ArticlePDF Available

Exercise Training and Work Task Induced Metabolic and Stress-Related mRNA and Protein Responses in Myalgic Muscles

Authors:
  • University College Copenhagen & Bispebjerg and Frederiksberg Hospital University of Copenhagen

Abstract and Figures

The aim was to assess mRNA and/or protein levels of heat shock proteins, cytokines, growth regulating, and metabolic proteins in myalgic muscle at rest and in response to work tasks and prolonged exercise training. A randomized controlled trial included 28 females with trapezius myalgia and 16 healthy controls. Those with myalgia performed ~7 hrs repetitive stressful work and were subsequently randomized to 10 weeks of specific strength training, general fitness training, or reference intervention. Muscles biopsies were taken from the trapezius muscle at baseline, after work and after 10 weeks intervention. The main findings are that the capacity of carbohydrate oxidation was reduced in myalgic compared with healthy muscle. Repetitive stressful work increased mRNA content for heat shock proteins and decreased levels of key regulators for growth and oxidative metabolism. In contrast, prolonged general fitness as well as specific strength training decreased mRNA content of heat shock protein while the capacity of carbohydrate oxidation was increased only after specific strength training.
This content is subject to copyright.
  
  
      

 
Exercise Training and Work Task Induced Metabolic and
Stress-Related mRNA and Protein Responses in Myalgic Muscles
Gisela Sjøgaard,
1
Mette K. Zebis,
1
Kristian Kiilerich,
2
Bengt Saltin,
3
and Henriette Pilegaard
2
              

         
           
       
       
    
                   
                
                  
                   
                 
                
                    
                
                  
                   
        
1. Introduction
       
         
        
           
         
        
        
       
      
      
          
       
         
        
       
       
       
        
       
       
         
          
       
        
       
          

        
      
       
        
        
       
         
        
         
        
        
Hindawi Publishing Corporation
BioMed Research International
Volume 2013, Article ID 984523, 12 pages
http://dx.doi.org/10.1155/2013/984523
  
      
     
         
        
        
      
         
          
        
       
          
       
         
          
         
         
          
          
         
       
          

      
       
     
      
      
 
       
     
      

        
       
        
       
      

2. Subjects and Methods
2.1. Study Design.        
      
           
       
        
        
  ±       44 ± 9.8
 1.65 ± 0.061  72 ± 15.0      
44± 9.1  1.68±0.055 70±10.6 
      
        
        
       
       
          
          
         
        
        
        
           
          
           

        
      
        

         
       
           
          
          
         
       
        
      
       
        
         
          
        
          
       
      
       
         
        
       
           

        
         
        
         
        
     
   
2.2. Repetitive and Stressful Work Day.   
          
        
          
     
          
         
        
           
         
          
        
 
         
         
         
  
         
        
          
          
         
         
       
        
      
       
         
      
      per se
     
2.3. Interventions.        
         
           
        
      
   
        
       
      
       
   %   
         %
         
        
       
       
    
     
         
  %
2
     
       
         
       %

2
         
     % 
       
        
         
        
      
         
       
       
         
      

         
          
 
2.4. Biopsies.       
         
       
       
       
       
        
 
        
         
         
         
          
          
        
          
     
           
        
             
          
         
 
2.5. Outcome Measures.       

           
         
           
        
      
      
      
   
     
      
    
       
         
        
        
2.5.1. Muscle Lysate.      
     %   
       %
         
          
   
3

4
      
        
     

     
      
     
       
  
2.5.2. SDS-PAGE and Western Blotting.  
        
%      
     
4 BioMed Research International
T 1: Primer and TaqMan probe sequences for real-time PCR.
Gene Forward primer Reverse primer Taqman probe
GLUT4 5
CCTGCCAGAAAGAGTCTGAAGC 3
5
ATCCTTCAGCTCAGCCAGCA 3
5
CAGAAACATCGGCCCAGCCTGTCA 3
GS 5
GCTCAGAGCAAGGCTCGAAT 3
5
CGGCCGGCGATAAAGAA 3
5
TTATGGGCATCTGGACTTCAACTTGGACA 3
HIF-15
GCCCCAGATTCAGGATCAGA 3
5
TGGGACTATTAGGCTCAGGTGAAC 3
5
ACCTAGTCCTTCCGATGGAAGCACTAGACAA 3
HO-1 5
GCCAGCAACAAAGTGCAAGAT 3
5
AGTGTAAGGACCCATCGGAGAA 3
5
AGAGGGAAGCCCCCACTCAACACC 3
Hsc70 5
GCAGACACAGACCTTCACTACCTATT 3
5
GGCACGCTCGCCTTCAT 3
5
AACCTGAATAAGCACACCAGGCTGGTTG 3
HSP72 5
GCGTGATGACTGCCCTGAT 3
5
CGCCCTCGTACACCTGGAT 3
5
TCCCCACCAAGCAGACGCAGATCT 3
IGF-IEa 5
CAGCGCCACACCGACAT 3
5
TTGTTTCCTGCACTCCCTCTACT 3
5
AAGACCCAGAAGGAAGTACATTTGAAGAACGC 3
IL-6 5
TCTCAGCCCTGAGAAAGGAGACA 3
5
CATCTTTGGAAGGTTCAGGTTGT 3
5
ACATGTGTGAAAGCAGCAAAGAGGCACTG 3
LDH-A 5
ACAACAGGATTCTAGGTGGAGGTT 3
5
GAGTTGATGTTTTTCCCAGTCCAT 3
5
TGCATGTTGTCCTTTTTATCTGATCTGTGATTAAAGC 3
LDH-B 5
GCTAAAGGATGATGAGGTTGCTC 3
5
TCACTAGTCACAGGTCTTTTAGGTCC 3
5
CTCAAGAAAAGTGCAGATACCCTGTGGGAC 3
Myostatin 5
ACCAGGAGAAGATGGGCTGAA 3
5
GTCAAGACCAAAATCCCTTCTGGA 3
5
CCGTTTTTAGAGGTCAAGGTAACAGACACACCA 3
PGC-15
CAAGCCAAACCAACAACTTTATCTCT 3
5
CACACTTAAGGTGCGTTCAATAGTC 3
5
AGTCACCAAATGACCCCAAGGGTTCC 3
TNF5
TCTGGCCCAGGCAGTCAGAT 3
5
AGCTGCCCCTCAGCTTGA 3
5
CAAGCCTGTAGCCCATGTTGTAGCAAACC 3
GS: glycogen synthase; HIF-1: hypoxia inducible factor-1; HO-1: heme oxygenase-1; HSP72 and HSc70: heat shock protein 70 and 72; IGF-1Ea: insulin-like growth factor-1Ea; IL-6: interleukin-6; LDH: lactate
dehydrogenase; PGC-1: peroxisome proliferator activated receptor gamma coactivator 1; TNF-: tumor necrosis factor alpha.
  
                       
             
  n   n  
  0,118    0,094  
  0,886   0,801  
 0,132   0,111  
  0,127    0,086  
  0,230    0,263  
  0,239    0,175  
  0,182    0,207  
  0,016   0,010  
  0,152   0,148  
  0,150   0,140  
  0,269    0,406  
 0,122    0,166  
 0,105    0,124  
        
   
      
         
       
     
         
       
      
       
         
      
       
        
      
       
         
      
       
         
      
    
   
2.5.3. RNA Isolation and Reverse Transcription.  
         
         
    
 
       
     
   
       
         
  

2.5.4. PCR.        
      
      
        
      
      
      
         
 
  


 
      
      
        
           
  
2.5.5. Determination of Single-Stranded cDNA Content. 
      
        
       
        
       
            
         
        
  
2.6. Statistical Analysis.      
       
      
       
        
        
        
         
        
       
        
         
           
         
6 BioMed Research International
T 3: Content of key metabolic proteins in for MYA and CON at baseline. isthenumberofsubjectsforwhomthekeyproteinwas
analyzed. Median, minimum, and maximum values are presented. No signi�cant differences were found, except for PDH-E protein being
signi�cantly lower in MYA than in CON in one-sided test (  ).
Proteins MYA, nMedian Min Max CON, nMediean Min Max
cyt c 19 0,142 0,069 0,212 16 0,171 0,089 0,282
Glut 4 19 0,437 0,280 0,984 16 0,393 0,280 0,774
GS 19 0,559 0,263 0,769 16 0,501 0,351 0,760
HKII 19 0,224 0,067 0,375 16 0,185 0,049 0,452
PDH-E119 0,114 0,066 0,229 16 0,139 0,088 0,203
T 4: mRNA content before and aer 7hrs standardized repeti-
tive stressful work.
Content of mRNA PRE POST
HIF-1(n= 7)
#
0.245
(0.075–0.4859)
0.419
(0.074–3.334)
HO-1 (n= 8)
0.180
(0.062–0.313)
2.069
(0.103–6.106)
HSP72 (n= 7)
#
0.347
(0.239–0.614)
2.465
(0.244–3.334)
IGF-1Ea (n= 6)
0.256
(0.164–0.511)
0.130
(0.108–0.208)
IL-6 (n= 7)
#
0.017
(0.005–0.072)
1.244
(0.004–4.347)
Myostatin (n= 8)
0.692
(0.049–1.218)
0.073
(0.011–0.610)
PGC-1(n= 6)
0.377
(0.092–1.082)
0.073
(0.038–0.323)
Values are presented as median (range).
#
Denotes 0.05 0.10 and
denotes 0.05 in paired test. HIF-1: hypoxia inducible factor-1;
HO-1: heme oxygenase-1; HSP72: heat shock protein 72; IGF-1Ea: insulin-
like growth factor-1Ea; IL-6: interleukin-6; PGC-1: peroxisome proliferator
activated receptor gamma coactivator 1.
were deemed signi�cant if a two-sided -value was less
than 0.10. e speci�c one-sided tests were (1) the protein
contents of PDH-E1and Cyt-c are lower in MYA compared
with CON; (2) basal mRNA levels of heat shock proteins
HSc70 and HSP72 increase with repetitive stressful work but
decrease with prolonged duration of training exercises in
MYA.
3. Results
3.1. Baseline. e PDH-E1protein level was signi�cantly
lower in the MYA group than in the CON group at baseline
(   in one-sided test). No other signi�cant differences
were observed between MYA and CON, and this was true for
both the mRNA data and the protein data (Tables 2 and 3).
Representative western blot images are presented in Figure 3.
3.2. Standardized Repetitive and Stressful Work. e stan-
dardized protocol including repetitive work, stress tests, and
computer work induced signi�cant changes in the mRNA
content of different genes. Signi�cant increases were found
for mRNA content of the heat shock proteins: HO-1
(  ) and HSP72 (  , one-sided), while IL-
6 and HIF-1showedatrendtoincrease(Table 4). In
contrast, PGC-1, IGF-1Ea, and myostatin mRNA contents
were signi�cantly lowered (  ) several fold aer the
standardized work day (Table 4).
3.3. Intervention. In the MYA group, the tenderness score
was 12.5 (4–28) out of the possible maximum score of 28
at baseline and which decreased signi�cantly in response to
10 wks intervention in SST and GFT by 11.0 (6–20) and 6.3
(4–13), respectively. But in REF the decrease of 3.2 (3–7)
was not signi�cant.
Biopsy data showed the basal level of HSP72 mRNA
content to decrease signi�cantly aer the SST and GFT
interventions, whereas HSc70 mRNA only decreased aer
the SST intervention period (  , one-sided) (Figures
1(a) and 1(b)). Further, GS and PDH-E1protein content
increased by 22and 21, respectively, (  ) only aer
the SST intervention (Figures 2(a) and 2(b)). Cyt c, HKII,
and GLUT4 protein content did not change in either of the
intervention groups. Representative western blot images are
shown in Figure 4.
4. Discussion
Repetitive stressful work tasks increased levels of mRNA
content for heat shock proteins and decreased mRNA levels
of growth regulating proteins and proteins related to oxida-
tive metabolism. In contrast, prolonged exercise training
decreased the basal level for heat shock protein. Speci�c
strength training but not general endurance training increas-
ed the protein content of key proteins in carbohydrate
storage and oxidation in myalgic skeletal muscle. Interest-
ingly, impairment in the capacity for carbohydrate oxidation
wasseenatbaselineinMYAcomparedwithCONbutno
differences in the basal level of mRNA contents were found.
4.1. MYA versus CON at Baseline. A novel �nding of the
present study was an observed lower protein level of PDH-
E1in females with trapezius myalgia than healthy controls
(Figure 1). PDH-E1is responsible for catalyzing the decar-
boxylation of pyruvate, and regulation of this PDH com-
ponent of the enzyme complex is thought to be important
for the mitochondrial choice of substrate at rest and during
exercise [31]. Reduced capacity of the pyruvate dehydro-
genase complex could facilitate movement of glycolytically
derived pyruvate toward lactate output rather than oxidation.
BioMed Research International 7
HSc70 mRNA
0
0.2
0.4
0.6
0.8
1
CON MYA REF SST GFT
= 0.066
(a)
HSP72 mRNA
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
CON MYA REF SST GFT
= 0.08
= 0.041
(b)
F 1: Effect of training on mRNA content. e mRNA content
of HSc70 (a) and HSP72 (b) decreased in the strength training group
(SST, ) during the 10 wks intervention period (  ).
Similarly, a decrease in HSP72 mRNA content was observed with the
GFT (  ) intervention (  ) (B). No changes were observed
for REF ((a): ; (b): ). e �gure illustrates the 5th and
95th percentile, outliers (black dot), the group median (solid line),
and group mean (dotted line).
is may underlie our �nding of higher interstitial muscle
lactate levels and impaired muscle oxygenation in MYA
compared with CON in this same experimental series during
the pegboard task as reported previously [25]. is is also
in accordance with a previous �nding, where patients with
trapezius myalgia were found to respond to repetitive low-
forcearmworkwithalargerinterstitialmusclelactate
increase than seen in healthy controls [32]. In concert, biopsy
studies on work-related trapezius myalgia have demonstrated
a reduced capillarisation per �ber cross-sectional area [33]
implying an impaired oxidative capacity, while in the present
subject groups such differences were not found between MYA
and CON [34].
4.2. Standardized Repetitive and Stressful Work Performed by
MYA. Static and highly repetitive work tasks have been iden-
ti�ed as risk factors for work-related trapezius myalgia [35].
Patients with work-related trapezius myalgia oen report
that pain worsens considerably even when remarkably light
physical work of neck and shoulder muscles is performed
which was con�rmed in the present subject group [36]. A
main �nding of the present study was that among MYA
GS
0.4
0.6
0.8
1
Pre Post
= 0.046
(a)
0.06
0.08
0.1
0.12
0.14
0.16
0.18
0.2
Pre Post
= 0.028
PDH-E1
(b)
F 2: Effect of training on protein content. e protein content
of GS (a) and PDH-E1(b) increased in the strength training group
(SST, ) aer the 10 wks intervention period (  ). e
�gure illustrates the 5th and 95th percentile, the groupmedian (s olid
line), and group mean (dotted line).
the experimntal work day including repetitive and stressful
work tasks elicited marked changes in the mRNA abundance
of a subset of metabolic and stress-related genes as will be
discussed in more detail below.
4.2.1. Heat Shock Proteins. e upregulation of HSP72
mRNA content observed in the present study may confer
protection against ischemia and preserve the cellular func-
tions [37], while HSc70 mRNA content remained unchanged
which is in accordance with its constitutively nature. e
10-fold increase in HO-1 mRNA content indicates that the
trapezius muscle may indeed be exposed to oxidative stress
during repetitive work tasks which is in accordance with
the increased interstitial lactate level reported in this subject
group during the repetitive work [25]. A previous study
showed that HO-1 mRNA increased with repetitive muscle
contractions, and increases in HO-1 protein content in
response to metabolic stress may be important in producing
antioxidants [38]. In combination the observed increase in
  
Glut 4
GS
15
46
89
102
40
Cyt C
HK-II
PDH-E1
C M CMkDa
         
           
           
Glut 4
GS
15
46
89
102
40
Cyt C
HK-II
PDH-E1
kDa
GFT SST
Pre Post Pre Post
         
          
          
        
         
      
       
4.2.2. Cytokines.      
        
        
        
       
      
        
         
   per se     
       
      
      
         
       
        
         
         
      
         
         
      
       
       
4.2.3. Growth Regulating Proteins.    
     % 
        
        
          
       
          
          
        
         
      
        
         
        
        
        
       
       
       
       
         
         
        
         
          
         
         
        
        
     
        
         
          
          
  
4.2.4. Metabolic Regulators.    
       
        
     
  
      
        
      
         
      
    
       
       
        
     
       
      
        
       
      
        
      
        
        
         
       
        
      
4.3. Training Intervention for MYA.    
        
        
       
      
        
      
  %     
  >       
         
     
4.3.1. mRNA Content.       
        
       
         
        
           
       
        
        
         
        
     
        
       
         
        
          
         
       
         
       
    
       
        
          
          
      
         
        
     
        
        
      
    
       
           
          
        
          
        
        
      
  
         
       
         
     
4.3.2. Protein Content.     
        
      
        
       
       
        
        
        
      
          
      
         
          
      
        
      
      

4.4. Limitations.       
           
           
        
       
         
        

      
         

       
   
10 BioMed Research International
5. Conclusion
In conclusion, no differences were found between MYA and
CON in the content of the basal level of a broad range of
mRNA’s. However, standardized repetitive, stressful work
had great impact on the mRNA expression in MYA, indi-
cating that daily repetitive low-intensity work tasks induce
metabolic stress upon the trapezius muscle. Furthermore,
a decrease in heat shock protein mRNA content was seen
not only aer strength training but also aer general �tness
training which indicates that the cellular homeostasis of
the trapezius muscle was improved in females with work-
related trapezius myalgia, regardless of training intervention
type. However, protein content of PDH-E1was lower in
MYA than CON and only speci�c strength training increased
the capacity of the oxidative and nonoxidative carbohydrate
metabolism in the trapezius muscle of MYA as seen by an
increased protein level of both GS and PDH-E1.
Acknowledgments
e authors would like to thank Rasmus S. Biensø for excel-
lent technical assistance. is study was supported by grants
from the Danish Medical Research Council 22-03-0264 and
271-08-0469, and the Danish Rheumatism Association 233-
1149-02.02.04.
References
[1] L. Punnett and D. H. Wegman, “Work-related musculoskeletal
disorders: the epidemiologic evidence and the debate,Journal
of Electromyography and Kinesiology, vol. 14, no. 1, pp. 13–23,
2004.
[2] G. Sjøgaard, K. Søgaard, H. J. Hermens et al., “Neuromuscular
assessment in elderly workers with and without work related
shoulder/neck trouble: the NEW-study design and physiolog-
ical �ndings,European Journal of Applied Physiology, vol. 96,
no. 2, pp. 110–121, 2006.
[3] S. E. Larsson, A. Bengtsson, L. Bodegard, K. G. Henriksson, and
J. Larsson, “Muscle changes in work-related chronic myalgia,
Acta Orthopaedica Scandinavica, vol. 59, no. 5, pp. 552–556,
1988.
[4] B. Larsson, J. Björk, K. G. Henriksson, B. Gerdle, and R.
Lindman, “e prevalences of cytochrome c oxidase negative
and superpositive �bres and ragged-red �bres in the trapezius
muscle of female cleaners with and without myalgia and of
female healthy controls,Pain, vol. 84, no. 2-3, pp. 379–387,
2000.
[5] F. Kadi, K. Waling, C. Ahlgren et al., “Pathological mechanisms
implicated in localized female trapezius myalgia,Pain, vol. 78,
no. 3, pp. 191–196, 1998.
[6] H. Pilegaard, G. A. Ordway, B. Saltin, and P. D. Neufer, “Trans-
criptional regulation of gene expression in human skeletal
muscle during recovery from exercise,American Journal of
Physiology, vol. 279, no. 4, pp. E806–E814, 2000.
[7] Y. Hellsten, J. J. Nielsen, J. Lykkesfeldt et al., “Antioxidant
supplementation enhances the exercise-induced increase in
mitochondrial uncoupling protein 3 and endothelial nitric
oxide synthase mRNA content in human skeletal muscle,Free
Radical Biology and Medicine, vol. 43, no. 3, pp. 353–361, 2007.
[8] H. Pilegaard, B. Saltin, and D. P. Neufer, “Exercise induces
transient transcriptional activation of the PGC-1gene in
human skeletal muscle,Journal of Physiology, vol. 546, no. 3,
pp. 851–858, 2003.
[9] M. S. Forde, L. Punnett, and D. H. Wegman, “Pathomechanisms
of work-related musculoskeletal disorders: conceptual issues,
Ergonomics, vol. 45, no. 9, pp. 619–630, 2002.
[10] H. J. C. G. Coury, R. F. C. Moreira, and N. B. Dias, “Evaluation
of the effectiveness of workplace exercise in controlling neck,
shoulder and low back pain: a systematic review,Revista
Brasileira de Fisioterapia, vol. 13, no. 6, pp. 461–479, 2009.
[11] M. Hagberg, K. Harms-Ringdahl, R. Nisell, and E. Wigaeus
Hjelm, “Rehabilitation of neck-shoulder pain in women indus-
trial workers: a randomized trial comparing isometric shoulder
endurance training with isometric shoulder strength training,
Archives of Physical Medicine and Rehabilitation, vol. 81, no. 8,
pp. 1051–1058, 2000.
[12] A. Randløv, M. Ostergaard, C. Manniche et al., “Intensive
dynamic training for females with chronic neck/shoulder pain.
A randomized controlled trial,Clinical Rehabilitation, vol. 12,
no. 3, pp. 200–210, 1998.
[13] J. Henriksson, “Training induced adaptation of skeletal muscle
and metabolism during submaximal exercise,Journal of Physi-
ology, vol. 270, no. 3, pp. 661–675, 1977.
[14] Y. Cao, T. Matsumoto, K. Motomura, A. Ohtsuru, S. Yamashita,
and M. Kosaka, “Impaired induction of heat shock protein
implicated in decreased thermotolerance in a temperature-
sensitive multinucleated cell line,P�ugers Archiv European
Journal of Physiology, vol. 437, no. 1, pp. 15–20, 1998.
[15] Y. R. A. Donati, D. O. Slosman, and B. S. Polla, “Oxidative injury
and the heat shock response,Biochemical Pharmacology, vol.
40, no. 12, pp. 2571–2577, 1990.
[16] A. Laszlo, “e relationship of heat-shock proteins, thermotol-
erance, and protein synthesis,Experimental Cell Research, vol.
178, no. 2, pp. 401–414, 1988.
[17] P. L. Moseley, E. S. Wallen, J. D. McCafferty, S. Flanagan, and J.
A. Kern, “Heat stress regulates the human 70-kDa heat-shock
gene through the 3’- untranslated region,American Journal of
Physiology, vol. 264, no. 6, pp. L533–L537, 1993.
[18] Y. Liu and J. M. Steinacker, “Changes in skeletal muscle heat
shock proteins: pathological signi�cance,Front Biosci, vol. 6,
pp. D12–D25, 2001.
[19] K. L. Milarski, W. J. Welch, and R. I. Morimoto, “Cell cycle-
dependent association of HSP70 with speci�c cellular proteins,
Journal of Cell Biology, vol. 108, no. 2, pp. 413–423, 1989.
[20] J. R. Subjeck and T. T. Shyy, “Stress protein systems of mam-
malian cells,American Journal of Physiology, vol. 250, no. C1,
p. C17, 1986.
[21] R. M. Tanguay, Y. Wu, and E. W. Khandjian, “Tissue-speci�c
expression of heat shock proteins of the mouse in the absence
of stress,Developmental Genetics, vol. 14, no. 2, pp. 112–118,
1993.
[22] D. A. Lepore and W. A. Morrison, “Ischemic preconditioning:
lack of delayed protection against skeletal muscle ischemia-
reperfusion,Microsurgery, vol. 20, pp. 350–355, 2000.
[23] A. Puntschart, M. Vogt, H. R. Widmer, H. Hoppeler, and
R. Billeter, “Hsp70 expression in human skeletal muscle aer
exercise,Acta Physiologica Scandinavica, vol. 157, no. 4, pp.
411–417, 1996.
BioMed Research International 11
[24] J. Ylinen, E. P. Takala, M. Nykänen et al., “Active neck muscle
training in the treatment of chronic neck pain in women: a
randomized controlled trial,Journal of the American Medical
Association, vol. 289, no. 19, pp. 2509–2516, 2003.
[25] G. Sjøgaard, L. Rosendal, J. Kristiansen et al., “Muscle oxy-
genation and glycolysis in females with trapezius myalgia dur-
ing stress and repetitive work using microdialysis and NIRS,
European Journal of Applied Physiology, vol. 108, no. 4, pp.
657–669, 2010.
[26] L. L. Andersen, M. Kjær, K. Søgaard, L. Hansen, A. I. Kryger,
and G. Sjøgaard, “Effect of two contrasting types of physical
exercise on chronic neck muscle pain,Arthritis Care and
Research, vol. 59, no. 1, pp. 84–91, 2008.
[27] A. L. Mackey, L. L. Andersen, U. Frandsen, C. Suetta, and
G. Sjøgaard, “Distribution of myogenic progenitor cells and
myonuclei is altered in women with vs. those without chron-
ically painful trapezius muscle,Journal of Applied Physiology,
vol. 109, no. 6, pp. 1920–1929, 2010.
[28] H. Pilegaard, J. B. Birk, M. Sacchetti et al., “PDH-E1dephos-
phorylation and activation in human skeletal muscle during
exercise: effect of intralipid infusion,Diabetes, vol. 55, no. 11,
pp. 3020–3027, 2006.
[29] K. Højlund, J. F. P. Wojtaszewski, J. Birk, B. F. Hansen, H.
Vestergaard, and H. Beck-Nielsen, “Partial rescue of in vivo
insulin signalling in skeletal muscle by impaired insulin clear-
ance in heterozygous carriers of a mutation in the insulin
receptor gene,Diabetologia, vol. 49, no. 8, pp. 1827–1837, 2006.
[30] C. Lundby, N. Nordsborg, K. Kusuhara, K. M. Kristensen, P. D.
Neufer, and H. Pilegaard, “Gene expression in human skeletal
muscle: alternative normalization method and effect of repeated
biopsies,European Journal of Applied Physiology, vol. 95, no. 4,
pp. 351–360, 2005.
[31] K. Kiilerich, J. B. Birk, R. Damsgaard, J. F. P. Wojtaszewski,
and H. Pilegaard, “Regulation of PDH in human arm and leg
muscles at rest and during intense exercise,American Journal
of Physiology, vol. 294, no. 1, pp. E36–E42, 2008.
[32] L. Rosendal, B. Larsson, J. Kristiansen et al., “Increase in
muscle nociceptive substances and anaerobic metabolism in
patients with trapezius myalgia: microdialysis in restand during
exercise,Pain, vol. 112, no. 3, pp. 324–334, 2004.
[33] B. Larsson, J. Björk, F. Kadi, R. Lindman, and B. Gerdle, “Blood
supply and oxidative metabolism in muscle biopsies of female
cleaners with and without myalgia,Clinical Journal of Pain, vol.
20, no. 6, pp. 440–446, 2004.
[34] L. L. Andersen, C. Suetta, J. L. Andersen, M. Kjær, and G.
Sjøgaard, “Increased proportion of mega�bers in chronically
painful muscles,Pain, vol. 139, no. 3, pp. 588–593, 2008.
[35] T. J. Armstrong, P. Buckle, J. F. Fine et al., “A conceptual
model for work-related neck and upper-limb musculoskeletal
disorders,ScandinavianJournalofWork,Environmentand
Health, vol. 19, no. 2, pp. 73–84, 1993.
[36] K. Søgaard, A. K. Blangsted, P. K. Nielsen et al., “Changed acti-
vation, oxygenation, and pain response of chronically painful
muscles to repetitive work aer training interventions: a ran-
domized controlled trial,European Journal of Applied Physiol-
ogy, vol. 112, pp. 173–181, 2012.
[37] J. C. L. Plumier, B. M. Ross, R. W. Currie et al., “Transgenic mice
expressing the human heat shock protein 70 have improved
post-ischemic myocardial recovery,Journal of Clinical Inves-
tigation, vol. 95, no. 4, pp. 1854–1860, 1995.
[38] D. A. Essig, D. R. Borger, and D. A. Jackson, “Induction of
heme oxygenase-1 (HSP32) mRNA in skeletal muscle following
contractions,American Journal of Physiology, vol. 272, no. 1,
pp. C59–C67, 1997.
[39] H. Langberg, J. L. Olesen, C. Gemmer, and M. Kjær, “Substan-
tial elevation of interleukin-6 concentration in peritendinous
tissue, in contrast to muscle, following prolonged exercise in
humans,Journal of Physiology, vol. 542, no. 3, pp. 985–990,
2002.
[40] K. Ostrowski, T. Rohde, M. Zacho, S. Asp, and B. K. Pedersen,
“Evidence that interleukin-6 is produced in human skeletal
muscle during prolonged running,Journal of Physiology, vol.
508, part 3, pp. 949–953, 1998.
[41] C. P. Fischer, “Interleukin-6 in acute exercise and training: what
is the biological relevance?” Exercise Immunology Review, vol.
12, pp. 6–33, 2006.
[42] B. K. Pedersen, A. Steensberg, C. Fischer et al., “e metabolic
role of IL-6 produced during exercise: is IL-6 an exercise
factor?” Proceedings of the Nutrition Society,vol.63,no.2,pp.
263–267, 2004.
[43] S. orn, K. Søgaard, L. A. C. Kallenberg et al., “Trapezius mus-
cle rest time during standardised computer work—a compar-
ison of female computer users with and without self-reported
neck/shoulder complaints,Journal of Electromyography and
Kinesiology, vol. 17, no. 4, pp. 420–427, 2007.
[44] L. Rosendal, K. Søgaard, M. Kjær, G. Sjøgaard, H. Langberg, and
J. Kristiansen, “Increase in interstitial interleukin-6 of human
skeletal muscle with repetitive low-force exercise,Journal of
Applied Physiology, vol. 98, no. 2, pp. 477–481, 2005.
[45] Y. Yang, B. Jemiolo, and S. Trappe, “Proteolytic mRNA expres-
sion in response to acute resistance exercise in human single
skeletal muscle �bers,Journal of Applied Physiology, vol. 101,
no. 5, pp. 1442–1450, 2006.
[46] E. Louis, U. Raue, Y. Yang, B. Jemiolo, and S. Trappe, “Time
course of proteolytic, cytokine, and myostatin gene expression
aer acute exercise in humanskeletal muscle,Journal of Applied
Physiology, vol. 103, no. 5, pp. 1744–1751, 2007.
[47] M. omas, B. Langley, C. Berry et al., “Myostatin, a negative
regulator of muscle growth, functions by inhibiting myoblast
proliferation,Journal of Biological Chemistry, vol. 275, no. 51,
pp. 40235–40243, 2000.
[48] S. McCroskery, M. omas, L. Maxwell, M. Sharma, and
R. Kambadur, “Myostatin negatively regulates satellite cell
activation and self-renewal,Journal of Cell Biology, vol. 162, no.
6, pp. 1135–1147, 2003.
[49] G. R. Adams and S. A. McCue, “Localized infusion of IGF-I
results in skeletal muscle hypertrophy in rats,Journal of Applied
Physiology, vol. 84, no. 5, pp. 1716–1722, 1998.
[50] G. Goldspink, “Gene expression in muscle in response to
exercise,JournalofMuscleResearchandCellMotility, vol. 24,
no. 2-3, pp. 121–126, 2003.
[51] G. Goldspink, “Mechanical signals, IGF-I gene splicing, and
muscle adaptation,Physiology, vol. 20, pp. 232–238, 2005.
[52] P. Vedsted, A. K. Blangsted, K. Søgaard, C. Orizio, and G.
Sjøgaard, “Muscle tissue oxygenation, pressure, electrical, and
mechanical responses during dynamic and static voluntary
contractions,European Journal of Applied Physiology, vol. 96,
no. 2, pp. 165–177, 2006.
[53] J. Lin, C. Handschin, and B. M. Spiegelman, “Metabolic control
through the PGC-1 family of transcription coactivators,Cell
Metabolism, vol. 1, no. 6, pp. 361–370, 2005.
   
            
        
 FAS EB Journal     
 
          
       
       FASEB Journal       
         
       
       
European Journal of Applied Physiology   
   
            
          
    European Journal of Applied
Physiology       
             
         
         European
Journal of Applied Physiology       
              
         
      Molecular
and Cellular Biology       
           
        
Medicine and Science in Sports and Exercise  
    
           
     Journal of
Sports Medicine and Physical Fitness      

           
       
  European Journal of Biochemistry 
     
           
           
         
Journal of Physiology     
             
       
       
        Diabetes 
     
           
       
    American Jour-
nal of Physiology       
... The above results from animal studies are consistent with findings by Sjogaard and colleagues showing that repetitive stressful work increases inducible Hsp70 levels in myalgic trapezius muscles of female humans (Sjogaard et al. 2013). Twenty-eight females with trapezius myalgia and 16 healthy females were included in the study, with all subjects employed in jobs with monotonous and repetitive work tasks (e.g., assembly line or office work). ...
... Twenty-eight females with trapezius myalgia and 16 healthy females were included in the study, with all subjects employed in jobs with monotonous and repetitive work tasks (e.g., assembly line or office work). The diagnosis of myalgia was fulfilled when subjects had: 1) pain or discomfort for more than 30 days during the last year in the neck and shoulder region; 2) more than 30 days of pain or discomfort in maximally three of eight major body regions; and 3) intense and frequent pain, assayed using three different scales (Sjogaard et al. 2013), and 4) palpable tenderness and tightness in the trapezius muscle (Sjogaard et al. 2010). At baseline, all participants (Controls and Myalgic patients) had biopsies collected from the trapezius muscle. ...
... In contrast, decreased tendon levels of Hsp70, an absence of tendon pathology, and no increases in any repair cytokine were observed in rats that had performed a low repetition low force task for 12 weeks, compared to control rats, suggesting that their tendon tissues had adapted to the task (Fig. 11.2a-f). These findings combined support a fatigue failure theory in which only the highest demand tasks or loads result in tissue pathology M. F. Barbe et al. (Fung et al. 2010;Fung et al. 2009;Gallagher and Heberger 2013;Neviaser et al. 2012) followed by enhanced repair processes, and that prolonged activity at low force parameters may activate metabolic changes that allow tendon tissues to handle more efficiently any potentially damaging changes occurring with task performance (Sjogaard et al. 2013). Fig. 11.2 Histopathology and production of repair proteins in flexor digitorum tendons after performance of repetitive tasks for 12 weeks at one of four combinations of repetitive rates and force levels as defined in Fig. 11.1. ...
Chapter
The heat shock protein (Hsp) response is understudied with non-exercise overuse injuries. We focused on the Hsp response in muscles and tendons undergoing such injury or cyclical loading. Hsp25 mRNA and protein levels increase in muscles undergoing functional overload, and show greater increases in fast type muscles. In an operant rat model of reaching and grasping, the inducible form of Hsp70 increased in muscles and tendons showing injury, with the greatest increase in rats performing a high repetition high force for 12 weeks, compared to easier repetition/loading paradigms. These increases were paralleled by increases in several repair-associated proteins (osteoactivin, MMPs, and TGFB1). Trapezius biopsies from patients with myalgia show increased mRNA levels of Hsp72 and decreased levels of growth and metabolism regulators. Prolonged exercise interventions in general, when provided to subjects with trapezius myalgia, decreased Hsp72 mRNA levels, while specific strength training of shoulder and neck muscles increased mRNA levels of analytes related to carbohydrate oxidation. In a rat model of supraspinatus injury, the Hsp response appeared related to the cascade of stress-related programmed cell death in torn tendons. A mild mechanical stimulation of cultured tendon fibroblasts reduced apoptosis and increased cell proliferation and may be helpful for tissue regeneration.
... As pain is a perception and always self-reported, an animal model can only observe and test motor and sensory behaviors as indications of fatigue and pain. We analyzed for voluntary motor behaviors suggestive of fatigue and sensory behaviors suggestive of pain or discomfort, as well as inflammatory cytokines and Hsp72 as injury markers [26,27]. All original data from behavioral and tissue analyses used to support the findings of this study are available from the corresponding author upon request. ...
... Regarding Hsp72 in the present rat study, we found a significant increase in Flex muscles of the HRHF-RL compared to the HRHF-SL and FRC-R, while in a human study, we did not find resting baseline differences in Hsp72 among workers with trapezius muscle myalgia compared to healthy controls. However, among the workers with trapezius muscle myalgia, Hsp72 increased ∼8 fold following a 7-hour workday with standardized repetitive work [27]. Interestingly, however, it was shown that Hsp72 decreased following a 10-week strength training period that in previous papers was reported to relieve trapezius muscle pain and improved muscle morphological and metabolic markers [72][73][74]. ...
Article
Full-text available
Introduction: Ca2+ regulatory excitation-contraction coupling properties are key topics of interest in the development of work-related muscle myalgia and may constitute an underlying cause of muscle pain and loss of force generating capacity. Method: A well-established rat model of high repetition high force (HRHF) work was used to investigate if such exposure leads to an increase in cytosolic Ca2+ concentration ([Ca2+]i) and changes in sarcoplasmic reticulum (SR) vesicle Ca2+ uptake and release rates. Result: Six weeks exposure of rats to HRHF increased indicators of fatigue, pain behaviors, and [Ca2+]i, the latter implied by around 50-100% increases in pCam, as well as in the Ca2+ handling proteins RyR1 and Casq1 accompanied by an ∼10% increased SR Ca2+ uptake rate in extensor and flexor muscles compared to those of control rats. This demonstrated a work-related altered myocellular Ca2+ regulation, SR Ca2+ handling, and SR protein expression. Discussion: These disturbances may mirror intracellular changes in early stages of human work-related myalgic muscle. Increased uptake of Ca2+ into the SR may reflect an early adaptation to avoid a sustained detrimental increase in [Ca2+]i similar to the previous findings of deteriorated Ca2+ regulation and impaired function in fatigued human muscle.
... E-mails and flyers were distributed among several workplaces with predominant computer-based tasks. Subjects were required (1) to perform at least 20 hrs of computer work a week, for at least 1 yr, (2) to suffer from neck pain for at least 30 days in the last year and for at least 1 day/wk, 30 (3) to report a pain score of 3 or higher on a 10-point numeric rating scale (NRS), and (4) to have work-related neck pain, which aggravates during the working day and week. Eligibility was assessed using an online questionnaire including demographic features, characteristics of current and previous episodes of neck pain, medical history (general health, injuries, surgery, medical imaging), medication use, and the Neck Disability Index. ...
... During a writing task, Leonard et al. (2010) 19 found a higher sEMG activity in the upper trapezius of subjects with work-related neck pain, compared with pain-free participants. Sjøgaard et al. (2010) 30 found a significantly larger sEMG activity of the upper trapezius, during a pegboard task, in patients with trapezius myalgia, compared with healthy controls. 45 found a linear relationship between the degree of self-reported pain and the changes in sEMG activity of postural neck muscles during a unilateral upper limb task. ...
Article
Objective: Myofascial pain can be accompanied by a disturbed surface electromyographic (sEMG) activity. Nevertheless, the effect of myofascial treatment techniques, such as dry needling (DN), on the sEMG activity is poorly investigated. Several DN studies also emphasize the importance of eliciting local twitch responses (LTRs) during treatment. However, studies investigating the added value of LTRs are scarce. Therefore, the aims of this study were first to evaluate the effect of DN on the sEMG activity of myalgic muscle tissue, compared with no intervention (rest), and secondly to identify whether this effect is dependent of eliciting LTRs during DN. Methods: Twenty-four female office workers with work-related trapezius myalgia were included. After completion of a typing task, changes in sEMG activity were evaluated after a DN treatment of the upper trapezius, compared with rest. Results: The sEMG activity increased after rest and after DN, but this increase was significantly smaller 10 minutes after DN, compared with rest. These differences were independent whether LTRs were elicited or not. Conclusions: Dry needling leads to a significantly lower increase in sEMG activity of the upper trapezius, compared with no intervention, after a typing task. This difference was independent of eliciting LTRs.
... Despite that oxidative stress is involved in NMDs, and exercise induces ROS production, some types of training increase mRNA levels and the expression of metabolic muscle proteins. In particular, a moderate and regular physical exercise has been suggested as non-pharmacological treatment for the NMDs (Sjøgaard et al., 2013). ...
Article
Full-text available
Neuromuscular diseases (NMDs) are a group of often severely disabling disorders characterized by dysfunction in one of the main constituents of the motor unit, the cardinal anatomic-functional structure behind force and movement production. Irrespective of the different pathogenic mechanisms specifically underlying these disease conditions genetically determined or acquired, and the related molecular pathways involved in doing that, oxidative stress has often been shown to play a relevant role within the chain of events that induce or at least modulate the clinical manifestations of these disorders. Due to such a putative relevance of the imbalance of redox status occurring in contractile machinery and/or its neural drive in NMDs, physical exercise appears as one of the most important conditions able to positively interfere along an ideal axis, going from a deranged metabolic cell homeostasis in motor unit components to the reduced motor performance profile exhibited by the patient in everyday life. If so, it comes out that it would be important to identify a proper training program, suitable for load and type of exercise that is able to improve motor performance in adaptation and response to such a homeostatic imbalance. This review therefore analyzes the role of different exercise trainings on oxidative stress mechanisms, both in healthy and in NMDs, also including preclinical studies, to elucidate at which extent these can be useful to counteract muscle impairment associated to the disease, with the final aim of improving physical functions and quality of life of NMD patients.
... Other beneficial effects were found to include a number of health-related factors such as lowered blood pressure. Direct measures on the muscle level using biopsy and microdialysis techniques showed an increase in metabolic capacity (84), demonstrated even at the gene level (80). ...
Article
Work-related physical activity (PA), in terms of peak loads, sustained and/or repetitive contractions presents risk factors for the development of muscular pain and disorders. However, PA as training tailored to the employee's work exposure, health, and physical capacity offers prevention and rehabilitation. We suggest the concept of "Intelligent Physical Exercise Training" relying on evidence-based sports science training principles.This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial-No Derivatives License 4.0 (CCBY-NC-ND), where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially without permission from the journal.
... But we did not have information on physical factor and work load among the subjects. Physical stress and work load may have impact on 8-OHdG formation in humans (Huang et al. 2012;Sjogaard et al. 2013;Zheng and Ariizumi 2007). In future research, we will consider these confounders and control them. ...
Article
Full-text available
PurposeCoke oven emissions containing polycyclic aromatic hydrocarbons (PAHs) are predominant toxic constituents of particulate air pollution that have been linked to increased risk of lung cancer. Numerous epidemiological studies have suggested that oxidative DNA damage may play a pivotal role in the carcinogenic mechanism of lung cancer. Little is known about the effect of interaction between PAHs exposure and lifestyle on DNA oxidative damage. Methods The study population is composed by coke oven workers (365) and water treatment workers (144), and their urinary levels of four PAH metabolites and 8-hydroxydeoxyguanosine (8-OHdG) were determined. Airborne samples of exposed sites (4) and control sites (3) were collected, and eight carcinogenic PAHs were detected by high-performance liquid chromatography. ResultsThe median values of the sum of eight carcinogenic PAHs and BaP in exposed sites were significantly higher than control sites (P < 0.01). The study found that the urinary PAH metabolites were significantly elevated in coke oven workers (P < 0.01). Multivariate logistic regression analysis revealed that the risk of high levels of urinary 8-OHdG will increase with increasing age, cigarette consumption, and levels of urinary 1-hydroxypyrene, and P for trend were all <0.05. Smoking can significantly modify the effects of urinary 1-hydroxypyrene on high concentrations urinary 8-OHdG, during co-exposure to both light or heavy smoking and high 1-hydroxypyrene levels (OR 4.28, 95% CI 1.32–13.86 and OR 5.05, 95% CI 1.63–15.67, respectively). Conclusions Our findings quantitatively demonstrate that workers exposed to coke oven fumes and smoking will cause more serious DNA oxidative damage.
Article
Full-text available
Physical activity is known to benefit health while muscle activation and movements performed during occupational work in contrast may result in work-related musculoskeletal disorders. Therefore, we posed the research question: which mode of muscle activation may result in a reversal of work-related disorders? To address this, we performed electromyographic (EMG) and kinematic assessments of workers with diverse exposure categories: sedentary monotonous work, prolonged walking/standing, and physically heavy work. The various job-specific exposure variables could be categorized in terms of duration, intensity, repetition, static component, peak force etc. that were subsequently identified as risk factors. Based on sports science principles we developed tailored exercise programs to counteract job exposure. EMG activity during exercise training was monitored to identify principal differences between exercise training and job patterns. Evidence from more than 20 RCT studies including >4000 workers showed positive effects such as decreased muscle pain and increased workability. Finally, we identified plausible underlying mechanisms in muscle tissue - human and animal - that confirmed metabolic, morphological, and hormonal changes with e.g. repetitive work that were reversal to adaptations reported with exercise training. Progress has been made in developing intelligent physical exercise training, IPET, as the best complementary activity to job exposure and includes muscle activations and movements that limit work-related inactivity atrophy as well as overload injury.
Thesis
Full-text available
Purpose: Repetitive strain injury (RSI) is accompanied by an increase in extracellular matrix (ECM), atrophy, and reduces the muscle power particularly in the elderly. Resistance training (RT) have potential positive effects on muscle function and morphology in elderly. Firstly, this study investigates changes in muscle tissues resulting from performance of a 6-weeks chronic eccentric contraction in aged rats. Using this model, the effects of eight-week therapeutic resistance training on recovery of pathological changes after chronic strain injury were examined. contraction. Methodology: in an experimental design, 48 elderly male Wistar rats were divided into six groups randomly. Three RSI groups underwent 6weeks (5 set of 10 repetitions, 5 days/week) of fast velocity submaximal eccentric contractions (5 sec trains of 0.2 msec pulses, voltage 40 V at 70 Hz), while the three control (CTL) groups were inactive. After 14 days, one of the RSI (RSI-1) and one of the control (CTL-1) were sacrificed for initial assessment of RSI-induced adaptations. Both RSI-RT and CTL-RT groups performed 8 weeks progressive resistance training (1 set of 6 repetitions using 50-100% 1RM, 3 days/week) and the other two groups (RSI-Re & CTL-2) were inactive without any modalities. Gastrocnemius muscle response was assessed by isometric force(IF) and muscle wet mass. Quantitative histopathological analysis and immunoblotting of myogenin protein were also done in all groups. Results: Raw and relative (percent to body weight) measures of isometric force and wet muscle mass of gastrocnemius in CTL-1 group are significantly greater than RSI-1 group. Masson Trichrome and Hematoxylin & eosin (H&E) stains also showed histopathologic changes were present in RSI-1 group that included increase in fibrosis and non-contractile area, and decrease of myofiber area (MA). After 10 weeks of injury protocol, fibrosis and decrease in MA and IF of gastrocnemius were remained in RSI-Re group, but muscle wet mass was recovered. RT significantly improved IF and MA in both training groups, but non-contractile area was not changed. Only in RSI-RT, the protein level of myogenin was greater than control group. Conclusion: These results suggest that in aged rat force deficit and histopathological changes of gastrocnemius muscle after chronic strain injury were reminded after 10 weeks. Therapeutic Resistance training with an emphasis on concentric phase, low velocity and adequate rest can attenuate functional and histopathological changes in muscle after chronic strain injury in elderly rats.
Article
Full-text available
Background & Aim: Resistance training (RT) is the most effective strategy to prevent age-related muscle wasting and weakness because it promotes muscle strength and function. As the loss of muscle mass contributes to sarcopenia, the effects of RT on hypertrophy and its myogenic processes is controversial in old age. The purpose of this study was to examine the effects of RT on strength, mass and protein level of myogenin in gastrocnemius muscle of elderly rats. Materials & Methods: Sixteen elderly male Sprague-Dawley rats (24-month age) divided equally into two groups (control and RT). RT group underwent 8weeks (3-days/week) of resistance training by climbing a wooden ladder with weights attached to their tails. 48h after the last session, isometric force, muscle wet mass and protein level of myogenin of gastrocnemius muscle were measured in both groups. Results: Absolute and relative (to body mass) isometric force of RT group were significantly greater than those in control group. There was not any significant difference in wet muscle mass between groups. Western blot analysis of muscle tissue also showed that the levels of myogenin did not significantly differ between two groups. Conclusion: Force production capacity and muscle quality (force to muscle mass ratio) were increased following resistance training in elderly rats through events are likely caused by neuromuscular adaptations. Additionally, the results suggest that increase in strength after resistance training in aged rats cannot be explained in terms of the changing in muscle mass and myogenin expression values.
Article
Full-text available
Background and purpose: Repetitive strain injury (RSI) is accompanied by an increase in extracellular matrix (ECM), atrophy, and reduces the muscle power. Resistance training (RT) have potential positive effects on muscle function and morphology in elderly. This research examined the effects of eight week therapeutic resistance training on recovery of pathological changes after 6weeks chronic eccentric contraction. Materials and methods: Eighteen elderly male Wistar rats were divided into three groups (control, RSI-rest, RSI-RT). Two experimental groups underwent 6weeks (5 days/week) of fast velocity submaximal eccentric contractions while the control group was inactive. After two weeks rest, RSI-RT group performed 8 weeks resistance training and RSI-rest group was detrained for 8 weeks. Gastrocnemius muscle response was assessed by isometric force and muscle wet mass. Quantitative histopathological analysis was also done in all groups. Results: Gastrocnemius tissue of injured limbs showed increase in ECM and decrease in myofiber area and isometric force after 6 weeks RSI model in RSI-rest group, but muscle wet mass did not change. RT significantly improved isometric force, myofiber area percent but decreased non-contractile area percentage. However, pathological changes after RSI were not fully recovered by RT. Conclusion: Therapeutic Resistance training with an emphasis on concentric phase, low velocity and adequate rest can attenuate functional and histopathological changes in muscle after chronic strain injury in elderly rats.
Article
Full-text available
Background: Musculoskeletal disorders have been recognized as a worldwide health problem. One of the measures for controlling these disorders is workplace exercise, either at the workstation or in a separate environment within the company. However, there is controversy regarding the effectiveness and means of applying these interventions. Objectives: To assess and provide evidence of the effectiveness of workplace exercise in controlling musculoskeletal pain. Methods: The following databases were searched: PubMed, MEDLINE, Embase, Cochrane, PEDro and Web of Science. Two independent reviewers selected the elegible studies. Possible disagreements were solved by consensus. All randomized controlled clinical trials that evaluated exercise interventions in the workplace musculoskeletal pain relief were included. The PEDro scale (range=0-10 points) was used to rate the quality of the studies included in this review. Results and Conclusions: The electronic search yielded a total of 8680 references published in English. At the end of the selection process, 18 studies were included. Strong evidence was found to support the effectiveness of physical exercise in controlling neck pain among workers who performed sedentary tasks in offices or administrative environments, while moderate evidence was found for low back pain relief among healthcare and industrial workers who performed heavy physical tasks. These positive results were reported when the training periods were longer than 10 weeks, the exercises were performed against some type of resistance and the sessions were supervised. None of the studies evaluating sedentary workers reported positive results for controlling musculoskeletal shoulder pain. Further randomized controlled trials are needed to comparatively evaluate, among other aspects, the effects of light and heavy training for shoulder pain relief.
Article
Full-text available
BACKGROUND: Musculoskeletal disorders have been recognized as a worldwide health problem. One of the measures for controlling these disorders is workplace exercise, either at the workstation or in a separate environment within the company. However, there is controversy regarding the effectiveness and means of applying these interventions. OBJECTIVES: To assess and provide evidence of the effectiveness of workplace exercise in controlling musculoskeletal pain. METHODS: The following databases were searched: PubMed, MEDLINE, Embase, Cochrane, PEDro and Web of Science. Two independent reviewers selected the elegible studies. Possible disagreements were solved by consensus. All randomized controlled clinical trials that evaluated exercise interventions in the workplace musculoskeletal pain relief were included. The PEDro scale (range=0-10 points) was used to rate the quality of the studies included in this review. Results and CONCLUSIONS: The electronic search yielded a total of 8680 references published in English. At the end of the selection process, 18 studies were included. Strong evidence was found to support the effectiveness of physical exercise in controlling neck pain among workers who performed sedentary tasks in offices or administrative environments, while moderate evidence was found for low back pain relief among healthcare and industrial workers who performed heavy physical tasks. These positive results were reported when the training periods were longer than 10 weeks, the exercises were performed against some type of resistance and the sessions were supervised. None of the studies evaluating sedentary workers reported positive results for controlling musculoskeletal shoulder pain. Further randomized controlled trials are needed to comparatively evaluate, among other aspects, the effects of light and heavy training for shoulder pain relief.
Article
Full-text available
The aim of this randomized controlled trial was to assess changes in myalgic trapezius activation, muscle oxygenation, and pain intensity during repetitive and stressful work tasks in response to 10 weeks of training. In total, 39 women with a clinical diagnosis of trapezius myalgia were randomly assigned to: (1) general fitness training performed as leg-bicycling (GFT); (2) specific strength training of the neck/shoulder muscles (SST) or (3) reference intervention without physical exercise. Electromyographic activity (EMG), tissue oxygenation (near infrared spectroscopy), and pain intensity were measured in trapezius during pegboard and stress tasks before and after the intervention period. During the pegboard task, GFT improved trapezius oxygenation from a relative decrease of -0.83 ± 1.48 μM to an increase of 0.05 ± 1.32 μM, and decreased pain development by 43%, but did not affect resting levels of pain. SST lowered the relative EMG amplitude by 36%, and decreased pain during resting and working conditions by 52 and 38%, respectively, without affecting trapezius oxygenation. In conclusion, GFT performed as leg-bicycling decreased pain development during repetitive work tasks, possibly due to improved oxygenation of the painful muscles. SST lowered the overall level of pain both during rest and work, possibly due to a lowered relative exposure as evidenced by a lowered relative EMG. The results demonstrate differential adaptive mechanisms of contrasting physical exercise interventions on chronic muscle pain at rest and during repetitive work tasks.
Article
In asynchronous populations of HeLa cells maintained at control or heat shock temperatures, HSP70 levels and its subcellular distribution exhibit substantial heterogeneity as demonstrated by indirect immunofluorescence with HSP70-specific monoclonal antibodies. Of particular interest is a subpopulation of cells in which the characteristic nuclear accumulation and nucleolar association of HSP70 is not detected after heat shock treatment. This apparent variation in the heat shock response is not observed when synchronized cells are examined. In this study, we demonstrate that three monoclonal antibodies to HSP70, in particular, do not detect nucleolar-localized HSP70 in heat-shocked G2 cells. This is not due to an inability of G2 cells to respond to heat shock as measured by increased HSP70 mRNA and protein synthesis, or due to a lack of accumulation of HSP70 after heat shock in G2. Rather the epitopes recognized by the various antibodies appear to be inaccessible, perhaps due to the association of HSP70 with other proteins. Non-denaturing immunoprecipitations with these HSP70-specific antibodies suggest that HSP70 may interact with other cellular proteins in a cell cycle-dependent manner.
Article
Strength training represents an alternative to endurance training for patients with type 2 diabetes. Little is known about the effect on insulin action and key proteins in skeletal muscle, and the necessary volume of strength training is unknown. A total of 10 type 2 diabetic subjects and 7 healthy men (control subjects) strength-trained one leg three times per week for 6 weeks while the other leg remained untrained. Each session lasted no more than 30 min. After strength training, muscle biopsies were obtained, and an isoglycemic-hyperinsulinemic clamp combined with arterio-femoral venous catheterization of both legs was carried out. In general, qualitatively similar responses were obtained in both groups. During the clamp, leg blood flow was higher (P < 0.05) in trained versus untrained legs, but despite this, arterio-venous extraction glucose did not decrease in trained legs. Thus, leg glucose clearance was increased in trained legs (P < 0.05) and more than explained by increases in muscle mass. Strength training increased protein content of GLUT4, insulin receptor, protein kinase B-alpha/beta, glycogen synthase (GS), and GS total activity. In conclusion, we found that strength training for 30 min three times per week increases insulin action in skeletal muscle in both groups. The adaptation is attributable to local contraction-mediated mechanisms involving key proteins in the insulin signaling cascade.
Article
 Cells of a temperature-sensitive mutant line (tsFT101) derived from a mouse mammary carcinoma cell line (FM3A) become multinucleated at a non-permissive temperature of 39°C because of disturbed cytokinesis. To explore how this relates to thermotolerance, we examined the proliferative activity of, and heat shock protein (HSP) expression in, FM3A and tsFT101 cells cultured at 37°C and 39°C after heat shock pretreatment (15 min exposure at 45°C). FM3A cells developed thermotolerance when cultured at both 37°C and 39°C, but whereas tsFT101 cells developed thermotolerance at 37°C, this was markedly reduced at 39°C. Western blot analysis showed similar degrees of expression of constitutive HSP70 (HSP73) in FM3A and tsFT101 cells after heat shock pretreatment at both 37°C and 39°C. However, expression of inducible HSP70 (HSP72) was reduced in tsFT101 cells at 39°C compared to 37°C and to FM3A cells at both 37°C and 39°C. Heat shock pretreatment activated DNA binding of heat shock transcription factor (HSF) in FM3A cells at 37°C and 39°C, but only at 37°C in tsFT101 cells. These results indicate that (1) multinucleation caused by disturbed cytokinesis increases temperature sensitivity, (2) HSP70 is critical for the development of thermotolerance in both FM3A and tsFT101 cells, and (3) decreased expression of inducible HSP70 parallels deficient development of thermotolerance in tsFT101 cells cultured at a non-permissive temperature.
Article
While strength training has been shown to be effective in mediating hypertrophy and reducing pain in trapezius myalgia, responses at the cellular level have not previously been studied. This study investigated the potential of strength training targeting the affected muscles (SST, n = 18) and general fitness training (GFT, n = 16) to augment the satellite cell (SC) and macrophage pools in the trapezius muscles of women diagnosed with trapezius myalgia. A group receiving general health information (REF, n = 8) served as a control. Muscle biopsies were collected from the trapezius muscles of the 42 women (age 44 ± 8 years; mean ± SD) before and after the 10 week intervention period and were analysed by immunohistochemistry for SCs, macrophages and myonuclei. The SC content of type I and II fibres was observed to increase significantly from baseline by 65% and 164%, respectively, with SST (P < 0.0001), together with a significant correlation between the baseline number of SCs and the extent of hypertrophy (r = -0.669, P = 0.005). SST also resulted in a 74% enhancement of the trapezius macrophage content (P < 0.01), accompanied by evidence for the presence of an increased number of actively dividing cells (Ki67(+)) post-SST (P < 0.001). GFT resulted in a significant 23% increase in the SC content of type II fibres, when expressed relative to myonuclear number only (P < 0.05). No changes in the number of myonuclei per fibre or myonuclear domain were detected in any group. These findings provide strong support at the cellular level for the potential of SST to induce a strong myogenic response in this population.
Article
Insulin-like growth factor I (IGF-I) peptide levels have been shown to increase in overloaded skeletal muscles (G. R. Adams and F. Haddad. J. Appl. Physiol. 81: 2509-2516, 1996). In that study, the increase in IGF-I was found to precede measurable increases in muscle protein and was correlated with an increase in muscle DNA content. The present study was undertaken to test the hypothesis that direct IGF-I infusion would result in an increase in muscle DNA as well as in various measurements of muscle size. Either 0.9% saline or nonsystemic doses of IGF-I were infused directly into a non-weight-bearing muscle of rats, the tibialis anterior (TA), via a fenestrated catheter attached to a subcutaneous miniosmotic pump. Saline infusion had no effect on the mass, protein content, or DNA content of TA muscles. Local IGF-I infusion had no effect on body or heart weight. The absolute weight of the infused TA muscles was approximately 9% greater (P < 0.05) than that of the contralateral TA muscles. IGF-I infusion resulted in significant increases in the total protein and DNA content of TA muscles (P < 0.05). As a result of these coordinated changes, the DNA-to-protein ratio of the hypertrophied TA was similar to that of the contralateral muscles. These results suggest that IGF-I may be acting to directly stimulate processes such as protein synthesis and satellite cell proliferation, which result in skeletal muscle hypertrophy.