ArticlePDF Available

Characterization of thirteen microsatellite markers in river and brook lampreys (Lampetra fluviatilis and L. planeri)

DOI:10.1007/s12686-012-9753-z
Authors:
Arnaud Gaigher at Max Planck Institute for Evolutionary Biology, Plön, Germany
Arnaud Gaigher
  • Max Planck Institute for Evolutionary Biology, Plön, Germany
Sophie Launey at French National Institute for Agriculture, Food, and Environment (INRAE)
Sophie Launey
Emilien Lasne at French National Institute for Agriculture, Food, and Environment (INRAE)
Emilien Lasne
Anne-Laure Besnard at French National Institute for Agriculture, Food, and Environment (INRAE)
Anne-Laure Besnard
Show all 5 authorsHide
Download full-text PDFDownload full-text PDF
Read full-text
Download citation

Abstract

We describe the development based on 454 pyrosequencing technology of thirteen microsatellite markers for two closely related species of lamprey: Lampetra fluviatilis and L. planeri. The number of alleles per locus ranged from 2 to 5 in L. fluviatilis and from 2 to 6 in L. planeri. Gene diversity ranged from 0.062 to 0.718 in L. fluviatilis and from 0.322 to 0.677 in L. planeri. These markers will be helpful to study population genetic structure of both species and resolve their taxonomic status as separate species or ecotypes of a single species.
gaigher-etal-consgenre
s-2013.pdf
Content uploaded by Guillaume Evanno
Author content
All content in this area was uploaded by Guillaume Evanno
Content may be subject to copyright.
gaigher-etal-consgenre
s-2013.pdf
Content uploaded by Guillaume Evanno
Author content
All content in this area was uploaded by Guillaume Evanno
Content may be subject to copyright.
TECHNICAL NOTE
Characterization of thirteen microsatellite markers in river
and brook lampreys (Lampetra fluviatilis and L. planeri)
Arnaud Gaigher
•
Sophie Launey
•
Emilien Lasne
•
Anne-Laure Besnard
•
Guillaume Evanno
Received: 8 August 2012 / Accepted: 13 August 2012 / Published online: 24 August 2012
Ó Springer Science+Business Media B.V. 2012
Abstract We describe the development based on 454
pyrosequencing technology of thirteen microsatellite
markers for two closely related species of lamprey: Lam-
petra fluviatilis and L. planeri. The number of alleles per
locus ranged from 2 to 5 in L. fluviatilis and from 2 to 6 in
L. planeri. Gene diversity ranged from 0.062 to 0.718 in L.
fluviatilis and from 0.322 to 0.677 in L. planeri. These
markers will be helpful to study population genetic struc-
ture of both species and resolve their taxonomic status as
separate species or ecotypes of a single species.
Keywords Lampetra fluviatilis Lampetra planeri
Microsatellites Gene flow Genetic structure
The river lamprey Lampetra fluviatilis and brook lamprey
L. planeri are two aquatic agnathans distributed throughout
Europe. L. fluviatilis is anadromous with a parasite feeding
style, while L. planeri is sedentary in freshwater and non-
parasitic. These species have undergone a significant
decline throughout Europe (Renaud 1997) and are listed in
Appendix III of the Bern convention. In France the river
lamprey is listed as vulnerable while the brook lamprey is
classified as least concern (UICN 2010). At the adult stage
both species are morphologically very similar and mostly
differ by their size with L. fluviatilis being larger than L.
planeri. In addition, they often coexist on the same
spawning sites (Lasne et al. 2010) and they cannot be
discriminated at the larval stage. They were classified as
distinct species due to their distinct life histories and
morphological differences (Hardisty and Potter 1971).
However, some studies based on mitochondrial DNA or
allozymes failed to reveal a strong divergence between
them, hence the hypothesis that they may in fact be two
ecotypes of a single species (Schreiber and Engelhorn
1998; Espanhol et al. 2007). Here we describe the devel-
opment of thirteen microsatellite markers that will be
useful to infer gene flow and disentangle two hypotheses:
(1) a recent divergence resulting in two closely related
species or (2) the existence of two ecotypes within a single
species. The distinction between both hypotheses may have
important consequences for the management of L. fluvia-
tilis and L. planeri populations.
Genomic DNA was extracted using the DNeasy Blood
and Tissue Kit (Qiagen) on tissues of 3 L. fluviatilis and 3 L.
planeri adults collected in France. The six samples were
pooled to make a microsatellite library common to both
species. We used a procedure combining DNA enrichment
and high throughput pyrosequencing (GS-FLX, Roche
Diagnostics) recently developed by Malausa et al. (2011).
The program QDD was used to identify and select micro-
satellites sequences and to design primer pairs (Megle
´
cz
et al. 2010). A total of 208 microsatellites were identified by
the Genoscreen company (Lille, France) and 48 loci were
selected based on their relatively high number of repetitions.
A. Gaigher S. Launey A.-L. Besnard G. Evanno (&)
INRA, UMR 985 Ecologie et Sante
´
des Ecosyste
`
mes,
35042 Rennes, France
e-mail: guillaume.evanno@rennes.inra.fr
A. Gaigher S. Launey A.-L. Besnard G. Evanno
Agrocampus Ouest, UMR ESE, 65 rue de Saint-Brieuc,
35042 Rennes, France
A. Gaigher
Department of Ecology and Evolution, University of Lausanne,
1015 Lausanne, Switzerland
E. Lasne
Muse
´
um National d’Histoire Naturelle, CRESCO, 35800 Dinard,
France
123
Conservation Genet Resour (2013) 5:141–143
DOI 10.1007/s12686-012-9753-z
Table 1 Characteristics of thirteen microsatellites developed for Lampetra fluviatilis and Lampetra planeri
Locus/GenBank accession Primer sequence (5
0
–3
0
) Repeat motif Fluorescent label/
multiplex panel
Allele size
range (bp)
L. fluviatilis (n = 32) L. planeri (n = 35)
Na Ho He Na Ho He
LP-003/ F: M13-TCACGTACGCGTTAACTCCA (CA)
8
6-FAM/1 111–115 2 0.406 0.448 3 0.371 0.322
JX468083 R: TTCCTTAATTGGTCTGCCTCA
LP-006/ F: M13-TGCCCACACGTGATAGACAT (AG)
8
PET/1 147–151 3 0.469 0.523 2 0.543 0.501
JX468084 R: GGCGATCGTCATAAATAGCC
LP-009/ F: M13-AACTCCCACGTGCAAAATTC (TG)
7
NED/4 206–210 3 0.563 0.597 3 0.400 0.341
JX468085 R: AGGCATCACTCCTAACGACG
LP-018/ F: M13-TTAAAAGTGCGGCGAAATCT (TG)
8
PET/3 245–251 5 0.594 0.675 6 0.629 0.637
JX468086 R: TGTTCCATAACCACTGCTCG
LP-022/ F: M13-GACAGCTCGCTCAAGGCTAC (AGG)
7
PET/1 232–238 3 0.313 0.304 2 0.457 0.504
JX468087 R: TCGTCGTGGTCACAGTCATC
LP-027/ F: M13-ACAGTCAACCTCCGACATCC (ATC)
7
PET/2 212–224 5 0.563 0.540 4 0.382 0.476
JX468088 R: AGCCCATGATGATTCCATTC
LP-028/ F: M13-AGAACTCTGTGGACGTTCCG (ATC)
5
6-FAM/2 250–259 4 0.781 0.718 4 0.571 0.646
JX468089 R: TCTCAAGAAATGAGTTCTCAATCG
LP-030/ F: M13-TGAGGGGAAAATGGAAACAG (CAT)
5
NED/4 259–268 4 0.563 0.626 3 0.543 0.560
JX468090 R: TTCAGGATGATAGCACTGCC
LP-037/ F: M13-GGATAATCGTCGCTGGTGTT (CA)
7
VIC/2 156–160 2 0.063 0.062 2 0.400 0.437
JX468091 R: GCACAAGCTTGATGTGACAAA
LP-039/ F: M13-GCACTTCCAACAAAGCCAGT (AC)
6
PET/4 159–178 5 0.375 0.484 4 0.743 0.677
JX468092 R: TATTTCAGCCACTTGGGCAT
LP-043/ F: M13-CTCCATTATACACGGGGACAG (TA)
6
NED/1 164–166 2 0.375 0.381 2 0.343 0.388
JX468093 R: TGAACCTTGGTGCTGAGATG
LP-045/ F: M13-AGAGGTGTTTCGCGTGCTAT (GTT)
6
VIC/3 190–196 3 0.531 0.558 2 0.429 0.466
JX468094 R: AAGGAGAGAGGAGGTTTCGG
LP-046/ F: M13-ACCGCAAACTCATCAGGAAC (CAC)
6
PET/3 154–166 3 0.688 0.670 4 0.457 0.487
JX468095 R: AAGCGGATTTAGAAGCGACA
M13 sequence: 5
0
-CACGACGTTGTAAAACGAC-3
0
The annealing temperature is the same for all loci (see the main text)
n number of samples, Na number of alleles, Ho observed heterozygosity, He expected heterozygosity
142 Conservation Genet Resour (2013) 5:141–143
123
PCR conditions were optimized for these loci using 17 L.
fluviatilis and 12 L. planeri. Genomic DNA was extracted
from tissue in a 10 % Chelex
Ò
solution (Sigma-Aldrich)
with 1 mg/ml Proteinase K and 1X TE (Tris/EDTA), heated
at 55 °C for 2 h followed by 99 °C for 10 min (modified
from Estoup et al. 1996). The amplification followed the
M13 method developed by Schuelke (2000). PCR was per-
formed in a 6 ll total volume containing approximately
15 ng DNA, 0.06 U Taq DNA polymerase, 5X PCR buffer
(GoTaq, Promega), 208 lM each dNTP, 2.17 mM MgCl
2
,
0.055 lM forward primer with a tail extented M13, 0.55 lM
reverse primer and 0.57 lM M13 primer labeled with a
fluorochrome (6-FAM, VIC, NED or PET). A Touchdown
PCR program was applied as follows: initial denaturation of
4 min at 94 °C, then 20 cycles including denaturation of 30 s
at 94 °C, annealing of 30 s starting at 65 °C then decreasing
of 0.5 °C per cycle and extension of 1 min at 72 °C; then, 10
cycles with denaturation of 30 s at 94 °C, annealing of 30 s
at 55 °C and extension of 1 min at 72 °C; and a final
extension step of 5 min at 72 °C. PCR products from dif-
ferent markers were pooled into four multiplexes before
migration (Table 1). Fragments were size fractionated on an
ABI Prism 3130xl Genetic Analyzer using the size standard
GeneScan 500 LIZ. Allele sizes were determined with
GeneMapper 3.7 (Applied Biosystems).
Thirteen markers were chosen based on successful
amplification and we assessed their polymorphism on 32 L.
fluviatilis from the Loire River (France) and 35 L. planeri
from the Oir River (France) (Table 1). The number of
alleles per locus (Na) and observed and expected hetero-
zygosities (Ho and He) were calculated using G
ENETIX
4.05.2 (Belkhir et al. 1996–2004). All loci were polymor-
phic (Table 1) and the number of alleles per locus ranged
from 2 to 5 for L. fluviatilis (mean 3.4) and 2 to 6 for L.
planeri (mean 3.2). The expected heterozygosity ranged
from 0.062 to 0.718 for L. fluviatilis and 0.322 to 0.677 for
L. planeri.
No null alleles or genotyping errors were found using
M
ICRO-CHECKER 2.2.3 (Van Oosterhout et al. 2004). Devi-
ations from Hardy–Weinberg equilibrium (HWE) and
linkage disequilibrium between loci were tested using
G
ENEPOP 4.1 (Rousset 2008). No linkage disequilibrium
was found and no deviation from HWE was detected after
sequential Bonferroni correction (Rice 1989).
These loci can be amplified in both species and will thus
be useful to assess the distribution of genetic diversity
within and between species and to clarify their taxonomic
status.
Acknowledgments We thank our colleagues from the INRA ‘U3E’
unit who helped us with samples’ collection. This study was funded
by the European Regional Development Fund (Transnational program
Interreg IV, Atlantic Aquatic Resource Conservation Project) and by
the French Ministry of Ecology and Sustainable Development (project
‘Amphihalins, cohe
´
rence du re
´
seau N2000 en mer’).
References
Belkhir K, Borsa P, Chikhi L, Raufaste N, Bonhomme F (1996–2004)
GENETIX 4.05, logiciel sous windows TM pour la ge
´
ne
´
tique
des populations. http://www.univ-montp2.fr/* genetix/genetix.
htm
Espanhol R, Almeida PR, Alves MJ (2007) Evolutionary history of
lamprey paired species Lampetra fluviatilis (L.) and Lampetra
planeri (Bloch) as inferred from mitochondrial DNA variation.
Mol Ecol 16:1909–1924
Estoup A, Largiader CR, Perrot E, Chourrout D (1996) Rapid one-
tube DNA extraction for reliable PCR detection of fish
polymorphic markers and transgenes. Mol Mar Biol Biotechnol
5:295–298
Hardisty MW, Potter IC (1971) The biology of lampreys, vol 1.
Academic Press, London
Lasne E, Sabatie
´
MR, Evanno G (2010) Communal spawning of
brook and river lampreys (Lampetra planeri and L. fluviatilis)is
common in the Oir river (France). Ecol Freshw Fish 19:323–325
Malausa T, Gilles A, Megle
´
cz E et al (2011) High-throughput
microsatellite isolation through 454 GS-FLX titanium pyrose-
quencing of enriched DNA libraries. Mol Ecol Resour 11:
638–644
Megle
´
cz E, Costedoat C, Dubut V, Gilles A, Malausa T, Pech N,
Martin JF (2010) QDD: a user-friendly program to select
microsatellite markers and design primers from large sequencing
projects. Bioinformatics 26:403–404
Renaud CB (1997) Conservation status of northern hemisphere
lampreys (Petromyzontidae). J Appl Ichthyol 13:143–148
Rice WR (1989) Analyzing tables of statistical tests. Evolution
43:223–225
Rousset F (2008) GENEPOP’007: a complete re-implementation of
the GENEPOP software for Windows and Linux. Mol Ecol
Resour 8:103–106
Schreiber A, Engelhorn R (1998) Population genetics of a cyclostome
species pair, river lamprey (Lampetra fluviatilis L.) and brook
lamprey (Lampetra planeri bloch). J Zool Syst Evol Res 36:
85–99
Schuelke M (2000) An economic method for the fluorescent labeling
of PCR fragments. Nat Biotechnol 18:233–234
UICN France, MNHN, SFI, ONEMA (2010) La Liste rouge des
espe
`
ces menace
´
es en France - Chapitre Poissons d’eau douce de
France me
´
tropolitaine. Paris, France. Available at www.uicn.
fr/IMG/pdf/Liste_rouge_France_Poissons_d_eau_douce_de_
metropole.pdf
Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004)
MICRO-CHECKER: software for identifying and correcting
genotyping errors in microsatellite data. Mol Ecol Notes 4:
535–538
Conservation Genet Resour (2013) 5:141–143 143
123
... However, a disadvantage of using microsatellites is that they are highly species-or genus-specific and usually have to be developed separately for each species or group of species. Nevertheless, microsatellite loci have now been developed for several lamprey species (Bryan et al., 2005;Gaigher et al., 2013;Luzier et al., 2010;McFarlane and Docker, 2009;Schedina et al., 2014;Spice et al., 2011;Takeshima et al., 2005). Analysis of microsatellite variation has thus provided important insights into population structure in several wide-ranging parasitic species (e.g. , providing greater resolution in these species than was possible with mtDNA sequence variation (see case studies below). ...
... The first microsatellite markers for European river lamprey were described by Gaigher et al. (2013). Bracken et al. (2015) used these markers together with cross-amplified microsatellites from other species to infer the population genetic structure of European river and brook lampreys, and the freshwater-resident form of European river lamprey in the UK. ...
... all F ST values significant). In France, Rougemont et al. (2015) also reported a weak genetic structure (F ST = 0.022, from 0 to 0.102) among ten European river lamprey populations using 13 microsatellites markers (Gaigher et al., 2013). A pattern of isolation by distance was also detected (r spearman = 0.79). ...
Population structure in anadromous lampreys: Patterns and processes
Article
Population structure can reveal the diversity, gene flow, and dispersal of a species. This information can be used to make management decisions and reveal fundamental aspects of an organism’s biology. Distinct intrinsic (e.g., biological characteristics) and extrinsic (e.g., geographical and historical events, environment, human pressures) factors can influence population structure, with significant differences among species. However, detection of population structure in migratory lamprey species can be difficult to detect due to their lack of natal homing; this is particularly the case for anadromous lampreys, with their potential for wide dispersal at sea during their parasitic feeding stage. We review phenotypic and genetic markers, as well as the methods that have been used to assess population structure in lampreys, and discuss the relative strengths and limitations of each. Structure has been detected in several anadromous species using some of these methods, even without homing in these species, but we briefly contrast the weak population structure observed in anadromous species with the stronger structure observed in freshwater-resident lamprey species (particularly non-migratory brook lampreys). We relate lamprey population structure to species-specific ecological traits, such as juvenile dispersal tendencies, and provide case studies of six species. Delineation of appropriate management units in migratory lamprey species is important for conservation and management.
... Temperature was set at 12 AE 1°C with a 12 : 12 photoperiod. After spawning of both females, 129 larvae as well as tissue samples from each adult were collected and genotyped using 13 microsatellite markers (Gaigher et al., 2013). Parentage analyses were performed with CERVUS 3.0 (Kalinowski et al., 2007) using the trio logarithm of the odd score, a 95% confidence level and allowing either no or up to two mismatches between putative parents and offspring. ...
... Genomic DNA was extracted from fin clips using a modified Chelex protocol (Estoup et al., 1996). Genotyping was performed with 13 microsatellite markers specifically developed for L. planeri and L. fluviatilis (Gaigher et al., 2013). Allelic richness (Ar), observed heterozygosity (Ho), expected heterozygosity (He) and inbreeding coefficient (Fis) for each population were calculated using FSTAT 2.9.3 (Goudet, 2001). ...
Low reproductive isolation and highly variable levels of gene flow reveal limited progress toward speciation between European river and brook lampreys
Article
Ecologically based divergent selection is a factor that could drive reproductive isolation even in the presence of gene flow. Population pairs arrayed along a continuum of divergence provide a good opportunity to address this issue. Here we used a combination of mating trials, experimental crosses and population genetics analyses to investigate the evolution of reproductive isolation between two closely related species of lampreys with distinct life histories. We used microsatellite markers to genotype over 1000 individuals of the migratory parasitic river lamprey (Lampetra fluviatilis) and freshwater-resident nonparasitic brook lamprey (L. planeri) distributed in 10 sympatric and parapatric population pairs in France. Mating trials, parentage analyses and artificial fertilizations demonstrated a low level of reproductive isolation between species even though size assortative mating may contribute to isolation. Most parapatric population pairs were strongly differentiated due to the joint effects of geographic distance and barriers to migration. In contrast, we found variable levels of gene flow between sympatric populations ranging from panmixia to moderate differentiation, which indicates a gradient of divergence with some population pairs that may correspond to alternative morphs or ecotypes of a single species and others that remain partially isolated. Ecologically-based divergent selection may explain these variable levels of divergence among sympatric population pairs but incomplete genome swamping following secondary contact could have also played a role. Overall, this study illustrates how highly differentiated phenotypes can be maintained despite high levels of gene flow that limit the progress toward speciation. This article is protected by copyright. All rights reserved.
... Genotyping was performed with 13 microsatellite markers specifically developed for L. planeri and L. fluviatilis after DNA extraction using a Chelex protocol modified from Estoup (1996) and strictly following protocols of Gaigher et al. (2013) and Rougemont et al. (2015). ...
Riverscape genetics in brook lamprey: genetic diversity is less influenced by river fragmentation than by gene flow with the anadromous ecotype
Article
Full-text available
Understanding the effect of human-induced landscape fragmentation on gene flow and evolutionary potential of wild populations has become a major concern. Here, we investigated the effect of riverscape fragmentation on patterns of genetic diversity in the freshwater resident European brook lamprey (Lampetra planeri) that has a low ability to pass obstacles to migration. We tested the hypotheses of (i) asymmetric gene flow following water current and (ii) an effect of gene flow with the closely related anadromous river lamprey (L. fluviatilis) ecotype on L. planeri genetic diversity. We genotyped 2472 individuals, including 225 L. fluviatilis, sampled from 81 sites upstream and downstream barriers to migration, in 29 western European rivers. Linear modelling revealed a strong positive relationship between genetic diversity and the distance from the river source, consistent with expected patterns of decreased gene flow into upstream populations. However, the presence of anthropogenic barriers had a moderate effect on spatial genetic structure. Accordingly, we found evidence for downstreamdirected gene flow, supporting the hypothesis that barriers do not limit dispersal mediated by water flow. Downstream L. planeri populations in sympatry with L. fluviatilis displayed consistently higher genetic diversity. We conclude that genetic drift and slight downstream gene flow drive the genetic make-up of upstream L. planeri populations whereas gene flow between ecotypes maintains higher levels of genetic diversity in L. planeri populations sympatric with L. fluviatilis. We discuss the implications of these results for the design of conservation strategies of lamprey, and other freshwater organisms with several ecotypes, in fragmented dendritic river networks.
... Genotyping was performed with 13 microsatellite markers specifically developed for L. planeri and L. fluviatilis after DNA extraction using a Chelex protocol modified from Estoup (1996) and strictly following protocols of (Gaigher et al., 2013;Rougemont et al., 2015) Genetic diversity within populations ...
Riverscape genetics in brook lamprey: genetic diversity is less influenced by river fragmentation than by gene flow with the anadromous ecotype
Preprint
Full-text available
  • Dec 2019
Understanding the effect of human induced landscape fragmentation on gene flow and evolutionary potential of wild populations has become a major concern. Here, we investigated the effect of riverscape fragmentation on patterns of genetic diversity in the freshwater resident brook lamprey (Lampetra planeri) that has a low ability to pass obstacles to migration. We also tested the hypotheses of i) asymmetric gene flow following water current and ii) admixture with the closely related anadromous L. fluviatilis ecotype having a positive effect on L. planeri genetic diversity. We genotyped 2472 individuals, including 225 L. fluviatilis, sampled in 81 sites upstream and downstream from barriers to migration, in 29 West-European rivers. Linear modelling revealed a strong positive relationship between the distance to the source and genetic diversity, consistent with expected patterns of decreased gene flow into upstream populations. However, the presence of anthropogenic barriers had a moderate effect on spatial genetic structure. Accordingly, we found evidence for downstream-directed gene flow, supporting the hypothesis that barriers do not limit dispersal following water flow. Downstream L. planeri populations in sympatry with L. fluviatilis displayed consistently higher genetic diversity. We conclude that genetic drift and slight downstream gene flow mainly drive the genetic make up of upstream L. planeri populations whereas admixture between ecotypes maintains higher levels of genetic diversity in L. planeri populations sympatric with L. fluviatilis. We discuss the implications of these results for the design of conservation strategies of lamprey, and other freshwater organisms with several ecotypes, in fragmented dendritic river networks.
... A wealth of genetic resources are being developed for lampreys, including sequencing of the complete mitochondrial genome for a number of species (Lee and Kocher 1995; Kawai et al. 2015;Ren et al. 2015Ren et al. , 2016Pu et al. 2016), development of nuclear microsatellite loci for population genetic applications (Bryan et al. 2005;Takeshima et al. 2005;McFarlane and Docker 2009;Luzier et al. 2010;Spice et al. 2011;Gaigher et al. 2013;Schedina et al. 2014), and sequencing of the complete somatic and germline genome of the sea lamprey (Smith et al. 2013(Smith et al. , 2018 and somatic genome of the Arctic lamprey (see Mehta et al. 2013;Manousaki et al. 2016; see Chap. 6). Next generation sequencing technologies such as Restriction site Associated DNA Sequencing (RAD-Seq), which sequences small segments (totaling 0.1-10%) of the genome, are allowing researchers to identify large numbers of single nucleotide polymorphisms (SNPs) for various applications related to lamprey evolution, ecology, and conservation (e.g., Mateus et al. 2013b;Hess et al. 2013;Hess 2016;Rougemont et al. 2017;Hume et al. 2018a). ...
There and Back Again: Lampreys in the 21st Century and Beyond
Chapter
  • Jun 2019
The 21st century is proving to be an exciting time to study lamprey biology. Lampreys have long provided important insights into key developments in vertebrate evolution; research in support of sea lamprey control in the Laurentian Great Lakes has made significant contributions to our understanding of lamprey biology; and there is now (near) global interest in the conservation of threatened lamprey species. Furthermore, we are beginning to see a convergence of these formerly discrete research areas, as well as greater interactions and knowledge exchange between researchers and managers from different geographic regions. In this conclusion to Volumes 1 and 2 of Lampreys: Biology, Conservation and Control, we provide an overview of some exciting advances in our knowledge of lamprey biology and potential challenges facing lampreys and lamprey biologists in the near future. Recent advances and remaining knowledge gaps in many aspects of fundamental lamprey biology are covered in other chapters in these two volumes; here, we focus on the intersection of biology, conservation, and control. For example, molecular analysis has resolved many of the previous uncertainties regarding lamprey phylogenetic relationships, but continued uncertainties (e.g., the relationship between “paired” parasitic and non-parasitic lampreys) and lack of an explicit phylogenetic framework contribute to ongoing confusion among biologists regarding correct lamprey nomenclature. Although lamprey taxonomy will no doubt continue to be revised as we refine our hypotheses regarding the evolutionary relationships among lampreys, it is important that we: (1) use consistent and accepted species names to enable accurate communication between researchers and managers from different regions; and (2) recognize that conservation legislation acknowledges biological diversity below the species level (i.e., evolutionarily significant units, ESUs) so that genetically or otherwise distinct lamprey populations are eligible for protection without prematurely or inconsistently describing each as a distinct species. Novel methodologies that are contributing to our understanding of lamprey biology and that have exciting applications to lamprey conservation and control include: (1) improvements to deepwater larval sampling methods to help evaluate the extent to which lentic and deep riverine habitats are used by different lamprey species; (2) improved tools for monitoring the spawning migration; (3) environmental DNA (eDNA) and pheromone detection assays that have the potential to provide cost-effective supplements to traditional lamprey survey methods; and (4) genetic and genomic tools that are being used in a variety of ways to help refine our understanding of lamprey biology (e.g., mating systems, larval dispersal and growth rates) and to aid conservation and control efforts (e.g., elucidating genetic stock structure, monitoring the success of translocation efforts). Not surprisingly, advances and challenges related to lamprey control and conservation are often “two sides of the same coin.” This is particularly true with respect to passage of upstream migrants at anthropogenic barriers, and knowledge of lamprey behavior at barriers is being used to both block sea lamprey migration in Great Lakes tributaries and enhance passage efficiency for other lampreys elsewhere. Achieving successful lamprey conservation and control will also require positive public and legislative attitudes towards species in need of conservation and continued public support and acceptance of sea lamprey control efforts. Pursuit of genetic control options in particular will need to address ethical and societal concerns.
... o anthropogenic barriers to migration with no opportunity for gene flow with L. fluviatilis. The sampling included temporal replicates on the Oir (2010Oir ( , 2011Oir ( and 2014), Bresle (2011 and 2014), and Risle rivers (2011 and 2014). A set of 13 microsatellites was used to genotype a total of 727 individuals following the protocol described in Gaigher et al. (2013). ...
Reconstructing the demographic history of divergence between European river and brook lampreys using approximate Bayesian computations
Article
Full-text available
  • Apr 2016
Inferring the history of isolation and gene flow during species divergence is a central question in evolutionary biology. The European river lamprey ( Lampetra fluviatilis ) and brook lamprey (L. planeri) show a low reproductive isolation but have highly distinct life histories, the former being parasitic-anadromous and the latter non-parasitic and freshwater resident. Here we used microsatellite data from six replicated population pairs to reconstruct their history of divergence using an approximate Bayesian computation framework combined with a random forest model. In most population pairs, scenarios of divergence with recent isolation were outcompeted by scenarios proposing ongoing gene flow, namely the Secondary Contact (SC) and Isolation with Migration (IM) models. The estimation of demographic parameters under the SC model indicated a time of secondary contact close to the time of speciation, explaining why SC and IM models could not be discriminated. In case of an ancient secondary contact, the historical signal of divergence is lost and neutral markers converge to the same equilibrium as under the less parameterized model allowing ongoing gene flow. Our results imply that models of secondary contacts should be systematically compared to models of divergence with gene flow; given the difficulty to discriminate among these models, we suggest that genome-wide data are needed to adequately reconstruct divergence history.
... fluviatilis which, as previous studies have shown, is usually limited to higher order channels, and individuals do not generally penetrate the smaller brooks even where access is unhindered by barriers (Hardisty & Potter 1971c;Hardisty 1986b). An interruption of gene flow between different life history forms should consequently stimulate genetic divergence and might ultimately lead to speciation via the development of reproductive isolation between them (Futuyma 1998). ...
The evolutionary and behavioural ecology of a European lamprey species pair (Lampetra fluviatilis and L. planeri): conservation concerns and anthropogenic impacts
Research
Full-text available
  • Nov 2015
PhD Thesis: Lampreys (Order Petromyzontiformes) have existed for over 365 million years and are considered the most ancient group of living vertebrates. Given the socioeconomic, cultural, and ecological consequences of declining lamprey populations, it is imperative to address declines by implementing effective conservation management. This thesis explores the conservation issues affecting the European lamprey species pair Lampetra fluviatilis and Lampetra planeri and offers a holistic approach to their management and conservation in relation to anthropogenic impacts. The rapid development of smallscale hydropower provides substantial risk to migrating biota. At the site of an Archimedes screw turbine, damage rates to lampreys that passed through the screw were low (1.5%) and distinct seasonal, and diel, patterns of migration were exhibited by recently transformed juvenile and larval lampreys. Results indicated longer periods of impingement risk than expected. Cumulative potential impacts of multiple hydropower sites on downstream fish passage (including lampreys) should, however, be considered by regulatory agencies when planning hydropower development within catchments. Anthropogenic barriers were also found to intensify differentiation between L. planeri populations and anadromous L. fluviatilis populations. Gene flow was consequently found to be asymmetric due to the barriers allowing downstream movement, whilst obstructing active upstream migration. Samples of 543 European river lamprey Lampetra fluviatilis and European brook lamprey Lampetra planeri from across 15 sites, primarily in the British Isles, were investigated for 829bp mtDNA sequence and 13 polymorphic microsatellite DNA loci. Contrasting patterns of population structure were found for mtDNA (which revealed no differentiation between species) and microsatellite DNA markers. Microsatellite markers revealed strong differentiation among freshwater-resident L. planeri populations, and between L. fluviatilis and L. planeri in most cases, but little structure was evident among anadromous L. fluviatilis populations. There is also evidence that there has been some degree of gene flow between L. fluviatilis and L. planeri since these populations were established. There is much debate as to whether lamprey paired-species constitute distinct species or are divergent ecotypes of a single polymorphic species. Overall, these findings are suggestive of multiple independent divergences of L. planeri from an anadromous ancestor (i.e. L. planeri are polyphyletic). Focus of conservation and management efforts, therefore, needs to be directed towards ensuring the longitudinal connectivity within rivers, and the continued existence of the specific habitats necessitated within lamprey life-cycles. Molecular techniques should be applied to identify genetically differentiated populations of freshwater-resident lampreys. Appropriate measures, such as, the designation of a network of Special Areas of Conservation (SACs), and recognising these populations as distinct Evolutionarily Significant Units, should also be implemented to ensure the survival of these populations.
... Thirteen recently developed polymorphic microsatellite loci were used to examine genetic differentiation among and between all L. fluviatilis and L. planeri populations. Eight microsatellite primers developed for European Lampetra (Lp-003, Lp-006, Lp-009, Lp-018, Lp-027, Lp-028, Lp-046 and Lp-045; Gaigher et al. 2013), one primer set developed for Lampetra richardsoni (Lri-5; Luzier et al. 2010), and four microsatellite primers developed in this study (using the protocol described in White et al. 2010) and optimized for European Lampetra species (Lamper_1, Lamper_2, Lamper_3, Lamper_4) were included (Table S3, Supporting information). ...
Contrasting population genetic structure among freshwater-resident and anadromous lampreys: The role of demographic history, differential dispersal and anthropogenic barriers to movement
Article
Full-text available
The tendency of many species to abandon migration remains a poorly understood aspect of evolutionary biology that may play an important role in promoting species radiation by both allopatric and sympatric mechanisms. Anadromy inherently offers an opportunity for the colonisation of freshwater environments, and the shift from an anadromous to a wholly-freshwater life-history has occurred in many families of fishes. Freshwater-resident forms have arisen repeatedly among lampreys (within the Petromyzontidae and Mordaciidae), and there has been much debate as to whether anadromous lampreys, and their derived freshwater-resident analogues, constitute distinct species or are divergent ecotypes of polymorphic species. Samples of 543 European river lamprey Lampetra fluviatilis (mostly from anadromous populations) and freshwater European brook lamprey L. planeri from across 18 sites, primarily in the British Isles, were investigated for 13 polymorphic microsatellite DNA loci, and 108 samples from six of these sites were sequenced for 829bp of mitochondrial DNA (mtDNA). We found contrasting patterns of population structure for mtDNA and microsatellite DNA markers, such that low diversity and little structure were seen for all populations for mtDNA (consistent with a recent founder expansion event), while fine-scale structuring was evident for nuclear markers. Strong differentiation for microsatellite DNA loci was seen among freshwater-resident L. planeri populations and between L. fluviatilis and L. planeri in most cases, but little structure was evident among anadromous L. fluviatilis populations. We conclude that post-glacial colonisation founded multiple freshwater-resident populations with strong habitat fidelity and limited dispersal tendencies, that became highly differentiated, a pattern that was likely intensified by anthropogenic barriers. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Multisensory valorization of a landscape as a method for identifying areas requiring value. A case study
Article
Full-text available
Multisensory landscape valorization as used in this study was intended to identify areas that required value. Our unique approach to the methodology allowed a comprehensive analysis of the research area, i.e. Lake Rusałka in Poznań, a major city in central western Poland. Analysis was based on recording multisensory experiences and assigning bonitation points to stimuli, enabling a comprehensive assessment of the analyzed area. The thusly designated zones indicated sites which required technical improvements and adequate planning in order to improve their perception.
Rapid one-tube DNA extraction for reliable PCR detection of fish polymorphic markers and transgenes
Article
Full-text available
Two simple and rapid procedures of DNA extraction based on Chelex resin were compared and optimized to get reliable amplification by polymerase chain reaction (PCR) from diverse sources of fish tissue (fin, liver, muscle, blood, scales, and individual eggs) at numerous nuclear loci (13 microsatellites and 4 lacZ transgenes) and mitochondrial loci (ND5/6 and cytochrome b/D loop). The first procedure worked for the majority of markers under investigation. However, it did not result in satisfactory PCR products for six microsatellite loci and for one mitochondrial DNA domain. This problem was addressed with the second procedure by adding proteinase K from the extraction start. This pretreatment provided an all-or-none improvement, as it had a strong positive effect on ''refractory'' loci (much better PCR yield and reduced number of unspecific and supernumerous bands) but did not quantitatively enhance or attenuate the amplification of all other loci.
Communal spawning of brook and river lampreys (Lampetra planeri and L-fluviatilis) is common in the Oir River (France)
Article
Full-text available
  • Sep 2010
Lasne E, Sabatié M-R, Evanno G. Communal spawning of brook and river lampreys (Lampetra planeri and L. fluviatilis) is common in the Oir River (France). Ecology of Freshwater Fish 2010: 19: 323–325. © 2010 John Wiley & Sons A/S Abstract – The taxonomic status of river Lampreys (Lampetra fluviatilis) and brook lampreys (L. planeri) has been repeatedly questioned due to the high morphological similarity of these species. Here, we report a high frequency (54%) of communal spawning involving both species in the Lampetra redds of a French coastal river. These observations suggest that reproductive isolation between the two species may not be as strong as previously supposed.
High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries
Article
Full-text available
  • Jul 2011
Microsatellites (or SSRs: simple sequence repeats) are among the most frequently used DNA markers in many areas of research. The use of microsatellite markers is limited by the difficulties involved in their de novo isolation from species for which no genomic resources are available. We describe here a high-throughput method for isolating microsatellite markers based on coupling multiplex microsatellite enrichment and next-generation sequencing on 454 GS-FLX Titanium platforms. The procedure was calibrated on a model species (Apis mellifera) and validated on 13 other species from various taxonomic groups (animals, plants and fungi), including taxa for which severe difficulties were previously encountered using traditional methods. We obtained from 11,497 to 34,483 sequences depending on the species and the number of detected microsatellite loci ranged from 199 to 5791. We thus demonstrated that this procedure can be readily and successfully applied to a large variety of taxonomic groups, at much lower cost than would have been possible with traditional protocols. This method is expected to speed up the acquisition of high-quality genetic markers for nonmodel organisms.
GENEPOP ' 007: a complete re-implementation of the GENEPOP software for Windows and Linux
Article
Full-text available
  • Jan 2008
This note summarizes developments of the genepop software since its first description in 1995, and in particular those new to version 4.0: an extended input format, several estimators of neighbourhood size under isolation by distance, new estimators and confidence intervals for null allele frequency, and less important extensions to previous options. genepop now runs under Linux as well as under Windows, and can be entirely controlled by batch calls.
GENETIX4. 05, logiciel sous Windows TM pour la génétiquedes populations
Article
  • Jan 2004
The Biology of Lampreys
Article
  • Jan 1971
Rice WR. Analyzing tables of statistical tests. Evol Int J Org Evol 43: 223-225
Article
Population genetics of a cyclostome species pair, river lamprey (Lampetra fluviatilis L.) and brook lamprey (Lampetra planeri Bloch)
Article
Horizontal agarose gel electrophoresis of 24 allozyme loci in four species of Central European lampreys (321 Lampetra planeri, 83 L. fluviatilis, 11 Eudontomyzon mariae and nine Petromyzon marinus) was used to study the ‘paired species’L. fluviatilis and L. planeri. The genetic differentiation of the anadromous river lamprey (L. fluviatilis) from the stationary brook lamprey (L. planeri) was within the range of ingroup differentiation of the latter, but L. fluviatilis exhibited much greater population cohesion over a more extended geographic range: GST = 0.0537 versus GST = 0.3398, Nem = 4.402 versus Nem = 0.4856, mean genetic among-stock distances D = 0.0047 versus D = 0.0257. L. planeri populations coexisting geographically with L. fluviatilis in the Rhine and Elbe river systems were genetically more cohesive than L. planeri stocks from the Danubian basin where L. fluviatilis is absent. Danubian L. planeri populations exhibit a lower degree of heterozygosity than brook lampreys from the Rhine river system, but comprise deeper genetic lineages (GST = 0.4629 versus GST = 0.2434), despite being sampled from a much more restricted area. Isolation-by-distance is observed for L. planeri from the Danubian but not from the Atlantic drainage basins. Transspecific gene flow between L. planeri from Atlantic drainage basins and the long-distant migrating L. fluviatilis is inferred, raising doubt on the validity of two separate biospecies. E. mariae and P. marinus are clearly differentiated from Lampetra spp. at several allozyme loci.
Conservation status of Northern Hemisphere lampreys (Petromyzontidae)
Article
Among the 34 nominal lamprey species in the Northern Hemisphere, ten are endangered; nine are vulnerable at least in part of their range, and one is extinct. The major cause is habitat degradation through pollution and stream regulation. Four conservation priorities are recommended: 1. The protection of all lamprey species or populations thereof listed as endangered; 2. where needed, the rehabilitation of the spawning streams of non-parasitic species and the removal or circumvention of any barriers preventing access to the spawning sites; 3. the protection of permanent freshwater resident populations of anadromous species, specifically of Entosphenus tridentatus, Lampetra ayresi, L. fluviatilis, Lethenteron japonicum and Petromyzon marinus: 4. the study of the conservation status of Asian lampreys.
MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data
Article
  • Sep 2004
DNA degradation, low DNA concentrations and primer-site mutations may result in the incorrect assignment of microsatellite genotypes, potentially biasing population genetic analyses. MICRO-CHECKER is WINDOWS(R)-based software that tests the genotyping of microsatellites from diploid populations. The program aids identification of genotyping errors due to nonamplified alleles (null alleles), short allele dominance (large allele dropout) and the scoring of stutter peaks, and also detects typographic errors. MICRO-CHECKER estimates the frequency of null alleles and, importantly, can adjust the allele and genotype frequencies of the amplified alleles, permitting their use in further population genetic analysis.