ArticlePDF Available

Pathways of cryptic invasion in a fish parasite traced using coalescent analysis and epidemiological survey

Authors:

Abstract and Figures

Introduced species have the potential to outperform natives via the introduction of new para-sites to which the native ecosystem is vulnerable. Cryptic diversity within an invasive species can obscure invasion patterns and confound proper man-agement measures. The aim of this study is to use coalescent theory based methodology to trace recent routes of invasion in populations of Ligula intestinalis, a globally distributed fish parasite possessing both native and recently introduced populations in North Africa. Molecular analyses of mitochondrial DNA discerned a pronounced genetic divergence between introduced and native populations. Distribution of mitochondrial haplotypes demonstrated common origin of European populations with North African parasites sampled from introduced fish species in Tunisia. To test the suggested pathway of introduc-tion, microsatellite data were examined in a model-based coalescent analysis using the software MIGRATE, where Europe to Tunisia direction of migration was favoured over alternative hypotheses of gene flow. Specificity of Tunisian populations to different host species was assessed in an epidemiol-ogic survey confirming prevailing host-based division between introduced and native parasites in North Africa. This approach combining advanced analysis
Content may be subject to copyright.
ORIGINAL PAPER
Pathways of cryptic invasion in a fish parasite traced using
coalescent analysis and epidemiological survey
Wafa Bouzid
Jan S
ˇ
tefka
Lilia Bahri-Sfar
Peter Beerli
Ge
´
raldine Loot
Sovan Lek
Noura Haddaoui
Va
´
clav Hyps
ˇ
a
Toma
´
s
ˇ
Scholz
Tahani Dkhil-Abbes
Rafik Meddour
Oum Kalthoum Ben Hassine
Received: 16 July 2012 / Accepted: 9 January 2013
Ó Springer Science+Business Media Dordrecht 2013
Abstract Introduced species have the potential to
outperform natives via the introduction of new para-
sites to which the native ecosystem is vulnerable.
Cryptic diversity within an invasive species can
obscure invasion patterns and confound proper man-
agement measures. The aim of this study is to use
coalescent theory based methodology to trace recent
routes of invasion in populations of Ligula intestinalis,
a globally distributed fish parasite possessing both
native and recently introduced populations in North
Africa. Molecular analyses of mitochondrial DNA
discerned a pronounced genetic divergence between
introduced and native populations. Distribution of
mitochondrial haplotypes demonstrated common
origin of European populations with North African
parasites sampled from introduced fish species in
Tunisia. To test the suggested pathway of introduc-
tion, microsatellite data were examined in a model-
based coalescent analysis using the software
MIGRATE, where Europe to Tunisia direction of
migration was favoured over alternative hypotheses of
gene flow. Specificity of Tunisian populations to
different host species was assessed in an epidemiol-
ogic survey confirming prevailing host-based division
between introduced and native parasites in North
Africa. This approach combining advanced analysis
W. Bouzid
Venoms and Biological Activities Laboratory, EA 4357,
PRES-Universite
´
de Toulouse, Jean-Franc¸ois
Champollion University Center, 81012 Albi, France
J. S
ˇ
tefka (&) V. Hyps
ˇ
a T. Scholz
Biology Centre ASCR, Institute of Parasitology
and Faculty of Science, University of South Bohemia,
Branis
ˇ
ovska
´
31, 37005 Ceske Budejovice,
Czech Republic
e-mail: jan.stefka@gmail.com
J. S
ˇ
tefka
Entomology Department, Natural History Museum,
Cromwell Road, SW7 5BD London, UK
L. Bahri-Sfar N. Haddaoui O. K. B. Hassine
Unite
´
de Recherche Biologie, Ecologie et Parasitologie
des organismes Aquatiques, Faculte
´
des Sciences de
Tunis, Tunis, Tunisia
P. Beerli
Department of Scientific Computing, Florida State
University, Tallahassee, FL 32311, USA
G. Loot S. Lek
Laboratoire Evolution et Diversite
´
Biologique,
U.M.R. CNRS-UPS 5174, Universite
´
Paul Sabatier,
118 Route de Narbonne, 31062 Toulouse cedex 4, France
T. Dkhil-Abbes
Laboratoire d’Aquaculture, INSTM,
28 rue du 2 mars 1934, 2035 Salammbo
ˆ
, Tunisia
R. Meddour
Laboratoire de Pisciculture et Pathologie, De
´
partement
des Sciences de la Mer, Faculte
´
des Sciences, Universite
´
Badji Mokhtar Annaba, Annaba, Algeria
123
Biol Invasions
DOI 10.1007/s10530-013-0418-y
of molecular markers with host-specificity data allows
revealing the evolution of host-parasite interactions
following biological invasion and provides basis for
devising future management measurements.
Keywords Aquaculture Coevolution
Directionality of migration Population split
Ligula intestinalis Parasite introduction
Introduction
Species introductions and invasions represent an
important threat to the functioning of ecosystems
(Clavero and Garcı
´
a-Berthou 2005), affect biodiver-
sity in invaded areas and may lead to significant
economic loss (Pimentel et al. 2005). Unlike free-
living organisms, which are often introduced to new
areas deliberately, parasites are usually inserted unin-
tentionally, simultaneously with their hosts. Despite
their partially hidden engagement, parasites often play
a key role in the invasion process of their hosts
(Prenter et al. 2004). When transferred to native
species, invading parasites can rapidly cause species
loss in favor of the introduced host species. Examples
of introduced parasites having detrimental impact on
local populations include malaria in Hawaii birds (Van
Riper III et al. 1986), poxvirus in red squirrels
(Rushton et al. 2006) and nematodes in European eel
(Sasal et al. 2008; Wielgoss et al. 2008).
Despite numerous examples of detrimental impact
of the introduced parasites or pathogens on terrestrial
and aquatic ecosystems, very few studies explored the
population genetic parameters of introduced parasitic
species or traced the routes of invasion using molec-
ular data. Surprisingly, amongst the few cases where
the relationships between native and introduced pop-
ulations of parasites were studied, it was often found
that introduced populations may represent several
genetically isolated clusters with independent origin
such as the giant river fluke parasitizing deer (Kra
´
lova
´
-
Hromadova
´
et al. 2011). Using mitochondrial
(mtDNA) haplotype data, it was demonstrated that at
least two independent introductions of flukes from
North America to Europe occurred, each from a
different area of the original range. In another case,
several lineages of a parasite differing in their host
preference were found in the newly invaded area.
Chytrid fungus that is rapidly spreading in amphibian
populations world-wide was shown to comprise sev-
eral lineages with different affinity and pathogenicity
on different amphibian hosts occurring in wild or bred
in captivity in Japan (Goka et al. 2009).
To devise effective measures against future intro-
duction of new species and to prevent recurrent
introduction of already established invaders, it is
important to identify the invasion routes and the
directionality of gene flow, especially in cases where
historical information is lacking or the biological
invasion emerges and propagates very quickly without
prior notice (Mergeay et al. 2006; Dlugosch and
Parker 2008). Estimating the direction and intensity of
gene flow in the situation where the exact source
population is unknown may be confounded by recur-
rent introductions and short time since the initial
colonization of new areas (Therriault et al. 2005).
Strong genetic links may prevail for generations in
populations that were only recently separated from
their ancestors, especially in cases where new area was
colonized by a large sample of the original population
(Wattier et al. 2007).
Frequently, the routes of species introduction are
situated between the new and old world ecosystems of
the temperate and tropic zones (e.g. Brown and
Stepien 2010; Ascunce et al. 2011). Here, we explore
a situation in which a fish stock of European origin has
been introduced into several freshwater systems of
North Africa. In an attempt to enrich the local fish
fauna, and rehabilitate dam reservoirs of Tunisia,
various European fish species (particularly cyprinids)
were introduced and stocked to complement the sole
indigenous species, the barbel Barbus callensis, and
the minnow Pseudophoxinus callensis. The introduc-
tions took place in 1960s following the Tuniso-
German cooperation project GTZ (Losse et al.
1991). For instance, the roach (Rutilus rubilio) and
the rudd (Scardinius erythrophthalmus) were intro-
duced from southern Europe (primarilly Italy) to serve
as forage for fish of economical importance, especially
for the sander Stizostedion lucioperca (Kraı
¨
em 1991;
Losse et al. 1991).
These introduced species are known to be potential
hosts for the diphyllobothriidean cestode Ligula
intestinalis (e.g. Manilla et al. 1984). The parasite
possesses a three-host lifecycle with copepods and fish
as intermediate hosts and piscivorous birds as the
definite host (Dubinina 1980). The secondary larvae
(plerocercoids) inhabiting body cavities of cyprinid
W. Bouzid et al.
123
fish cause severe pathogenic effects on the fish growth
(Loot et al. 2002), morphology (Loot et al. 2001a),
sexual development (Carter et al. 2005) and behaviour
(Brown et al. 2001), leading to high mortality rates in
fish populations (Loot et al. 2001b). Due to its
importance in fish aquaculture and popularity
in ecological and evolutionary studies L. intestinalis,
has become a favourite parasitic model organism
(Hoole et al. 2010) and its host preferences and
geographical distribution in Euro-Asia are very well
explored (Dubinina 1980). In Tunisia, the presence
of the parasite was reported in the introduced roach
R. rubilio and rudd S. erythrophtalamus in Sidi Salem
and Nebhana dam reservoirs (Kraı
¨
em 1991; Djemali
2005; Bahri-Sfar et al. 2010). Elsewhere in Africa,
Ligula infection has only been reported from native
cyprinid species (Khalil and Polling 1971; Dejen et al.
2006).
Earlier studies dealing with genetic variability of
Ligula populations on a global scale showed that
L. intestinalis comprises several genetically isolated
lineages with separated host spectra and distinct
geographic distribution (Bouzid et al. 2008a, b;S
ˇ
tefka
et al. 2009). The populations inhabiting European and
North African regions were found to comprise two
sympatric mitochondrial clades, termed clade A and
B, which markedly differed in their host preference.
The clade A was suggested to have been introduced to
the North African area with its cyprinid hosts, whereas
clade B was found to be native in both areas. Using
microsatellite data, the study of S
ˇ
tefka et al. (2009)
found significant amount of structure between the
introduced and native populations of clade A, whereas
no indication of population structure was found inside
the European continent despite geographically and
host extensive sampling. The uniformity of the
European clade A populations was accounted to the
dispersion with bird hosts mediating extensive gene
flow. Due to short duration of the infection in the
definitive host, it was suggested that Mediterranean
Sea represents a barrier impassable for parasites with
their bird hosts migrating across the sea annually,
however the directionality of the ancestral genetic
connection between Europe and North-Africa and the
potential of introduced parasites to threat local fish
fauna were left unexplored.
Using molecular and epidemiologic data we aim to
(1) consolidate the phylogenetic position of native and
introduced populations of L. intestinalis in the Euro-
Mediterranean area with respect to the global distri-
bution of the species; (2) explore differences in host
preference between native and introduced populations
in North Africa and (3) investigate the directionality
of gene flow between L. intestinalis populations in
Europe and the introduced North African populations.
Materials and methods
Study area and fish sampling
Fish specimens from introduced European fish, roach
(R. rubilio) and rudd (
S. erythrophthalmus) were
sampled in Tunisia from summer 2004 to autumn
2005. The sampling of these species was realized in
Sidi Salem reservoir, which constitutes the largest
reservoir of drinking water in the north-west of
Tunisia (surface of 4,300 ha and depth of about
10 m at normal level) and Nebhana reservoir located
in central Tunisia (surface of 540 ha and depth of
about 10 m at normal level). In order to prevent young
fish that are not infected with plerocercoids from
capturing, net meshes sized 40 mm were used. In the
same period, native barbels (B. callensis) were sam-
pled in Sidi Salem and Nebhana sites using seine-net.
Collected parasites were stored in 70 % ethanol and
kept in freezer prior to molecular analyses.
Parasite specimens from native minnow (P. call-
ensis) were provided by Dr. M. Kraı
¨
em and collabo-
rators from the National Institute of Marine Sciences
and Technologies, Salammbo
ˆ
, Tunisia. These speci-
mens were collected in 2004 using the seine-net
throughout the banks of Joumine (surface of 234 km
2
with a depth of about 1 m) and Remel (surface of 684
Km
2
, with a depth of about 1 m 30) (North and North
east of Tunisia respectively) where a great number of
P. callensis occur (Kraı
¨
em 1983). P. callensis parasite
specimens were preserved in denatured ethanol since
their collection in 2004.
Parasite samples from Algeria provided by Alge-
rian colleagues (see Acknowledgement) were origi-
nally fixed in formalin and later transfered to pure
ethanol in our laboratory. Samples from the European
area of distribution were collected in the frame of
previous studies (Bouzid et al. 2008b;S
ˇ
tefka et al.
2009) (see map in Fig. 1 for localities sampled in the
Pathways of cryptic invasion in a fish parasite
123
European and north African areas of distribution).
Complete list of localities and specimens analysed in
this study is available in Table 1.
Parasite analyses
For material collected in Tunisia, each individual fish
was dissected to count plerocercoids present in the
abdominal cavity. Plerocercoid larvae of L. intestinal-
is were identified using the determination key of
Dubinina (1980). The Prevalence (P) and Mean
Intensity (MI) were calculated as defined by Margolis
et al. (1982). No epidemiology data were available for
samples from Algeria, which were collected prior to
this study.
PCR amplification and DNA sequencing
Molecular characterization of collected parasites were
carried out using concatenated matrix of sequences of
cytochrome oxidase I (COI) and cytochrome b (COB)
genes, and then compared to available sequences
from Genbank obtained earlier (Bouzid et al. 2008b)
belonging to specimens from a large geographic scale.
Details of collection localities, fish host species,
number of specimens analysed and their accession
numbers are given in Table 1.
Total genomic DNA was extracted using the
Promega DNA isolation kit (Promega, Madison, WI)
from samples stored in ethanol. PCR reactions were
performed using conditions and primers from
Bouzid et al. (2008a, b). Purified DNA (20 ng/ll)
was sequenced directly with ABI BigDye chemistry
using the same primers as for DNA amplification.
DNA extractions using Chelex 100 Resin (Sigma-
Aldrich) were applied to Algerian samples xed in
formalin. Approximately 2 mm of dried plerocercoid
tissue was placed into a tube containing 100 llof10%
Chelex solution. Tubes were kept at 95 °C for 30 min
and vortexed occassionally. Prior to PCR, the tubes were
vortexed and spinned down on a microcentrifuge and
2 ll of supernatant were used for amplification. Since
some extractions failed to amplify, probably due to
DNA degradation caused by formalin, new sets of
primers for COI and COB were designed (Table 2).
These internal primers annealed in conserved regions
inside the two genes and were used with regular forward
and reverse PCR primers in the PCRs as described
Clade A-native in Europe
Clade B-native in Europe/N. Africa
probably Clade A-lacking molecular data
Sidi Salem
Joumine
Nebhana
Remel
Fig. 1 Map of the distribution of L. intestinalis populations studied in the Euro-Mediterranean area of distribution. Detailed
information on localities and sample sizes is provided in Table 1
W. Bouzid et al.
123
Table 1 Geographic origin and host species of Ligula samples
Country of
origin
Collection
locality
Host species Symbol Number of samples
analysed
for both genes (haplotype
numbers used in Figs. 1, 2)
GenBank accession number
COB COI
Algeria Keddara reservoir Barbus sp. ALG1Bsp 4 (1, 2, 4) JQ279107/44-45/48 JQ279072
Taksebt reservoir Barbus setivimensis ALG2Bs 3 (2, 3) JQ279108/46-47 JQ279070-71/73
Oued Hamiz Barbus sp. ALG3Bsp 10 (1, 4, 5, 7, 8, 9) JQ279106/09-12/14-15
[EU241143-45]
JQ279068/74-79
[EU241219-21]
Oubeira reservoir P. callensis ALG4Pc 1 (6) JQ279113 *
Australia Goodga river Galaxias truttaceus
(Osmeriformes)
AU Gt 1 (10) [EU241146] [EU241222]
Moates lake Galaxias maculatus
(Osmeriformes)
AU Gm 1 (11) [EU241147] [EU241223]
Canada Dalpec lake Coulsius plumbeus CA Cp 1 (14) [EU241152] [EU241228]
Dumbo lake Semotilus atromaculatus CA Sa 4 (12, 13, 15, 16) [EU241148-49/50-51] [EU241224-27]
China Dong Tink lake Hemiculter bleekeri CN Hb 2 (18) [EU241153-54] [EU241229-30]
Zhanghe reservoir Neosalanx taihuensis
(Osmeriformes)
CN Nt 3 (17, 19) [EU241155-57] [EU241232/34/36]
Czech Republic Lipno reservoir Rutilus rutilus CZ1Rr 4 (22, 26, 35, 36) [EU241159/65/69/70] [EU2412477-81]
Zelivka reservoir CZ2Rr 1 (37) [EU241178] [EU241282]
Alburnus alburnus CZ2Aa 1 (34) [EU241177] [EU241246]
Nove
´
Mly
´
ny reservoir Abramis brama CZ3Ab 5 (27, 28, 29, 30, 31) [EU241166/79/80/82/84] [EU241263-70/83-86]
Za
´
hlinice and Tlumac
ˇ
ov
ponds
Podiceps cristatus—bird
host
CZ4Pc 6 (20, 21, 23, 32) [EU241164/67/68/74/87/90/91] [EU241244-45/62/87/93]
Mergus merganser—bird
host
CZ4 Mm 1 (24) [EU241193] [EU241239]
Tovacov pond P. cristatus—bird host CZ5Pc 1 (33) [EU241186] [EU241288]
Estonia Peipsi lake A. brama EE Ab 5 (24, 43, 44, 45, 46) JQ279121-22 [EU241160/92/95] JQ279085-86
[EU241275-76/94]
Ethiopia Tana lake Barbus humilis ET Bh 1 (47) [EU241197] [EU241295]
Barbus tsanensis ET Bt 1 (48) [EU241196] [EU241296]
Barbus intermedius ET Bi 1 (49) [EU241198] [EU241297]
France Pareloup and Vioulou
lakes
A. alburnus FR1Aa 3 (21, 52, 53) JQ279123-24 [EU241163/99] JQ279087-88
[EU241258/60]
R. rutilus FR1Rr 5 (21, 41, 50) JQ279117/19/42 [E] JQ279081/83-84/104
Muret and Lavernose
lakes
FR2Rr 2 (41, 51) JQ279118/43 JQ279082/105
Blicca bjoerkna FR2Bb 1 (51) [EU241201] [EU241259]
Cre
´
teil reservoir R. rutilus FR3Rr 5 (50, 54, 55, 56, 57, 58) JQ279125-26
[EU241172/73/200]
JQ279089/90
[EU241261/99/300,
EU636655]
Pathways of cryptic invasion in a fish parasite
123
Table 1 continued
Country of
origin
Collection
locality
Host species Symbol Number of samples
analysed
for both genes (haplotype
numbers used in Figs. 1, 2)
GenBank accession number
COB COI
Germany Mu
¨
ggelsee R. rutilus DE Rr 6 (34, 38, 39, 40, 41, 42) JQ279116/20 [EU24185/202-04]] JQ279080/84 [EU241273-74/
301/02]
Great Britain Scotland, river Gryfe R. rutilus GB Rr 1 (59) [EU241205] [EU241303]
P. phoxinus GB Pp 1 (60) [EU241175] [EU241304]
Wales, Aberystwyth P. phoxinus GB Pp 1 (44) [EU241161] [EU241247]
N. Ireland Lough Neagh lake R. rutilus IE Rr 3 (41, 61, 64) [EU241117/206/07] [EU241248-50]
Gobio gobio IE Gg 3 (20, 62, 63) [EU241188/89/208] [EU241290/305]
Poland Wloclawski reservoir Rhodeus amarus PL Ra 1 (25) [EU241194] [EU241289/92]
Russia Khanka lake, Far East Hemiculter lucidus RU Hl 1 (65) [EU241209] [EU241311]
Rybinsk reservoir A. brama RU Ab 5 (44, 66, 67, 68, 69) [EU241158/210/11/12/13] [EU241251-56/58/309-10]
Tunisia Sidi Salem reservoir R. rubilio TN1Rb 8 (70, 71, 73, 81) JQ279127-29 [EU241214-17] JQ279091-92 [EU241271/312-
15]
S. erythrophthalmus TN1Se 5 (21, 72, 73, 80) JQ279130/32/34/41 [EU241162] JQ279093/95/97/103
[EU241272]
B. callensis ––
P. callensis ––
Nebhana reservoir R. rubilio TN2Rb 2 (74, 75) JQ279135-36 JQ279098-99
S. erythrophthalmus TN2Se 2 (73) JQ279131/33 JQ279094/96
B. callensis ––
P. callensis ––
Oued Joumine P. callensis TN3Psc 2 (76, 77) JQ279137/38 JQ279100-01
Oued Remel P. callensis TN4Psc 2 (78, 79) JQ279139/40 JQ279102
Ukraine Dniester river Carassius carassius UA Cc 1 (83) [EU241218] [EU241238]
R. rutilus UA Rr 1 (84) [EU241176] [EU241317]
A. alburnus UA Aa 1 (82) [EU241181] [EU241316]
Totals 199 (84)
Distribution of 84 haplotypes (referred to under their GenBank Accession numbers) is given
GenBank accession number between [] refer to sequence retrieved from Bouzid et al. (2008b)
*, Sequencing failed due to formalin caused DNA degradation
–, No Ligula specimen was found in the corresponding host/locality
W. Bouzid et al.
123
above. Thus, each gene was amplified and sequenced in
two smaller fragments (approximately 200 bp in
length). Same PCR approach was applied to some of
the Tunisian samples stored in denatured ethanol, which
also showed lower amplification success.
Concatenated alignments of mitochondrial COI and
COB genes were created in BioEdit (Hall 1999)
without use of manual corrections. Program Collapse
1.2 (Posada 2004) was used to retrieve individual
haplotypes.
Phylogenetic analyses
The evolutionary history of samples was inferred from
the matrix of concatenated COI and COB haplotypes
using Maximum Parsimony (MP), Maximum Likeli-
hood (ML) and Bayesian inference (BI) methods. The
software Mega v.4 (Tamura et al. 2007) was employed
for the MP analysis using the Close-Neighbor-
Interchange algorithm with search level 3 (Nei and
Kumar 2000), where the initial trees were obtained
with the random addition of sequences (10 replicates).
Calculation of bootstrap consensus tree was inferred
from 1,000 replicates.
ML analysis was performed in PhyML v. 3.0
(Guindon et al. 2010). The analysis was run using
GTR ? G model and the parameters of gamma
distribution were estimated from the data. The model
of molecular evolution of sequences was selected
using Akaike Information Criterion in Modeltest
(Posada and Crandall 1998). Bootstrap support was
obtained by 1,000 replications.
BI reconstruction of phylogeny was performed in
MrBayes 3.2.16 (Huelsenbeck and Ronquist 2001)
using 10 million Markov Chain Monte Carlo (MCMC)
replications and two independent runs (4 chains each).
Based on the Akaike Information Criterion in MrMod-
eltest 2.3 (Nylander 2004), the GTR ? I ? G model
was the best supported model of molecular evolution.
Convergence between parameter estimates and the
effective sampling sizes were checked in Tracer 1.5
(Rambaut and Drummond 2005). Credibility of
obtained topologies was checked using program
AWTY (Nylander et al. 2008), where consistency
between two independent runs and posterior proba-
bility trends of the identified clades were inspected
across successive MCMC steps. COI and COB
sequences of a diphyllobothridean tapeworm Diphyl-
lobothrium latum (GenBank accession no. AB269325)
were used as outgroup.
Population structure and genetics of European
and N. African lineages
Genealogy of obtained mtDNA haplotypes was
reconstructed using TCS 1.21 (Clement et al. 2000).
Statistics of genetic diversity (haplotype diversity—
Hd; nucleotide diversity—Pi) and neutrality tests (Fu
and Li’s D and Tajima’s D) were performed in
DNASP 5.1 (Librado and Rozas 2009). Dataset
containing combined COI and COB was also used to
assess the level of population structure among studied
samples performing Analysis of Molecular Variance
(AMOVA) in Arlequin 3.5 (Excoffier and Lischer
2010). The calculations based on the F
ST
coefficient
(Weir and Cockerham 1984) were run using 10,000
permutations. Three levels of structure were evaluated
independently for two Euro-Mediterranean clades A
and B: (1) variability among European and North
African populations, (2) variability among popula-
tions (localities) inside the two landmasses, and (3)
variability among specimens inside each population.
Directionality of gene flow
Microsatellite data obtained by S
ˇ
tefka et al. (2007,
2009) were employed to test the hypothesis of Europe
to Tunisia directionality of migration (i.e. invasion) of
the clade A L. intestinalis populations. The dataset
contains allelic data for 15 microsatellite loci in 189
specimens of European Ligula and 53 specimens of
Tunisian Ligula. To detect directional gene flow, we
Table 2 COI and COB
internal primers used to
sequence L. intestinalis
from Algeria fixed in
formalin
Gene Sequence (5
0
to 3
0
) Direction Gene position
COI TTTAGTTCAGTTACTATGATTATTGGC Sense 913–938
COI GCCAATAATCATAGTAACTGAACTAAA Antisense 938–913
COB GCTGCTACTGTGTTAACTGCAATAG Sense 397–421
COB CTATTGCAGTTAACACAGTAGCAGC Antisense 421–397
Pathways of cryptic invasion in a fish parasite
123
analysed the data for several contradicting structured
population models using a Bayes factor approach
(Jeffreys 1961; Kass and Raftery 1995) built into the
program MIGRATE 3.2 (Beerli 2006; Beerli and
Palczewski 2010). The Bayes factor analyses allow
ordering of alternative, not necessarily nested popu-
lation models. Bayes factors also take into account the
available amount of data and the number of estimated
parameters. In contrast, traditionally used likelihood
ratio tests require nested models and do not correct for
over-parameterization (Burnham and Anderson 2002).
MIGRATE 3.2 implements thermodynamic integra-
tion to allow accurate model selection and model
ordering. Model probabilities were calculated treating
the marginal likelihoods like model weights (Kass and
Raftery 1995), similar to the procedure described by
Burnham and Anderson (2002) for Akaike’s informa-
tion criterion weights.
The microsatellite analysis of S
ˇ
tefka et al. (2009)
using STRUCTURE software (Falush et al. 2007)did
not indicate any structuring inside Europeanpopulations
of clade A Ligula despite their wide geographical range.
To eliminate any effect that cryptic diversification
among these populations could have on the Migrate
analysis, the European samples were partitioned into 3
different sets and analysed independently against the
Tunisian population with 53 samples. The first set
contained a random sample of 75 plerocercoids from
all European populations totalling 189 plerocercoids
obtained by S
ˇ
tefka et al. (2009). The second set
contained 84 French samples, which are geographically
the closest sampled localities to Tunisia. For a compar-
ison to the French samples, the third analysed set
contained 58 plerocercoids from Czech localities, which
are geographically more distant. Microsatellite datasets
used in the analyses have been deposited in the Dryad
data repository (10.5061/dryad.54fk2).
Migrate analyses were run using four population
genetic models: (1) Four parameter model allowing
for two different sizes for the northern and southern
population and two independent migration parame-
ters; (2) Three parameter model identical to (1) except
that there is no migration from North to South; (3)
Three parameter model identical to (1) except that
there is no migration from South to North and (4) One
parameter model that assumes that the northern
and southern samples belong to the same panmictic
population. Each set of models was run for the
data pairs: France and Tunisia, Czech Republic and
Tunisia, Europe and Tunisia. The models were then
compared using their marginal likelihoods (Bayes
factors: Kass and Raftery 1995; Beerli and Palczewski
2010).
Before running all models, we established run time
parameters of MIGRATE so that replicated runs return
the same marginal likelihoods plus minus 0.5 log
likelihoods units. Each MIGRATE run used Bayesian
inference with 4 parallel chains with temperatures
1.0, 1.5, 3.0, and 1,000,000. Likelihoods from these
parallel chains were collected to approximate the
marginal likelihood using thermodynamic integration
(Beerli and Palczewski 2010). Run parameters were
the following: 100,000 steps burn-in, sampling 10,000
parameters every 100th step for each of the 15 loci.
Prior distributions were uniform and over the range
of 0–100 for the mutation-scaled effective population
size Theta (H) and 0–100 for the mutation-scaled
effective migration rate (M). Brownian motion
approximation to the stepwise microsatellite mutation
model (introduced in Migrate version 1.5, 2002, Blum
et al.2004) was used in the analysis.
Results
Epidemiological parameters of North African
populations
According to our observations, the parasite L. intes-
tinalis occurs in the two introduced species R. rubilio
and S. erythrophthalmus
populations in Sidi Salem
and Nebhana dam reservoirs in Tunisia. Moreover, the
parasite was also found to inhabit body cavities of the
autochthonous fish P. callensis in Joumine and Remel
sites. However, no specimen was found among the 120
dissected specimens of native B. callensis in sidi salem
and Nebhana reservoirs (Table 3). Paradoxically, in
Algeria, Ligula samples were found in native Barbus
sp in Keddara, Hamiz and Taksebt reservoirs and in
native P. callensis in Oubeira reservoir. In Algeria,
Ligula was also recovered from introduced Cyprinus
carpio and Anguilla anguilla (Anguillidae). Due to
a long-term fixation in formalin, these specimens
were unfortunately unsequenceable. This unse-
quenced material, probably belonging to the European
clade A, is marked on the map in Fig. 1.
Sampling in Tunisia was extensive enough to allow
epidemiological comparisons of infection between
W. Bouzid et al.
123
host species and localities. The values of prevalence
and mean intensity of infection with Ligula pleroc-
ercoids are provided in Table 3. The data show that
roach is more infected with Ligula than rudd in both
studied sites where the introduced species co-occur.
Prevalence (P) in Sidi Salem site is higher than that in
Nebhana site, whereas the mean intensity (MI) is much
lower in Sidi Salem than in Nebhana for both fish
species.
Sequences and phylogenetic analysis
The concatenated matrix of COI and COB sequences
was 801 bp long and contained data for 199 Ligula
specimens. A total of 104 samples belonged to the
Euro-Mediterranean populations from clades A and B,
43 new sequences were obtained in addition to earlier
studies (Bouzid et al. 2008b). Eighty-four different
haplotypes (23 new) were identified among the total
of 199 analysed samples.
MP, ML and BI analyses of the concatenated matrix
produced mutually congruent results with a robust
nodal support for most clades (Fig. 2). Basic structure
of the tree reflects geographical sampling of the
specimens. Well separated lineages were found for
samples from Europe, North Africa, Ethiopia and
other geographical units. With the exclusion of MP,
also the basal relationships among lineages from
geographicaly separate regions are relatively well
resolved compared to an earlier study analysing
shorter stretch of mtDNA (Bouzid et al. 2008b). All
sequenced Ligula specimens from the introduced
roach and rudd in Sidi Salem and Nebhana were
grouped in the same clade and clustered among the
European specimens. Ligula specimens collected form
autochtonous P. callensis were genetically distant
from the introduced forms and clustered in the same
clade as Algerian specimens from barbels (Fig. 2).
Population structure and genetics
The pattern of distribution of mtDNA haplotypes
clearly shows common origin of European and
Tunisian populations of the clade A Ligula. Tunisian
haplotypes are dispersed across nearly the whole
network of European samples. One haplotype (21) is
even shared among Tunisian, French and Czech
samples. An indication of emerging population struc-
ture is however visible with multiple Tunisian samples
gathered in haplotypes 71, 73 and 74 on one side of the
network. The clade B network shows higher degree of
separation with none of the haplotypes shared between
the two areas and with European haplotypes mostly
centred in one part of the network. European clade B
was sampled at much fewer localities than plerocerc-
oids of the clade A, thus to a certain degree the genetic
uniformity seen in European clade B samples may be
due to unsampled populations.
Genetic diversity statistics show similar values of
Hd for the clade A and B lineages (Table 4). The two
lineages, however, differ markedly in their Pi values.
Clade B showed an order of a magnitude higher value
(0.0375) than clade A (0.0056). Similarly, the two
clades differ in the results of the neutrality tests.
Whilst clade A shows strongly negative values for
both tests, clade B shows neutral results for Tajima’s D
but significantly positive value for Fu and Li’s D.
Several other differences emerge when populations
Table 3 Prevalence and
mean intensity of
L. intestinalis in introduced
and native host species in
Tunisian freshwater
Fish species Host ? parasite
status
Sampling
Site
Number of
inspected fish
Prevalence
(%)
Mean
intensity (MI)
R. rubilio Introduced Sidi Salem 256 14.8 2.9
Nebhana 79 5.1 6.3
S. erythrophthalmus Introduced Sidi Salem 95 4.2 1.8
Nebhana 72 1.4 4.0
B. callensis Native Sidi Salem 70 0.0 0.0
Nebhana 50 0.0 0.0
P. callensis Native Sidi Salem 20 0.0 0.0
Nebhana 15 0.0 0.0
Joumine 105 4.8 2.0
Remel 254 18.5 1.7
Pathways of cryptic invasion in a fish parasite
123
of the two lineages are analysed separately. Clade A
populations from N. Africa show lower Hd and
slightly lower Pi compared to the European popula-
tion. N. African population shows neutral values of
neutrality tests compared to highly negative results for
Europe. Differences are seen also between European
and N. African populations of clade B. European
population show much lower value of Pi and slightly
negative but significant values in both neutrality tests.
The results of AMOVA analysis correspond very
well to the patterns seen in haplotype genealogies
and in the diversity statistics. The volume of genetic
variability captured at the highest level, between
Europe and North Africa, shows moderate but signif-
icant values for both clades (Table 5). The value is
lower for clade B, which may reflect a smaller number
of samples analysed and shorter distances between
some haplotypes. The highest volume of variability
was however detected amongst samples within pop-
ulations, which again corresponds with the patterns
shown in Fig. 3.
Gene flow in the clade A
The MIGRATE analysis showed consistent results
over all runs for the three arrangements of the data.
Fig. 2 Maximum likelihood tree based on concatenated matrix
of sequences of cytochrome oxidase subunit I and cytochrome b.
The numbers at the nodes indicate bootstrap support values
higher than 60 % and posterior probabilities higher than 0.85
(MP/ML/BI). Haplotype numbers refer to the numbers listed in
Table 1. Numbers in parentheses denote the number of samples
grouped within a haplotype (if greater than one). Length of the
haplotype 2 terminal branch was shortened
W. Bouzid et al.
123
The direction of gene flow from Europe to Tunisia
received the highest support (Table 6). Analyses of
European subsets, France and Czech Republic,
resulted in a similar model order. The best models
were also those that allow for gene flow from North
to South.
Discussion
Phylogeography of Ligula populations
Species introductions are often followed by a rapid
spread of introduced organisms throughout invaded
areas (e.g. Fujisaki et al. 2010). Revealing invasion
routes and the level of gene flow between introduced
and parental populations may be obscured by the
speed of dissemination of introduced populations and
by insufficient knowledge of the genetic diversity of
populations in the original distribution range (Khamis
et al. 2009;Kra
´
lova
´
-Hromadova
´
et al. 2011). The data
and analyses presented in this study, successfully
address these problems in the tapeworm species
L. intestinalis. An earlier study by Bouzid et al.
(2008b) showed that L. intestinalis is a globally
distributed parasite forming multiple isolated lineages.
Most of the lineages displayed localized allopatric
distribution, but deeper evolutionary relationships
between several of these lineages remained unre-
solved. Samples of two lineages, one from Mexico
(Bouzid et al. 2008b) and one from China (Li et al.
2000; Li and Liao 2003), for which only COI data
were available, have been removed from the current
dataset compared to the earlier study. Nevertheless,
because sequences of two mtDNA genes were com-
bined in this study, the obtained phylogeny resolved the
relationships amongst basal groups. Our results con-
firmed the basal position of the Ethiopian and Canadian
lineages and placed the Euro-Mediterranean popula-
tions of Ligula (clades A and B) into a global context.
Two lineages with sympatric Euro-Mediterranean
distribution are genetically highly differentiated and
show a closer affinity to the samples outside their
distribution range than to each other. Whereas the
genetically uniform clade A is more closely related to
samples morphologically identified as L. interrupta
from China and Far East Russia, clade B comprises
also samples from Australia and China (Fig. 2). This
shows that the two clades are probably separated for
evolutionary long time and are well adapted to their
respective spectra of fish hosts. The situation inside
these lineages is however different. While both
lineages show strong genetic links between European
and North African territories; this link is considerably
stronger between the populations of the clade A.
Despite the moderate level of population structure
between the two continents revealed for both clades by
AMOVA, this structure is probably only emerging in
the clade A as indicated by the near even distribution
of Tunisian haplotypes in Fig. 3. Surprisingly, the
number of haplotypes in Tunisian populations is
relatively high, showing that the pioneering popula-
tion was considerably large. In accordance with this
Table 4 Genetic diversity and neutrality tests in clade A and
B populations from Europe and N. Africa
N H Hd Nd Fu&Li’s D Tajima’s D
CladeA 72 49 0.977 0.0056 -3.572** -2.111**
CladeB 24 17 0.960 0.0375 1.393** -0.020
CladeA-EU 56 42 0.984 0.0051 -4.044** -2.289**
CladeA-N.Af. 16 8 0.758 0.0045 0.218 0.287
CladeB-EU 7 6 0.952 0.0036 -1.704* -1.610*
CladeB-N.Af. 17 11 0.926 0.0475 1.544** 0.536
N number of samples, H number of haplotypes, Hd haplotype diversity,
Pi nucleotide diversity. Levels of significance: ** (P \ 0.01),
* P = \0.02–0.01 [
Table 5 AMOVA results of population genetic structure in Euro-Mediterranean clades of L. intestinalis using mtDNA data
Level of hierarchy Clade A Clade B
F
ST
df Variance
components
% F
ST
df Variance
components
%
1) Among continents 0.255 1 0.68755 25.48** 0.156 1 0.59438 12.97*
2) Among populations within continents 0.299 21 0.11835 4.39 0.266 8 0.62373 13.61
3) Within populations 0.059 51 1.89281 70.14** 0.130 19 3.36491 73.42
% Percentage of variation, Levels of significance: ** (P \ 0.001), * P = 0.006
Pathways of cryptic invasion in a fish parasite
123
W. Bouzid et al.
123
fact the Bottleneck analysis of S
ˇ
tefka et al. (2009) did
not find significant genetic loss in these populations
analysing multilocus data for all available specimens.
Conversely, intercontinental population structure in
clade B is probably of older origin with none of the
haplotypes shared between Europe and North Africa.
The pattern of the two genetically differentiated
clades with differing level of population subdivision
between the two continents is also supported by the
results of the summary statistics in Table 5. Whereas
Bouzid et al. (2008b) were only able to compare the
overall differences between the clade A and B
lineages, extended sampling allowed us to contrast
also intraclade differences between European and N.
African populations of the two clades. Decreased
value of Hd in clade A populations from Tunisia
compared to Europe may be related to their recent
introduction. Conversely, the N. African population of
Clade B shows higher values of Pi compared to the
samples from Europe. This may be either due to longer
presence of the clade B in Africa or due to historical
population bottlenecks in the European population
reducing its genetic diversity, e.g. during quaternary
glaciations. This view of different processes ongoing
in European and N. African populations is also
corroborated by the neutrality test results. When
analysed together the clade B populations show weak
sign of population size decrease or stagnation (positive
value of Fu and Li’s D test, near zero value in Tajima’s
D). When analysed separately, the N. African popu-
lation retains the picture of a stagnating population
(positive and close to zero values), whereas European
population shows significantly negative values, which
is usually interpreted as a sign of historical growth
(Hartl and Clark 1997).
Multilocus analysis of gene flow
Despite a very short time since the suggested intro-
duction of the clade A to the North African territory,
a north to south direction of the gene flow across
Mediterranean Sea was clearly confirmed by the
analysis of multilocus genetic data. Based on the
absence of the introduced Ligula in all 514 analyzed
native fish from the Tunisian lakes, we are confident
that no clade A specimens were present in North
Africa prior to the introduction of European fish hosts
in the late 1960s. The generation time in Ligula is
typically between 20 and 36 months (Dubinina 1980),
hence only up to 25 generations passed by since the
introduction of the host populations to Tunisia
40–50 years ago. MIGRATE is based on the coales-
cence framework and estimates long-term parameters,
but runs with simulated datasets (Beerli 2009) show
that the most recent past contributes more heavily to
the parameter estimates than the distant past. The
estimated migration rates may be inflated by the recent
divergence, but our results show that the differentia-
tion of the Tunisian and the European population has
progressed enough to estimate the direction of ances-
tral gene flow with confidence.
Host specificity and ecology of native
and introduced parasite populations
Previous studies suggested mixed effect of geography
and host specificity resulting in different host prefer-
ences of the two clades. Whereas clade A was found in
a phylogenetically derived group of cyprinid fish
(subfamilies Alburninae and Leuciscinae), clade B
was found in basal groups of cyprinids like Gobion-
inae and Cyprininae (Bouzid et al. 2008b;S
ˇ
tefka et al.
Table 6 Population model comparison in clade A: log mar-
ginal likelihoods for four models
Population
pairs
1 2 3 4
France–
Tunisia
-49,635 -24,979 -26,609 -25,970
Czech Rep.–
Tunisia
-38,258 -18,734 -19,572 -19,579
Europe–
Tunisia
-104,772 -55,503 -68,604 -57,173
Ranking 4,4,4 1,1,1 3,2,3 2,3,2
Model
probability
0.0 1.0 0.0 0.0
The white circle marks the first population (European), black the
second (Tunisian). Highest values are in bold
Fig. 3 Haplotype networks of analysed populations. Hollow
circles represent missing haplotypes along the mutational
pathway. Dashed lines mark alternate connections, each only
1 bp long. Green background highlights samples collected in
Europe, blue samples from North Africa. Sequences obtained
from GenBank are in black print, new sequences are in grey.
Abbreviated names of analysed Ligula specimens and their
respective haplotype numbers are the same as listed in Table 1.
(Color figure online)
b
Pathways of cryptic invasion in a fish parasite
123
2009). Thus, the host specificity of the two clades
seemed to correlate with taxonomic affiliation of
their host. Epidemiological data obtained here on
an extended sampling in the North African region
confirm such pattern only to a limited extent. The
native African parasite fauna does not infect intro-
duced hosts and, in the same way, the introduced
populations are only restricted to the introduced hosts
from the Leuciscinae subfamily. However, the clade B
was frequently found both in basal cyprinids and in
native North African Leuciscinae (P. callensis). This
finding demonstrates that locally adapted populations
or lineages of Ligula arise independently of the
taxonomic origin of the hosts. Thus, the distribution
of Ligula lineages in different host species is not
driven by cospeciation as is common in many other
groups of parasites or mutualists like ectoparasitic lice
(e.g., Clayton et al. 2003; Light and Hafner 2008) and
endosymbionts (Thao et al. 2000), respectively.
Speciation and diversification through host speci-
ficity is widely accepted as an important mode of
speciation in parasitic organisms (Poulin 2007). The
evolutionary patterns shown here demonstrate that
for L. intestinalis, the geographic distribution is the
key factor in the development of genetically isolated
lineages and host specificity arises secondarily
through adaptation to locally available hosts. Immu-
nological interactions between the host and parasite
were suggested as the factor defining the width of host
specificity in Ligula (Arme 1997; Olson et al. 2002;
Bouzid et al. 2008b). These adaptations however
provide a very strong barrier against host switching.
With exclusion of a single exception, both lineages
retain their host specificity even in localities with
sympatric occurrence of both types of cyprinid hosts.
The exception was found by S
ˇ
tefka et al. (2009), who
identified one of the specimens retrieved from roach
using microsatellite genotyping and mtDNA sequenc-
ing as a member of the clade B. Similarly, the same
specimen (haplotype 54, FR3Rr) clusters with other
European clade B members in our analysis (Fig. 3).
In the analysis of host preferences of introduced
Ligula populations, we found that roach is infected
more frequently than rudd (Table 3). Surprisingly,
rudd represents the predominant species (48 %) within
the introduced fish community, whereas roach abun-
dance is only 6 % (Djemali et al. 2003). Such
discrepancy between parasite infection rates and host
population densities is in contrast to the expectations
predicting more common species or genotypes to be
infected more frequently, a phenomenon sometimes
referred to as coevolutionary alternation (Thompson
1994; Nuismer and Thompson 2006). We cannot
exclude that current situation is only a temporary
stage in the long-term cycle of population dynamics
between Ligula and its hosts. For example, at the
beginning of the fish introduction campaign in the
1960s, roach abundance in Sidi Salem reservoir was
much higher than that of rudd (Kraı
¨
em 1983; Djemali
2005). Unfortunately, no historical data on Ligula
prevalence in roach and rudd in Tunisia are available
and we cannot conclude if there was a historical
correlation between parasite prevalence and host
abundance. However, such dynamics was described
in a Ligula population infecting roach and rudd in
Great Britain, where infection rates in a small lake
population fluctuated between 0 and 78 % in approx-
imately 10-year cycles (Kennedy et al. 2001). These
fluctuations were assigned to the mixed effect of the
mortality of infected fish, competition between the
two host species and availability of definitive hosts.
Additionally, Loot et al. (2006) showed that the
similarities of the temporal dynamics of host life cycle
act to favour or disadvantage the success of local host
selection by parasites with a complex life cycle.
The dynamics of roach in Tunisia could favour the
encounter rate between roach populations and cope-
pods as successive intermediate hosts, but other
biological features such as differences in feeding
preferences between roach and rudd may play an
important role (for a discussion see Bahri-Sfar et al.
2010).
Concerns for local fish fauna
It is possible that the parasites of the clade A will
eventually break the current host barrier between the
introduced and native fish in North Africa and will
become infective for P. callensis, which is phyloge-
netically and ecologically close species to the intro-
duced hosts (Perea et al. 2010). Similarly, we cannot
exclude that the clade B occurring in P. callensis will
become infective for introduced hosts, although the
situation appears more complex. Clade B is natively
distributed both in North Africa and in Europe, and
apart from the exception described above (one spec-
imen found in roach in France); it retains specificity to
the basal groups of cyprinids within its European
W. Bouzid et al.
123
range despite sympatric occurrence of many other
cyprinid hosts. Furthermore, the clade B comprises
several haplotypic lineages, and based on microsatel-
lite analysis of S
ˇ
tefka et al. (2009), the North African
and European samples represent two related, but
distinguishable clusters. Hence it is conceivable that
each of these clusters possesses specific adaptations
preventing successful host switches at least within a
short period of time.
Despite restricted distribution of the clade A in
introduced fish, there is concern that introduced
populations of the parasite can spread to other
Tunisian freshwater areas where potential Ligula host
populations were introduced (reservoirs Ben Mtir, Bir
Mechergua, etc.) by transfer of infected fish stock
and/or by birds. In Algeria, several cases of parasite
infection with Chilodonella cyprini (Ciliophora),
Gyrodactylus sp., Dactylogyrus sp., D. anchoratus
(Monogena) Bothriocephalus acheilognathi and
L. intestinalis were reported following the introduc-
tion of cyprinids such as Cyprinus carpio, Aristichthys
nobilis, Hypophthalmichthys molitrix and Ctenophar-
yngodon idella (Meddour 1988; Meddour et al. 2005).
Besides, infection with Ligula may lead to serious
changes in the trophic chain. Carnivorous species like
the pikeperch Sander lucioperca that feed on the
infected fish could experience significant changes in
their dynamics. Djemali et al. (2003) showed that the
population dynamics of the introduced rudd and roach
strongly influence the state of the pikeperch stock. In
addition, the reversal of the situation in roach and
rudd abundance is likely to be attributable to a high
perturbation and mortality of the roach stock infected
by Ligula (Ben Hassine, personal communication).
This is of great concern given that the pikeperch has an
important national economic values but also interna-
tional in that it is exported to European markets where
the need in this species is increasing.
To conclude, using an example of a freshwater fish
parasite we demonstrate that a combination of mul-
tilocus markers with advanced analytic tools helps
to reconstruct invasion pathways even in organisms
where the introduction to novel environment occurred
only very recently. This approach also allows dis-
crimination between cryptic lineages of the species in
question, where native and introduced populations
may otherwise be easily confused. This is important in
order to better understand the course and impact of
biological invasion. We combined these genetic data
with epidemiological survey in the Tunisian area of
distribution, which confirmed the validity of host-
based division between the introduced and native
populations of the parasite. Although this introduced
parasite lineage does not represent immediate threat to
the native fish fauna of the North African region, the
information on the genetic links and distribution of
the introduced parasite represents a solid baseline for
future development of prevention and control of
introduced species, known to harbour harmful para-
sites or pathogens.
Acknowledgments We thank Abdessalem Arab, Sonia
Thabet, Abdelkader Lounaci and Mejdeddine Kraı
¨
em for
providing part of the Ligula samples. The study was supported
by the Embassy of France in Tunisia and by the Czech Science
Foundation (projects No. 206/08/1019, 506/12/1632). Research
stay of JS
ˇ
in the Natural History Museum was funded by Marie
Curie Fellowship (project no. 235123, FP7-PEOPLE-IEF-
2008). PB was partly supported by American National Science
Foundation grants DEB 0822626 and DEB 1145999. Part of the
computations were performed using the computing and storage
facilities owned by parties and projects contributing to the
National Grid Infrastructure MetaCentrum (provided under the
programme Projects of Large Infrastructure for Research,
Development, and Innovations, LM2010005) and using the
Florida State University High Performance Computing facility.
References
Arme C (1997) Ligulosis in two cyprinid hosts: Rutilus rutilus
and Gobio gobio. Helmithologia 34:191–196
Ascunce MS, Yang C–C, Oakey J, Calcaterra L, Wu W-J, Shih
C-J, Goudet J, Ross KG, Shoemaker DW (2011) Global
invasion history of the fire ant Solenopsis invicta. Science
331:1066–1068
Bahri-Sfar L, Haddaoui N, Bouzid W, Essetti I, Qninba A, Ben
Hassine OK (2010) Compared parasitic infection of Ligula
intestinalis (Cestoda: Diphyllobothridae) in Cyprinidae
species: Rutilus rubilio and Scardinius erythrophthalmus
in two dam reserves in Tunisia. Parasite 17:241–250
Beerli P (2006) Comparison of Bayesian and maximum-likeli-
hood inference of population genetic parameters. Bioin-
formatics 22:341–345. doi:10.1093/bioinformatics/bti803
Beerli P (2009) How to use migrate or why are markov chain
monte carlo programs difficult to use? In: Bertorelle G,
Bruford MW, Hauffe HC et al (eds) Population genetics for
animal conservation. Cambridge University Press, Cam-
bridge, pp 42–79
Beerli P, Palczewski M (2010) Unified framework to evaluate
panmixia and migration direction among multiple sam-
pling locations. Genetics 185:313–326. doi:10.1534/
genetics.109.112532
Blum MGB, Damerval C, Manel S, Francois O (2004) Brownian
models and coalescent structures. Theor Popul Biol 65:
249–261
Pathways of cryptic invasion in a fish parasite
123
Bouzid W, Lek S, Mace M, Ben Hassine OK, Etienne R, Legal
L, Loot G (2008a) Genetic diversity of Ligula intestinalis
(Cestoda: Diphyllobothriidea) based on analysis of inter-
simple sequence repeat markers. J Zool Syst Evol Res
46:289–296
Bouzid W, S
ˇ
tefka J, Hyps
ˇ
a V, Lek S, Scholz T, Legal L, Ben
Hassine OK, Loot G (2008b) Geography and host speci-
ficity: two forces behind the genetic structure of the
freshwater fish parasite Ligula intestinalis (Cestoda:
Diphyllobothriidae). Int J Parasitol 38:1465–1479
Brown JE, Stepien CA (2010) Population genetic history of the
dreissenid mussel invasions: expansion patterns across
North America. Biol Invasions 12:3687–3710
Brown SP, Loot G, Grenfell BT, Gue
´
gan JF (2001) Host
manipulation by Ligula intestinalis: accident or adapta-
tion? Parasitology 123:519–529
Burnham KP, Anderson DR (2002) Model selection and
multimodel inference: a practical information-theoretic
approach, 2nd edn. Springer, New York
Carter V, Pierce R, Dufour S, Arme C, Hoole D (2005) The
tapeworm Ligula intestinalis (Cestoda: Pseudophyllidea)
inhibits LH expression and puberty in its teleost host, Ru-
tilus rutilus. Reproduction 130:939–945
Clavero M, Garcı
´
a-Berthou E (2005) Invasive species are a
leading cause of animal extinctions. Trends Ecol Evol
20:110. doi:10.1016/j.tree.2005.01.003
Clayton DH, Al-Tamimi S, Johnson KP (2003) The ecological
basis of coevolutionary history In: Page RDM (ed) Tangled
trees: phylogeny, cospeciation and coevolution. University
of Chicago Press, Chicago, pp 310–341
Clement M, Posada D, Crandall KA (2000) TCS: a computer
program to estimate gene genealogies. Mol Ecol 9:1657–
1659
Dejen E, Vijverberg J, Sibbing FA (2006) Spatial and temporal
variation of cestode infection and its effects on two small
barbs (Barbus humilis and B. tanapelagius) in Lake Tana,
Ethiopia. Hydrobiologia 556:109–117
Djemali I (2005) E
´
valuation de la biomasse piscicole dans les
plans d’eau douce tunisiens: approches analytique et
acoustique. Institut National Agronomique de Tunisie
Djemali I, Kraı
¨
em MM, Cadic N, Proteau JP, El Abed A, Jarboui
O (2003) Evaluation de la biomasse piscicole en eau douce
par e
´
cho prospection: application a
`
la retenue de Sidi
Salem. Bull Inst Natl Sci Technol Mer 30:23–32
Dlugosch KM, Parker IM (2008) Founding events in species
invasions: genetic variation, adaptive evolution, and the
role of multiple introductions. Mol Ecol 17:431–449. doi:
10.1111/j.1365-294X.2007.03538.x
Dubinina MN (1980) Tapeworms (Cestoda, Ligulidae) of the
fauna of the USSR. Amerind Publishing Co, New Delhi
Excoffier L, Lischer HEL (2010) Arlequin suite ver 3.5: a new
series of programs to perform population genetics analyses
under Linux and Windows. Mol Ecol Resour 10:564–567.
doi:10.1111/j.1755-0998.2010.02847.x
Falush D, Stephens M, Pritchard JK (2007) Inference of popu-
lation structure using multilocus genotype data: dominant
markers and null alleles. Mol Ecol Notes 7:574–578
Fujisaki I, Pearlstine EV, Mazzotti FJ (2010) The rapid spread of
invasive Eurasian collared doves Streptopelia decaocto in
the continental USA follows human-altered habitats. Ibis
152:622–632
Goka K, Yokoyama J, Une Y, Kuroki T, Suzuki K, Nakahara M,
Kobayashi A, Mizutani T, Inaba S, Hyatt AD (2009)
Amphibian chytridiomycosis in Japan: distribution, hap-
lotypes and possible route of entry into Japan. Mol Ecol
18:4757–4774
Guindon S, Dufayard J-F, Lefort V, Anisimova M, Hordijk W,
Gascuel O (2010) New algorithms and methods to estimate
maximum-likelihood phylogenies: assessing the perfor-
mance of PhyML 3.0. Syst Biol 59:307–321
Hall TA (1999) BioEdit: a user-friendly biological sequence
alignment editor and analysis program for Windows 95/98/
NT. Nucleic Acids Symp Ser 41:95–98
Hartl DL, Clark AG (1997) Principles of population genetics,
3rd edn. Sinauer Associates, Sunderland, MA
Hoole D, Carter V, Dufour S (2010) Ligula intestinalis (Ces-
toda: Pseudophyllidea): an ideal fish-metazoan parasite
model? Parasitology 137:425–438
Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian
inference of phylogenetic trees. Bioinformatics 17:754–755
Jeffreys H (1961) The theory of probability. Oxford University
Press, New York. (3rd edition 1998)
Kass RE, Raftery AE (1995) Bayes Factors. J Am Stat Assoc
90:773–779
Kennedy CR, Shears PC, Shears JA (2001) Long-term dynamics
of Ligula intestinalis and roach Rutilus rutilus: a study of
three epizootic cycles over thirty-one years. Parasitology
123:257–269
Khalil L, Polling L (1971) Checklist of the helminth parasites of
african freshwater fishes. In: Farnham R (ed). Common-
wealth Agricultural Bureaux publishing, Slough, pp 80
Khamis FM, Karam N, Ekesi S, De Meyer M, Bonomi A, Go-
mulski LM, Scolari F, Gabrieli P, Siciliano P, Masiga D,
Kenya EU, Gasperi G, Malacrida AR, Guglielmino CR
(2009) Uncovering the tracks of a recent and rapid inva-
sion: the case of the fruit fly pest Bactrocera invadens
(Diptera: Tephritidae) in Africa. Mol Ecol 18:4798–4810
Kraı
¨
em M (1983) Les poissons d’eau douce de Tunisie: inven-
taire commente
´
et re
´
partition ge
´
ographique. Bull Inst Natl
Sci Tech Oce
´
anogr Pe
ˆ
che Salammbo
ˆ
10:107–124
Kraı
¨
em M (1991) E
´
tude Eco-biologique de principales espe
`
ces
de poissons des retenues des barrages de Sidi Salem, Bir
M’Cherga, Melle
`
gue, Bouhertma, Nebhana et Sidi Saad.
Rapports Techniques Projet Tuniso-Allemend de pe
ˆ
che
continentale 11: 48
Kra
´
lova
´
-Hromadova
´
I, Bazsalovicsova
´
E, S
ˇ
tefka J, S
ˇ
pakulova
´
M, Va
´
vrova
´
S, Szemes T, Tkach V, Trudgett A, Pybus M
(2011) Multiple origins of European populations of the
giant liver fluke Fascioloides magna (Trematoda: Fascio-
lidae), a liver parasite of ruminants. Int J Parasitol 41:
373–383
Li J, Liao X (2003) The taxonomic status of Digramma
(Pseudophyllidae: Ligulidae) inferred from DNA sequen-
ces. J Parasitol 89:792–799
Li J, Liao X, Yang H (2000) Molecular characterization of a
parasitic tapeworm (Ligula) based on DNA sequences from
formalin-fixed specimens. Biochem Genet 38:309–322
Librado P, Rozas J (2009) DnaSP v5: a software for compre-
hensive analysis of DNA polymorphism data. Bioinfor-
matics 25:1451–1452
Light JE, Hafner MS (2008) Codivergence in heteromyid
rodents (Rodentia: Heteromyidae) and their sucking lice of
W. Bouzid et al.
123
the genus Fahrenholzia (Phthiraptera: Anoplura). Syst Biol
57:449–465
Loot G, Lek S, Brown SP, Gue
´
gan J-F (2001a) Phenotypic
modification of roach (Rutilus rutilus L.) infected with
Ligula intestinalis L. (Cestoda: Pseudophyllidea). J Paras-
itol 87:1002–1010
Loot G, Lek S, Dejean D, Gue
´
gan J-F (2001b) Parasite-induced
mortality in three host populations of the roach Rutilus
rutilus (L.) by the tapeworm Ligula intestinalis (L.). Ann
Limnol Int J Limnol 37:151–159
Loot G, Aulagnier S, Lek S, Thomas F, Gue
´
gan J-F (2002)
Experimental demonstration of a behavioural modification
in a cyprinid fish, Rutilus rutilus (L.), induced by a parasite,
Ligula intestinalis (L.). Can J Zool 80:738–743
Loot G, Park Y-S, Lek S, Brosse S (2006) Encounter rate
between local populations shapes host selection in complex
parasite life cycle. Biol J Lin Soc 89:99–106
Losse G, Nau W, Winter M (1991) Le de
´
veloppement de la
pe
ˆ
che en eau douce dans le nord de la Tunisie: Projet de la
coope
´
ration technique Tuniso-Allemande. Utilisation des
barrages pour la pisciculture, GTZ Gmbh
Manilla G, Albertini D, Falasca MP (1984) Ligula intestinalis
(L., 1758) Gmelin, 1790 (Cestoda: Ligulidae) in Rutilus
rubilio (Pisces: Cyprinidae) of Campotosto Lake. Riv
Parasitol 45:263–279
Margolis L, Esch GW, Holmes JC, Kuris AM, Schad GA (1982)
The use of ecological terms in parasitology (report of an ad
hoc committee of the American Society of Parasitologists).
J Parasitol 68:131–133
Meddour A (1988) Parasites of freshwater fishes from Lake
Oubeira. Dissertation, Department of Zoology, The Uni-
versity of Liverpool, UK, Algeria
Meddour A, Rouabhi A, Meddour-Bouderda K, Loucif N,
Remili A, Khataly Y (2005) Expe
´
rimentations sur la
reproduction artificielle de Sander lucioperca, Hypoph-
thalmichthys molitrix et Aristichthys nobilis en Alge
´
rie. Sci
Technol 23:63–71
Mergeay J, Verschuren D, De Meester L (2006) Invasion of an
asexual American water flea clone throughout Africa and
rapid displacement of a native sibling species. Proc R Soc
Lond Biol 273:2839–2844
Nei M, Kumar S (2000) Molecular evolution and phylogenetics.
Oxford University Press, New York
Nuismer SL, Thompson JN (2006) Coevolutionary alternation
in antagonistic interactions. Evolution 60:2207–2217
Nylander JAA (2004) MrModeltest v2. Program distributed by
the author. Evolutionary Biology Center Uppsala University
Nylander JAA, Wilgenbusch JC, Warren DL, Swofford DL
(2008) AWTY (are we there yet?): a system for graphical
exploration of MCMC convergence in Bayesian phyloge-
netics. Bioinformatics 24:581–583
Olson PD, Littlewood DTJ, Griffiths D, Kennedy CR, Arme C
(2002) Evidence for the co-existence of separate strains or
species of Ligula in Lough Neagh, Northern Ireland.
J Helminthol 76:171–174
Perea S, Bo
¨
hme M, Zupancic P, Freyhof J, Sanda R, O
¨
zulug M,
Abdoli A, Doadrio I (2010) Phylogenetic relationships and
biogeographical patterns in Circum-Mediterranean sub-
family Leuciscinae (Teleostei, Cyprinidae) inferred from
both mitochondrial and nuclear data. BMC Evol Biol
10:265
Pimentel D, Zuniga R, Morrison D (2005) Update on the envi-
ronmental and economic costs associated with alien-inva-
sive species in the United States. Ecol Econ 52:273–288
Posada D (2004) Collapse (Version 1.2). A tool for collapsing
sequences to haplotypes. http://darwin.uvigo.es/
Posada D, Crandall KA (1998) MODELTEST: testing the
model of DNA substitution. Bioinformatics 14:817–818.
doi:10.1093/bioinformatics/14.9.817
Poulin R (2007) Evolutionary ecology of parasites, 2nd edn.
Princeton University Press, Princeton
Prenter J, Macneil C, Dick JTA, Dunn AM (2004) Roles of
parasites in animal invasions. Trends Ecol Evol 19:385–
390
Rambaut A, Drummond A (2005) Tracer. Institute of Evolu-
tionary Biology, University of Edinburgh. http://tree.bio.
ed.ac.uk/software/tracer/
Rushton SP, Lurz PWW, Gurnell J, Nettleton P, Bruemmer C,
Shirley MDF, Sainsbury AW (2006) Disease threats posed
by alien species: the role of a poxvirus in the decline of the
native red squirrel in Britain. Epidemiol Infect 134:521–533
Sasal P, Taraschewski H, Grondin H, Valade P, Wielgoss S,
Moravec F (2008) Parasite communities in eels of the
Island of Reunion (Indian Ocean): a lesson in parasite
introduction. Parasitol Res 102:1343–1350
S
ˇ
tefka J, Gilleard JS, Grillo V, Hyps
ˇ
a V (2007) Isolation and
characterization of microsatellite loci in the tapeworm
Ligula intestinalis (Cestoda: Pseudophyllidea). Mol Ecol
Notes 7:794–796
S
ˇ
tefka J, Hyps
ˇ
a V, Scholz T (2009) Interplay of host specificity
and biogeography in the population structure of a cosmo-
politan endoparasite: microsatellite study of Ligula intes-
tinalis (Cestoda). Mol Ecol 18:1187–1206
Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4:
Molecular Evolutionary Genetics Analysis (MEGA) soft-
ware version 4.0. Mol Biol Evol 24:1596–1599
Thao ML, Moran NA, Abbot P, Brennan EB, Burckhardt DH,
Patrick A, Brennan EB, Burckhardt DH, Baumann P
(2000) Cospeciation of psyllids and their primary
prokaryotic endosymbionts. Appl Environ Microbiol 66:
2898–2905
Therriault TW, Orlova MI, Docker MF, Macisaac HJ, Heath DD
(2005) Invasion genetics of a freshwater mussel (Dreissena
rostriformis bugensis) in eastern Europe: high gene flow
and multiple introductions. Heredity 95:16–23
Thompson JN (1994) The coevolutionary process. University of
Chicago Press, Chicago
Van Riper C III, van Riper SG, Goff ML, Laird M (1986) The
epizootiology and ecological significance of malaria in
Hawaiian land birds. Ecol Monogr 56:327–344
Wattier RA, Haine ER, Beguet J, Martin G, Bollache L, Musko
´
IB, Platvoet D, Rigaud T (2007) No genetic bottleneck or
associated microparasite loss in invasive populations of a
freshwater amphipod. Oikos 116:1941–1953
Weir BS, Cockerham CC (1984) Estimating F-statistics for the
analysis of population structure. Evolution 38:1358–1370
Wielgoss S, Taraschewski H, Meyer A, Wirth T (2008) Popu-
lation structure of the parasitic nematode Anguillicola
crassus, an invader of declining North Atlantic eel stocks.
Mol Ecol 17:3478–3495
Pathways of cryptic invasion in a fish parasite
123
... geneious .com). The evolutionary history of the samples was inferred from the matrix of concatenated ITS1 and cox1 haplotypes using the maximum parsimony (MP), maximum likelihood (ML), and Bayesian inference (BI) methods (Bouzid et al. 2013). The MP analysis was implemented in PAUP version 4.0 (Swofford 2002) using the tree bisection and reconnection (TBR) algorithm with 50 replicates of a random sequence addition. ...
... The MP analysis was implemented in PAUP version 4.0 (Swofford 2002) using the tree bisection and reconnection (TBR) algorithm with 50 replicates of a random sequence addition. Bootstrap support was calculated in 1000 replications of the TBR search (Bouzid et al. 2013). The ML analyses were performed using PhyML 3.0 (Guindon et al. 2010). ...
... The model for the molecular evolution of the sequences was selected using Akaike's information criterion (AIC) in Model-Test (Posada & Crandall 1998). Bootstrap support was obtained by 1000 replications (Bouzid et al. 2013). The BI reconstruction of the phylogeny was performed in MrBayes 3.2 (Huelsenbeck & Ronquist 2001) using 10 million Markov chain Monte Carlo (MCMC) replications and 2 independent runs (4 chains each). ...
Full-text available
Article
Tapeworms of the genus Dibothriocephalus are widely distributed throughout the world, and some are agents of human diphyllobothriasis, one of the most important fish-borne zoonoses caused by a cestode parasite. Until now, the population genetic structure of diphyllobothriid tapeworms in the Baikal Rift Zone (BRZ) has remained unexplored. The major aim of this study was to analyse the population genetic structure of D. dendriticus and D. ditremus parasitising fish in the BRZ based on internal transcribed spacer 1 (ITS1) and mitochondrial gene cytochrome oxidase subunit I (cox1) sequences. We found that both species had complex population genetic structures. Each species formed 2 clades (D. dendriticus: Clade 1 & 2; D. ditremus Clade A & B) that differed in genetic diversity. D. dendriticus haplotypes in Clade 1 formed a star-like sub-network with a main haplotype, whereas the haplotypes in Clade 2 formed a diffuse network. We assumed that the complex population genetic structure of D. dendriticus was a consequence of populations evolving under different palaeoecological conditions during the Last Glacial Maximum. In contrast to D. dendriticus, both clades in the D. ditremus samples formed a diffuse network. Our findings revealed hypothetical pathways in the formation of the population genetic structure of diphyllobothriids in the BRZ. On one hand, isolation by distance played an important role; on the other hand, lake recolonisation from refugia and a genetic bottleneck after the end of the Last Glacial Maximum had a possible influence.
... We generated a concatenated dataset of two fragments of mtDNA (Cytb and COI) comprising 1,310 bp in length for the 30 selected samples of L. intestinalis and aligned it with 82 sequences from two previous studies (Bouzid et al. 2008b(Bouzid et al. , 2013; Table S1). Bayesian Inference (BI) and Maximum Likelihood (ML) approaches were carried out to reconstruct the phylogenetic relationships of the newly sampled plerocercoids. ...
... At the first sight, this result could imply that different phases of the L. intestinalis infection cycle are present in the lake, switching between different hosts. However, even though our sequencing analysis confirmed that all Czech samples belong to the same mtD-NA Clade A (as in Bouzid et al. 2008b, Bouzid et al. 2013 we also found emerging genetic differentiation between freshwater bream plerocercoids and the rest of population of L. intestinalis from the samples. Thus, the ecology of roach and bream is probably highly independent of each other. ...
Full-text available
Article
Ligula intestinalis (Linnaeus, 1758) is a tapeworm parasite with a worldwide distribution that uses a wide variety of fish species as its second intermediate host. In the present study, we investigated the prevalence and population genetic structure of plerocercoids of L. intestinalis in five common cyprinoid species, roach Rutilus rutilus (Linnaeus), freshwater bream Abramis brama (Linnaeus), white bream Blicca bjoerkna (Linnaeus), bleak Alburnus alburnus (Linnaeus), and rudd Scardinius erythrophthalmus (Linnaeus), collected in six water bodies of the Czech Republic (Milada, Most, Medard, Jordán, Římov and Lipno). Of the six study sites, the highest frequency of parasitism was recorded in Lake Medard (15%). The overall prevalence rate among the species was as follows: roach > rudd ≥ freshwater bream > bleak > white bream. Two mitochondrial genes (cytb and COI) were used to compare the population genetic structure of parasite populations using selected samples from the five fish species. The results of the phylogenetic analysis indicated that all populations of L. intestinalis were placed in Clade A, previously identified as the most common in Europe. At a finer scale, haplotype network and PCoA analyses indicated the possible emergence of host specificity of several mtDNA haplotypes to the freshwater bream. Moreover, pairwise Fixation indices (FST) revealed a significant genetic structure between the parasite population in freshwater bream and other host species. Parasite populations in roach not only showed the highest rate of prevalence but also depicted a maximum number of shared haplotypes with populations from bleak and rudd. Our results suggest that recent ecological differentiation might have influenced tapeworm populations at a fine evolutionary scale. Thus, the differences in prevalence between fish host species in different lakes might be influenced not only by the parasite's ecology, but also by its genetic diversity.
... The relatively recent description of a new species of Schistocephalus, S. cotti Chubb, Seppälä, Lüscher, Milinski and Valtonen, 2005, from Europe indicates that there might be unknown diversity to be discovered in birds. The same applies to Ligula intestinalis, which represents a complex of morphologically indistinguishable species that differ from each other genetically, in their geographical distribution and spectrum of fish intermediate hosts (Bouzid et al., 2008(Bouzid et al., , 2013Štefka et al., 2009); thus throughout the article the term Ligula cf. intestinalis is used. ...
Full-text available
Article
Broad tapeworms (Cestoda: Diphyllobothriidea) are the principal agents of widespread food-borne cestodosis. Diphyllobothriosis and diplogonoporosis, caused by members of the genera Diphyllobothrium, Diplogonoporus and Adenocephalus, are the most common fish cestodoses with an estimated 20 million people infected worldwide, and has seen recent (re)emergences in Europe due to the increasing popularity of eating raw or undercooked fish. Sparganosis is a debilitating and potentially lethal disease caused by the larvae of the genus Spirometra, which occurs throughout much of the (sub)tropics and is caused by the consumption of raw snakes and frogs, and drinking water contaminated by infected copepods. Both diseases are caused by several species, but the frequency by which the transition to humans has occurred has never been studied. Using a phylogenetic framework of 30 species based on large and small nuclear ribosomal RNA subunits (ssrDNA, lsrDNA), large subunit mitochondrial ribosomal RNA (rrnL) and cytochrome c oxidase subunit I (cox1), we hypothesize that humans have been acquired as accidental hosts four times across the tree of life of diphyllobothriideans. However, polytomies prevent an unambiguous reconstruction of the evolution of intermediate and definitive host use. The broad host spectrum and the frequency with which switching between major host groups appears to have occurred, may hold the answer as to why accidental human infection occurred multiple times across the phylogeny of diphyllobothriideans. In this study Diplogonoporus is determined to be the junior synonym of Diphyllobothrium. Furthermore, we divide the latter polyphyletic genus into (i) the resurrected genus Dibothriocephalus to include freshwater and terrestrial species including Dibothriocephalus dendriticus, Dibothriocephalus latus and Dibothriocephalus nihonkaiensis as the most common parasites of humans and (ii) the genus Diphyllobothrium to accommodate parasites from cetaceans including the type species Diphyllobothrium stemmacephalum and Diphyllobothrium balaenopterae n. comb. known also from humans. The non-monophyletic aggregate of marine species from seals is provisionally considered as incertae sedis.
... Since MIGRATE was successfully applied to identify the source of a freshwater tapeworm recently introduced to northern Africa [40], we used it here to assess the invasion route of CZ and DFF populations of F. magna. Due to low number of samples, the PL population was not included in the analysis. ...
Full-text available
Article
Background Fascioloides magna (Trematoda: Fasciolidae) is an important liver parasite of a wide range of free-living and domestic ruminants; it represents a remarkable species due to its large spatial distribution, invasive character, and potential to colonize new territories. The present study provides patterns of population genetic structure and admixture in F. magna across all enzootic regions in North America and natural foci in Europe, and infers migratory routes of the parasite on both continents. Methods In total, 432 individuals from five North American enzootic regions and three European foci were analysed by 11 microsatellite loci. Genetic data were evaluated by several statistical approaches: (i) the population genetic structure of F. magna was inferred using program STRUCTURE; (ii) the genetic interrelationships between populations were analysed by PRINCIPAL COORDINATES ANALYSIS; and (iii) historical dispersal routes in North America and recent invasion routes in Europe were explored using MIGRATE. ResultsThe analysis of dispersal routes of the parasite in North America revealed west-east and south-north lineages that partially overlapped in the central part of the continent, where different host populations historically met. The exact origin of European populations of F. magna and their potential translocation routes were determined. Flukes from the first European focus, Italy, were related to F. magna from northern Pacific coast, while parasites from the Czech focus originated from south-eastern USA, particularly South Carolina. The Danube floodplain forests (third and still expanding focus) did not display relationship with any North American population; instead the Czech origin of the Danube population was indicated. A serial dilution of genetic diversity along the dispersion route across central and eastern Europe was observed. The results of microsatellite analyses were compared to previously acquired outputs from mitochondrial haplotype data and correlated with past human-directed translocations and natural migration of the final cervid hosts of F. magna. Conclusions The present study revealed a complex picture of the population genetic structure and interrelationships of North American and European populations, global distribution and migratory routes of F. magna and an origin of European foci.
... Its life cycle includes a copepod and a fish as intermediate hosts, and a piscivorous bird, in which the parasite reaches sexual maturity, serving as the definitive host (Kennedy et al. 2001;Loot et al. 2001;Bouzid et al. 2008;Hoole et al. 2010;Kroupova et al. 2012). Tapeworms of the L. intestinalis species complex infect a large range of freshwater Cyprinidae (Bouzid et al. 2013), and are widespread throughout the northern hemisphere (Dubinina 1980). It has been recorded from the body cavity of, among others, roach, Rutilus rutilus (Kennedy et al. 2001;Loot et al. 2002), straightfin barb, Barbus paludinosus (Barson and Marshall 2003), tench, Tinca tinca (Korkmaz and Zencir 2009) and Chalcalburnus mossulensis (Parsa Khanghah et al. 2011). ...
Full-text available
Article
The dynamics of the emergence, duration, and decline phases in epizootic cycles are well known for humans and some crops, but they are poorly understood for host–parasite systems in the wild. Invading parasites may be particularly insidious as they are often introduced unintentionally, simultaneously with their hosts, and later transferred to species in the new location. Not all introductions of alien species are successful. Many introductions may occur, but individuals subsequently fail to spread or reproduce. Here we investigate the dynamics of an epizootic process of the tapeworm Ligula intestinalis in the Hamiz reservoir, Algeria, and explore its effects on the cyprinid fish Barbus callensis. Regular sampling was conducted from October 2005 to February 2008 with intermittent surveys carried out until 2010. Five percent of the 566 specimens of B. callensis that were caught were infected, with the maximum number of parasites found in spring. There was no obvious difference in weight between uninfected fish and infected ones, and infection did not affect fish condition. However, infected fish were significantly longer than uninfected fish and had inhibited gonad development. The proportion of infected fish caught was significantly higher in year 1 and by the second winter, infection collapsed to zero. The Ligula infection thus appeared to have minimal ecological effects and be of a temporary nature, thus exhibiting a cyclic character. Taken together, our data indicates that this infection declined or even failed during our study period. Failure may be due to the specific genetic strain of Ligula, but invasive carp may also have been influential in both the introduction and subsequent decline of this parasite. We thus highlight Ligula's unique role as a model to study the long-term effects of parasitization on host species dynamics.
Article
Ligula intestinalis is a common pseudophyllidean cestode found in freshwater ecosystems worldwide. It has a complex life cycle involving a planktonic copepod as first intermediate host, a planktivorous fish as second intermediate host, and a fish-eating bird as the final host. The most conspicuous stage within the life cycle is the plerocercoid, which develops in the abdominal cavity of the fish host and has a substantial effect on its health, fecundity, and behaviour. It can cause epizootic cycles of mass mortality within fish populations. Molecular studies have demonstrated the existence of several lineages which represent separate species differing in the spectrum of fish hosts and geographical distribution. This parasite has recently been introduced to freshwater systems of Africa and Oceania, either by migratory birds or the trade in fish. L. intestinalis has been an ideal model to study ecological interactions, endocrine disruption, pollution monitoring, and genetic biodiversity.
Article
Cryptic invasions are defined as the introduction and spread of non-native lineages within the species' native range (intra-specific cryptic invasion) or the invasion of non-native species that goes unnoticed due to misidentification as a native or another invasive species (inter-specific cryptic invasion). While population-specific attributes are acknowledged to play a critical role in the success and impact of biological invasions in general, our knowledge of the causes and consequences of cryptic invasions is largely neglected. Cryptic invasions are inherently difficult to recognize and, despite being likely widespread, often go undetected. In this review, we analyse the sources, mechanisms, and consequences of cryptic invasions. Using a bibliometric survey, we first quantify the relative proportion of study questions, taxa, and geographic regions. We then highlight the value of comparative information from archived specimens in uncovering the occurrence and timing of cryptic invasions. We examine the mechanisms of cryptic invasions and emphasise the role of anthropogenic environmental changes on the arrival of cryptic invaders. We then discuss the role of interspecific biological interactions in the success of cryptic invasions and the role of hybridization between native and non-native lineages in cryptic invasions. We examine the competitive advantage of some invasive lineages in key physiological, ecological or sexually-selected traits. We argue that cryptic invasions, often undetected, may trigger subsequent rapid range expansions. We suggest that cryptic invasions are much more common than currently acknowledged. We highlight the role of coevolved associations (host-parasite, mutualism, herbivory), inherently population-specific, in the impacts of cryptic invasions on local communities. Finally, we outline a framework to manage intraspecific cryptic invasions.
Full-text available
Article
Laboratory and field experiments were conducted on the island of Hawaii from 1977-1980 in an effort to determine the impact of avian malaria on the forest birds. At 16 study sites from sea level to tree line in mesic and xeric habitat, birds were captured and bled to determine the host and altitudinal distribution of blood parasites. In the laboratory, six bird species were challenged with malarial parasites to measure host susceptibility. Distributions, activity cycles, and transmission potentials of malarial parasite vectors were also analyzed. One species of Plasmodium was present from sea level to tree line, concentrated in the mid-elevational ranges in the ecotonal area where vectors and native birds had the greatest overlap. Native forest birds were: (a) more susceptible to malaria than were introduced species; (b) most likely to have malaria during the nonbreeding, wet season; (c) found ranging lower in xeric than in mesic forests; and (d) found to have a lower prevalence of malaria in xeric forests. Temporal as well as elevational differences in prevalence and parasitemia levels of wild birds were apparent throughout the annual cycle, a result of differing host and parasite responses to biotic and abiotic factors. Avian malaria probably did not reach epizootic proportions on Hawaii until after @?1920. However, since that time it has had a negative impact on the population dynamics of the native forest birds and is today a major limiting factor, restricting both abundance and distribution of these species on the island. In response, a number of native bird species have developed immunogenetic and behavioral responses that reduce the impact of the parasite on host populations.
Full-text available
Article
Le suivi des paramètres quantitatifs du parasitisme par Ligula intestinalis (Cestoda : Diphyllobothridae) a été réalisé par l’examen de 516 spécimens appartenant à deux espèces introduites de poissons d’eau douce : Rutilus rubilio (350 individus) et Scardinius erythrophthalmus (166 individus). Les échantillonnages ont été réalisés dans deux retenues de barrages, Sidi Salem et Nebhana en Tunisie. L’analyse de la composition spécifique de l’avifaune piscivore dans ces deux retenues a révélé l’existence d’espèces d’oiseaux déjà décrites dans la littérature comme étant des hôtes définitifs de la ligule. Le suivi de l’avifaune dans les deux plans d’eau a montré une abondance relative et une fréquence plus élevées dans la retenue de Sidi Salem que dans celle de Nebhana. L’analyse des prévalences, des intensités moyennes et de l’abondance du parasite a révélé des valeurs plus importantes chez le gardon, Rutilus rubilio qui semble donc le second hôte intermédiaire préférentiel de Ligula intestinalis dans ces milieux. L’analyse comparée de la parasitose, dans les deux retenues prospectées, suggère que la ligule présente deux stratégies différentes d’infestation selon le plan d’eau. À Sidi Salem, grande retenue dont la superficie est plus importante que celle de Nebhana et qui de plus abrite une avifaune piscivore plus importante et beaucoup plus diversifiée, le parasite infeste le maximum d’individus hôtes avec des charges parasitaires faibles. En revanche, à Nebhana, petite retenue, le parasite infeste moins d’individus hôtes qu’à Sidi Salem, mais avec des intensités moyennes beaucoup plus élevées. L’analyse de la prévalence en fonction de la taille et de l’âge au niveau de la retenue de Sidi Salem a révélé des valeurs plus élevées dans les grandes classes de taille chez le gardon.
Article
The pathology of Ligula-infections in Rutilus rutilus and Gobio gobio differs in several respects. In natural infections of R. rutilus, there is a pronounced host cellular response which can be demonstrated in fry shortly after infection and which becomes more pronounced with fish age. In contrast, no cellular response is ever found in natural infections of G. gobio. It has been proposed that parasites from R. rutilus and G. gobio differ in their ability to stimulate a host response. Transplantation experiments lend support to this view, although it cannot be excluded that host factors may also play a role. There are qualitative and quantitative differences in splenic and pronephric leucocyte counts, and in spleen weights, between the two hosts. In R. rutilus, infection is invariably accompanied by cytological changes in the gonadotrophs of the pituitary gland, and an inhibition of gonadal development. Thus, the gonads fail to undergo seasonal cycles of development and regression, and they resemble those of immature fish, irrespective of host age. Detailed studies have not been undertaken with G. gobio. However, such cytological evidence as is available indicates that, although pituitary gonadotrophs are reduced in apparent number in infected fish, gametogenesis proceeds further in parasitised G. gobio than in R. rutilus. It is suggested that these differences might indicate that Ligula from R. rutilus and G. gobio are different strains or species. Although comparison of iso-electric focusing gels of parasite extracts supports this view, with seven of 43 identifiable bands differing in worms from the two hosts, evidence from enzyme analysis does not.