Rescue of Infralimbic mGluR(2) Deficit Restores Control Over Drug-Seeking Behavior in Alcohol Dependence

Article (PDF Available)inThe Journal of Neuroscience : The Official Journal of the Society for Neuroscience 33(7):2794-806 · February 2013with79 Reads
DOI: 10.1523/JNEUROSCI.4062-12.2013 · Source: PubMed
Abstract
A key deficit in alcohol dependence is disrupted prefrontal function leading to excessive alcohol seeking, but the molecular events underlying the emergence of addictive responses remain unknown. Here we show by convergent transcriptome analysis that the pyramidal neurons of the infralimbic cortex are particularly vulnerable for the long-term effects of chronic intermittent ethanol intoxication. These neurons exhibit a pronounced deficit in metabotropic glutamate receptor subtype 2 (mGluR(2)). Also, alcohol-dependent rats do not respond to mGluR(2/3) agonist treatment with reducing extracellular glutamate levels in the nucleus accumbens. Together these data imply a loss of autoreceptor feedback control. Alcohol-dependent rats show escalation of ethanol seeking, which was abolished by restoring mGluR(2) expression in the infralimbic cortex via viral-mediated gene transfer. Human anterior cingulate cortex from alcoholic patients shows a significant reduction in mGluR(2) transcripts compared to control subjects, suggesting that mGluR(2) loss in the rodent and human corticoaccumbal neurocircuitry may be a major consequence of alcohol dependence and a key pathophysiological mechanism mediating increased propensity to relapse. Normalization of mGluR(2) function within this brain circuit may be of therapeutic value.
Neurobiology of Disease
Rescue of Infralimbic mGluR
2
Deficit Restores Control Over
Drug-Seeking Behavior in Alcohol Dependence
Marcus W. Meinhardt,
1
Anita C. Hansson,
1
Stephanie Perreau-Lenz,
1
Christina Bauder-Wenz,
1
Oliver Sta¨hlin,
1
Markus Heilig,
2
Clive Harper,
3
Karla U. Drescher,
4
Rainer Spanagel,
1
and Wolfgang H. Sommer
1
1
Institute of Psychopharmacology at Central Institute of Mental Health, Medical Faculty Mannheim, University of Heidelberg, 68159 Mannheim, Germany,
2
Laboratory of Clinical and Translational Studies, National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, Maryland
20892,
3
New South Wales Tissue Resource Centre, University of Sydney, 2006 Sydney, Australia, and
4
Abbott Neuroscience Research, 67061 Ludwigshafen,
Germany
A key deficit in alcohol dependence is disrupted prefrontal function leading to excessive alcohol seeking, but the molecular events
underlying the emergence of addictive responses remain unknown. Here we show by convergent transcriptome analysis that the pyra-
midal neurons of the infralimbic cortex are particularly vulnerable for the long-term effects of chronic intermittent ethanol intoxication.
These neurons exhibitapronounced deficit in metabotropic glutamate receptor subtype 2 (mGluR
2
). Also, alcohol-dependent rats do not
respond to mGluR
2/3
agonist treatment with reducing extracellular glutamate levels in the nucleus accumbens. Together these data imply
a loss of autoreceptor feedback control. Alcohol-dependent rats show escalation of ethanol seeking, which was abolished by restoring
mGluR
2
expression in the infralimbic cortex via viral-mediated gene transfer. Human anterior cingulate cortex from alcoholic patients
shows a significant reduction in mGluR
2
transcripts compared to control subjects, suggesting that mGluR
2
loss in the rodent and human
corticoaccumbal neurocircuitry may be a major consequence of alcohol dependence and a key pathophysiological mechanism mediating
increased propensity to relapse. Normalization of mGluR
2
function within this brain circuit may be of therapeutic value.
Introduction
The molecular and neuroanatomical substrates underlying sub-
stance use disorders including alcohol dependence remain poorly
understood. Imbalances in glutamate neurotransmission and ho-
meostasis are considered to play a central role for the increased
propensity to relapse in addicted individuals (Everitt and
Robbins, 2005; Kalivas, 2009; Spanagel, 2009). In particular, the
glutamatergic corticoaccumbal pathway plays an essential role
for reinstating drug-seeking behavior in animal models of relapse
(Kalivas, 2009). It has been shown that lesions or inactivation of
the medial prefrontal cortex (mPFC) or nucleus accumbens pre-
vent reinstatement of drug seeking following extinction, while
activation of either structure stimulates drug seeking (Cornish
and Kalivas, 2000; Capriles et al., 2003; McFarland et al., 2004).
Supporting this notion, human functional magnetic resonance
imaging identified a positive correlation between cue reactivity,
craving, and activity in prefrontocortical regions in addicted pa-
tients (Wilson et al., 2004; Schacht et al., 2013). A dysregulation
of central glutamate levels in these areas during withdrawal and
protracted abstinence was recently reported as well (Hermann et
al., 2012a,b). Despite these findings on the role of the mPFC–
accumbal pathway in relapse, relatively little is known about the
molecular and cellular neuroadaptations within this circuit that
result in susceptibility to relapse.
Here we set out to elucidate alcohol-induced dysregulation of
mPFC function in rats with a history of alcohol dependence, i.e.,
by exposure to daily cycles of intermittent alcohol vapor intoxi-
cation and withdrawal, a paradigm that produces high intoxica-
tion with brain alcohol levels above 200 mg/dl and induces
behavioral and molecular changes relevant for the pathophysiol-
ogy of alcoholism in both rats and mice (Rogers et al., 1979;
Roberts et al., 2000; Rimondini et al., 2002, 2003, 2008; Becker
and Lopez, 2004; O’Dell et al., 2004; Hansson et al., 2008;
Sommer et al., 2008; Melendez et al., 2012). Animals derived
from this procedure are termed “postdependent” to emphasize
the fact that neuroadaptations induced through a history of alco-
hol dependence remain even in the absence of continued ethanol
intoxication. This phenomenon has been consistently demon-
strated for a long-lasting behavioral sensitivity to stress and al-
tered amygdala (Amy) gene expression (Funk et al., 2006; Heilig
and Koob, 2007; Sommer et al., 2008 ; Vendruscolo et al., 2012).
In this sense, postdependent animals may model the increased
propensity to relapse in abstinent alcoholic patients (Bjo¨rk et al.,
2010; Heilig et al., 2010). We used a multilayered search strategy
Received Aug. 23, 2012; revised Oct. 19, 2012; accepted Oct. 29, 2012.
Author contributions: M.W.M., A.C.H., S.P.-L., M.H., R.S., and W.H.S. designed research; M.W.M., A.C.H., S.P.-L.,
C.B.-W. O.S., K.U.D., and W.H.S. performed research; M.H., C.H., and K.U.D. contributed unpublished reagents/
analytic tools; M.W.M., M.H., K.U.D., R.S., and W.H.S. analyzed data; M.W.M., R.S., and W.H.S. wrote the paper.
This work was supported by the Bundesministerium fu¨r Bildung und Forschung within the frameworks of NGFN
Plus (FKZ 01GS08151, 01GS08152, and 01GS08155; see www.ngfn-alkohol.de, Spanagel et al., 2010) and ERA-Net
TRANSALC (FKZ 01EW1112), the European Commission FP-6 Integrated Project IMAGEN (PL037286), the Deutsche
Forschungsgemeinschaft (Center Grant SFB636; project Grant HA 6102/1-1 to A.C.H.; Reinhart-Koselleck Award SP
383/5-1 to R.S.),and the IntramuralResearch Program ofthe NIAAA (M.H.).We thank ElisabethRo¨bel and Fernando
Leonardi-Essmann for assistance in laboratory experiments.
The authors declare no competing financial interests.
Correspondence should be addressed to Wolfgang H. Sommer, Central Institute of Mental Health, Square J5,
68159 Mannheim, Germany. E-mail: wolfgang.sommer@zi-mannheim.de.
DOI:10.1523/JNEUROSCI.4062-12.2013
Copyright © 2013 the authors 0270-6474/13/332794-13$15.00/0
2794 The Journal of Neuroscience, February 13, 2013 33(7):2794 –2806
that started with an unbiased transcriptome screening of multiple
brain regions and converged on a distinct neuronal population
that exhibits a profound metabotropic glutamate receptor sub-
type 2 (mGluR
2
) deficit. This receptor belongs to the Class II
metabotropic glutamate receptors (mGluR
2/3
) that are key to
regulating glutamatergic neurotransmission in brain regions
mediating drug seeking and incentive motivation, including
the mPFC–accumbal pathway (Ohishi et al., 1993; Olive,
2009). mGluR
2/3
negatively modulate glutamate transmission
as autoreceptors by inhibiting glutamate release and by reduc-
ing neuronal excitability at the postsynaptic level (Ferraguti
and Shigemoto, 2006). Dysregulation of mGluR
2/3
function
within the mPFC–accumbal pathway has been found after
withdrawal from chronic exposure to cocaine, nicotine, and
opioids (Liechti and Markou, 2007; Moussawi et al., 2009;
Olive, 2009). Here we found that the mGluR
2
autoreceptor
function is specifically disrupted after a history of alcohol de-
pendence, which allowed us to develop a rescue strategy for
restoring behavioral control in alcohol-dependent rats by fo-
cal mGluR
2
overexpression.
Materials and Methods
Animal husbandry. Male Wistar rats, initial weight 220–250 g, were used
(Charles River), housed four per cage under a 12 h light/dark cycle with
ad libitum access to food and water. All behavioral testing was performed
during the dark phase, 5 d per week. All experiments were conducted in
accordance with the ethical guidelines for the care and use of laboratory
animals and were approved by the local animal care committee (Regier-
ungspraesidium Karlsruhe, Karlsruhe, Germany). Five batches of ani-
mals were uniformly treated with either intermittent alcohol vapor or air
exposure: Batch 1, n 10 per group for microarray and n 8 per group
for in situ hybridization; Batch 2, n 8 per group for laser-capture
microscopy (LCM) study; Batch 3, n 8 per group for microdialysis;
Batches 4 and 5, n 8 and 16 per group for operant self-administration
experiments, respectively.
Ethanol exposure. Rats were weight-matched, assigned into the two
experimental groups, and exposed to either ethanol vapor or normal air
using a rodent alcohol inhalation system as described previously
(Rimondini et al., 2002). Briefly, pumps (Knauer) delivered alcohol into
electrically heated stainless-steel coils (60°C) connected to an airflow of
18 L/min into glass and steel chambers (1 1 1 m). For the next 7
weeks rats were exposed to five cycles of 14 h of ethanol vapor per week
(0:00 A.M. to 2:00 P.M.) separated by daily 10 h periods of withdrawal.
Twice per week, blood (20
l) was sampled from the lateral tail vein,
and blood alcohol concentrations were determined using an AM1
Analox system (Analox Instruments). After the last exposure cycle, rats
remained abstinent for 2–3 weeks before further entering further exper-
iments (3 weeks for gene expression and microdialysis analysis, 2 weeks
for resumption of operant training).
Measurement of ethanol withdrawal signs. Using a withdrawal rating
scale according to Macey et al. (1996), alcohol withdrawal signs in-
cluding irritability to touch (vocalization), body tremors, tail rigidity,
and ventromedial limb retraction were weekly scored, 6 h after etha-
nol vapor was turned off. Each sign was assigned a score of 0–2, based
on the following severity scale: 0, no sign; 1, moderate; 2, severe. The
sum of the four observation scores (0 to 8) was used as a quantitative
measure of withdrawal severity. For these behavioral observations,
animals were individually transferred from their home cages to a
quiet observation room to avoid extraneous stimulation, and animals
were observed in a blind fashion.
Rat brain tissue samples and microarray experiment. Three weeks after
the last exposure cycle, postdependent (alcohol exposed, n 10) and
control (air exposed, n 10) animals were killed during the first4hof
the light cycle by decapitation, and brains were frozen in 40°C isopen-
tane and kept at 80°C. Bilateral samples were obtained under a magni-
fying lens using anatomical landmarks (Paxinos and Watson, 1998).
Amygdala, nucleus accumbens, and medial prefrontal cortex including
Cg1 2, prelimbic cortex, and infralimbic cortex) according to Paxinos
and Watson (1998) were prepared as described previously (Arlinde et al.,
2004). Briefly, amygdala was prepared from a 2 mm-thick-coronal slice,
taken in a Kopf brain slicer by placing the rostral blade on the caudal edge
of the optic chiasm. For preparation of cingulate cortex and accumbens,
the rostral blade was placed 4 mm rostral to this landmark, and a second
2 mm coronal slice was obtained. Cortical tissue was dissected out with a
scalpel, while amygdala and accumbens tissues were obtained using a
punch (2 mm diameter). Samples were stored at 80°C until RNA was
prepared.
Total RNA was extracted with Trizol reagent (Invitrogen) followed by
an RNeasy (Qiagen) column-based cleanup step according to the man-
ufacturer’s instructions. All RNA samples showed A260/280 absorption
ratios between 1.9 and 2.1. RNA integrity was determined using an Agi-
lent 2100 Bioanalyzer (Agilent Technologies), and only material without
signs of degradation was used.
Microarray target preparation was done for individual samples and
hybridization to RAE230A arrays, staining, washing, and scanning of the
chips were performed according to the manufacturer’s technical manual
(Affymetrix). The Microarray Analysis Suite 5.0 (MAS5)-produced CEL
files were inspected for regional hybridization bias and quality control
parameters as described previously (Reimers et al., 2005). Forty-eight
microarrays (mPFC, 9 and 9; accumbens, 7 and 7; amygdala, 7 and 9,
postdependent and control rats, respectively) passed quality control. The
MAS5 recognized 60% of the 15 800 probe sets on the RAE230A array
as present in our samples. Robust multichip average expression values
were obtained and tested for differential gene expression using Welch’s
two-sample t test, assuming unequal variances at a p 0.05 threshold.
The microarray CEL files were imported into gene set enrichment anal-
ysis (GSEA) software, available at www.broadinstitute.org/gsea/, and
gene set enrichment analysis was performed against gene sets for glu-
tamatergic and GABAergic neurons described by Sugino et al. (2006)
(Table 1 ).
Human brain tissue. Human brain tissue samples were obtained from
the New South Wales Tissue Resource Centre at the University of Sydney,
Australia (http://www.pathology.usyd.edu.au/trc.htm). Tissue from 30
male subjects of European descent consisting of 15 chronic alcoholics
Table 1. Gene sets for glutamatergic and GABAergic neurons
Glutamatergic genes GABAergic genes
Adora1 Kpna1 Abat
Ak3l1 Lmo4 Capza1
Ap1gbp1 Lmo7 Cds2
Arpc5 Mast3 Cygb
Arpp21 Neurod2 Gad1
Baiap2 Nphp1 Gad2
Cpd Nrgn Grik1
Crip2 Nupl1 Kcnc1
Crym Ppp3ca Klhl13
Dgat2 Ptk2 Ltbp3
Dusp14 Ptk2b Map3k1
Egr4 Rap2b Paip2
Ensa Rin1 Pcaf
Ets2 Srr Pcp4l1
Fhl2 St3gal5 Pdxk
Galntl1 Stx1a Ppp3cb
Gpm6b Synpo Ptprm
Gria2 Tesc Rpp25
Hebp1 Tjp1 Slc32a1
Igfbp6 Tyro3 Slc6a1
Itpka Zfp179 Socs5
Klf10 Zfp238 Sv2a
Klhl2 Txnl1
Gene sets were taken fromSugino etal. (2006)who found extremely divergent expression profiles from GABA-ergic
interneurons and glutamatergic pyramidal neurons. p values for top candidates ranged from a maximum of 1.5
10
11
to1.8 10
27
(GABAergicversus glutamatergic population).Only genes thathadrat homologes andwere
present on the Affymetrics arrays were used. Significant genes in the microarray experiment from mPFC are in bold
letters.
Meinhardt et al. mGluR
2
and Drug Seeking J. Neurosci., February 13, 2013 33(7):2794–2806 2795
and 15 control cases was used for this study. Subject affiliation to the
alcoholics or control group was confirmed postmortem using the Diag-
nostic Instrument for Brain Studies–Revised, which is consistent with the
criteria of the Diagnostic and Statistical Manual for Mental Disorders,
fourth edition (DSM-IV) (American Psychiatric Association, 1994). All
alcoholics had consumed 80 g of ethanol per day, whereas the control
cases had an average daily consumption of 20 g. To reduce the number
of confounding factors, we tried to not include any subjects where the
cause of death was suicide, the postmortem interval was 40 h, or blood
alcohol or significant amounts of psychiatric medication (concentration
1.0 mg/L) was detected at the autopsy whenever possible. For each
subject, we analyzed tissue samples from the anterior cingulate cortex.
RNA extraction and analysis was done as described previously
(Sommer et al., 2010). RNA from brain tissue was isolated using Trizol
according to manufacturer’s protocol (Invitrogen). RNA samples under-
went a cleanup step using the RNeasy Mini Kit (Qiagen) and were then
treated with RQ1 RNase-free DNase (Promega) following manufactur-
er’s instructions, to eliminate DNA contamination. All RNA samples had
acceptable 260/280 ratios (1.8 –2.1). RNA samples were then analyzed
with an Agilent 2100 Bioanalyzer and the RNA integrity number. RNA
(100 ng) was used for cDNA synthesis using reverse transcription re-
agents according to the manufacturer’s protocol (Applied Biosystems).
For the quantitative real-time (qRT)-PCR method, see below, Quantita-
tive RT-PCR from micropunched, amplified, and human tissue. In ad-
dition to GAPDH, we used ALUSX as a second endogenous control.
Results were similar for both reference genes.
Stereotaxic injections. For stereotaxic injections of the retrograde tracer
(n 8 per group), rats were anesthetized (isofluran) and placed in a Kopf
stereotaxic instrument, and 300 nl of rhodamine-labeled fluorescent la-
tex microspheres (Lumafluor) were delivered to the nucleus accumbens
shell at 70 nl/min using a WPI microinjectionpump through a 33 gauge
beveled needle. The stereotaxic coordinates for the injections (Wistar
rats, 500 g) were 1.8 mm AP, 0.9 mm ML, and 7.5 mm DV relative
to bregma. Following surgery, rats were single housed for 2 d. Aftera7d
recovery period, rats were euthanized for tissue collection as described
below.
For lentiviral injections, rats received 600 nl of either Lenti-control or
Lenti-mGluR
2
to bilaterally into the infralimbic cortex at 70 nl/min. The
stereotaxic coordinates for the injections (500 g Wistar rats) were 3.2
mm AP, 0.52 mm ML, and 5.1 mm DV relative to bregma.
Gene expression analysis of infralimbic projection neurons via qRT-PCR.
Rats recovered for 1 week following stereotaxic tracer delivery. For per-
fusions, rats were anesthetized (ketamin/xylazin, 100/5 mg/kg, i.p.) and
transcardially perfused with ice-cold 50 ml PBS followed by 80 ml 0.5%
paraformaldehyde (PFA) containing 20% sucrose. After perfusions,
brains were removed and flash frozen in 40°C isopentanol and stored at
80°C up to 72 h before sectioning.
Frozen brains were cut into 12-
m-thick coronal sections with a cry-
ostat. Sections were mounted on PALM membrane slides and kept at
80°C and process at the same day. Just before LCM, slides were thawed
to 25°C; rapidly trimmed of tissue tech; dehydrated with 75% EtOH
(30s), 95% EtOH (30s), 100% EtOH (30s), and xylene (1 min); and then
air-dried for 5 min and immediately used for LCM.
LCM was performed using a Zeiss PALM laser system. Tracer-labeled
cells were identified using a CY3 advanced filter cube (excitation, band-
pass 546/12; emission, bandpass 575– 640). The laser focus followed a
circular trajectory of 8 –10
m in diameter to cut out and separate tracer
positive cells from the adjacent tissue, following a final slightly subfocal
laser pulse to catapult the cell into an LCM cup. Laser-targeted cells were
bonded to adhesive LCM caps by aiming the laser beam at the thin plastic
sheet in the cap directly above the target cell. Per animal, 70 –100 cells
were collected.
RNA was extracted with the RNeasy Micro kit for microdissected cryo-
sections. All steps were performed according to the manufactures recom-
mendations. A speed vac (Vacufuge 2015727; Eppendorf) was used to dry
down the eluted RNA to 3
l for the further amplification step. Total
RNA was amplified using the TargetAmp 2-Round aRNA Amplification
Kit 2.0 (Epicenter) according to manufacturer’s recommendations. We
typically obtained 2–5
g of amplified RNA after the second amplifica-
tion round. Amplifications were performed from six exposed and seven
control tracer cell RNA extractions.
Quantitative RT-PCR from micropunched, amplified, and human tissue.
RNA (100 ng total) was reverse transcribed using the High Capacity
RNA-to-cDNA Master Mix (Applied Biosystems) following the manu-
facturer’s protocol. Samples were assayed in triplicate in a total reaction
volume of 20
l using Power SYBR Green PCR Master Mix (Applied
Biosystems) on an Applied Biosystems 7900 HT RT-PCR System (40
cycles of 95°C for 15 s and 60°C for 1 min). A melting profile was re-
corded at the end of each PCR to check for aberrant fragment amplifica-
tions. Primers for each target were designed toward the 3 end of the
coding sequence by considering exon–exon junctions when possible,
based on the National Center for Biotechnology Information reference
sequence database. Amplicons were designed with 95–110 bp length and
melting temperatures 75°C to be able to distinguish between ampli-
cons and primer-dimer formations in the melting analysis. For primer
sequences, see Table 2. The Applied Biosystems SDS 2.2.2 software was
used to analyze the SYBR Green fluorescence intensity and to calculate
the theoretical cycle number when a defined fluorescence threshold was
passed (Ct values). Relative quantification was done according to the
2-⌬⌬CT method, whereby Actin
(Actb) was used as internal normal-
izer for rat tissue and glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) for the human tissue. The 2-⌬⌬Ct method is defined such that
a cycle (Ct) is the cycle at which there is a significant detectable increase
in fluorescence; the Ct value is calculated by subtracting the Ct value for
the endogenous control from the Ct value for the mRNA of interest. The
⌬⌬Ct value is calculated by subtracting the Ct value of the control
sample from the Ct of the experimental sample. For graphical interpre-
tation, the ⌬⌬Ct values were transformed (x); thus downregulated
genes show ⌬⌬Ct values 0 and upregulated genes show ⌬⌬Ct values
0. The ⫺⌬⌬Ct values were compared by an unpaired t test for each
gene ( p 0.05 considered significant). Actb and GAPDH Ct values were
not different between groups. Statistical testing was done by t test on the
⌬⌬CT values. The software and ⌬⌬CT method was used to determine
statistical significance. Melting curves for all primers used in this study
exhibited single fluorescence change peaks at the appropriate melting
temperatures. This indicates the absence of primer-dimer formation.
Table 2. Primer sequences used of QRT-PCR
Species Name RefSeq ID Forward primer Reverse primer
Rat Actb NM_031144.2 AGCCATGTACGTAGCCATCCA TCTCCGGAGTCCATCACAATG
Rat Crym NM_053955 CATCTGGCAAGTGAGCAGAA GGGACTAGGCCTCCTTTGAT
Rat Egr1 NM_012551.2 CAGGAGTGATGAACGCAAGA GGGATGGGTAGGAAGAGAGG
Rat Egr2 NM_053633 TCCGAGTTCTGAACCTTTGG GGACACTTGCAACACCACTG
Rat Egr4 NM_019137.1 CACAGAGCAGGCGATACCTT ACATCCCCAGCTTGACTCTG
Rat Grm2 NM_001105711.1 GTGAGGTGGTGGACTCAACA CGTGGATGAGGGTCTATGCT
Rat Gria3 NM_032990.2 ACTGAAAACGTGGCTGCTTC GAAAGGTCATTGCACCATCA
Rat Nr4a1 NM_024388.1 CCTCATTCCAGAAGATGGACA TGAGCTGGGAGGGATAAGAG
Rat Nr4a3 NM_017352 TACGGAGTCCGCACCTGCGA CGACGTCTCTTGTCTACCGGGC
Rat Slc1a3 NM_019225.1 TGGGCCTGCCCACGGATGA CCCGGCCCCGAGGGAG
Human Gapdh NM_002046.4 CATGAGAAGTATGACAACAGCCT AGTCCTTCCACGATACCAAAGT
Human Grm2 NM_001130063.1 CGCCGCCTCTACAAGGACT GGCCAATACCATCACCAAAG
2796 J. Neurosci., February 13, 2013 33(7):2794 –2806 Meinhardt et al. mGluR
2
and Drug Seeking
In situ hybridization. Riboprobes and in situ hybridizations were per-
formed as described previously (Hansson et al., 2008). In a parallel batch
of animals to the microarray, postdependent (alcohol exposed, n 8)
and control (air exposed, n 8) animals were killed by decapitation
during the first4hofthelight phase, and brains were frozen in 40°C
isopentane and kept at 80°C. Coronal brain sections (10
m) were
cryosectioned at forebrain bregma levels 3.0 mm and 2.0 mm. The
rat-specific riboprobes for all genes were generated based on the gene
reference sequence in the PubMed database (http://www.ncbi.nlm.nih.
gov/Entrez): Egr-1, position 1384 to 1851 bp on rat cDNA (gene refer-
ence number, NM_012551.1); mGluR
2
, position 1327 to 1620 bp on rat
cDNA (gene reference number, XM_343470.1); mGluR
3
, position 314 to
662 bp on rat cDNA (gene reference number, XM_342626.1); NMDA
receptor 2a, position 434 to 876 bp on rat cDNA (gene reference number,
RATNMDA2A); NMDA receptor 2b, position 205 to 591 bp on rat
cDNA (gene reference number, NM_012574.1).
Phosphor imager-generated (Fujifilm Bio-Imaging Analyzer Systems)
digital images were analyzed using MCID Image Analysis Software (Im-
aging Research). Regions of interest were defined by anatomical land-
marks as described in the atlas of Paxinos and Watson (1998) and
illustrated in Figure 2. Based on the known radioactivity in the 14C
standards, image values were converted to nanocuries per gram.
Microdialysis and assay of microdialysate glutamate levels. Three weeks
after ethanol exposure, rats weighed 450–550 g for surgery and were
housed in groups of four before and individually after surgery. Rats were
anesthetized (isofluran, 1.5–2%) and placed in a stereotaxic frame (Kopf
Instruments). CMA11 guide cannula (20 gauge, 14 mm; CMA Microdi-
alysis) were unilaterally implanted 2.0 mm above the nucleus accumbens
shell (1.6 mm AP, 0.8 mm ML, and 5.6 mm DV). Coordinates were
based on bregma, midline, and dura, respectively (Paxinos and Watson,
1998). Cannulas were anchored with three stainless-steel screws and den-
tal acrylic. Animals were allowed to recover from surgery for 1 week.
Microdialysis experiments were conducted in conscious, freely moving
rats, 3 weeks after last ethanol vapor exposure. Dialysis probes (CMA11 2
mm; CMA Microdialysis) with 2 mm active membrane were introduced into
the guide cannula 12 h before the beginning of the dialysis experiments to
minimize damage-induced release of neurotransmitters and metabolites.
Each animal participated in one only microdialysis experiment. Samples
were collected every 15 min at a flow rate of 1.5
l/min. After 3 baseline
samples, rats were injected with a saline solution as a control. Thirty minutes
later rats were injected intraperitoneally with 3 mg/kg mGluR
2/3
agonist
LY379268 ((1R,4R,5S,6R)-4-amino-2-oxabicyclo[3.1.0]hexane-4,6-
dicarboxylic acid), and sampling continued for the remaining time of
the experiment.
Eight microliters of ortho-pthaldialdehyde/N-isobutyryl-L-cysteine
solution (from Calbiochem and Fluka, respectively) were added to 20
l
microdialysate or standard volume. After three times mixing and a reac-
tion time of 3 min, 14
l were injected (CTC PAL autosampler; Axel
Semrau) onto a HPLC column (Waters Xbridge C18 3.5
m 10/2.1 mm
guard cartridge and Waters Xbridge C18 3.5
m 100/2.1 mm). The mo-
bile phase consisted of 50 m
M Na
2
HPO
4
,1mM Na-EDTA, 20% metha
-
nol, pH 6.5, with phosphoric acid. Flow rate was set to 0.3 ml/min (Rheos
flux pump; Axel Semrau). Between every single injection, the system was
flushed with 20
l acetonitrile. Glutamate was measured via a fluores-
cence detector (L-7480; Merck). The system was calibrated by standard
solutions of glutamate containing 10 pmol/10
l per injection. Gluta-
mate was identified by its retention time and peak height with an external
standard method using chromatography software (Chrom Perfect; Jus-
tice Laboratory Software).
Immunohistochemistry. Rats were killed by transcardial perfusion with
0.9% saline (w/v) followed by 4% PFA (w/v) in 1 PBS. Brains were
postfixed in 4% buffered PFA at 4°C for 12 h, dehydrated in 1 PBS-
sucrose (10%) solution for 3–7 d, and flash frozen at 80°C. Sections (14
m) were cut with a cryostat, cycled with an ImmunoPen, washed one
time for 5 min (200
l of 0.01 M PBS, pH 7.4 on the sections), and air
dried. Sections were incubated with primary antibody in diluted 0.01
M
PBS, pH 7.4, plus 0.3% Triton X-100 at 4°C overnight, followed by ap-
propriate secondary antibodies (diluted with 0.01
M PBS, pH 7.4, plus
0.03% Triton X-100) for1hatroom temperature. All antibodies were
tested for optimal dilution, the absence of cross-reactivity, and nonspe-
cific staining. To detect the enhanced GFP, we used rabbit eGFP, diluted
1:500 (Invitrogen), as primary antibody and donkey-anti-rabbit Alexa
488, diluted 1:600 (Invitrogen), as secondary antibody. For visualization
of the mGluR
2
we used a mouse-mGluR
2
, diluted 1:500 (Santa Cruz
Biotechnology), as primary antibody and the donkey-anti-mouse 594,
diluted 1:800 (Invitrogen), as secondary antibody.
Operant alcohol self-administration apparatus. All alcohol-seeking ex-
periments were performed in operant chambers (MED Associates) en-
closed in ventilated sound-attenuating cubicles. The chambers were
equipped with a response lever on each side panel of the chamber. Re-
sponses at the appropriate lever activated a syringe pump that delivered a
30
l drop of fluid into a liquid receptacle next to it. A light stimulus
(house light) was mounted above the right response lever of the self-
administration chamber. An IBM-compatible computer controlled the
delivery of fluids, presentation of stimuli, and data recording.
The reinstatement protocol used in the present report is the one that was
used by Ciccocioppo et al. (2002) with a slight modification, i.e., a syringe
pump delivered a 30
l drop of fluid into a liquid receptacle as opposed to
100
l drop of fluid in the Ciccocioppo protocol. This modification mark-
edly increased responding for alcohol (approximately fivefold), which al-
lowed us to better monitor animals’ motivation to receive alcohol.
Alcohol self-administration training. All animal training and testing
sessions were performed during the dark phase of their light cycle. Ani-
mals were trained to self-administer 10% (v/v) ethanol in daily 30 min
sessions using a fixed-ratio 1 (FR1) schedule using Samson’s sucrose-
fading procedure (Tolliver et al., 1988). During the first3doftraining,
animals were kept fluid deprived for 20 h per day. Responses at the left
lever were reinforced by the delivery of 0.2% (w/v) saccharin solution.
For the next 3 d, animals underwent the same procedure without fluid
deprivation. Following acquisition of saccharin-reinforced responding,
rats were trained to self-administer ethanol. During the next three ses-
sions, responses at the left lever resulted in the delivery of 0.03 ml of 5%
(v/v) ethanol plus 0.2% saccharin solution. Responses at the left lever
were recorded but had no programmed consequences. Thereafter, the
concentration of ethanol was increased first to 8% and then to 10% v/v,
and the concentration of saccharin was decreased until saccharin was
eliminated completely from the drinking solution.
Conditioning phase. The purpose of the conditioning phase was to
train the animals to associate the availability of ethanol with the presence
of specific discriminative stimuli. This phase started after the completion
of the saccharin-fading procedure. Discriminative stimuli predicting
ethanol (10%) availability were presented during each subsequent daily
30 min session. An orange flavor extract served as the cue stimulus for
ethanol. This olfactory stimulus was generated by depositing six drops of
an orange extract into the bedding of the operant chamber before each
session. In addition, each lever press resulting in ethanol delivery was
accompanied bya5sblinking conditioned light stimulus (CS). The 5 s
period served as a “time-out,” during which responses were recorded but
not reinforced. At the end of each session, the bedding of the chamber
was changed, and trays were thoroughly cleaned. The animals received a
total of 10 ethanol conditioning sessions. Throughout the conditioning
phase, responses at the right lever were recorded but not reinforced (in-
active lever). After the final conditioning phase, rats were sorted into two
balanced experimental groups of which one was exposed to alcohol vapor
(resulting in the postdependent group) and the other received normal air
(control group).
Conditioning and extinction phase in postdependent rats. Following a 2
week abstinence phase, all animals were reconditioned to self-administer
10% ethanol in 10 daily conditioning sessions. After completing the re-
conditioning phase, rats were subjected to daily 30 min extinction ses-
sions for 12 consecutive days, which in total were sufficient to reach the
extinction criterion of 10 lever responses per session. Extinction ses-
sions began by extending the levers without presenting olfactory discrim-
inative stimuli. Responses at the previously active lever activated the
syringe pump, without resulting in the delivery of ethanol or the presen-
tation of response-contingent cues (stimulus light).
Reinstatement testing. For reinstatement, animals were divided into
two groups per condition (control and postdependent) on the basis of their
Meinhardt et al. mGluR
2
and Drug Seeking J. Neurosci., February 13, 2013 33(7):2794–2806 2797
performance during the last four retraining sessions. After the last extinction
trial, animals received bilateral stereotaxic injections in the infralimbic cortex
(for details, see above, Stereotaxic injections). Reinstatement began 7 d after
the final extinction session. In these tests, rats were exposed to the same
conditions as during the conditioning phase, except that the ethanol was not
available. Sessions were initiated by the extension of both ethanol-associated
and inactive levers and the presentation of the discriminative stimulus pre-
dicting ethanol. Responses at the ethanol-associated lever were followed by
the activation of the syringe pump without any ethanol delivery and the
presentation of the CS (light).
Generation of Lenti-mGluR
2
vector. The mGluR
2
cDNA was amplified
using the IMAGp998E1215366Q clone as a template (Imagenes). After
purification, the cDNA was cloned into the pCDH-MCS-T2A-copGFP
vector (BioCat). The vector containing the mGluR2 insert was purified,
sequenced, tested in cell culture, and finally used for lentiviral produc-
tion. Active lentiviral particles were produced by System Biosciences.
Statistics. Microarray, PCR and in situ hybridization data were com-
pared by t test. Data from the microdialysis experiment were analyzed
using two-way repeated-measures ANOVA. Behavioral experiments
were analyzed by two-way ANOVA or t test where appropriate. Post hoc
testing was done with Fisher LSD test. The withdrawal scores were com-
pared using a Mann–Whitney test. Statistical significance was set at a p
0.05. Statistica 10.0 software for Windows was used (StatSoft).
Results
Gene expression analysis in ethanol responsive brain regions
point to the infralimbic region
We started with an unbiased transcriptome analysis to determine
potential targets of alcohol-induced neuroadaptations, classified
the affected cell types in the region, and identified candidate
genes for further experiments. Microarray-based transcriptome
analysis revealed that chronic intermittent alcohol exposure had
long-term effects on gene expression in three brain regions im-
plicated in drug dependence, namely, mPFC, nucleus accum-
bens, and amygdala (Koob and Volkow, 2010)(Fig. 1A). We used
GSEA (Subramanian et al., 2005) to test the hypothesis of func-
tionally related postdependent neuroadaptations in GABAergic
or glutamatergic neurons. For this purpose, we used two marker
gene sets described previously as extremely divergent between
GABAergic and glutamatergic neurons (Sugino et al., 2006). Re-
sults indicate a highly significant enrichment of downregulated
glutamatergic marker genes (p 0.01) in the mPFC of postde-
pendent rats (Fig. 1 B,C; Table 1). We selected a number of can-
didate genes for corroborative analysis by quantitative PCR
(Table 3). Among the confirmed candidates was Grm2, the gene
coding for mGluR
2
, which was robustly downregulated in the
mPFC of postdependent rats compared to controls. We next used
in situ hybridization to address the question whether or not a
specific subregion of the mPFC is preferentially affected in post-
dependent rats. Several genes derived from the transcriptome
study, i.e., members of the activity-dependent Egr-family (Egr1
and Egr2) and glutamate receptors (Nr-2a, Nr-2b, Grm2) showed
significant downregulation only in the infralimbic cortex, with
the most profound effect again the gene for mGluR
2
(Fig. 2
A,B).
In contrast, the expression of the pharmacologically highly sim-
ilar mGluR
3
was not altered in this region (mean nanocuries per
grams SEM; infralimbic cortex, control, 40.80 2.13; postde-
pendent, 41.59 2.19; not significant; prelimbic cortex, control,
51.49 1.75; postdependent, 53.06 1.09; not significant). To-
gether, these findings suggest that the infralimbic cortex is a hot spot
within the mPFC for alcohol dependence-induced alterations.
Infralimbic–accumbal glutamatergic projection neurons are
highly sensitive to alcohol dependence-induced
neuroadaptations
Together, these experiments lead to the conclusion that glutama-
tergic neurons in the infralimbic cortex are highly sensitive to
alcohol-induced neuroplasticity. To identify the specific neuro-
Figure 1. Expression analysis from three brain regions of postdependent (PD) rats and controls showing a distinct downregulation of glutamatergic marker genes in mPFC. Samples from mPFC,
nucleus accumbens (NAc), and Amy of postdependent rats and controls were processed on Affymetrix GeneChip arrays. A, Venn diagram showing the number of significant differently expressed
genes in each region. B, GSEA shows significant downregulation of an a priori defined set of glutamatergic marker genes in the mPFC, but not in the other regions. Each line corresponds to a gene
of the respective set and is positioned according to its ranked effect size among all analyzed genes on the microarray (for gene sets, see Table 1). NAc-GABA, Normalized enrichments score, 1.4159;
nominal p value, 0.0819; false discovery rate (FDR) q value, 0.1082; NAc-GLU, normalized enrichments score, 1.2078; nominal p value, 0.2218; FDR q value, 0.2596; Amy-GABA, normalized
enrichmentsscore, 0.6877;nominalp value,0.8511; FDRq value,0.8632;Amy-GLU, normalizedenrichments score,0.9564; nominalpvalue, 0.4991;FDR qvalue, 0.5629;mPFC-GABA,normalized
enrichments score, 1.4622; nominal p value, 0.0489; FDR q value, 0.1259; mPFC-GLU, normalized enrichments score, 1.6227; nominal p value, 0.0; FDR q value, 0.0021. **p 0.01 (corrected).
C, Heat map showing theexpressionoftheglutamatergic marker genes postdependent and control rats. Thirteen of 45 genes of the set are significantly downregulatedinpostdependentrats( p
0.05). Red shows higher and green shows lower expression compared to the mean of all samples.
2798 J. Neurosci., February 13, 2013 33(7):2794 –2806 Meinhardt et al. mGluR
2
and Drug Seeking
circuitry involved, we used a strategy that allows labeling pyrami-
dal neurons within the infralimbic cortex via their projections to
the nucleus accumbens shell subregion. We performed retro-
grade tracing by infusing rhodamine-labeled fluorescent latex
microspheres into the nucleus accumbens shell (Katz and Iar-
ovici, 1990; Reynolds and Zahm, 2005), isolated the labeled cell
population (70 –100 cells) within the infralimbic cortex
through LCM, and extracted the RNA for expression analysis
(Fig. 3 A,B).
We tested eight candidate genes from the mPFC microarray
experiment (Table 3). Among these, Grm2 as well as the Egr-
family genes Egr2 and Egr4 were identified as significantly down-
regulated in the infralimbic cortex neurons of the postdependent
group. Expression differences detected within the purified
neuronal population were markedly en-
hanced compared to those in the analy-
sis performed on tissue homogenates.
Expression of Grm2 and Egr2 was 10-
fold and 500-fold, respectively, al-
tered in enriched infralimbic projection
neuron populations from postdepen-
dent rats (Fig. 3C), although these dif-
ferences were less than twofold when
applying the same PCR analysis to tissue
homogenates. The experiment reveals
the extent to which major dysregulation
can be disguised in heterogeneous samples
and emphasizes the importance of studying
well-characterized cell populations in
the brain. In conclusion, we demonstrate
that infralimbic–accumbal glutamatergic
projection neurons are highly sensitive
to alcohol dependence-induced neuro-
adaptations, and identify mGluR
2
re
-
ceptor downregulation in this pathway
as a candidate mechanism for observed
behavioral deficits.
Functional consequences of
mGluR
2
reduction
mGluR
2
function in the corticoaccum
-
bal pathway was assessed by in vivo mi-
crodialysis. We measured extracellular
glutamate levels in the nucleus accum-
bens shell of freely moving rats (Fig.
4A). Given its role as a presynaptic
autoreceptor, stimulation of mGluR
2
is
expected to downregulate glutamate re-
lease, resulting in reduced glutamate
overflow in the dialysate. Accordingly, systemic administra-
tion of the mGluR
2/3
agonist LY379268 (3 mg/kg, i.p.) resulted
in a robust and sustained decrease of extracellular glutamate
levels in the nucleus accumbens shell of control rats. In con-
trast, no such effect was seen in postdependent rats (Fig. 4B).
Basal glutamate levels were not different between postdepen-
dent and control rats (Fig. 4B). These data are consistent with
the interpretation that the downregulation of Grm2 expres-
sion could lead to a lack of mGluR
2
autoreceptor function at
the terminals of the infralimbic projection neurons. Such a
deficit would impact on activity-dependent glutamatergic
neurotransmission in the corticostriatal pathway and presum-
ably also on behavioral output.
Table 3. QRT-PCR validation of selected candidate genes from micropunched tissue and IL projection neurons cells
Gene Gene title
Microarray bulk qRT-PCR bulk qRT-PCR IL neurons
p FC p FC p FC
Egr1 Early growth response 1 0.0231 0.2524 0.0137 0.5738 0.196 1.294
Egr2 Early growth response 2 0.0084 0.7276 0.0123 0.8669 0.006 9.844
Egr4 Early growth response 4 0.0006 0.5907 0.0077 0.7916 0.041 1.203
Gria3 Ionotrophic glutamate receptor 3 0.0356 0.3008 0.0368 0.3686 0.683 0.316
Grm2 Metabotropic glutamate receptor 2 0.0044 0.2747 0.0102 0.5101 0.004 2.402
Crym Mu-crystallin homolog 0.0065 0.2962 0.0292 0.6153 0.161 0.897
Nr4a1 Nuclear receptor subfamily 4, group A, member 1 0.0074 0.2802 0.0063 0.7108 0.001 2.402
Nr4a3 Nuclear receptor subfamily 4, group A, member 3 0.0061 0.3224 0.0005 1.2155 Nondetectable
Slc1a3 Glial high affinity glutamate transporter 0.7954 0.0163 Not assessed Nondetectable
Validation ofselected genes determined to be differentially expressed in the mPFC exposed group (n 9) versus control (n 9) by microarray analysis or in the IL of the exposed group (n 5) versus control (n 5) is shown. Bold values
are confirmed qRT-PCR data from microarray results. FC, fold change.
Figure 2. Prefrontal in situ hybridization point to the infralimbic cortex as major site of neuroadaptations. A, Dark-field microphoto-
graphs from autoradiograms of in situ hybridization of Grm2 from control and postdependent (PD) rats on coronal sections, 2.2 mm
relative tobregmalevel. Enlarged images for bothgroupson the right. Arrows indicatesignal in the infralimbic region.B, Quantificationof
in situ expression levels (nanocuries per gram, mean SEM) in postdependent (black bars) versus control rats (white bars) for selected
candidategenessignificantlyaltered.Nr-2a,Nr-2b,Egr1, andGrm2mRNAsarerobustlyalteredwithintheinfralimbiccortex,butunaffected
incingulate,prelimbic, ororbitofrontal cortex. *p 0.05; **p 0.01; ***p 0.001 comparingpostdependentversus control(Student’s
t test). Cing, Cingulate cortex; PreL, prelimbic cortex; IL, infralimbic cortex; OFC, orbitofrontal cortex.
Meinhardt et al. mGluR
2
and Drug Seeking J. Neurosci., February 13, 2013 33(7):2794–2806 2799
Figure 4. Glutamate microdialysis in postdependent (PD) versus control animals shows blunted response to mGluR
2
agonist treatment in postdependent rats. A, The active membranes of the
microdialysis probes are represented by black lines and were verified within the nucleus accumbens shell from 1.9 to 1.2 anterior to bregma. B, Nucleus accumbens shell glutamate levels after
intraperitoneal application of 3 mg/kg mGluR
2/3
agonist LY379268. Control animals show decrease of extracellular glutamate levels, whereas postdependent rats show a blunted response to the
agonisttreatment,indicating adownregulation of mGluR
2
.Inset,Basal glutamatelevels (two-way ANOVA;main effectofethanol dependencehistory, F
(1,11)
6.672, p 0.05; main effectof time,
F
(11,121)
1.521, notsignificant;significant interactionof ethanoldependence history bytime, F
(11,121)
2.331, p 0.05). *p 0.05;**p 0.01;***p 0.001 (FisherLSDpost hoctest). NAcSh,
Nucleus accumbens shell.
Figure 3. Robust downregulation of Grm2 transcripts in rat infralimbic accumbens shell projection neurons lead to blunted response to Grm2 agonist treatment in postdependent (PD) rats. A,
Locations of the 33 gauge injection cannula tips for the injections the retrograde tracer into the nucleus accumbens shell are represented by small black triangles. The cannula placements for the
nucleus accumbens shell were verified within the region from 1.6 to 2.2 mm. B, Distribution of retrograde tracer within the nucleus accumbens shell (range, 2.2 to 1.0 mm relative to
bregma). Fluorescent cells were clearly visible in sections from 1.9 to 2.5 mm relative to bregma in the infralimbic and the dorsal peduncular cortex. Insert shows a representative confocal
microscope image. Arrows indicate retrograde tracer-positive cells, colabeled with the neuronal marker NeuN. Scale bars: left, 100
m; right, 10
m. C, Downregulated genes in glutamatergic
projection neurons in the infralimbic cortex compared to the micropunched mPFC (bulk tissue) from the microarray study. The graph represents the delta delta cycle threshold SEM on a
logarithmic scale of selected mRNAs, expressing the change in cycle thresholds from treatment to controls compared back to an endogenous control. In addition, Crym, a marker gene of
glutamatergic pyramidalneurons according to the GENSATmousebrain atlas (www.gensat.org), was highlyexpressed in all samples (quantitativePCRcycle threshold of 14),whereasSlc1a3, the
gene for the glial glutamate transporter, was not detectable (cycle threshold, 39), indicating that we indeed succeeded in collecting a highly purified glutamatergic neuronal population. *p
0.05; **p 0.01. PreL, Prelimbic cortex; IL, infralimbic cortex.
2800 J. Neurosci., February 13, 2013 33(7):2794 –2806 Meinhardt et al. mGluR
2
and Drug Seeking
Restoration of mGluR
2
attenuates excessive cue-induced
alcohol seeking
We next examined the role of mGluR
2
receptors in infralimbic neu
-
rons projecting to the nucleus accumbens shell for cue-induced re-
instatement of alcohol-seeking behavior, an established animal
model of relapse (Epstein et al., 2006; Sanchis-Segura and Spana-
gel, 2006). First, rats were trained to self-administer alcohol be-
fore alcohol vapor exposure (Fig. 5AE). After the last exposure
cycle, postdependent rats showed clear signs of withdrawal (ap-
proximately five of a maximal eight points from a global with-
drawal score) (Macey et al., 1996), whereas this rating for control
rats was close to zero (p 0.004, Mann–Whitney; Fig. 5B). After
2 weeks of recovery, all rats were retrained to self-administer
ethanol until stable response rates were achieved once more.
Control rats regained self-administration rates that were similar
to their preexposure rates (90% of preexposure). In contrast,
postdependent rats rapidly escalated their self-administration
rates by 155% (Fig. 5A,D). Motivation to obtain alcohol was
further assessed by a progressive ratio reinforcement schedule
(Hodos, 1961). Postdependent rats showed a significantly higher
break point for alcohol self-administration than controls (t
(29)
3.09, p 0.01; Fig. 5C), a significantly steeper slope of the corre-
lation between response rates during ethanol self-administration
under an FR1 schedule, and progressive ratio breakpoints (cor-
relation equations test, p 0.05; Fig. 5F). This shows that esca-
lated alcohol self-administration in postdependent rats is
associated with an increased motivation to obtain the drug rein-
forcer, a key characteristic of addictive behavior (Deroche-
Gamonet et al., 2004). These data are consistent with a recent
report that also showed increased motivation to obtain ethanol
following a history of experimenter imposed alcohol dependence
(Kufahl et al., 2011; Vendruscolo et al., 2012).
Alcohol associated cues are potent triggers of relapse in alco-
holic patients. This pathological behavior is typically modeled in
the reinstatement procedure (Epstein et al., 2006; Sanchis-Segura
and Spanagel, 2006). Following stable lever responding accom-
panied by discrete cues predicting alcohol availability (CS),
postdependent and control rats underwent extinction (Fig. 5D)
Figure 5. Diagram illustrating the experimental procedure of the postdependent (PD) cue-induced reinstatement model. A, Animals underwent alcohol self-administration under a fixed ratio
FR1 schedule until they reached stable lever presses accompanied by discrete cues predicting alcohol availability (CS). Control and postdependent rats do not differ in this phase. After initial
training, half of the animals (resulting in the postdependent group) were alcohol vapor exposed for 7 weeks. B, At the end of the 7 week exposure, withdrawal signs were scored 8 h after last
intoxication. Following 2weeksof abstinence, rats were retrained to self-administeralcohol.C, D, Postdependent rats show higher self-administration (D)andalso higher motivation (C) for alcohol
in a progressive ratio test. Two-way ANOVA showed a significant main effects of ethanol dependence history (F
(1,24)
8.91, p 0.01) and significant interactions of ethanol dependence history
by self-administration condition (F
(1,92)
6.08, p 0.05). Extinction training was not different between groups (postdependent vs control groups, t
(30)
0.243, not significant). E, Presentation
of the CS elicits in significant reinstatement in control and postdependent rats with significant higher levels in the postdependent group (control, 42.1 3.4 vs postdependent, 84.4 13.2;
t
(13)
⫽⫺2.896, p 0.01). F, Linear regression analysis of mean lever presses and performance in the progressive ratio test of postdependent and control rats. Both groups show a significant
deviation from zero (postdependent, p 0.004; control, p 0.009). Furthermore, postdependent rats show a significantly steeper slope of the correlation between response rates during ethanol
self-administration under an FR1 schedule, and progressive ratio breakpoints. Error bars indicate SEM.
Meinhardt et al. mGluR
2
and Drug Seeking J. Neurosci., February 13, 2013 33(7):2794–2806 2801
followed by a cue-induced reinstatement test. Postdependent rats
displayed significantly higher reinstatement of alcohol seeking
than control rats (p 0.01; Fig. 5E). To directly assess the role of
mGluR
2
in mPFC for cue-induced reinstatement of alcohol seek
-
ing, we generated two lentiviral vectors expressing either the
mGluR
2
receptor together with eGFP or eGFP alone (lenti-
mGluR
2
and lenti-control, respectively; Fig. 6A
). Following alco-
hol/cue training, all rats went through extinction training,
resulting in fewer than 10 responses (Fig. 6F). After completion
of extinction training, rats were bilaterally injected with the
respective lentiviral constructs into the infralimbic cortex (Fig.
6B–F), allowed to recover, and examined for cue-induced rein-
statement of alcohol seeking. Notably, immunohistochemistry
confirmed the coexpression of the lenti-mGluR
2
construct for all
studied animals exclusively in the infralimbic cortex and in their
neuronal projection target, the nucleus accumbens shell, EGFP-
positive axon terminals were clearly visible (Fig. 6 D,E). Presen-
tation of the ethanol-associated cues resulted in significant
resumption of operant responding in animals receiving the con-
trol lentiviral construct (paired t test; control, t
(7)
4.157, p
0.01; postdependent, t
(7)
4.211, p 0.01; Fig. 6F), with a
highly increased mean (SEM) number of responses in postde-
pendent (87.6 8.9) compared to control (51.9 8.1) rats.
Lenti-mGluR
2
did not significantly alter drug-seeking behavior
in controls. However, lenti-mGluR
2
showed significant reduc
-
tion in postdependent animals, such that their lever-pressing be-
havior declined for 40% to control levels. These effects were
confirmed by two-way ANOVA with significant main effects of
ethanol dependence history (F
(1,24)
9.947, p 0.01) and virus
treatment (F
(1,24)
7.932, p 0.01), but no significant interac
-
tion (F
(1,43)
2.032, p 0.163). We did not find time-dependent
spontaneous recovery of lever pressing when reexposing the an -
imals to the operant chamber after the 1 week time delay
between the last extinction trial followed by sham operation
and the reinstatement test (extinction, 8.9 1.3; spontaneous
recovery, 10.9 2.5, not significant). We also did not find
evidence for behavioral abnormalities (for example, weight
loss, agitation, and self-injury) in any experimental group.
Lenti-control and lenti-mGluR
2
rats did not differ in locomo
-
tor activity or their responding for natural rewards under the
same reinforcement schedule used for ethanol self-administration
(Fig. 7A–C), demonstrating that effects of mGluR
2
overex
-
pression on reduced ethanol-seeking behavior were not sec-
ondary to alterations in task performance.
Downregulated GRM2 in human alcoholics
To translate these animal findings to humans, we determined
GRM2 expression in postmortem brain tissue samples from
alcohol-dependent patients and controls matched for age and
postmortem interval (Sheedy et al., 2008).
A human brain region that is anatomically and functionally
related to the rodent mPFC is the anterior cingulated cortex
(Uylings et al., 2003). However, it has to be pointed out that a
one-to-one relationship between human and rodent prefronto-
cortical regions does not exist and functional elements of rodent
distinctions including of the infralimbic cortex can be found in
various areas of the enlarged human prefrontocortical volume.
Within the anterior cingulate cortex, we found a significant, 2.6-
fold decrease in GRM2 transcript levels in alcoholics compared to
controls (Fig. 8A,B).
Discussion
The data presented here provide a fundamentally new insight
into the molecular basis by which a prolonged history of alcohol
dependence causes a substantial and long-lasting reorganization
of the medial prefrontal cortex. To the best of our knowledge, the
present data from gene expression and functional studies consti-
tute strong experimental evidence of anatomical and molecular
pathway-specific plasticity in the mPFC as a sequel to alcohol
dependence and establish a key pathophysiological mechanism
for the increased propensity to relapse. In particular, we discov-
ered a locally restricted but profound molecular pathology,
namely, the infralimbic cortex-specific expression deficit of
mGluR
2
, as a critical component for excessive alcohol seeking in
postdependent rats, and that restoring this receptor function is
sufficient for regaining control over this addictive behavior.
The infralimbic cortex shows a unique pattern of alcohol
dependence-induced alterations, as evidenced by the regional-
specific downregulation of transcription factors Egr1 and Egr2
known to be involved in neuronal plasticity, as well as on the
glutamate receptor genes Grin2a, Grin2b, and Grm2. Impor-
tantly, the downregulation of Grm2 and Egr2 is much more
pronounced in purified infralimbic–accumbens shell projec-
tion neurons, 10-fold and 500-fold, respectively, high-
lighting these genes within this cell population as functionally
relevant for the pathological process. Notably, the Grm2 promoter
contains transcription factor binding sites for the Egr-family as
well as a unique Egr2 binding site (according to the DECODE
database, http://www.sabiosciences.com/chipqpcrsearch.php?
appTFBS), which provide a potential substrate for regulation of
Grm2 expression by Egr2. On the other hand, mGluR
2
may reg
-
ulate Egr2 expression, as suggested by experiments in Grm2
knock-out mice that show a lack of Egr2 activation following drug
application (Moreno et al., 2011). Whether or not the downregu-
lation of these genes is functionally related is yet unknown, but
both seem to be involved in dependence-related plasticity of glu-
tamatergic neurons, mGluR
2
directly at the level of the synapse,
and Egr2 via stimulus-transcription coupling.
Importantly, we found a lack of mGluR
2
receptor function in
the terminal fields of the infralimbic projections, which became
evident as an inability of these neurons to modulate nucleus ac-
cumbens shell glutamate levels in response to receptor stimula-
tion with an mGluR
2/3
agonist. This effect is consistent with the
pronounced reduction in mGluR
2
expression—with no change
in mGluR
3
expression—in the infralimbic cortex of postdepen
-
dent rats. However, a recent study found no differences in
mGluR
2/3
functional activity within the mPFC in postdependent
rats after 4 weeks of repeated cycles of vapor exposure (Kufahl et
al., 2011). How can this discrepancy been explained? We demon-
strated previously that in the alcohol vapor exposure procedure, a
temporal threshold for induction of escalation of alcohol con-
sumption and concomitant neuroplastic changes occur (Rimon-
dini et al., 2003). Hence, postdependent rats that were exposed to
alcohol vapor for 7 weeks displayed a marked increase in alcohol
self-administration, whereas postdependent rats exposed for
shorter periods (2 and 4 weeks) did not show such an escalation
(Rimondini et al., 2003). Here we report that postdependent rats
exposed to alcohol vapor for 7 weeks show an augmented rein-
statement response of alcohol-seeking behavior and that this
dependence-like phenotype is directly linked to an mGluR
2
def
-
icit in the infralimbic cortex. In the study by Kufahl et al. (2011),
rats were exposed to alcohol vapor for 4 weeks and did not differ
either in their reinstatement response nor in mGluR
2/3
functional
2802 J. Neurosci., February 13, 2013 33(7):2794 –2806 Meinhardt et al. mGluR
2
and Drug Seeking
Figure 6. Conditioned reinstatement of drug-seeking behavior attenuates only with lenti-mGluR
2
bilateral viral injections. A, Schematic representation of the lentiviral expression plasmids used for the
productionof Lenti-mGluR
2
andLenti-EGFP. cPPT, centralpolypurine tract;copGFP,copepod Pontellinaplumata GFP; WPRE,Woodchuck HepatitisVirus Posttranscriptional RegulatoryElement. B,Illustration of
bilateral Lenti-mGluR
2
and Lenti-EGFP injection sites. Green circles represent the spread area of the virus. C,Locations of the 33 gauge injection cannula tips for the lentiviral injection into the infralimbic cortex
are representedbysmall black triangles, respectively. Thecannulaplacements were verified within theinfralimbiccortex from 3.2to 2.2 anteriortobregma. D,Schematicrepresentation of the infralimbic
projectionsite.Theinsetshowsthenucleusaccumbensshell regionwithits EGFPpositiveaxons originatingfromthe injectionsiteat 7dafter lentiviralinfection.E,Left,SiteofLenti-mGluR
2
deliveryadaptedfrom
Paxinos and Watson’s (1998) rat brain atlas. Right, Representative microscope image of a virally infected cell in the infralimbic cortex showing mGluR
2
, EGFP, merged and secondary antibody negative control.
EGFP andmGluR
2
expression wasassessedusing immunohistochemistry. PrL, Prelimbic cortex;IL,infralimbic cortex; DP, dorsal peduncularcortex.F, Presentationofthe CS elicitsinsignificant reinstatement
inboth controlandPD ratswith lenti-EGFP.Lenti-mGluR
2
significantlyattenuates drug-seekingbehavioronly inpostdependent (PD)rats down tothe levelof thecontrolgroup. *p0.05;**p0.01;***p
0.001. For detailed statistics, see Results. Error bars indicate SEM.
Meinhardt et al. mGluR
2
and Drug Seeking J. Neurosci., February 13, 2013 33(7):2794–2806 2803
activity from controls, which supports the
definition of a temporal threshold for
induction of escalation in alcohol con-
sumption and alcohol seeking and the
herewith associated neuroplastic changes.
Together, a careful, cell type-specific in-
vestigation of the group II mGluRs shows
a highly restricted mGluR
2
downregula
-
tion in sparsely distributed glutamatergic
neurons located in the ventral part of the
mPFC, the infralimbic region.
With our viral rescue experiment, we
could further show that mGluR
2
receptors
in infralimbic neurons are necessary for
the control exerted by this region on alco-
hol seeking. Consequently, infralimbic
neurons in postdependent animals are ca-
pable of eliciting a sufficient glutamate re-
sponse to drug cues, but in the absence of
feedback provided by mGluR
2
receptors,
the information transmitted by this signal
cannot be properly processed, thereby
disrupting adequate behavioral control.
On the other hand, adding extra mGluR
2
autoreceptors to normal infralimbic neu-
rons does not seem to disrupt glutamatergic
signaling and behavioral output in a task
controlled by this brain structure. This
concept is further supported by electro-
physiological evidence from long-term
cocaine-exposed rats., Using in vivo stimu-
lation from the prefrontal cortex of long-
term cocaine-exposed rats revealed an
mGluR
2/3
deficit in the nucleus accumbens
(Moussawi et al., 2011). In another model of
cocaine-induced addiction-like behavior,
there was a lack in mGluR
2/3
-mediated
long-term depression in mPFC neurons
that was associated with a strong downregulation of mGluR
2/3
re
-
ceptors (Kasanetz et al., 2012). Thus, both alcohol and cocaine de-
pendence are associated with medioprefrontal mGluR
2
deficits
that may lead to an inflexible state of the brain. Although we did not
provide electrophysiological evidence, our study substantially ex-
tends the findings from the cocaine models by demonstrating that an
addiction-like behavior, here excessive alcohol seeking, can be res-
cued through restoring mGluR
2
levels in the mPFC.
Impairments in executive control over behavior are known
risk factors for drug addiction (Everitt and Robbins, 2005).
Alcohol-dependent patients have severe deficits in many aspects
of prefrontocortical functions encompassing emotion, cogni-
tion, and behavior, whereby medial subdivisions of the prefrontal
cortex are of particular interest here because of their role in mo-
tivation, control of emotions, salience attribution, and decision
making (Goldstein and Volkow, 2011). These functions have
been established not only in humans but also in rodents (Uylings
et al., 2003). Typical behaviors seen in patients with damage to
the ventromedial PFC are social inappropriateness, impulsivity,
and poor judgment (Bechara et al., 1994). Enduring mediopre-
frontal gray matter losses were found in alcoholic patients and are
associated with severe functional deficits in the ability to control
reward-predicting stimuli (Duka et al., 2011). Interestingly, these
deficits increase with the number of detoxifications experienced
by the patients, which resonates with previous observations in
experimental animals that the number of withdrawals, rather
than the mere level of intoxication, is important for the occur-
rence of long-lasting behavioral and neural symptoms, i.e., a
postdependent state (Roberts et al., 2000; Stephens et al., 2005;
Sommer et al., 2008; Heilig et al., 2010). A previous fMRI study in
alcoholics found increased mPFC activation in response to alco-
hol cues, which was positively correlated with relapse risk
(Gru¨sser et al., 2004). In experimental animals, cue presentation
of conditioned stimuli predicting a drug reward results in a sig-
nificant increase in glutamate levels in the nucleus accumbens
(Hotsenpiller et al., 2001). Most likely, this input derives from
prefrontal areas, given that the mPFC–accumbal glutamatergic
pathway is necessary for reinstating drug-seeking behavior. Like-
wise, our observed deficit in mGluR
2
autoreceptor function
within the infralimbic cortex of postdependent rats may lead to
increased accumbal glutamate levels after cue presentation, with
subsequent excessive drug-seeking behavior.
Importantly, we also find a reduction in GRM2 expression in
the anterior cingulate cortex from alcohol-dependent patients,
which suggests that the deficits found in our animal model may
be a feature in alcoholism in at least some patients. It remains to
be clarified whether or not the reduced GRM2 expression found
in the present sample is functionally linked to the progressive
reduction in prefrontal neuronal density, which was seen in a
previous study on postmortem brain tissue from alcoholics
Figure 7. Behavioral observations forthe delayed reinstatement and betweenLenti-mGluR
2
- andLenti-EGFP-injected animals
in responding for natural rewards and in locomotor activity. A, We did not find time-dependent spontaneous recovery of lever
pressing when reexposing the animals to the operant chamber after the 1 week time delay between last extinction trial followed
bysham operationand reinstatementtest. Nodifferences wereobserved betweenLenti-mGluR
2
-and Lenti-EGFP-injectedanimals
in responding for natural rewards and in locomotor activity. B, Both groups were exposed to five 30 min operant sessions to
self-administered sweetened condensed milk under an FR1 schedule. Lenti-mGluR
2
and Lenti-EGFP lever-pressing behavior did
not differ. C, Lenti-mGluR
2
and Lenti-EGFP rats show equal locomotion when exposed to a 45 min open-field session. Inset, Total
track length completed in the 45 min session. Error bars indicate SEM.
Figure 8. Downregulation of Grm2 transcript in the human anterior cingulated cortex. A, Schematic representation of the
anterior cingulate cortex of the human brain on a sagittal section (adapted from Standring, 2008). B, RT-qPCR showing Grm2
downregulation in the human anterior cingulate cortex of patients classified with alcohol use disorder compared to respective
controls. *p 0.05 (Student’s t test). Error bars indicate SEM. AUD, alcohol use disorder.
2804 J. Neurosci., February 13, 2013 33(7):2794 –2806 Meinhardt et al. mGluR
2
and Drug Seeking
(Miguel-Hidalgo et al., 2006). However, the reduction in GRM2
expression and number of neurons may together lead to an ab-
solute deficit of mGluR
2
receptors in the mPFC of alcoholics.
This may have important implications for the development of
treatments for relapse prevention because absolute deficits can-
not be efficiently targeted by agonist treatment. Indeed, this may
be one of the reasons for the relatively narrow therapeutic win-
dow for reducing alcohol seeking in experimental animals by
mGluR
2/3
agonists (Kufahl et al., 2011). Thus, instead of focusing
on the development of more specific mGluR
2
ligands, novel ther
-
apeutic strategies should attempt to overcome the blockade of
mGluR
2
expression. Focal virus-mediated gene therapy, al
-
though potentially feasible (Kaplitt et al., 2007), is unlikely to be
applied for the treatment of addictions. Alternatively, pharmaco-
logical approaches targeting key proteins involved in glutamate
homeostasis, such as glutamate transporters or mGluRs, could
potentially be effective treatments in relapse prevention. In con-
clusion, the present study illustrates the feasibility of a structured
discovery strategy, that starting with an unbiased screening over
progressively narrowing experimental approaches allows identi-
fying a specific pathological mechanism and can point toward
new directions for therapeutic development.
References
American Psychiatric Association (1994) Diagnostic and statistical manual
of mental health disorders, 4th ed. Washington, DC: American Psychiat-
ric Association.
Arlinde C, Sommer W, Bjo¨rk K, Reimers M, Hyytia¨ P, Kiianmaa K, Heilig M
(2004) A cluster of differentially expressed signal transduction genes
identified by microarray analysis in a rat genetic model of alcoholism.
Pharmacogenomics J 4:208–218. CrossRef Medline
Bechara A, Damasio AR, Damasio H, Anderson SW (1994) Insensitivity to
future consequences following damage to human prefrontal cortex. Cog-
nition 50:7–15. CrossRef Medline
Becker HC, Lopez MF (2004) Increased ethanol drinking after repeated
chronic ethanol exposure and withdrawal experience in C57BL/6 mice.
Alcohol Clin Exp Res 28:1829–1838. CrossRef Medline
Bjo¨rk K, Hansson AC, Sommer WH (2010) Genetic variation and brain
gene expression in rodent models of alcoholism implications for medica-
tion development. Int Rev Neurobiol 91:129 –171. CrossRef Medline
Capriles N, Rodaros D, Sorge RE, Stewart J (2003) A role for the prefrontal
cortex in stress- and cocaine-induced reinstatement of cocaine seeking in
rats. Psychopharmacology (Berl) 168:66 –74. CrossRef
Ciccocioppo R, Martin-Fardon R, Weiss F (2002) Effect of selective blockade of
mu(1) or delta opioid receptors on reinstatement of alcohol-seeking behavior
by drug-associated stimuli in rats. Neuropsychopharmacology 27:391–399.
CrossRef Medline
Cornish JL, Kalivas PW (2000) Glutamate transmission in the nucleus ac-
cumbens mediates relapse in cocaine addiction. J Neurosci 20:RC89.
Medline
Deroche-Gamonet V, Belin D, Piazza PV (2004) Evidence for addiction-like
behavior in the rat. Science 305:1014 –1017. CrossRef Medline
Duka T, Trick L, Nikolaou K, Gray MA, Kempton MJ, Williams H, Williams
SC, Critchley HD, Stephens DN (2011) Unique brain areas associated
with abstinence control are damaged in multiply detoxified alcoholics.
Biol Psychiatry 70:545–552. CrossRef Medline
Epstein DH, Preston KL, Stewart J, Shaham Y (2006) Toward a model of
drug relapse: an assessment of the validity of the reinstatement procedure.
Psychopharmacology (Berl) 189:1–16. CrossRef
Everitt BJ, Robbins TW (2005) Neural systems of reinforcement for drug
addiction: from actions to habits to compulsion. Nat Neurosci 8:1481–
1489. CrossRef Medline
Ferraguti F, Shigemoto R (2006) Metabotropic glutamate receptors. Cell
Tissue Res 326:483–504. CrossRef Medline
Funk CK, O’Dell LE, Crawford EF, Koob GF (2006) Corticotropin-releasing
factor within the central nucleus of the amygdala mediates enhanced
ethanol self-administration in withdrawn, ethanol-dependent rats. J Neu-
rosci 26:11324 –11332. CrossRef Medline
Goldstein RZ, Volkow ND (2011) Dysfunction of the prefrontal cortex in
addiction: neuroimaging findings and clinical implications. Nat Rev Neu-
rosci 12:652– 669. CrossRef Medline
Gray H (1918) Anatomy: descriptive and surgical.
Gru¨sser SM, Wrase J, Klein S, Hermann D, Smolka MN, Ruf M, Weber-Fahr
W, Flor H, Mann K, Braus DF, others (2004) Cue-induced activation of
the striatum and medial prefrontal cortex is associated with subsequent
relapse in abstinent alcoholics. Psychopharmacology (Berl) 175:296 –302.
CrossRef
Hansson AC, Rimondini R, Neznanova O, Sommer WH, Heilig M (2008)
Neuroplasticity in brain reward circuitry following a history of ethanol
dependence. Eur J Neurosci 27:1912–1922. CrossRef Medline
Heilig M, Koob GF (2007) A key role for corticotropin-releasing factor in
alcohol dependence. Trends Neurosci 30:399 406. CrossRef Medline
Heilig M, Egli M, Crabbe JC, Becker HC (2010) Acute withdrawal, pro-
tracted abstinence and negative affect in alcoholism: are they linked? Ad-
dict Biol 15:169–184. CrossRef Medline
Hermann D, Weber-Fahr W, Sartorius A, Hoerst M, Frischknecht U, Tunc-
Skarka N, Perreau-Lenz S, Hansson AC, Krumm B, Kiefer F, Spanagel R,
Mann K, Ende G, Sommer WH (2012a) Translational magnetic reso-
nance spectroscopy reveals excessive central glutamate levels during alco-
hol withdrawal in humans and rats. Biol Psychiatry 71:1015–1021.
Medline
Hermann D, Frischknecht U, Heinrich M, Hoerst M, Vollmert C, Vollsta¨dt-
Klein S, Tunc-Skarka N, Kiefer F, Mann K, Ende G (2012b) MR spec-
troscopy in opiate maintenance therapy: association of glutamate with the
number of previous withdrawals in the anterior cingulate cortex. Addict
Biol 17:659 667. CrossRef Medline
Hodos W (1961) Progressive ratio as a measure of reward strength. Science
134:943–944. CrossRef Medline
Hotsenpiller G, Giorgetti M, Wolf ME (2001) Alterations in behaviour and
glutamate transmission following presentation of stimuli previously as-
sociated with cocaine exposure. Eur J Neurosci 14:1843–1855. CrossRef
Medline
Kalivas PW (2009) The glutamate homeostasis hypothesis of addiction. Nat
Rev Neurosci 10:561–572. CrossRef Medline
Kaplitt MG, Feigin A, Tang C, Fitzsimons HL, Mattis P, Lawlor PA, Bland RJ,
Young D, Strybing K, Eidelberg D, During MJ (2007) Safety and tolera-
bility of gene therapy with an adeno-associated virus (AAV) borne GAD
gene for Parkinson’s disease: an open label, phase I trial. Lancet 369:2097–
2105. CrossRef Medline
Kasanetz F, Lafourcade M, Deroche-Gamonet V, Revest JM, Berson N,
Balado E, Fiancette JF, Renault P, Piazza PV, Manzoni OJ (2012) Pre-
frontal synaptic markers of cocaine addiction-like behavior in rats. Mol
Psychiatry. Advance online publication. doi:10.1038/mp.2012.59.
CrossRef
Katz LC, Iarovici DM (1990) Green fluorescent latex microspheres: a new
retrograde tracer. Neuroscience 34:511–520. CrossRef Medline
Koob GF, Volkow ND (2010) Neurocircuitry of addiction. Neuropsychop-
harmacology 35:217–238. Medline
Kufahl PR, Martin-Fardon R, Weiss F (2011) Enhanced sensitivity to atten-
uation of conditioned reinstatement by the mGluR(2/3) agonist
LY379268 and increased functional activity of mGluR(2/3) in rats with a
history of ethanol dependence. Neuropsychopharmacology 36:1–12.
CrossRef Medline
Liechti ME, Markou A (2007) Metabotropic glutamate 2/3 receptor activa-
tion induced reward deficits but did not aggravate brain reward deficits
associated with spontaneous nicotine withdrawal in rats. Biochem Phar-
macol 74:1299 –1307. CrossRef Medline
Macey DJ, Schulteis G, Heinrichs SC, Koob GF (1996) Time-dependent
quantifiable withdrawal from ethanol in the rat: effect of method of de-
pendence induction. Alcohol 13:163–170. CrossRef Medline
McFarland K, Davidge SB, Lapish CC, Kalivas PW (2004) Limbic and motor
circuitry underlying footshock-induced reinstatement of cocaine-seeking
behavior. J Neurosci 24:1551–1560. CrossRef Medline
Melendez RI, McGinty JF, Kalivas PW, Becker HC (2012) Brain region-
specific gene expression changes after chronic intermittent ethanol expo-
sure and early withdrawal in C57BL/6J mice. Addict Biol 17:351–364.
CrossRef Medline
Miguel-Hidalgo JJ, Overholser JC, Meltzer HY, Stockmeier CA, Rajkowska G
(2006) Reduced glial and neuronal packing density in the orbitofrontal
cortex in alcohol dependence and its relationship with suicide and dura-
Meinhardt et al. mGluR
2
and Drug Seeking J. Neurosci., February 13, 2013 33(7):2794–2806 2805
tion of alcohol dependence. Alcohol Clin Exp Res 30:1845–1855.
CrossRef Medline
Moreno JL, Holloway T, Albizu L, Sealfon SC, Gonza´lez-Maeso J (2011)
Metabotropic glutamate mGlu2 receptor is necessary for the pharmaco-
logical and behavioral effects induced by hallucinogenic 5-HT2A receptor
agonists. Neurosci Lett 493:76 –79. CrossRef Medline
Moussawi K, Pacchioni A, Moran M, Olive MF, Gass JT, Lavin A, Kalivas PW
(2009) N-Acetylcysteine reverses cocaine-induced metaplasticity. Nat
Neurosci 12:182–189. CrossRef Medline
Moussawi K, Zhou W, Shen H, Reichel CM, See RE, Carr DB, Kalivas PW
(2011) Reversing cocaine-induced synaptic potentiation provides en-
during protection from relapse. Proc Natl Acad SciUSA108:385–390.
CrossRef Medline
O’Dell LE, Roberts AJ, Smith RT, Koob GF (2004) Enhanced alcohol self-
administration after intermittent versus continuous alcohol vapor expo-
sure. Alcohol Clin Exp Res 28:1676 –1682. CrossRef Medline
Ohishi H, Shigemoto R, Nakanishi S, Mizuno N (1993) Distribution of the
messenger RNA for a metabotropic glutamate receptor, mGluR2, in the
central nervous system of the rat. Neuroscience 53:1009–1018. CrossRef
Medline
Olive MF (2009) Metabotropic glutamate receptor ligands as potential ther-
apeutics for addiction. Curr Drug Abuse Rev 2:83–98. CrossRef Medline
Paxinos G, Watson C (1998) The rat brain in stereotaxic coordinates. San
Diego: Academic.
Reimers M, Heilig M, Sommer WH (2005) Gene discovery in neurophar-
macological and behavioral studies using Affymetrix microarray data.
Methods 37:219 –228. CrossRef Medline
Reynolds SM, Zahm DS (2005) Specificity in the projections of prefrontal
and insular cortex to ventral striatopallidum and the extended amygdala.
J Neurosci 25:11757–11767. CrossRef Medline
Rimondini R, Arlinde C, Sommer W, Heilig M (2002) Long-lasting increase
in voluntary ethanol consumption and transcriptional regulation in the
rat brain after intermittent exposure to alcohol. FASEB J 16:27–35.
CrossRef Medline
Rimondini R, Sommer W, Heilig M (2003) A temporal threshold for induc-
tion of persistent alcohol preference: behavioral evidence in a rat model of
intermittent intoxication. J Stud Alcohol 64:445– 449. Medline
Rimondini R, Sommer WH, Dall’Olio R, Heilig M (2008) Long-lasting tol-
erance to alcohol following a history of dependence. Addict Biol 13:26
30. CrossRef Medline
Roberts AJ, Heyser CJ, Cole M, Griffin P, Koob GF (2000) Excessive ethanol
drinking following a history of dependence animal model of allostasis.
Neuropsychopharmacology 22:581–594. CrossRef Medline
Rogers J, Wiener SG, Bloom FE (1979) Long-term ethanol administration
methods for rats: advantages of inhalation over intubation or liquid diets.
Behav Neural Biol 27:466 486. CrossRef Medline
Sanchis-Segura C, Spanagel R (2006) Behavioural assessment of drug rein-
forcement and addictive features in rodents: an overview. Addict Biol
11:2–38. CrossRef Medline
Schacht JP, Anton RF, Myrick H (2013) Functional neuroimaging
studies of alcohol cue reactivity: a quantitative meta-analysis and sys-
tematic review. Addict Biol 18:121–133. CrossRef Medline
Sheedy D, Garrick T, Dedova I, Hunt C, Miller R, Sundqvist N, Harper C
(2008) An Australian Brain Bank: a critical investment with a high re-
turn! Cell Tissue Bank 9:205–216.
Sommer WH, Rimondini R, Hansson AC, Hipskind PA, Gehlert DR, Barr CS,
Heilig MA (2008) Upregulation of voluntary alcohol intake, behavioral
sensitivity to stress, and amygdala crhr1 expression following a history of
dependence. Biol Psychiatry 63:139 –145. CrossRef Medline
Sommer WH, Lidstro¨m J, Sun H, Passer D, Eskay R, Parker SCJ, Witt SH,
Zimmermann US, Nieratschker V, Rietschel M, Margulies EH, Palkovits
M, Laucht M, Heilig M (2010) Human NPY promoter variation
rs16147:TC as a moderator of prefrontal NPY gene expression and
negative affect. Human Mut 31:E1594–E1608. CrossRef
Spanagel R (2009) Alcoholism: a systems approach from molecular physi-
ology to addictive behavior. Physiol Rev 89:649 –705. CrossRef Medline
Spanagel R, Bartsch D, Brors B, Dahmen N, Deussing J, Eils R, Ende G,
Gallinat J, Gebicke-Haerter P, Heinz A, Kiefer F, Ja¨ger W, Mann K, Mat-
tha¨usF,No¨then M, Rietschel M, Sartorius A, Schu¨tz G, Sommer WH,
Sprengel R, et al. (2010) An integrated genome research network for
studying the genetics of alcohol addiction. Addict Biol 15:369–379.
CrossRef Medline
Standring S (2008) Gray’s anatomy: the anatomical basis of clinical practice,
Ed 40. New York: Churchill-Livingstone/Elsevier.
Stephens DN, Ripley TL, Borlikova G, Schubert M, Albrecht D, Hogarth L,
Duka T (2005) Repeated ethanol exposure and withdrawal impairs hu-
man fear conditioning and depresses long-term potentiation in rat
amygdala and hippocampus. Biol Psychiatry 58:392– 400. CrossRef
Medline
Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette
MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, Mesirov JP
(2005) Gene set enrichment analysis: a knowledge-based approach
for interpreting genome-wide expression profiles. Proc Natl Acad Sci
U S A 102:15545–15550. CrossRef Medline
Sugino K, Hempel CM, Miller MN, Hattox AM, Shapiro P, Wu C, Huang ZJ,
Nelson SB (2006) Molecular taxonomy of major neuronal classes in the
adult mouse forebrain. Nat Neurosci 9:99 –107. CrossRef Medline
Tolliver GA, Sadeghi KG, Samson HH (1988) Ethanol preference following
the sucrose-fading initiation procedure. Alcohol 5:9 –13. CrossRef
Medline
Uylings HB, Groenewegen HJ, Kolb B (2003) Do rats have a prefrontal cor-
tex? Behav Brain Res 146:3–17. CrossRef Medline
Vendruscolo LF, Barbier E, Schlosburg JE, Misra KK, Whitfield TW Jr, Logrip
ML, Rivier C, Repunte-Canonigo V, Zorrilla EP, Sanna PP, Heilig M,
Koob GF (2012) Corticosteroid-dependent plasticity mediates compul-
sive alcohol drinking in rats. J Neurosci 32:7563–7571. CrossRef Medline
Wilson SJ, Sayette MA, Fiez JA (2004) Prefrontal responses to drug cues: a
neurocognitive analysis. Nat Neurosci 7:211–214. CrossRef Medline
2806 J. Neurosci., February 13, 2013 33(7):2794 –2806 Meinhardt et al. mGluR
2
and Drug Seeking
    • "Furthermore, escalation of alcohol self-administration and increased motivation to obtain alcohol is observed following a history of alcohol dependence, and this " post-dependent " phenotype has been shown to be associated with a marked down-regulation of prelimbic mGluR2 expression. Rescue of this molecular deficit specifically in neurons projecting to the nucleus accumbens shell was also able to rescue the behavioral phenotype in these animals (Meinhardt et al, 2013). © 2016 Macmillan Publishers Limited. "
    [Show abstract] [Hide abstract] ABSTRACT: Group II metabotropic glutamate receptors (mGluR2 and mGluR3) may control relapse of alcohol seeking, but previously available Group II agonists were unable to discriminate between mGluR2 and mGluR3. Here, we use AZD8529, a novel positive allosteric mGluR2 modulator, to determine the role of this receptor for alcohol-related behaviors in rats. We assessed the effects of AZD8529 (20 and 40 mg/kg s.c.) on male Wistar rats trained to self-administer 20% alcohol, and determined the effects of AZD8529 on self-administration, as well as stress-induced and cue-induced reinstatement of alcohol seeking. The on-target nature of findings was evaluated in Indiana P-rats, a line recently shown to carry a mutation that disrupts the gene encoding mGluR2. The behavioral specificity of AZD8529 was assessed using self-administration of 0.2% saccharin, and locomotor activity tests. AZD8529 marginally decreased alcohol self-administration at doses that neither affected 0.2% saccharin self-administration nor locomotor activity. More importantly, cue- but not stress-induced alcohol seeking was blocked by the mGluR2 positive allosteric modulator. This effect of AZD8529 was completely absent in P rats lacking functional mGluR2s, demonstrating the receptor specificity of this effect. Our findings provide evidence for a causal role of mGluR2 in cue-induced relapse to alcohol seeking. They contribute support for the notion that positive allosteric modulators of mGluR2 block relapse-like behavior across different drug categories.Neuropsychopharmacology accepted article preview online, 24 June 2016. doi:10.1038/npp.2016.107.
    Full-text · Article · Jun 2016
    • "Acutely, ethanol inhibits NMDA receptor function in both the cortex and subcortical targets including the striatum (Woodward, 2000; Yin et al., 2007) and repeated ethanol exposure has been shown to produce sensitized glutamate release in the NAc (Szumlinski et al., 2007). Chronic ethanol exposure result in increases in extracellular glutamate in the NAc (Griffin III et al., 2013), as well as alterations in both metabotropic and ionotropic glutamate receptor expression that could be related to the expression of behavioral inflexibility (Kroener et al., 2012; Meinhardt et al., 2013). While dopamine and glutamate signaling in the dorsolateral striatum have been directly implicated in the expression of habitual ethanol seeking (Corbit et al., 2014; Shnitko and Robinson, 2015), and while the normal functioning of these systems is likely to be altered by "
    [Show abstract] [Hide abstract] ABSTRACT: The development of alcohol-use disorders is thought to involve a transition from casual alcohol use to uncontrolled alcohol-seeking behavior. This review will highlight evidence suggesting that the shift toward inflexible alcohol seeking that occurs across the development of addiction consists, in part, of a progression from goal-directed to habitual behaviors. This shift in "response strategy" is thought to be largely regulated by corticostriatal network activity. Indeed, specific neuroanatomical substrates within the prefrontal cortex and the striatum have been identified as playing opposing roles in the expression of actions and habits. A majority of the research on the neurobiology of habitual behavior has focused on non-drug reward seeking. Here, we will highlight recent research identifying corticostriatal structures that regulate the expression of habitual alcohol seeking and a comparison will be made when possible to findings for non-drug rewards. Copyright © 2015 Elsevier Inc. All rights reserved.
    Full-text · Article · May 2015
    • "Thus, pharmacological blockade or very low levels of mGluR2 mRNA is associated with increased alcohol consumption by alcohol preferring as well as alcohol nonpreferring rats (Li et al., 2010; Holmes et al., 2013; Meinhardt et al., 2013; Zhou et al., 2013). Similarly, post-mortem analysis of human frontal cortex from alcohol-dependent patients revealed a decreased expression levels of mGluR2 mRNA (Meinhardt et al., 2013) further highlighting its involvement in the development and/or expression of alcohol dependence. "
    [Show abstract] [Hide abstract] ABSTRACT: Alcoholism is a serious public health concern that is characterized by the development of tolerance to alcohol's effects, increased consumption, loss of control over drinking and the development of physical dependence. This cycle is often times punctuated by periods of abstinence, craving and relapse. The development of tolerance and the expression of withdrawal effects, which manifest as dependence, have been to a great extent attributed to neuroadaptations within the mesocorticolimbic and extended amygdala systems. Alcohol affects various neurotransmitter systems in the brain including the adrenergic, cholinergic, dopaminergic, GABAergic, glutamatergic, peptidergic, and serotonergic systems. Due to the myriad of neurotransmitter and neuromodulator systems affected by alcohol, the efficacies of current pharmacotherapies targeting alcohol dependence are limited. Importantly, research findings of changes in glutamatergic neurotransmission induced by alcohol self- or experimenter-administration have resulted in a focus on therapies targeting glutamatergic receptors and normalization of glutamatergic neurotransmission. Glutamatergic receptors implicated in the effects of ethanol include the ionotropic glutamate receptors (AMPA, Kainate, and NMDA) and some metabotropic glutamate receptors. Regarding glutamatergic homeostasis, ceftriaxone, MS-153, and GPI-1046, which upregulate glutamate transporter 1 (GLT1) expression in mesocorticolimbic brain regions, reduce alcohol intake in genetic animal models of alcoholism. Given the hyperglutamatergic/hyperexcitable state of the central nervous system induced by chronic alcohol abuse and withdrawal, the evidence thus far indicates that a restoration of glutamatergic concentrations and activity within the mesocorticolimbic system and extended amygdala as well as multiple memory systems holds great promise for the treatment of alcohol dependence.
    Full-text · Article · Apr 2015
Show more

  • undefined · undefined
  • undefined · undefined
  • undefined · undefined

Recommended publications

Discover more