Trametes versicolor Extract Modifies Human Fecal Microbiota Composition In vitro

Abstract

Trametes versicolor is a mushroom used as a traditional Chinese medicine (Yun-zhi) for a wide array of seemingly disparate conditions. We hypothesized that many of its multiple purported activities could be mediated through stimulation of beneficial mutualist components of the microbiota. Human fecal microbiota was cultured anaerobically to determine its ability to ferment a common extract of T. versicolor, designated polysaccharide peptide (PSP), and the ability of PSP to alter the composition of the microbial community. The presence of PSP and fructooligosaccharides (FOS, a common prebiotic) in the medium, but not cellulose, significantly increased levels of Bifidobacterium spp. PSP also elevated Lactobacillus spp., while reducing Clostridium spp., Staphylococcus spp. and Enterococcus spp. Levels of Streptococcus spp., Bacteroides spp. and Escherichia did not significantly change. Fermentation of PSP increased the concentration of organic acids (lactate and short-chain fatty acids), decreased the pH, and induced β-galactosidase and β-glucosidase activities. The genera of the human microbiota that are promoted by FOS and other prebiotics are also stimulated by the Trametes versicolor extract, PSP. Thus, Trametes versicolor, a common East Asian botanical, contains putative prebiotic agents that alter human gut microbiota and pH. This prebiotic-like activity may help explain some of the plethora of the health benefits attributed to this traditional Chinese medicine.

Full text

ORIGINAL PAPER
Trametes versicolor Extract Modifies Human Fecal
Microbiota Composition In vitro
Zhuo-Teng Yu &Bo Liu &Purna Mukherjee &
David S. Newburg
Published online: 23 February 2013
#Springer Science+Business Media New York 2013
Abstract Trametes versicolor is a mushroom used as a
traditional Chinese medicine (Yun-zhi) for a wide array of
seemingly disparate conditions. We hypothesized that many
of its multiple purported activities could be mediated
through stimulation of beneficial mutualist components of
the microbiota. Human fecal microbiota was cultured anaer-
obically to determine its ability to ferment a common extract
of T. versicolor, designated polysaccharide peptide (PSP),
and the ability of PSP to alter the composition of the micro-
bial community. The presence of PSP and fructooligosac-
charides (FOS, a common prebiotic) in the medium, but not
cellulose, significantly increased levels of Bifidobacterium
spp. PSP also elevated Lactobacillus spp., while reducing
Clostridium spp.,Staphylococcus spp.and Enterococcus
spp.Levels of Streptococcus spp.,Bacteroides spp.and
Escherichia did not significantly change. Fermentation of
PSP increased the concentration of organic acids (lactate
and short-chain fatty acids), decreased the pH, and induced
β-galactosidase and β-glucosidase activities. The genera of
the human microbiota that are promoted by FOS and other
prebiotics are also stimulated by the Trametes versicolor
extract, PSP. Thus, Trametes versicolor, a common East
Asian botanical, contains putative prebiotic agents that alter
human gut microbiota and pH. This prebiotic-like activity
may help explain some of the plethora of the health benefits
attributed to this traditional Chinese medicine.
Keywords Trametes versicolor .PSP .Fecal microbiota .
In vitro fermentation
Introduction
The mushroom Trametes versicolor is found widely in tem-
perate forests in the northern hemisphere as saprophytes on
decaying trees. Trametes preparations are traditional East
Asian botanicals (Yun-zhi) currently in widespread use,
whose oral ingestion is reported to result in a variety of
health benefits. Two of the most common preparations are
extracts of cultured Trametes mycelia, named polysacchar-
opeptide (PSP) from China, and polysaccharide-K (PSK)
from Japan. Both preparations have a predominance of
molecular masses of approximately 100 kDa that consist
primarily of β-glucans, polymers of D-glucose containing
β-1,3 and α-1,4 glucosidic linkages, that can also contain
galactose, mannose, xylose, arabinose, rhamnose, and fu-
cose. The polysaccharide moiety is highly branched and
stable to enzymatic proteolysis [1,2].
The activity of Trametes has been attributed to these large
β-glucans found in its extract. β-glucans are not readily
digestible by intestinal enzymes of humans. Most large
indigestible glycans ingested orally are not able to traverse
the intestinal epithelium and therefore remain in the gut until
being utilized by colonic microbiota or excreted in the
stools. Some of these indigestible dietary glycans can mod-
ify the intestinal bacteria in humans and modulate the im-
mune system. Thus, orally consumed indigestible glycans
that enhance colonization by beneficial microbes in the
human gut and provide health benefits are classified as
Z.-T. Yu :B. Liu :D. S. Newburg
Department of Pediatric Gastroenterology and Nutrition,
Harvard Medical School, Massachusetts General Hospital,
Boston, MA 02129, USA
Present Address:
Z.-T. Yu :B. Liu :P. Mukherjee :D. S. Newburg (*)
Program in Glycobiology, Department of Biology, Boston College,
Higgins Hall,
140 Commonwealth Avenue,
Chestnut Hill, MA 02467-3961, USA
e-mail: david.newburg@bc.edu
Plant Foods Hum Nutr (2013) 68:107–112
DOI 10.1007/s11130-013-0342-4

prebiotics [3]. To our knowledge, the ability of
Trametes glycans to alter fecal microbial community
composition has not been investigated. The hypothesis
addressed herein is that Trametes glycans alter the fecal
microbiota composition in a positive way (i.e., enhanc-
ing Bifidobacteria and Lactobacilli), lower the pH, and
suppress potential pathogens. To test this hypothesis,
human fecal microbiota communities were cultured with
PSP, whereupon major known genera of human micro-
biota were measured, as well as pH changes, lactate and
fatty acid production, and activity of two glycosidases
(enzymes that release sugars from glycans). FOS, a well
recognized potent prebiotic,isusedasareferencepos-
itive control.
Materials and Methods
Substrates
Tested materials included PSP (Trametes versicolor, batch
no. WH060501, Winsor Health Products, Ltd.), fructooligo-
saccharide (FOS), and cellulose (both from Sigma-Aldrich
Chemical Co., St. Louis, MO).
In vitro Fermentation
Fresh fecal samples were from eight healthy people (five
male, three female, 30 to 64 years of age) who had not
received antibiotics, prebiotics, or probiotics for the previous
six months and had no recent history of gastrointestinal dis-
orders.Sampleswereprocessedwithin2hofcollection.Each
substrate (5 g/L) was tranferred into tubes containing 9 mL of
autoclaved medium plus 1 mL of inoculum. The inoculum
was 10 % (w/v) fecal slurry in pre-reduced phosphate-
buffered saline (pH 7.2; Oxoid) [4]. The medium contained
per liter: 2 g peptone, 2 g yeast extract, 0.1 g NaCl, 0.04 g
K
2
HPO
4,
0.01 g MgSO
4
·7H
2
O, 0.01 g CaCl
2
·6H
2
O, 2 g
NaHCO
3
, 0.005 g hemin (Sigma-Aldrich), 0.5 g L-cysteine
HCl, 0.5 g bile salts, 2 mL Tween 80, 10 μLvitaminKand
4 mL of 0.025 % (w/v) resazurin solution (Oxoid Ltd.,
Basingstoke, UK). Medium without test materials was inocu-
lated with feces as a baseline control. In vitro fermentation was
performed in an anaerobic workstation (DG250 Anaerobic
work station, Don Whitley Scientific Limited, UK) at 37 °C.
Culture fluid was taken for analysis after 24 h, which was
several hours into the maximum stationary phase for PSP-
treated and negative control populations. Samples were stored
at −20 °C until completion of analyses. Experiments were
carried out in triplicate; the average value of each experiment
was considered a single independent measure.
pH and Lactate Levels
After 24 h of bacterial fermentation, the hydrogen ion
concentration of the culture media was measured using a
pH meter (Corning, pH meter 240, USA). Lactate con-
centration in the medium was determined by a commer-
cial enzymatic lactate assay (kit no. K607-100; BioVision
Inc., CA, USA).
SCFA Analysis by LC/MS
Short chain fatty acids (SCFAs) were analyzed by
LC/MS. One milliliter of culture medium was centrifuged
at 10,000 × gfor 10 min, the supernatant filtered through
Table 1 Oligonucleotide
primers used in this study Target Oligos Sequence (5′-3′) Annealing temp.
(°C)
Lactobacillus Lab 159 GGAAACAG(A ⁄G)TGCTAATACCG 61
Lab0677 CACCGCTACACATGGAG
Bacteroidetes Bfra-F ATAGCCTTTCGAAAGRAAGAT 50
Bfra-R CCAGTATCAACTGCAATTTTA
Bifidobacterium Bifid-F CTCCTGGAAACGGGTGG 50
Bifid-R GGTGTTCTTCCCGATATCTACA
Clostridium perfringens group Clp-F ATGCAAGTCGAGCGA(G/T)G 55
Clp-R TATGCGGTATTAATCT(C/T)CCTTT
Enterococcus Ent-R ACTCGTTGTACTTCCCATTGT 62
Ent-F CCTTATTGTTAGTTGCCATCATT
Staphylococcus TStaG422 GGCCGTGTTGAACGTGGTCAAATCA 58
TStag765 TIACCATTTCAGTACCTTCTGGTAA
Streptococcus Strep-1 GAAGAATTGCTTGAATTGGTTGAA 62
Strep-R GGACGGTAGTTGTTGAAGAATGG
Escherichia UidA784F GTGTGATATCTACCCGCTTCGC 56
UidA866R AGAACGCTTTGTGGTTAATCAGGA
108 Plant Foods Hum Nutr (2013) 68:107–112

a0.2μm filter, and the filtrate stored at 4 °C until use.
All reagents were of analytical grade from Sigma-
Aldrich (Pennsylvania, USA). Ultra-pure water was
from a Super-Q water purification system (Millipore,
Billerica, USA). Chromatographic resolution was on an
Agilent ZORBAX Eclipse XDB-C8 (4.6 × 150 mm,
5μm) column. The mobile phase was a water and
acetonitrile gradient ending in 100 % water. Detection
was by selected ion monitoring in an Agilent 1100
LC/MSD. The detector range was set to m/z 54–90,
thereby including the ions of acetic acid, m/z=84
(M+Na)+, propionic acid m/z= 98 (M+Na)+ and butyric
acid m/z=112 (M+Na)+.
β-Glucosidase and β-Galactosidase Activity in the Media
β-glucosidase activity was measured enzymatically by
ρ-nitrophenyl release from ρ-nitrophenyl-β-D-glucopyrano-
side (ρNPG) [5]. Briefly, 1 mL of 5 mM ρNPG in 100 mM
sodium phosphate buffer (pH 7.0) was added to 0.2 mL of
media, and incubated at 37 °C for 15 min. The reaction was
stopped by addition of 0.5 mL of 1 M sodium carbonate at
4 °C. Aliquots (1 mL) in 1.8 mL Eppendorf centrifuge tubes
were centrifuged at 14,000× gfor 30 min. Enzymatic release
of ρ-nitrophenol was measured spectrophotometrically at
420 nm (DU Series 600 and 7000, Beckman Instruments
Inc., USA). One unit of enzyme activity is the amount of
β-glucosidase that releases 1 μmol of ρ-nitrophenol from
ρNPG substrate per milliliter per minute.
β-galactosidase activity was measured enzymatic re-
lease of ο-nitrophenol from ο-nitrophenyl β-D-galactopyr-
anoside (ο-NPGal) [5,6]. Briefly, 1 mL of 15 mM ο-
NPGal in 0.03 M sodium phosphate buffer (pH 6.8) was
added to 0.2 mL of media. After incubation at 37 °C for
15 min, the reaction was stopped with addition of 0.1 M
sodium carbonate (0.5 mL at 4 °C). Absorbance was
measured at 420 nm. One unit of β-galactosidase was
the amount of enzyme that releases 1 μmol of ο-nitro-
phenol per mL per minute under the assay conditions. The
activities of both glycosidases were expressed in units per
mL of culture media.
Microbial Population Enumeration by Real-Time PCR
DNA was extracted from the fermentation cultures by the
method of Zhu et al. [7]. After 24 h of incubation, 2 mL
aliquots of the fermentation media were centrifuged at
12,000 × gfor 30 min. DNA was released from the pellet
by disruption in a Biospect Bead Beater for 3 min and
isolated by extraction with chloroform/phenol. PCR ampli-
fication and detection were by real-time PCR (Bio-Rad
Laboratories, Hercules, CA, USA) with a series of genus-
specific primer pairs (Table 1). Each reaction mixture con-
sisted of 5 μLofiQ™SYBR® Green Supermix (Bio-Rad
Laboratories), 1 μL of each of the specific primers at a
concentration of 0.25 μM, 1 μL of template DNA, and
buffer to make the total volume 25 μL. The fluorescent
products were detected at the last step of each cycle.
Melting curve analysis after amplification distinguished
target from non-target PCR products. Standard curves
were constructed from eight 10-fold dilutions of bacterial
DNA extracted from pure cultures of between 2 and 9 log
10
colony forming units (CFUs) of each of the following:
Staphylococcus epidermidis ATCC 12228, Lactobacillus del-
brueckii. subsp. lactis ATCC 7830, Bifidobacterium infantis
S12 ATCC 15697, Clostridum perfringens ATCC13124,
Streptococcus thermophilus ATCC 19258, Enterococcus
Table 2 Comparison of short chain fatty acid (SCFA) concentration
(mM) in fecal media supplemented with PSP, FOS, cellulose or no
carbohydrate (negative control) (n=8; mean ± SD). Values not sharing
a common superscript within a row are significantly different (P< 0.05)
SCFA Control Cellulose PSP FOS
Acetate 1.38± 0.29
a
1.56± 0.35
a
3.67± 0.49
b
3.06± 0.39
b
Propionate 1.57± 0.41
a
1.73± 0.02
a
4.81± 0.81
b
3.30± 0.96
b
Butyrate 1.38± 0.02
a
1.38± 0.04
a
2.39± 0.07
b
2.37± 0.02
b
4
4.5
5
5.5
6
6.5
Control Cellulose PSP 5
g
/L F OS 5
g
/L
pH
*
*
a
0
1
2
3
4
5
Control Cellulose PSP 5
g
/L FOS 5
g
/L
Lactate concentration (mM)
**
b
Fig. 1 pH (a) and lactate
concentration (b) after 24 h
incubation of fecal microbiota
in media containing Trametes
extracts (PSP, 5 g/L), FOS
(5 g/L), cellulose (5 g/L)
or no additional carbohydrate
(negative control) (n=8;
mean ± SD). *, P<0.05 relative
to control
Plant Foods Hum Nutr (2013) 68:107–112 109

faecalis ATCC 19433, Escherichia coli H10407 ATCC 35401,
and Bacteroides fragilis DAMZ 2151.
Statistical Analysis
Data are expressed as mean ± SD. Differences between
groups were tested by one-way ANOVA. When differences
were found, Student’st-test was used for pairwise compar-
isons; P≤0.05 was considered significant.
Results
pH and Lactate in the Media
To test whether PSP affects the infant intestinal lumen via the
microbiota, fecal microbiota were inoculated in media con-
taining PSP, FOS, cellulose or no additional carbon source.
After 24 h fermentation, the pH was significantly lower with
PSP and FOS supplementation than in unsupplemented and
cellulose control groups (Fig. 1). These differences were
accompanied by increases in lactate and short chain fatty acid
concentrations in the PSP and FOS groups relative to the
unsupplemented and cellulose groups (Fig. 1,Table2).
Thus, fermentation of PSP or FOS into organic acids contrib-
uted toward the acidification of the media.
Bacterial Population Changes
Population changes were monitored by real-time PCR of
genes characteristic of eight major genera of fecal bacteria,
shown in Table 3. PSP supplementation resulted in an ele-
vation of Bifidobacterium over that of the unsupplemented
and cellulose supplemented control groups (P< 0.05). The
frequency of Lactobacillus in the PSP and FOS treatment
group were significantly higher than that in the negative
controls (P<0.05). Conversely, there were significantly
fewer Clostridium,Staphylococcus and Enterococcus after
incubation with PSP (P<0.05). Similarly, there was a trend
toward Escherichia being lower following PSP treatment
than in controls. No significant differences were apparent
between the frequency of Streptococcus and Bacteroides in
the PSP treatment and control groups.
β-Glucosidase and β-Galactosidase Activities
in the Fermentation Culture
Fermentation of specific glycans by intestinal bacteria often
involves induction and release of specific bacterial glycosi-
dases involved in the glycan degradation and utilization.
Consistent with this, the β-galactosidase activities in the
media of PSP and FOS treatment groups were significantly
higher than in the media of the control and cellulose groups
(Fig. 2)(P<0.05), as were β-glucosidase activities (Fig. 2).
These glycosidases would be expected to allow fecal micro-
biota to hydrolize PSP into small glycans suitable for
metabolic fermentation.
Discussion
The Trametes versicolor mushroom is a traditional Chinese
botanical, most commonly available today as PSP and PSK.
Table 3 Changes in microbial composition of fecal samples incubated
in the presence of PSP or FOS. Genera of fecal microbiota grown 24 h
in media containing PSP, FOS or no substrate (control) as the principle
sugar sources were measured by quantitative real-time PCR (qPCR),
and expressed as log
10
(genome equivalent mL
−1
)(n= 8; mean ± SD).
Values not sharing a common superscript within a row are significantly
different (P<0.05)
Bacterial groups Control Cellulose PSP FOS
Bifidobacteria spp.5.80± 0.65
a
5.75± 0.97
a
7.15± 0.38
b
7.52± 0.12
b
Lactobacillus spp.5.18± 0.16
a
4.94± 0.58
a
7.35± 0.30
c
6.09± 0.17
b
Clostridium spp.7.75± 0.39
a
5.80± 0.37
b
4.97± 0.05
c
5.09± 0.08
c
Staphylococcus spp.4.48±0.07
a
4.38± 0.12
a
4.09± 0.17
b
4.36± 0.03
a
Enterococcus spp.6.54± 0.72
a
3.80± 0.35
c
5.33± 0.47
b
5.86± 0.15
ab
Escherichia spp. 4.31± 0.45
a
4.10± 1.23
a
3.98± 0.52
a
3.19± 0.32
b
Streptococcus spp.7.82±0.17
a
7.27± 0.70
a
8.03± 0.31
ab
8.65± 0.05
b
Bacteroides spp.7.05± 0.36
a
6.49± 0.66
a
7.17± 0.06
a
7.04± 0.03
a
80
100
120
140
160
180
Control Cellulose PSP FOS
-galactosidase activity (U/mL)
**
80
100
120
140
160
180
Control Cellulose PSP FOS
-galactosidase activity (U/mL)
**
ab
Fig. 2 β-galactosidase (a)and
β-glucosidase (b) activity
(U/mL) after 24 h incubation of
fecal microbiota supplemented
with Trametes extracts (PSP,
5 g/L), FOS (5 g/L), cellulose
(5 g/L) or no additional
carbohydrate (negative control)
(n=8; mean ± SD). *, P<0.05
relative to control
110 Plant Foods Hum Nutr (2013) 68:107–112

These Trametes aqueous extracts are reported to inhibit
cancer and enteric inflammation, and are currently in
widespread use in East Asia [8–10]. However, their mech-
anism of action is unclear. The activity has been postulat-
ed to be due to the large β-glycan carbohydrate molecules
that predominate in Trametes extracts [1]. Such large
glycans taken orally are not digested by the mammalian
intestinal epithelial cells to an appreciable extent, and
hence, little of the glycan is able to traverse the intestinal
mucosa and enter the bloodstream [11]. Although colonic
bacteria can digest some complex plant glycans into
smaller fragments [1], colonic mucosal epithelium does
not readily absorb such molecules. However, dietary gly-
cans digested only by microbiota are prime candidates for
prebiotic effects.
In our anaerobic culture model system of human microbial
communities, Bifidobacteria and Lactobacilli grew to signif-
icantly higher numbers in the PSP treatment group and in the
FOS positive control group relative to the unsupplemented
and cellulose supplemented negative controls.Moreover, the
induction of β-galactosidase and β-glucosidase activity by
PSP suggests an adaptation by the microbiota to make glycans
of PSP available for fermentation, further supporting the role
of PSP as a potent prebiotic. We posit that this induction is
specific for enzymes used in PSP degradation.
Moreover, Clostridium spp.,Staphylococcus spp.and
Enterococcus spp. were reduced by PSP supplementa-
tion. This is consistent with Trametes extract being
antimicrobial, either through a direct or through an
indirect mechanism, or both. Supporting a direct effect,
PSK per se was reported to exhibit antimicrobial activ-
ity against E. coli [12]. Supporting indirect inhibition,
low pH inhibits the growth and colonization by many
pathogens, including coliform and clostridia species
[13]. Supplementation with PSP lowered pH in the
media, supporting an indirect inhibition of the growth
of potential pathogens. The data reported herein demon-
strate that PSP, the trametes extract, robustly displayed
prototypic prebiotic characteristics.
Most commonly, PSP is ingested by humans as an at-
tempt to reduce risk of cancer. It is noteworthy that the
reduction of pH by PSP, with production of lactate and short
chain fatty acids, could also mediate an anti-cancer effect.
Lactate and short-chain fatty acids may help reduce the risk
of colon cancer [14–16]. Butyrate is a primary energy
source for colonocytes. Butyrate-producing bacteria are
associated with less colon cancer in mice [17]. Thus, we
speculate that this prebiotic effect could be linked to preven-
tion or amelioration of cancer through modulation of the
immune system, suppression of colonization by microbes that
produce carcinogens or irritants, or by inducing production of
secondary metabolites by the microbiota that could suppress
carcinogenesis. If such mechanisms were demonstrated and
elucidated, the use of trametes as a cancer treatment would be
much more widely accepted in the east and west alike.
In summary, the data reported herein suggest that PSP
promotes the growth and activity of probiotic (mutualist sym-
biont) bacterial genera like Bifidobacteria and Lactobacilli.
Colonization by such probiotic bacteria could benefit the
host [18–20]. In the anaerobic model of microbial fermen-
tation used herein, inclusion of PSP and FOS in the cultures,
but not of cellulose, reduced Clostridium,Staphylococcus
and Enterococcus. This observation provides additional evi-
dence supporting PSP as a strongly prebiotic compound.
These prebiotic activities could also contribute to any pur-
ported anticancer activity.
Acknowledgments We thank Winsor Health Products, Ltd. for their
gift of PSP and partial support, Dr. Gherman Wiederschain for helpful
assistance with the manuscript, and the NIH for grants HD013021,
HD059140, and AI075563.
Conflict of interest Dr. Zhuoteng Yu declares that she has no conflict
of interest. Dr. Bo Liu declares that he has no conflict of interest.
Dr. Purna Mukherjee declares that she has no conflict of interest.
Dr. David S. Newburg declares that he has no conflict of interest.
References
1. Ng TB (1998) A review of research on the protein-bound
polysaccharide (polysaccharopeptide, PSP) from the mush-
room Coriolus versicolor (Basidiomycetes: Polyporaceae).
Gen Pharmacol 30:1–4
2. Cui J, Chisti Y (2003) Polysaccharopeptides of Coriolus versi-
color: physiological activity, uses, and production. Biotechnol Adv
21:109–122
3. Gibson GR, Probert HM, Loo JV et al (2004) Dietary modulation
of the human colonic microbiota: updating the concept of pre-
biotics. Nutr Res Rev 17:259–275
4. Hughes SA, Shewry PR, Gibson GR et al (2008) In vitro fermen-
tation of oat and barley derived beta-glucans by human faecal
microbiota. FEMS Microbiol Ecol 64:482–493
5. Otieno DO, Shah NP (2007) Endogenous beta-glucosidase and
beta-galactosidase activities from selected probiotic micro-
organisms and their role in isoflavone biotransformation in soy-
milk. J Appl Microbiol 103:910–917
6. Hsu CA, Yu RC, Chou CC (2005) Production of beta-galactosidase
by Bifidobacteria as influenced by various culture conditions. Int J
Food Microbiol 104:197–206
7. Zhu WY, Williams BA, Konstantinov SR et al (2003) Analysis of
16S rDNA reveals bacterial shift during in vitro fermentation of
fermentable carbohydrate using piglet faeces as inoculum.
Anaerobe 9:175–180
8. Hsieh TC, Wu JM (2001) Cell growth and gene modulatory
activities of Yunzhi (Windsor Wunxi) from mushroom Trametes
versicolor in androgen-dependent and androgen-insensitive human
prostate cancer cells. Int J Oncol 18:81–88
9. Standish LJ, Wenner CA, Sweet ES et al (2008) Trametes versi-
color mushroom immune therapy in breast cancer. J Soc Integr
Oncol 6:122–128
Plant Foods Hum Nutr (2013) 68:107–112 111

10. Torkelson CJ, Sweet E, Martzen MR et al (2012) Phase 1 clinical
trial of Trametes versicolor in women with breast cancer. ISRN
Oncol 2012:251632
11. Ramberg JE, Nelson ED, Sinnott RA (2010) Immunomodulatory
dietary polysaccharides: a systematic review of the literature. Nutr
J 9:54
12. Harada H, Sakagami H, Konno K et al (1988) Induction of
antimicrobial activity by antitumor substances from pine cone
extract of Pinus parviflora Sieb. et Zucc. Anticancer Res
8:581–587
13. Su WJ, Waechter MJ, Bourlioux P et al (1987) Role of volatile
fatty acids in colonization resistance to Clostridium difficile in
gnotobiotic mice. Infect Immun 55:1686–1691
14. Reddy BS (1998) Prevention of colon cancer by pre- and
probiotics: evidence from laboratory studies. Br J Nutr 80:
S219–S223
15. Rowland IR, Rumney CJ, Coutts JT et al (1998) Effect of
Bifidobacterium longum and inulin on gut bacterial metabolism
and carcinogen-induced aberrant crypt foci in rats. Carcinogenesis
19:281–285
16. Reddy BS (1999) Possible mechanisms by which pro- and pre-
biotics influence colon carcinogenesis and tumor growth. J Nutr
129:1478S–1482S
17. Roberfroid MB, Bornet F, Bouley C et al (1995) Colonic microflora:
nutrition and health. Summary and conclusions of an International
Life Sciences Institute (ILSI) [Europe] workshop held in Barcelona,
Spain. Nutr Rev 53:127–130
18. Holzapfel WH, Haberer P, Snel J et al (1998) Overview of gut flora
and probiotics. Int J Food Microbiol 41:85–101
19. Newburg DS, Ruiz-Palacios GM, Morrow AL (2005) Human milk
glycans protect infants against enteric pathogens. Annu Rev Nutr
25:37–58
20. Rendón-Huerta J, Juárez-Flores B, Pinos-Rodríguez J, Aguirre-Rivera
J, Delgado-Portales R (2012) Effects of different sources of fructans on
body weight, blood metabolites and fecal bacteria in normal and obese
non-diabetic and diabetic rats. Plant Foods Hum Nutr 67(1):64–70
112 Plant Foods Hum Nutr (2013) 68:107–112