein))
Figure 1 Box plot analysis of the association of SULT1A1*1/2 (G638A) with platelet
SULT1A1 activity in Japanese subjects.
Notes: The plus sign and line inside each box indicate mean and median and the
upper and lower limits of the box are the seventy-fth and twenty-fth percentiles,
respectively. The vertical bars above and below show the maximum and minimum
values, respectively. The solid circles outside the box are outlier values. Activity is
presented in log scale. p values are shown for the genotypes whose differences in
mean level of activity were statistically signicant.
Abbreviation: SULT1A1, sulfotransferase isoform 1A1.
1
0
3 (n = 25)
2 (n = 63)
P
trend
= 0.008
−1
−2
−3
4 or more32
Copy number
Log (platelet SULT1A1 activity (nmol/min/mg protein))
4 or more (n = 9)
Figure 2 Box plot analysis of the association of SULT1A1 copy number variant with
platelet SULT1A1 activity in Japanese subjects (n = 97).
Notes: Platelet SULT1A1 activity was determined by colorimetrical methods
described in the “Materials, subjects, and methods” section and is shown in log
scale. The p
trend
test was performed for the three groups with different copies of
the SULT1A1 gene. The plus sign and line inside each box indicate mean and median
and the upper and lower limits of the box are the seventy-fth and twenty-fth
percentiles, respectively. The vertical bars above and below show the maximum and
minimum values, respectively. The solid circles outside the box are outlier values.
Activity is presented in log scale. P values are shown for the genotypes whose
differences in mean level of activity were statistically signicant.
Abbreviation: SULT1A1, sulfotransferase isoform 1A1.
Copy number variation markedly
inuences SULT1A1 activity
in Japanese subjects
In the 97 Japanese subjects with genotype and phenotype data
available, the frequency distribution of SULT1A1 CNVs 2, 3,
and $4 was 65.0%, 25.8%, and 9.2%, respectively. Notably,
SULT1A1 CNVs were significantly associated with platelet
SULT1A1 activity (trend test P = 0.008, Figure 2). Univariate
analysis indicated that CNVs and the SULT1A1*1 SNP were
the only genetic variants tested that were significantly asso-
ciated with activity in the Japanese population (P = 0.0009
and 0.037, respectively, Table 2). Pair-wise comparison indi-
cated that SULT1A1 activity is higher in subjects carrying
higher copy numbers (3 or $4) than those with two copies
of SULT1A1 (P = 0.005 and P = 0.025, respectively). Copy
number variation accounted for 10% of the observed variation
in SULT1A1 activity in Japanese subjects (Table 3).
submit your manuscript | www.dovepress.com
Dovepress
Dovepress
22
Yu et al
Pharmacogenomics and Personalized Medicine 2013:6
Han Chinese subjects, respectively.
25
In this study, the allele
frequency for SULT1A1*1/2 in Japanese subjects was 0.109,
which is consistent with previous reports.
13,26,27
Further,
genotype–phenotype analysis indicated that SULT1A1*1/2
was only marginally associated with SULT1A1 activity in
Japanese subjects, accounting for only 4% of the observed
inter-individual variability.
While promoter SNPs have been demonstrated to be sig-
nificantly associated with enzymatic activity in Caucasians
and African-Americans,
19
we found no significant associa-
tions in Japanese subjects. We further identified two common
SNPs in the distal promoter; similarly, these SNPs were not
associated with platelet SULT1A1 activity.
We have reported that 3-UTR SNPs play a central role
in the regulation of SULT1A1 activity in both Caucasians
and African-Americans and, combined with CNV, they
account for the largest percentage of variability in enzymatic
activity.
20
In this study, the allele frequencies of SNPs in the
3-UTR were substantially lower than the allele frequencies
in Caucasians and African-Americans and no influence on
enzymatic activity was evident. Since the allele frequencies
were low in Japanese subjects, it is possible that a larger study
population could identify significant associations.
SULT1A1 CNVs also display ethnic differences, with
5% of Caucasian subjects possessing a single copy of the
gene, 61% with two copies, and 26% with three or more
copies, while 63% of African-American subjects had
three or more copies.
28
This study further documented
that the variability in the level of the SULT1A1 enzyme
in platelet and liver samples was best explained by gene
copy-number differences. In the present study, 65% of the
Japanese subjects had two copies of SULT1A1, which was
similar to the distribution in Caucasians. Of all the genetic
variants examined in the study, copy number variation has
the greatest impact on SULT1A1 enzymatic activity in
Japanese people, accounting for 10% of the observed inter-
individual variability. Although the effects of copy number
variation are statistically significant, the overall impact is
small, leading to the speculation that environmental influ-
ences could be the greatest determinant of variability in
SULT1A1 activity. Indeed, some dietary chemicals and
environmental phenolic contaminants have been shown
to be potent inhibitors of SULT1A1.
29,30
Thus, studies of
gene–environment interactions in determining SULT1A1
activity warrant further study in all ethnicities.
Conclusion
We found that SULT1A1 CNVs and, to a lesser extent,
SULT1A1*1/2, were significantly associated with the
SULT1A1 phenotype, while other genetic variants were not.
The small magnitude of the contribution of these variants to
inter-individual differences in phenotype in Japanese people
indicates that results of pharmacogenomic and molecular
epidemiological studies involving SULT1A1 genetic variants
should be interpreted with caution. Studies of other genetic,
epigenetic, and environmental influences on SULT1A1 activ-
ity are required to fully understand inter-individual variability
in this important enzyme.
Acknowledgments
This work was supported by the National Cancer Institute
(grant number R01CA128897) and Susan G Komen for the
Cure (grant number BCTR0707584). TK was supported by
a Grant-in-Aid for Scientific Research (C:20590156) from
the Japan Society for the Promotion of Science.
Disclosure
The authors declare no conflicts of interest in this work.
References
1. Jakoby WB, Ziegler DM. The enzymes of detoxication. J Biol Chem.
1990;265(34):20715–20718.
2. DeBaun JR, Miller EC, Miller JA. N-hydroxy-2-acetylaminofluorene
sulfotransferase: its probable role in carcinogenesis and in protein-
(methion-S-yl) binding in rat liver. Cancer Res. 1970;30(3):577–595.
3. Falany CN. Sulfation and sulfotransferases. Introduction: changing
view of sulfation and the cytosolic sulfotransferases. FASEB J. 1997;
11(1):1–2.
4. Nishiyama T, Ogura K, Nakano H, et al. Reverse geometrical selectivity
in glucuronidation and sulfation of cis- and trans-4-hydroxytamoxifens
by human liver UDP-glucuronosyltransferases and sulfotransferases.
Biochem Pharmacol. 2002;63(10):1817–1830.
Table 3 Results of multivariate analysis of variance and linear
regression of platelet sulfotransferase isoform 1A1 (SULT1A1)
activity (nmol/min/mg protein) with genetic predictors among
Japanese subjects
a
Variable n (%) Partial
sum of
square
Partial
R
2
β coefcient
b
P
638 G . A (rs9282861)
GG
AA/AG
78 (80.4)
19 (19.6)
1.19
0.04
1.21
1.00
c
0.17
Copy number
2
3
$4
63 (65)
25 (25.8)
9 (9.2)
3.07
0.10
0.64
0.91
1.00
c
0.02
0.65
Total model SS 29.76
Notes:
a
Models with natural log of SULT1A1 activity as dependent variable and
adjusted for demographics;
b
coefcient transformed back to original scale;
c
reference
category. Bold text indicates the signicance of the association with phenotype.
Abbreviation: SS, sum of square.
submit your manuscript | www.dovepress.com
Dovepress
Dovepress
23
SULT1A1 copy number variation and SNPs in Japanese subjects
Pharmacogenomics and Personalized Medicine
Publish your work in this journal
Submit your manuscript here: http://www.dovepress.com/pharmacogenomics-and-personalized-medicine-journal
Pharmacogenomics and Personalized Medicine is an international, peer-
reviewed, open access journal characterizing the influence of genotype
on pharmacology leading to the development of personalized treatment
programs and individualized drug selection for improved safety, efficacy
and sustainability. This journal is indexed on the American Chemical
Society’s Chemical Abstracts Service (CAS). The manuscript manage-
ment system is completely online and includes a very quick and fair
peer-review system, which is all easy to use. Visit http://www.dovepress.
com/testimonials.php to read real quotes from published authors.
Pharmacogenomics and Personalized Medicine 2013:6
5. Edavana VK, Yu X, Dhakal IB, et al. Sulfation of fulvestrant by
human liver cytosols and recombinant SULT1A1 and SULT1E1.
Pharmacogenomics Pers Med. 2011;4:137–145.
6. Edavana VK, Dhakal IB, Yu X, Williams S, Kadlubar S. Sulfation of
4-hydroxy toremifene: individual variability, isoform specificity, and
contribution to toremifene pharmacogenomics. Drug Metab Dispos.
2012;40(6):1210–1215.
7. Raftogianis RB, Wood TC, Otter ness DM, Van Loon JA,
Weinshilboum RM. Phenol sulfotransferase pharmacogenetics in
humans: association of common SULT1A1 alleles with TS PST
phenotype. Biochem Biophys Res Commun. 1997;239(1):298–304.
8. Nowell S, Ambrosone CB, Ozawa S, et al. Relationship of phenol sulfo-
transferase activity (SULT1A1) genotype to sulfotransferase phenotype
in platelet cytosol. Pharmacogenetics. Dec 2000;10(9):789–797.
9. Kotnis A, Kannan S, Sarin R, Mulherkar R. Case-control study and
meta-analysis of SULT1A1 Arg213His polymorphism for gene,
ethnicity and environment interaction for cancer risk. Br J Cancer.
2008;99(8):1340–1347.
10. Liang G, Miao X, Zhou Y, Tan W, Lin D. A functional polymorphism
in the SULT1A1 gene (G638A) is associated with risk of lung cancer in
relation to tobacco smoking. Carcinogenesis. 2004;25(5):773–778.
11. Bamber DE, Fryer AA, Strange RC, et al. Phenol sulphotransferase
SULT1A1*1 genotype is associated with reduced risk of colorectal
cancer. Pharmacogenetics. 2001;11(8):679–685.
12. Tiemersma EW, Bunschoten A, Kok FJ, Glatt H, de Boer SY,
Kampman E. Effect of SULT1A1 and NAT2 genetic polymorphism
on the association between cigarette smoking and colorectal adenomas.
Int J Cancer. 2004;108(1):97–103.
13. Ozawa S, Katoh T, Inatomi H, et al. Association of genotypes of
carcinogen-activating enzymes, phenol sulfotransferase SULT1A1
(ST1A3) and arylamine N-acetyltransferase NAT2, with urothelial
cancer in a Japanese population. Int J Cancer. 2002;102(4):418–421.
14. Nowell S, Ratnasinghe DL, Ambrosone CB, et al. Association of
SULT1A1 phenotype and genotype with prostate cancer risk in
African-Americans and Caucasians. Cancer Epidemiol Biomarkers
Prev. 2004;13(2):270–276.
15. Tang D, Rundle A, Mooney L, et al. Sulfotransferase 1A1 (SULT1A1)
polymorphism, PAH-DNA adduct levels in breast tissue and breast
cancer risk in a case-control study. Breast Cancer Res Treat. 2003;78(2):
217–222.
16. Zheng W, Xie D, Cerhan JR, Sellers TA, Wen W, Folsom AR.
Sulfotransferase 1A1 polymorphism, endogenous estrogen exposure,
well-done meat intake, and breast cancer risk. Cancer Epidemiol
Biomarkers Prev. 2001;10(2):89–94.
17. Nowell S, Sweeney C, Winters M, et al. Association between sulfotrans-
ferase 1A1 genotype and survival of breast cancer patients receiving
tamoxifen therapy. J Natl Cancer Inst. 2002;94(21):1635–1640.
18. Nowell SA, Ahn J, Rae JM, et al. Association of genetic variation
in tamoxifen-metabolizing enzymes with overall survival and recur-
rence of disease in breast cancer patients. Breast Cancer Res Treat.
2005;91(3):249–258.
19. Ning B, Nowell S, Sweeney C, et al. Common genetic polymorphisms
in the 5-flanking region of the SULT1A1 gene: haplotypes and their
association with platelet enzymatic activity. Pharmacogenet Genomics.
2005;15(7):465–473.
20. Yu X, Dhakal IB, Beggs M, et al. Functional genetic variants in the
3-untranslated region of sulfotransferase isoform 1A1 (SULT1A1) and
their effect on enzymatic activity. Toxicol Sci. 2010;118(2):391–403.
21. Frame LT, Ozawa S, Nowell SA, et al. A simple colorimetric assay
for phenotyping the major human thermostable phenol sulfotrans-
ferase (SULT1A1) using platelet cytosols. Drug Metab Dispos.
2000;28(9):1063–1068.
22. Mulder GJ, Hinson JA, Gillette JR. Generation of reactive metabolites
of N-hydroxy-phenacetin by glucoronidation and sulfation. Biochem
Pharmacol. 1977;26(3):189–196.
23. Jones AL, Hagen M, Coughtrie MW, Roberts RC, Glatt H. Human platelet
phenolsulfotransferases: cDNA cloning, stable expression in V79 cells
and identification of a novel allelic variant of the phenol-sulfating form.
Biochem Biophys Res Commun. 1995;208(2):855–862.
24. Nagar S, Walther S, Blanchard RL. Sulfotransferase (SULT) 1A1 poly-
morphic variants *1, *2, and *3 are associated with altered enzymatic
activity, cellular phenotype, and protein degradation. Mol Pharmacol.
2006;69(6):2084–2092.
25. Carlini EJ, Raftogianis RB, Wood TC, et al. Sulfation pharmacogenetics:
SULT1A1 and SULT1A2 allele frequencies in Caucasian, Chinese and
African-American subjects. Pharmacogenetics. 2001;11(1):57–68.
26. Ohtake E, Kakihara F, Matsumoto N, et al. Frequency distribution
of phenol sulfotransferase 1A1 activity in platelet cells from healthy
Japanese subjects. Eur J Pharm Sci. 2006;28(4):272–277.
27. Ozawa S, Shimizu M, Katoh T, et al. Sulfating-activity and stability
of cDNA-expressed allozymes of human phenol sulfotransferase,
ST1A3*1 ((213)Arg) and ST1A3*2 ((213)His), both of which exist in
Japanese as well as Caucasians. J Biochem. 1999;126(2):271–277.
28. Hebbring SJ, Adjei AA, Baer JL, et al. Human SULT1A1 gene: copy
number differences and functional implications. Hum Mol Genet.
2007;16(5):463–470.
29. Coughtrie MW, Johnston LE. Interactions between dietary chemicals
and human sulfotransferases-molecular mechanisms and clinical
significance. Drug Metab Dispos. 2001;29(4 Pt 2):522–528.
30. Waring RH, Ayers S, Gescher AJ, et al. Phytoestrogens and
xenoestrogens: the contribution of diet and environment to endocrine
disruption. J Steroid Biochem Mol Biol. 2008;108(3–5):213–220.
submit your manuscript | www.dovepress.com
Dovepress
Dovepress
Dovepress
24
Yu et al
    • "Although humans lack a direct ortholog of Sult3a1, the human sulfotransferase with the closest amino acid similarity is a phenol sulfotransferase called SULT1A1 (Brix et al. 1999; Gamage et al. 2006). Humans contain between one and five copies of SULT1A1 (Gaedigk et al. 2012; Hebbring et al. 2007; Yu et al. 2013) and our results suggest that copy number variation could be associated with the variation in benzene induced toxicity in humans. "
    [Show abstract] [Hide abstract] ABSTRACT: Background: Inhalation of benzene at levels below the current exposure limit values leads to hematotoxicity in occupationally exposed workers. objective: We sought to evaluate Diversity Outbred (DO) mice as a tool for exposure threshold assessment and to identify genetic factors that infuence benzene-induced genotoxicity. Methods: We exposed male DO mice to benzene (0, 1, 10, or 100 ppm; 75 mice/exposure group) via inhalation for 28 days (6 hr/day for 5 days/week). Te study was repeated using two independent cohorts of 300 animals each. We measured micronuclei frequency in reticulocytes from peripheral blood and bone marrow and applied benchmark concentration modeling to estimate exposure thresholds. We genotyped the mice and performed linkage analysis. Results: We observed a dose-dependent increase in benzene-induced chromosomal damage and estimated a benchmark concentration limit of 0.205 ppm benzene using DO mice. Tis estimate is an order of magnitude below the value estimated using B6C3F1 mice. We identifed a locus on Chr 10 (31.87 Mb) that contained a pair of overexpressed sulfotransferases that were inversely correlated with genotoxicity. Conclusions: The genetically diverse DO mice provided a reproducible response to benzene exposure. Te DO mice display interindividual variation in toxicity response and, as such, may more accurately refect the range of response that is observed in human populations. Studies using DO mice can localize genetic associations with high precision. Te identifcation of sulfotransferases as candidate genes suggests that DO mice may provide additional insight into benzene-induced genotoxicity. © 2015, Public Health Services, US Dept of Health and Human Services .All rights reserved.
    Full-text · Article · Nov 2014
    • "In humans, DHEA and DHEA-S are interconverted by sulphatases and sulphotransferases in peripheral and adrenal tissue [10] with 99% of circulating DHEA in the sulphate form. [11] While not yet studied in horses, genetic mutations , including single nucleotide polymorphisms and copy number variations [12] in the gene coding for sulphotransferase enzymes have been identified in humans, including those enzymes responsible for sulphation of DHEA. [13] These mutations have the potential to affect the rate of metabolism of drugs that undergo sulfate conjugation. "
    [Show abstract] [Hide abstract] ABSTRACT: In order to ensure the welfare of performance horses and riders as well as the integrity of the sport, the use of both therapeutic and illegal agents in horse racing is tightly regulated. While Dehydroepiandrosterone (DHEA) is not specifically banned from administration to racehorses in the United States and no screening limit or threshold concentration exists, the metabolic conversion of DHEA to testosterone make its presence in nutritional supplements a regulatory concern. The recommended regulatory threshold for total testosterone in urine is 55 and 20 ng/mL for mares and geldings, respectively. In plasma, screening and confirmation limits for free testosterone (mares and geldings), of no greater than 0.1 and 0.025 ng/mL, respectively are recommended. DHEA was administered orally, as part of a nutritional supplement, to 8 exercised female thoroughbred horses and plasma and urine samples collected at pre-determined times post administration. Using liquid chromatography-mass spectrometry (LC-MS), plasma and urine samples were analyzed for DHEA, DHEA-sulfate, testosterone, testosterone-sulfate, pregnenolone, androstenedione, and androstenediol. DHEA was rapidly absorbed with maximal plasma concentrations reaching 52.0 ± 43.8 ng/mL and 32.1 ± 12.9 ng/mL for DHEA and DHEA sulfate, respectively. Free testosterone was not detected in plasma or urine samples at any time. Maximum sulfate conjugated testosterone plasma concentrations were 0.98 ± 1.09 ng/mL. Plasma testosterone-sulfate concentrations did not fall below 0.1 ng/mL and urine testosterone-sulfate below 55 ng/mL until 24–36 h post DHEA administration. Urine testosterone sulfate concentrations remained slightly above baseline levels at 48 h for most of the horses studied. Copyright © 2014 John Wiley & Sons, Ltd.
    Full-text · Article · Sep 2014
  • [Show abstract] [Hide abstract] ABSTRACT: Cytosolic SULT1A1 participates in the bioconversion of a plethora of endogenous and xenobiotic substances. Genetic variation in this important enzyme such as SNPs can vary by ethnicity and have functional consequences on its activity. Most SULT1A1 genetic variability studies have been centered on the SULT1A1*1/2 SNP. Highlighted here are not only this SNP, but other genetic variants associated with SULT1A1 that could modify drug efficacy and xenobiotic metabolism. Some studies have investigated how differential metabolism of xenobiotic substances influences susceptibility to or protection from cancer in multiple sites. This review will focus primarily on the impact of SULT1A1 genetic variation on the response to anticancer therapeutic agents and subsequently how it relates to environmental and dietary exposure to both cancer-causing and cancer-preventative compounds.
    Article · Nov 2014
Show more