ArticlePDF Available

Withania somnifera Water Extract as a Potential Candidate for Differentiation Based Therapy of Human Neuroblastomas

Authors:

Abstract and Figures

Neuroblastoma is an aggressive childhood disease of the sympathetic nervous system. Treatments are often ineffective and have serious side effects. Conventional therapy of neuroblastoma includes the differentiation agents. Unlike chemo-radiotherapy, differentiation therapy shows minimal side effects on normal cells, because normal non-malignant cells are already differentiated. Keeping in view the limited toxicity of Withania somnifera (Ashwagandha), the current study was aimed to investigate the efficacy of Ashwagandha water extract (ASH-WEX) for anti-proliferative potential in neuroblastoma and its underlying signalling mechanisms. ASH-WEX significantly reduced cell proliferation and induced cell differentiation as indicated by morphological changes and NF200 expression in human IMR-32 neuroblastoma cells. The induction of differentiation was accompanied by HSP70 and mortalin induction as well as pancytoplasmic translocation of the mortalin in ASH-WEX treated cells. Furthermore, the ASH-WEX treatment lead to induction of neural cell adhesion molecule (NCAM) expression and reduction in its polysialylation, thus elucidating its anti-migratory potential, which was also supported by downregulation of MMP 2 and 9 activity. ASH-WEX treatment led to cell cycle arrest at G0/G1 phase and increase in early apoptotic population. Modulation of cell cycle marker Cyclin D1, anti-apoptotic marker bcl-xl and Akt-P provide evidence that ASH-WEX may prove to be a promising phytotherapeutic intervention in neuroblatoma related malignancies.
Content may be subject to copyright.
Withania somnifera
Water Extract as a Potential
Candidate for Differentiation Based Therapy of Human
Neuroblastomas
Hardeep Kataria
1
, Renu Wadhwa
2
, Sunil C. Kaul
2
, Gurcharan Kaur
1
*
1Department of Biotechnology, Guru Nanak Dev University, Amritsar, India, 2National Institute of Advanced Industrial Science and Technology, Tsukuba, Japan
Abstract
Neuroblastoma is an aggressive childhood disease of the sympathetic nervous system. Treatments are often ineffective and
have serious side effects. Conventional therapy of neuroblastoma includes the differentiation agents. Unlike chemo-
radiotherapy, differentiation therapy shows minimal side effects on normal cells, because normal non-malignant cells are
already differentiated. Keeping in view the limited toxicity of Withania somnifera (Ashwagandha), the current study was
aimed to investigate the efficacy of Ashwagandha water extract (ASH-WEX) for anti-proliferative potential in neuroblastoma
and its underlying signalling mechanisms. ASH-WEX significantly reduced cell proliferation and induced cell differentiation
as indicated by morphological changes and NF200 expression in human IMR-32 neuroblastoma cells. The induction of
differentiation was accompanied by HSP70 and mortalin induction as well as pancytoplasmic translocation of the mortalin
in ASH-WEX treated cells. Furthermore, the ASH-WEX treatment lead to induction of neural cell adhesion molecule (NCAM)
expression and reduction in its polysialylation, thus elucidating its anti-migratory potential, which was also supported by
downregulation of MMP 2 and 9 activity. ASH-WEX treatment led to cell cycle arrest at G0/G1 phase and increase in early
apoptotic population. Modulation of cell cycle marker Cyclin D1, anti-apoptotic marker bcl-xl and Akt-P provide evidence
that ASH-WEX may prove to be a promising phytotherapeutic intervention in neuroblatoma related malignancies.
Citation: Kataria H, Wadhwa R, Kaul SC, Kaur G (2013) Withania somnifera Water Extract as a Potential Candidate for Differentiation Based Therapy of Human
Neuroblastomas. PLoS ONE 8(1): e55316. doi:10.1371/journal.pone.0055316
Editor: Rossella Rota, Ospedale Pediatrico Bambino Gesu’, Italy
Received August 6, 2012; Accepted December 21, 2012; Published January 31, 2013
Copyright: ß2013 Kataria et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: The study was supported by grants from the Department of Biotechnology, Government of India to Guru Nanak Dev University, under DBT-AIST, Japan
collaboration program. H. K. is supported by fellowship grant from the Council of Scientific and Industrial Research (CSIR), India. The funders had no role in study
design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: kgurcharan.neuro@yahoo.com
Introduction
Neuroblastoma (NB) is the most common extra-cranial pediatric
tumor that is derived from neural crest precursors. It is often
malignant and undifferentiated in nature and retains the capability
to differentiate into a variety of cells, including neurons,
melanocytes and schwann cells. Since NB frequently has
heterogeneous neoplastic populations which are highly variable
in their state of differentiation, it has been predicted that failure of
the neural crest cells to fully differentiate causes the development
of neuroblastoma [1]. These have been extensively studied as a
neoplastic model and to develop differentiation based chemo-
therapies [1,2] that are often complicated by the requirement of
high doses and their cytotoxicity. Amongst others, retinoid-based
differentiation and maintenance therapy has relatively increased
survival rate for NB patients, however, there is still a significantly
considerable number of patients showing relapse and deteriorated
phases of NB [3,4,5]. Therefore, new treatment strategies are
necessary to overcome existing shortcomings of conventional
therapies.
Withania somnifera commonly known as Ashwagandha/Indian
ginseng/Winter cherry is one of the most esteemed medicinal
plants used in Ayurveda (Indian traditional medicine system) for
over 3000 years. It has been used for all human age groups and no
side effects have been reported so far [6]. Ashwagandha extracts as
well as its different isolated bioactive constituents have been
demonstrated to possess beneficial adaptogenic, anticancer, anti-
convulsant, immunomodulatory, antioxidative and neurological
effects. Several bioactive alkaloids and steroidal-lactone based
phytochemicals, e.g. Ashwagandhine, Cuscohygrine, Isopelletier-
ine, Anaferine, Anhygrine, Tropine, Sitoindosides (Saponins) and
the diversely functional Withanolides, Withanamides, and Glyco-
withanolides have been isolated from different parts of this plant
[7,8,9]. Its increasing therapeutic benefits continuously attract the
attention of pharmacologists for biomedical investigations on plant
extracts and isolated phytochemicals [10,11,12]. Recently reports
from our lab and others have revealed the role of Ashwagandha in
neuroprotection [13,14].
Neuronal-differentiation and neuro-oncogenesis are multifacto-
rial processes and are known to be influenced by multiple cell-
signaling pathways including cytoskeleton and cell adhesion, stress
and growth factor responses. Neurofilaments (NFs) are major
cytoskeletal components of neurons and are composed mainly of
three different polypeptide subunits: NF-L (68 kDa); NF-M
(160 kDa); and NF-H (200 kDa). NF200 is expressed mainly in
differentiated neurons [15,16]; its phosphorylated form is exten-
sively used as axonal marker. The expression pattern of many heat
shock proteins appears to be closely linked in early mammalian
development to critical differentiation and proliferation stages
[17,18]. Some stress chaperones, such as mortalin perform
PLOS ONE | www.plosone.org 1 January 2013 | Volume 8 | Issue 1 | e55316
multiple functions relevant to multiple stress reponse, cell survival
and differentiation [19,20,21].
The neural cell adhesion molecule (NCAM) exhibits high
structural diversity and it has been implicated in a multitude of
cellular functions, not only during neural development and
plasticity but also in oncogenesis [22,23]. The most prominent
and unique posttranslational modification of NCAM is addition of
polysialic acid (PSA), to the fifth immunoglobulin like domain of
NCAM [24]. Despite the abundant evidence that polysialic acid is
critically involved in neural development and tumor malignancy,
its mode of action on the cellular level is still unclear [25]. Akt
(protein kinase B), is an important regulator for multiple biological
processes, including metabolism, cell size, apoptosis, and cell cycle
progression [26]. Cyclin D1, a proto-oncogene and an important
regulator of G1 to S-phase transition and bcl-xl (an important
member of bcl-2 anti-apoptotic family of proteins) have also been
shown to regulate neuronal differentiation [27,28].
In an effort to expand strategies for targeting neuroblastoma
cells, the current study explored the potential anti-cancer
activity of ASH-WEX on neuroblastoma cells. In the present
study, we demonstrate that ASH-WEX is a potent anti-
proliferative and proapoptotic agent of neuroblastoma cells
in vitro. These effects are associated with an increased expression
of Neurofilament (NF200), HSP70, mortalin, NCAM and a
concomitant inhibition of PSA-NCAM expression. We also
demonstrate that ASH-WEX inhibits the MMP-2 and MMP-9
activity and cell migration and to further ascertain the
underlying signalling pathways the expression of cell cycle
marker Cyclin D1, anti-apoptotic marker bcl-xl and Akt-P were
studied. Cell cycle analysis and Annexin V-FITC/PI staining
were done to ascertain the cell state after ASH-WEX treatment.
As such, these findings identify ASH-WEX as a potential
therapeutic agent for the treatment of high grade neuroblasto-
mas.
Materials and Methods
Ashwagandha Water Extract Preparation (ASH-WEX)
ASH-WEX was prepared as reported earlier [29]. Briefly, 10 g
of dry leaf powder was suspended in 100 ml of distilled water and
stirred overnight at 4565uC, followed by filtration under sterile
conditions. The filtrate thus obtained was treated as 100% ASH-
WEX.
Cell Culture and Treatments
IMR-32, SH-SY5Y and Neuro-2a cell lines were obtained
from National Centre for Cell Sciences (Pune, India) and TGW
cell line was obtained from the Health Science Research
Resources Bank (Osaka, Japan). IMR-32, TGW and Neuro-2a
neuroblastoma cell line were maintained on DMEM supple-
mented with 1X PSN (Invitrogen), 10% FBS (Biological
Industries) at 37uC and humid environment containing 5%
CO
2
. SH-SY5Y cells were maintained on DMEM/Ham’s F-12
(1:1) nutrient mixture supplemented with 10% FBS. Cultures at
30–40% confluency were treated with ASH-WEX (0.01– 1.0%
diluted in medium) for 72 h. The control cultures were given a
medium change alone. For comparisons a standard differenti-
ation inducing agent Retinoic acid (RA) was included in the
study. RA (10 mM) treatments were given in the presence of
10% FBS similar to ASH-WEX treatment groups. To ascertain
the effect of the vehicle, DMSO in the RA treated group,
DMSO (1 ml/ml) treated cells were studied along with the
control (untreated) IMR-32 cells for 72hrs (Figure S1).
Cell Proliferation Assay and Morphological Study
ASH-WEX was tested for anti-proliferative activity on IMR-32,
TGW, SH-SY5Y and Neuro-2a neuroblastoma cells using the 3-
(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide
(MTT) test. Morphological changes in neuroblastoma cells treated
with different concentrations of ASH-WEX were examined by
phase contrast microscopy.
Immunostaining
The control and treated IMR-32 neuroblastoma cells were fixed
with paraformaldehyde followed by permeabilization with 0.3%
PBST. After blocking with 5% normal goat serum (NGS), the
coverslips were incubated with anti NF-200 (1:500, Sigma), anti-
HSP70 (1:1000, Sigma), anti-NCAM (1:500, Sigma), anti-PSA-
NCAM (1:200, Abcys), anti-Cyclin D1 (1:500, Sigma), anti-bcl-xl
(1:100, Sigma) and anti-Akt-P (1:200, Sigma) diluted in 0.1%
PBST, for 24h at 4uC in humid chamber. Secondary antibody
(goat anti-mouse/IgG/IgM Alexa Fluor conjugated from Invitro-
gen) was applied for 2h at room temperature. Cells were then
mounted with anti-fading reagent and observed. Each experiment
was carried out in duplicate and repeated thrice. Images were
captured using Cool Snap CCD camera and the pictures were
analyzed using Image pro-plus software version 4.5.1 from the
media cybernetics.
Western Blotting
Cells were grown and treated in 90 mm petri-plates were
harvested with PBS-EDTA (1 mM). Cell pellet was homogenized
in NP-40 lysis buffer (50 mM Tris, 150 mM NaCl, 0.5% Sodium
deoxycholate, 0.1% SDS, 1.0% NP-40) and protein content in the
supernatant was determined by the Bradford method. Protein
lysate (20–30 mg) was resolved on 10% SDS-PAGE followed by
blot transfer onto a PVDF membrane (Hybond-P) using the
semidry Novablot system (Amersham Pharmacia). Subsequently,
membranes were be probed with mouse anti-NF 200 (1:2000),
anti-HSP70 (1:5000), anti-NCAM (1:2000), anti-PSA (1:1000),
anti-Cyclin D1 (1:2500), anti-bcl-xl (1:1000) and anti-Akt-P
(1:2000, Sigma). Immunoreactive bands were visualized using
ECL Plus western blot detection system (Amersham Biosciences).
In order to account for potential variations in protein estimation
and sample loading, expression of each protein was compared to
that of a-tubulin in each sample after stripping the blot. Each
experiment was repeated thrice.
mRNA Expression by Semiquantitative RT-PCR
Total RNA was extracted from the cells by the TRI reagent
(Sigma) according to manufacturer’s instruction. Equal amount of
RNA was used for cDNA synthesis. cDNA was synthesized in
20 ml reactions containing 200 units M-MLV reverse transcrip-
tase, 4 ml56first strand buffer, 2 ml DTT (0.1 M) (Invitrogen),
5mg of total RNA, 1 mM each of dNTPs (Amersham), 20U of
ribonuclease inhibitor (Sigma), and 250 ng pd(N)
6
random
hexamers (MBI, Fermentas). 2 ml of cDNA was amplified in a
50 ml PCR reaction mixture containing 2U Taq polymerase, 5 ml
106PCR buffer, 1.5 ml of 50 mM MgCl
2
(Sigma), 1 mlof10mM
dNTP mix (Amersham), and 20 pM respective primers (Table 1).
Cycling conditions comprised of an initial denaturation of 3 min at
94uC followed by 35 cycles of amplification (at 94uC for 40 sec,
55uC for 45 sec and 72uC for 1 min) and final elongation step at
72uC for 10 min. To control the PCR reaction components and
the integrity of the RNA, 2 ml of each cDNA sample was amplified
separately for b-actin specific primer. Each experiment was
repeated thrice.
Withania Induces Differentiation in IMR-32 Cells
PLOS ONE | www.plosone.org 2 January 2013 | Volume 8 | Issue 1 | e55316
Wound Scratch Assay
In order to investigate IMR-32 cell migration capability after
ASH-WEX treatment, cells were grown to confluent monolayer.
The monolayer was wounded by scratching the surface with a
sterile needle (22 gauge). The initial wounding and the movement
of the cells in the scratched area was photographically monitored
for 24 h after the treatment with the ASH-WEX extract. The
assay was done in duplicate and repeated thrice.
Matrix Metalloproteinases (MMPs) Zymography
Samples of supernatant medium conditioned by cell culture
under different experimental conditions were separated on a 10%
SDS-PAGE containing 0.1% gelatin. After electrophoresis, gels
were washed with 2.5% Triton X-100 (in 50 mM Tris-HCl) for
30 min to remove SDS, followed by incubating the gel in
zymogram developing buffer (Invitrogen) at 37uC for 48 hrs. Gels
were subsequently stained with Coomassie brilliant blue and
destained in buffer containing 50% methanol and 10% acetic acid
(v/v), and the location of gelatinolytic activity was detected as clear
bands. Samples from three different experiments were analysed for
quantitative analysis.
Cell Cycle Analysis Using Propidium Iodide
Cells were plated at 2 610
5
cells/dish in 10 cm diameter
dishes, and then grown either in the presence or absence of ASH-
WEX and RA. After 72 hrs of treatment, the cells were harvested
from dishes by collecting trypsinized cells together with floating
cells in the medium. For each condition, a volume of the cell
suspension corresponding to 2 610
6
cells was centrifuged and the
resultant cell pellet was resuspended in ice-cold PBS (1.0 ml). Cells
were fixed in ice-cold 70% ethanol and stained with propidium
iodide. FACS analysis was performed using a BD Accuri C6 flow
cytometer (BD Biosciences Immunocytometry Systems, San Jose,
CA). DNA content histograms and cell cycle phase distributions
were modelled from at least 20,000 single events by excluding cell
aggregates based on scatter plots of fluorescence pulse area versus
fluorescence pulse width using FCS Express 4 flow research
edition software (De novo software). The experiments were
repeated thrice for further analysis.
Annexin-FITC Apoptosis Assay
To determine the extent of apoptotic and necrotic cell death,
cells were stained with annexin V conjugated with FITC and PI
using the Annexin V-FITC Apoptosis Detection Kit (Miltneyi
Biotech), according to the manufacturer’s protocols. Annexin V
has a high affinity for phosphatidylserine exposed on the outer
membrane of apoptotic cells, while PI is transported to late-stage
apoptotic/necrotic cells with disrupted cell membranes. The cells
from control and treated groups were trypsinized, washed with
PBS, and resuspended in 1 ml of annexin V binding buffer (16)
with addition of 10 ml annexin V-FITC. Following incubation (for
15 min in the dark at room temperature) and centrifugation
(5 min, 3006g), 500 ml of annexin V binding buffer and 5 mlofPI
were added to the cell pellet and incubated for further 5 min in the
same conditions. Then, viable (annexin V-, PI-negative), early
apoptotic (annexin V-positive, PInegative), late apoptotic (annexin
V-, PI-positive) and necrotic (annexin V-negative, PI-positive) cells
were detected by flow cytometry (Accuri C6 flow cytometer;
Becton–Dickinson) and quantified from three different experi-
ments by FCS Express 4 flow research edition software (De novo
software).
Data Analysis
The captured images were analyzed using Image Pro-Plus
software version 4.5.1 from Media Cybernetics. The extent of
immunoreactivity was quantified by the overall density of their
respective immunoreactivity each in 5–6 randomly selected fields
on each image using the count/size command of the Image Pro-
Plus software. 15 different images were used from three different
experiments and the data were averaged and expressed as
percentage with respect to control.
Statistical Analysis
Values are expressed as mean 6SEM. The SigmaStat for
Windows (version 3.5) was adopted to analyse the results by
Student’s t-test in order to determine the significance of the means.
Values of p,0.05 were considered as statistically significant.
Table 1. Primer sequences used for semi-quantitative RT-PCR.
No. mRNA Primer Sequence
Expected product
size
1. NF200 F 59CAAGGAACCCAGCAAACCA3’ R 59GGCCTCTGTCTTGGGTTTCTC3’ 106 bp
2. HSP70 F 59GAGTTCAAGCGCAAACACAA3’ R 59CTCAGACTTGTCGCCAATGA3’ 428 bp
3. Mortalin F 59CAGTCTTCTGGTGGATTAAG 39R59ATTAGCACCGTCACGTAACACCTC 39420 bp
4. NCAM F 59TGAGGGTACTTACCGCTGTG3’ R 59GTTGCTGGCAGTGCACATGT3’ 651 bp
5. PST F 59TAAGGTGCAATCTAGCTCCTGTGGTGG3’ R 59GCATCCTGTGAGGACTGGCGTTGGAAA3’ 474 bp
6. MMP-2 F 59GGCTGGTCAGTGGCTTGGGGTA3’ R 59AGATCTTCTTCTTCAAGGACCGGTT3’ 200 bp
7. MMP-9 F 59TGTACCGCTATGGTTACAC3’ R 59CCGCGACACCAAACTGGA3’ 357 bp
8. Cyclin D1 F 59ATGGAACACCAGCTCCTGTGCTGC3’ R 59TCAGATGTCCACGTCCCGCACGT3’ 888 bp
9. Bcl-xl F 59AGGATACAGCTGGAGTCAG3’ R 59TCTCCTTGTCTACGCTTTCC3’ 417 bp
10. Akt F 59ACGACCGCCTCTGCTTTG3’ R 59ACACGCGCTCACGAGACA3’ 101 bp
11. b-actin F 59TCACCCACACTGTGCCCATCTACGA3’ R 59CAGCGGAACCGCTCATTGCCAATGG3’ 285 bp
doi:10.1371/journal.pone.0055316.t001
Withania Induces Differentiation in IMR-32 Cells
PLOS ONE | www.plosone.org 3 January 2013 | Volume 8 | Issue 1 | e55316
Results
ASH-WEX Exerted Antiproliferative Effects and Induced
Differentiated Morphology
Human neuroblastoma cell lines IMR-32, TGW, SH-SY5Y
and mouse neuroblastoma cell line Neuro-2a cells were cultured in
the presence of different concentrations of ASH-WEX. The
extract was cytotoxic (Fig. 1a) at concentrations higher than 0.5%.
At lower concentrations (0.5% and less), cells appeared to be
growth arrested with extended neurite like projections which
appeared to be similar to the differentiated cells. The antiprolif-
erative activity of ASH-WEX cell was further investigated by
MTT assay (Fig. 1a). ASH-WEX was able to reduce the
proliferation rate in all the four neuroblastoma cell lines. Based
on the MTT data, we selected 0.2% and 0.5% ASH-WEX
concentrations for testing its differentiation inducing potential and
human neuroblastoma cell line IMR-32 was selected for further
studies.
IMR-32 neuroblastoma cells when treated with 0.2% and 0.5%
of ASH-WEX, showed significant morphological changes as
compared to control cells (Fig. 1b). The treated cells showed
extended and multiple projections. To confirm the induction of
differentiation, the expression of mature neuronal marker, NF200
was examined. Furthermore 10 mM RA treated cells were taken as
positive control to compare the differentiation status. ASH-WEX
treatment lead to increased expression of NF200 (Fig. 1c);
Comparison of the NF200 expression in ASH-WEX and RA
treated cells revealed that ASH-WEX was a strong inducer of
neuronal differentiation (Fig. 1d)). Increase in NF200 expression in
0.2% and 0.5% treated cells was also confirmed by Western
blotting and RT-PCR to ascertain the changes at both transla-
tional and transcriptional levels (Fig. 1e,f).
ASH-WEX Induced HSPs and Senescence in
Neuroblastoma
HSP70 expression was increased with 0.5% ASH-WEX
treatments and the increase in HSP70 immunoreactivity was
comparable to that of 10 mM RA treated group (Fig. 2a,b).
Western blot and RT-PCR results further supported these
Figure 1. Growth curve inhibition as assessed by MTT assay in IMR-32, TGW, SH-SY5Y and Neuro-2a cells (a). Data are representative of
three different experiments done in triplicates and expressed as mean 6S.E.M. (b) Phase contrast images of IMR-32, TGW, SH-SY5Y and Neuro-2a
neurolastoma cells treated with 0.0% (Control), 0.2% and 0.5% ASH-WEX. (c) NF200 expression in response to ASH-WEX treatment in control, ASH-
WEX (0.2% and 0.5%) and RA treated IMR-32 cultures. The relative intensity measurement of immunofluorescence is shown (d). (e) Representative
Western blot hybridization signals for NF200 from control and test samples. (f) Representative RT-PCR results for NF200 mRNA in control and treated
cells and their relative densitometry analysis represented by histograms. ‘‘*’’ represents the statistical significant (p,0.05) difference between control
and ASH-WEX treated groups.
doi:10.1371/journal.pone.0055316.g001
Withania Induces Differentiation in IMR-32 Cells
PLOS ONE | www.plosone.org 4 January 2013 | Volume 8 | Issue 1 | e55316
observations as there was significant increase in HSP70 expression
(Fig. 2d,f). We further examined the ASH-WEX and RA treated
cells for the induction of senescence using mortalin staining as a
marker. It was observed that the ASH-WEX treated cells showed
pancytoplasmic staining of mortalin in 80–90% of the cells
indicating the senescent status as compared to perinuclear staining
in the control undifferentiated cells (Fig. 2a). Furthermore, we
found that mortalin was also localized into the nucleus of 0.5%
ASH-WEX treated cells. In contrast, RA treated group showed a
unipolar expression of mortalin. Mortalin staining intensity was
significantly higher in ASH-WEX treated cells (Fig. 2c) which was
also confirmed by Western blotting results and further mRNA
expression changes are supported by RT-PCR data (Fig. 2d,f).
ASH-WEX Modulated Cell Cycle, Apoptotic and Survival
Markers
To further look into the possible signalling pathways associated
with antiproliferative, antimigratory and differentiation inducing
potential of ASH-WEX, the expression of Cyclin D1, bcl-xl and
Akt-P were examined. Only 0.5% ASH-WEX treatment group
was further used for these studies as higher concentration of ASH-
WEX showed more promising results as compared to 0.2% ASH-
WEX group. 0.5% ASH-WEX treatment lead to significant
decrease in expression of Cyclin D1 as assessed by quantitative
analysis of intensity of immunocytofluorescence (Fig. 3a,b). The
expression was significantly low at both the translational as well as
transcriptional level as assessed by Western blotting and RT-PCR,
respectively (Fig. 3e,f) and more pronounced changes were
observed in ASH-WEX treated cells as compared to RA treated
group.
Anti-apoptotic marker bcl-xl was significantly decreased upon
0.5% ASH-WEX treatement as assessed by immunocytofluore-
cence and expression was significantly lower than the RA treated
group (Fig. 3a,c). Western blotting and RT-PCR results also
showed significant downregulation of bcl-xl expression upon ASH-
WEX treatment (Fig. 3e,f). Phosphorylation of Akt appeared to be
induced upon treatment with both ASH-WEX and RA. Further-
more, it was localized more into the neurite like projections of the
cells in the treated cells (Fig. 3a). The increase in Akt-P expression
Figure 2. HSP70 and Mortalin expression in response to ASH-WEX treatment in control, ASH-WEX (0.2% and 0.5%) and RA treated
IMR-32 cultures (a). The relative intensity measurement of immunofluorescence is shown as histogram for HSP70 (b) and Mortalin (c).
Representative Western blot hybridization signals for HSP70 (d) and Mortalin (e) from control and test samples and their relative intensity.
Representative RT-PCR results for HSP70 and Mortalin mRNA in control and treated cells and their relative densitometry analysis represented by
histograms. ‘‘*’’ represents the statistical significant (p,0.05) difference between control and ASH-WEX treated groups.
doi:10.1371/journal.pone.0055316.g002
Withania Induces Differentiation in IMR-32 Cells
PLOS ONE | www.plosone.org 5 January 2013 | Volume 8 | Issue 1 | e55316
was not statistically significant in the ASH-WEX group as shown
by Western blotting results (Fig. 3e). The mRNA expression of Akt
was also increased, although not significantly, in the ASH-WEX
treated group (Fig. 3f).
ASH-WEX Leads to G0/G1 Cell Cycle Arrest
Since it has been reported that cell cycle arrest at the G0/G1 or
G2/M boundaries, as well as cytokinetic block may be indicative
of senescence-like alterations and followed by cell death events, we
analyzed cell cycle distribution in IMR-32 cells in our experimen-
tal conditions. As regards the G2/M and S phases of the cycle,
there was a significant decrease in the median percentage of cells
with DNA content corresponding to these phases after treatment
with 0.5% ASH-WEX and RA, in comparison with the population
of control cells (Fig. 4a). There were only 26.26% cells in S phase
in ASH-WEX treated group as compared to 39.08% in control
and 32.45% in RA treated groups. Concurrently, a significant
increase in the median percentage of cells classified as G0/G1,
according to their DNA content, has been observed as a
consequence of exposure to 0.5% ASH-WEX and RA. ASH-
WEX treated group showed highest percentage of cells (64.64%)
in G0/G1 phase as compared to 47.47% in control and 59.38% in
RA treated groups (Fig. 4b).
To further verify these observations and to resolve the question
if the above-described fluctuations in the percentages of cells
between cell cycle phases were related to G0/G1 arrest and
consequently differentiation, or rather to an elevated rate of cell
death in G0/G1, Annexin V-FITC and PI staining was performed
(Fig. 4c). With 0.5% ASH-WEX treatment, the median values for
annexin V-positive/PI-negative (early apoptotic), annexin V-
positive/PI-positive (late apoptotic), annexin V-negative/PI-posi-
tive (necrotic) cells were 53.10, 10.93 and 0.01%, respectively
which were significantly higher than the control group, indicating
a shift toward late apoptosis. RA treatment group further showed
an increase in number of early apoptotic (61.60%) and late
apoptotic (16.75%) cells, as compared to the control (Fig. 4c,d).
ASH-WEX Induced Anti-migratory Properties in IMR-32
neuroblastoma Cells
Expression of plasticity markers such as neural cell adhesion
molecule and its polysialylated form (NCAM and PSA-NCAM)
was studied in IMR-32 cells to investigate their adhesion and
migratory characteristics with and without the treatment with
ASH-WEX. The protein and mRNA expression of NCAM was
significantly increased in cells treated with 0.5% ASH-WEX as
Figure 3. Immunofluorescence detection of Cyclin D1, bcl-xl and Akt-P is shown in control, 0.2% and 0.5% ASH-WEX, RA treated
IMR-32cells (a). Relative intensity measurement of immunofluorescence is shown as histograms for Cyclin D1 (b), bcl-xl (c) and Akt-P (d).
Representative Western blot hybridization signals for Cyclin D1, bcl-xl and Akt-P from control and test samples (0.5% ASH-WEX and RA treated cells)
(e). mRNA expression analysis for Cyclin D1, bcl-xl and Akt-P was done and densometery results for intensity analysis are represented as histogram (f).
‘‘*’’ represents the statistical significant (p,0.05) difference between control and ASH-WEX treated groups.
doi:10.1371/journal.pone.0055316.g003
Withania Induces Differentiation in IMR-32 Cells
PLOS ONE | www.plosone.org 6 January 2013 | Volume 8 | Issue 1 | e55316
detected by immunostaining, Western blotting and RT-PCR
(Fig. 5a,b,d) which was even higher than the RA treated group.
Polysialylation of NCAM was significantly reduced upon treat-
ment with ASH-WEX as the expression of PSA-NCAM was
minimal in 0.5% ASH-WEX treated group as depicted by
immunostaining and Western blotting. In the control group 80–
90% cells expressed PSA-NCAM which was downregulated after
ASH-WEX treatment. Only 5–10% cells seemed to be stained
positive for PSA-NCAM in 0.5% ASH-WEX (Fig. 5a). Expression
of polysialyltransferase (PST) was evaluated using RT-PCR in the
ASH-WEX and RA treated cells. There was significant decrease
in the expression of PST when treated with ASH-WEX as
compared to control group (Fig. 5c,d). To evaluate the motility of
IMR-32 cells, wound-healing assay was performed with and
without adding ASH-WEX and 10 mM RA in these groups. As
shown in Fig. 6a, untreated IMR-32 cells were able to invade the
scratched area that was fully re-colonized by 24 hr. 0.2% and
0.5% water extract treatment significantly reduced the migration
rate of the IMR-32 neuroblastoma cells. Very few cells were seen
in the scratched area in the 0.5% treatment group as compared to
10 mM RA treated group after 24 hrs of treatment. Quantitative
analysis also indicated a significant decrease (about 27 to 55%) of
the cell migration rate following ASH-WEX treatment which was
around 76% in RA treated group (Fig. 6b). Further gelatin
zymography was performed to assess the activity of MMP-2 and
MMP-9 matrix metalloproteinases to co-relate with the anti -
migratory properties of ASH-WEX. It was found that MMP-2 and
MMP-9 activities were reduced significantly in the 0.5% treated
group as compared to control and 10 mM RA group. The MMP-2
activity was apparently more decreased out of the two MMPs
analysed (Fig. 6c) and the change was statistically significant. In
contrast, RA treatment group showed slight induction of MMP2
activity. Expression of MMP-2 and MMP-9 was analysed at
mRNA level and 0.5% ASH-WEX treatment lead to significant
decrease in their expression as compared to control group (Fig. 6d).
Discussion
Differentiation therapy focuses on the development and use of
specific agents designed to selectively engage the process of
terminal differentiation, leading to the eventual elimination of
tumorigenic cells and rebalance of normal cellular homeostasis. In
the present study, the differentiation inducing potential of
Ashwagandha was evaluated for its activity against neuroblastoma
Figure 4. ASH-WEX affects the distribution of events in the IMR-32 cell cycle. IMR-32 cells were treated with 0.5% ASH-WEX and RA for 72 h
(a). The evaluation of cell cycle progression was done by DNA staining by propidium iodide. The figure shows representative FACS profiles of the
distribution of cells in G0/G1, S, and G2/M phases as analysed by FCS software. (b) Histogram represents percentage distribution of the cells in
different phases (G0/G1, S, and G2/M) after ASH-WEX treatment as compared to control. (c) Flow cytometric examination of apoptosis, necrosis and
cell viability-the Annexin V/PI assay. Diagrams show four subgroups of cells. Viable (Q1, annexin V-, PI-), early apoptotic (Q2, annexin V+, PI-), late
apoptotic (Q3, annexin V+,PI+) and necrotic/damaged (Q4, annexin V-, PI+) are represented in different quadrants. (d) Histogram represents
percentage distribution of the cells in different quadrants. ‘‘*’’ represents the statistical significant (p,0.05) difference between control and ASH-WEX
treated groups.
doi:10.1371/journal.pone.0055316.g004
Withania Induces Differentiation in IMR-32 Cells
PLOS ONE | www.plosone.org 7 January 2013 | Volume 8 | Issue 1 | e55316
cell lines. RA is a potent regulator of neuroblastoma cell
differentiation [30] and used in number of cancer differentiation
based therapeutics. RA and its derivatives activate retinoic acid
receptors and retinoid X receptor (RAR-RXR) complexes and
induce neural differentiation of NSCs [31]. We took 10 mMRAas
a positive control for differentiation, to compare the potential of
ASH-WEX with conventional differentiation inducing agent RA.
ASH-WEX was able to inhibit the cell proliferation in a dose
dependent manner in the IMR-32, TGW, SH-SY5Y and Neuro-
2a neuroblastoma cell lines. Further it was observed to induce
differentiated morphology in these cell lines at 0.5% ASH-WEX
dose with neurite like projections. These observations were further
confirmed by NF200 expression which showed significant increase
in ASH-WEX treated cells which was more pronounced as
compared to RA-treated group. NF200 and its phosphorylated is a
marker of differentiation of neuronal cells [16]. In an earlier study,
the constituents of alcoholic extract of Ashwagandha have been
shown to elevate level of NF200 in neuroblastoma cells along with
neurite outgrowth [32,33]. Consistent with these reports the
increase in expression of NF200 in the present study could be
attributed to differentiation inducing activity of ASH-WEX in the
neuroblastoma cells.
The differentiation state is accompanied by the formation of
dendrites and axonal processes and requires an increase in protein
transport. In the present study, HSP70 level was found to be
elevated when treated with ASH-WEX which was maximum in
the RA treated group. HSP70 is an essential ATP-dependent
uncoating enzyme and its induction is important in the neuronal
differentiation and neurite extension [34,35]. Another natural
molecule, Celastrol has been shown to induce HSP70 both in
undifferentiated neuroblastoma cells [36]. Thus the increase in
HSP70 expression after ASH-WEX and RA treatment may
support their differentiation inducing activity the IMR-32 cells.
The expression of mortalin in the ASH-WEX treated cells
shifted from juxtanuclear to pancytoplasmic pattern. Furthermore,
the expression of mortalin was significantly upregulated upon
0.5% ASH-WEX treatment. Earlier studies have demonstrated
that immortal cells display a perinuclear distributon of mortalin,
whereas, the normal mortal cells exhibit a pancytoplasmic
expression [37]. Also, mortalin carries the function of control of
cell proliferation and differentiation [21,38]. Its role in neuroblas-
toma cell differentiation has been established in another recent
study as a favorable prognostic indicator of neuroblastoma
differentiation [39]. Thus the pancytoplasmic distribution and
enhanced expression of mortalin further suggests that ASH-WEX
treatment may be inducing cellular senescence and also confirms
the differentiation status of the IMR-32 cells in treated cells. These
results are also supported by our earlier findings of Ashwagandha
Figure 5. NCAM and PSA-NCAM expression in response to ASH-WEX treatment in control, ASH-WEX (0.2% and 0.5%) and RA
treated IMR-32 cultures (a). Representative Western blot hybridization signals for NCAM (b) and PSA-NCAM (c). Representative RT-PCR results for
NCAM and PST mRNA in control and treated cells and their relative densitometry analysis represented by histograms. ‘‘*’’ represents the statistical
significant (p,0.05) difference between control and ASH-WEX treated groups.
doi:10.1371/journal.pone.0055316.g005
Withania Induces Differentiation in IMR-32 Cells
PLOS ONE | www.plosone.org 8 January 2013 | Volume 8 | Issue 1 | e55316
induced mortalin expression in glioma cells [29,40]. Furthermore
0.5% ASH-WEX treated cells showed nuclear localization of
mortalin which was apparently more than the RA treated group.
Recent study has shown the association of mortalin with RARa
and RXRa is remarkably increased in the nucleus and coincides
with the RA-elicited growth arrest, concomitant with a tight
correlation between RA-induced nuclear translocation of mortalin
and RA triggered neuronal differentiation [21].
ASH-WEX treatment of IMR-32 cells resulted in downregula-
tion of cyclin D1 expression at transcriptional as well as
translational level. Genetic aberrations and over-expression of
the Cyclin D1 gene have been reported for several human
neoplasms and neuroblastomas [41,42] and elevated expression of
cyclin D1 is associated with high degree of malignancy and rapid
cell proliferation [43]. Moreover, Cyclin D1 overexpression has
been reported to prevent differentiation in neuroblastoma [44].
On the contrary, downregualtion/silencing of Cyclin D1 mRNA
leads to neuronal outgrowth and differentiation [42]. Recently
some studies have functionally linked neuronal differentiation to
cell cycle regulation which frequently involves the G1 cell cycle
entry point [28,45,46,47]. The current study further investigated
the phase population in the cell cycle after treatment with ASH-
WEX. Analysis of neuroblastoma cells after ASH-WEX treatment
revealed a strong differentiated phenotype. FACS analysis of these
cells showed an increase of the G0/G1 fraction at 72 hours after
treatment which was even better than RA treated cells under
similar conditions. In concordance with the arrest of the cell cycle
in G1 phase, ASH-WEX treatment resulted in a reduction in
cyclin D1 protein levels, thus suggesting that neuroblasts
differentiate towards a neuronal phenotype after inhibition of
the G1 checkpoint. Apart from cell cycle regulation these G1 entry
checkpoint regulators have been linked to other signal transduc-
Figure 6. Representative phase contrast images of control, 0.2% or 0,5% ASH-WEX and RA treated cells, in which motility was
analyzed by Wound-scratch test (a). Images show the starting (0 h after scratch) and the end (24 h after scratch) point of the analysis. (b) Graph
shows that the rate of IMR-32 migration in response to ASH-WEX treatment in comparison to untreated cells. Data are obtained from a set of scratch
test analysis (N = 3) and are expressed as means 6standard error. Representative MMP zymogram from control and treated samples and their
densometery analysis is represented as histogram (c). mRNA expression for MMP2 and MMP9 was analyzed by RT-PCR. Relative percentage
expression was expressed as histogram (d). ‘‘*’’ represents the statistical significant (p,0.05) difference between control and ASH-WEX treated
groups.
doi:10.1371/journal.pone.0055316.g006
Withania Induces Differentiation in IMR-32 Cells
PLOS ONE | www.plosone.org 9 January 2013 | Volume 8 | Issue 1 | e55316
tion routes. The involvement of Cyclin D1 in neuronal differen-
tiation processes has been suggested by earlier studies [46,48].
This is in line with the findings that growth signaling pathways
determine differentiation patterns in non-malignant neuroblasts
and influence the differentiation state of neuroblastoma [42].
These signal transduction routes most frequently involve the
transcriptional regulation of Cyclin D1 and thus the effect on
neuronal differentiation by these signal transduction routes could
partly function through Cyclin D1 regulation [49]. Inhibition of
the G1 regulating genes CDK4 or Cyclin D1 in neuroblastoma
cell lines lead to the restoration of the G1 checkpoint and
subsequent neuronal differentiation [50]. In our previous study we
have established that Ashwagandha alcoholic extract causes cell
cycle arrest at G2/M [40]. The difference could be due to different
nature of extracts used and thereby different bioactive molecules
and their mode of action. As cell cycle arrest is a prerequisite of
differentiation, it is reasonable to relate the role of ASH-WEX in
regulating cell cycle leading to G0/G1 cell cycle arrest with
downregulation of cyclin D1 and consequent differentiation of the
IMR-32 cells. Annexin V-FITC/PI staining study further supports
this observation as there is increase in early apoptotic cell
population which may be due to differentiation inducing ability
of ASH-WEX thus ultimately leading to normal cell apoptotic
pathway.
Most of the neuroblastoma cells, including IMR-32, are
resistant to apoptosis and differentiation. Bcl-xl is widely expressed
in neuroblastoma cells and inhibits chemotherapy-induced apop-
tosis [51]. Anti-apoptotic functions of bcl-xl are well known.
Recent reports on curcumin, andrographolide, cranberry
proanthocyanidines have established bcl-xl mediated pro-apoptot-
ic properties of natural compounds [52,53]. Therefore we
evaluated whether ASH-WEX could influence bcl-xl expression
in the IMR-32 cells. ASH-WEX lead to downregulation of bcl-xl
both at transcriptional and translational level, which further
supports pro-apoptotic potential of ashwagandha extracts in the
cancerous cells [54]. Akt is another important cell signalling
molecule involved in cell proliferation and survival. Akt-P
expression was upregulated in the IMR-32 cells upon treatment
with ASH-WEX. It is known that Akt is at a pivotal nodal point in
the signaling pathway of almost all RTKs and is activated by the
phosphoinositol-3-kinase. It has been reported earlier that in
Neuro2a neuroblastoma cells, Akt showed increased phosphory-
lation after serum withdrawal leading to differentiation [55]. Also
estrogen and mevastatin has been known to induce Akt mediated
neurite outgrowth leading to differentiatiaon in neuroblastoma
cells [56,57]. In keeping with this proposal, Perez-Tenorio and co-
workers showed P-Akt to strongly associate with a lower S-phase
fraction [58]. In addition to its vital function in cell survival, a role
for PI3K/Akt signalling has also been implicated in neuronal
differentiation, and several aspects of neurite outgrowth, including
elongation, calibre and branching, are regulated by activated Akt
[59]. These findings suggest that IMR-32 neuroblastoma cells after
treatment with ASH-WEX with relatively high P-Akt levels may
remain well-differentiated and exhibit a slower growth rate. P-Akt
post translational change is the activated form of Akt and changes
in expression of P-Akt at protein level and Akt at mRNA level
could be due to post-translational modifications for signalling
mechanisms. We propose that the increase in Akt-P expression on
treatment with ASH-WEX is an indicator of induction of cell
differentiation in the IMR-32 cells.
NCAM, is required for neurite outgrowth in culture and in
axonal guidance and setting up of the neuronal network in vivo
[60,61]. NCAM is a developmentally regulated protein and is
implicated in a variety of cellular processes, such as cell-cell
adhesion, cell migration, neurite outgrowth, and synaptic plastic-
ity. The present data shows highly up-regulated expression of
NCAM upon 0.5% ASH-WEX treatment. Interestingly, low
NCAM expression has been shown to relate with clinically
aggressive cancers and vice-versa [62]. In the present study,
NCAM was highly expressed in ASH-WEX treated group and
also appeared to be translocated into the growing neurites that
develops upon differentiation, thus suggesting their participation in
neurite outgrowth and adhesion. These results are in line with our
previous study in which ASH-WEX has been shown to induce
NCAM expression in glioma cells [29]. NCAM undergoes post-
translational modification including the addition of PSA chains on
its extracellular domain [63]. Expression of PSA is associated with
cellular migration, axon induction and also contacts with their
target [64]. PSA expression in most cancer cells is correlated with
tumor metastasis and associated with tumor differentiation as well
as serves as an onco-developmental antigen [65,66]. In the present
study, ASH-WEX significantly reduced the surface expression of
PSA-NCAM and these findings are also supported by Western
blotting results. ASH-WEX treatment seems to downregulate
polysialylation through inhibition of PST enzyme as suggested by
RT-PCR results of PST expression.
The decrease in surface expression of PSA-NCAM may be
attributed to differentiated phenotype of IMR-32 cells. Neuro-
blastoma proliferation has been shown to be facilitated by
polysialylation of NCAM and surface expression of PSA is
regulated at the level of polysialyltransferase transcription [67].
PSA expression in cancerous cells appears to facilitate mitosis and
metastasis [68]. Bertozzi’s group showed that feeding cells with N-
butylmannosamine can inhibit polysialyltransferase activity and
suggested that glycosylation efficiency may decrease substantially
when the structure of a precursor carbohydrate residue is modified
[69,70]. Regulation of polysialyltransferase expression was sug-
gested to occur at the transcription-initiation level [71,72].
Nakagawa et al. [73] demonstrated that the cAMP-CREB
pathway regulates polysialyltransferase expression in cell culture.
In addition, Bruses and Rutishauser [74] have proposed a
calcium-dependent regulatory mechanism for enzyme activity. It
has also been reported that polysialyltransferase phosphorylation
may be involved in regulation of PSA expression [66]. Thus
present findings compare well with previous results on other PSA-
expressing tumors [65], in which polysialyltransferase mRNA and
PSA expression correlates with tumor progression.
To further assess the anti-migratory potential role of ASH-
WEX in neuroblastoma, MMPs expression was studied by gel
zymography. MMPs play an important role in tumor invasion and
metastasis [75,76]. MMP-2 and MMP-9 appear to be differentially
expressed during development of the rat CNS [77]. It has been
known that increase in the expression, secretion in the media, and
activation of MMP-2 and 9, leads to a more tumorigenic
phenotype due to increased MMP-2 mediated invasion [78,79].
It is also well known that metastatic aggressiveness of the tumor is
inversely related to its differentiation status. Earlier studies have
established that overexpression of cyclin D1 leads to an increase in
invasive properties of cells and cyclin-D1 expression was associated
with the increased gelatinolytic activity of proMMP-2 and MMP-2
[80]. ASH-WEX treatment was observed to downregulate Cyclin
D1 expression as well as activity/expression of MMP2 and 9 thus
indicating its anti-invasive/migratory properties.
Previous studies have established that the active components of
ASH-WEX are neither heat labile, nor proteinaecious and nucleic
acid in nature [29] which needs to be further investigated. In the
present study, ASH-WEX induced upregulation of NF200, HSP70
and mortalin expression may be correlated with the induction of
Withania Induces Differentiation in IMR-32 Cells
PLOS ONE | www.plosone.org 10 January 2013 | Volume 8 | Issue 1 | e55316
differentiation in these neuroblastoma cells which was even better
than the RA treatment groups. The upregulation of NCAM and
downregulation of PSA-NCAM and MMPs may explain the anti-
migratory and differentiation inducing properties of ASH-WEX.
The decrease in Cyclin D1 and bcl-xl expression and enhanced
expression of Akt-P may be resulting in arrest of IMR-32 cell
proliferation and their differentiation into mature neuron-like cells.
FACS analysis demonstrated that ASH-WEX caused an arrest of
the cell cycle in the G0/G1 phase with a decrease of cell
population in synthesis and mitosis phases in IMR-32 cells. Since
most of the antineoplastic drugs in clinical use block the cell cycle
in the S or G2/M phases, whereas, ASH-WEX blocks the cell
cycle in the G1 phase, a combination of ASH-WEX with currently
used drugs might possibly improve therapies of neuroblastoma.
Overall ASH-WEX treatment shows decreased neuroblastoma cell
proliferation, cell migration in addition to induction of senescence
and cell cycle arrest leading to differentiated phenotype. ASH-
WEX appears to affect multiple pathways for its anti-cancer and
differentiation inducing role in IMR-32 neuroblastoma cells
instead of targeting a single protein or pathway which needs to
be further studied. The current study supports the idea that ASH-
WEX may have the potential to reduce the malignancy of
neuroblastomas. Low dose efficacy of ASH-WEX with its
differentiation inducing potential may suggest that it could be a
potential candidate for adjunct therapy of neuroblastomas and
glioblastomas.
Supporting Information
Figure S1 To ascertain the effect (if any) of the vehicle, DMSO
in the RA treated group, DMSO (1 ml/ml) treated cells were
studied along with the control (untreated) IMR-32 cells for 72 hrs.
DMSO was not found to affect the cell morphology (as indicated
by phase contrast photographs) and expression of NF200 and
HSP70 in these cultures when compared with untreated control
cells. DAPI stain was used as counterstain to visualize the nucleus.
(TIF)
Author Contributions
Conceived and designed the experiments: HK GK RW SK. Performed the
experiments: HK. Analyzed the data: HK GK RW SK. Contributed
reagents/materials/analysis tools: GK. Wrote the paper: HK GK RW SK.
References
1. Spix C, Pastore G, Sankil a R, Stiller CA, Steliarova-Foucher E (2006)
Neuroblastoma incidence and survival in European children (1978–1997):
report from the Automated Childhood Cancer Information System project.
Eur J Cancer 42: 2081–2091.
2. Matthay KK, Yanik G, Messina J, Quach A, Huberty J, et al. (2007) Phase II
study on the effect of disease sites, age, and prior therapy on response to iodine-
131-metaiodobenzylguanidine therapy in refractory neuroblastoma. J Clin
Oncol 25: 1054–1060.
3. Armstrong JL, Ruiz M, Boddy AV, Redfern CP, Pearson AD, et al. (2005)
Increasing the intracellular availability of all-trans retinoic acid in neuroblastoma
cells. Br J Cancer 92: 696–704.
4. Armstrong JL, Taylor GA, Thomas HD, Boddy AV, Redfern CP, et al. (2007)
Molecular targeting of retinoic acid metabolism in neuroblastoma: the role of the
CYP26 inhibitor R116010 in vitro and in vivo. Br J Cancer 96: 1675–1683.
5. Njar VC, Gediya L, Purushottamachar P, Chopra P, Belosay A, et al. (2006)
Retinoids in clinical use. Med Chem 2: 431–438.
6. Gupta GL, Rana AC (2007) Protective effect of Withania somnifera dunal root
extract against protracted social isolation induced behavior in rats.
Indian J Physiol Pharmacol 51: 345–353.
7. Matsuda H, Murakami T, Kishi A, Yoshikawa M (2001) Structures of
withanosides I, II, III, IV, V, VI, and VII, new withanolide glycosides, from
the roots of Indian Withania somnifera DUNAL. and inhibitory activity for
tachyphylaxis to clonidine in isolated guinea-pig ileum. Bioorg Med Chem 9:
1499–1507.
8. Misra L, Mishra P, Pandey A, Sangwan RS, Sangwan NS, et al. (2008)
Withanolides from Withania somnifera roots. Phytochemistry 69: 1000–1004.
9. Misra L, Mishra P, Pandey A, Sangwan RS, Sangwan NS (2012) 1,4-Dioxane
and ergosterol derivatives from Withania somnifera roots. J Asian Nat Prod Res
14: 39–45.
10. Malik F, Kumar A, Bh ushan S, Khan S, Bhatia A, et al. (2007) Reactive oxygen
species generation and mitochondrial dysfunction in the apoptotic cell death of
human myeloid leukemia HL-60 cells by a dietary compound withaferin A with
concomitant protection by N-acetyl cysteine. Apoptosis 12: 2115–2133.
11. Mulabagal V, Subbaraju GV, Rao CV, Sivaramakrishna C, Dewitt DL, et al.
(2009) Withanolide sulfoxide from Aswagandha roots inhibits nuclear transcrip-
tion factor-kappa-B, cyclooxygenase and tumor cell proliferation. Phytother Res
23: 987–992.
12. Jayaprakasam B, Padmanabhan K, Nair MG (2010) Withanamides in Withania
somnifera fruit protect PC-12 cells from beta-amyloid responsible for
Alzheimer’s disease. Phytother Res 24: 859–863.
13. Kumar S, Seal CJ, Howes MJ, Kite GC, Okello EJ (2010) In vitro protective
effects of Withania somnifera (L.) dunal root extract against hydrogen peroxide
and beta-amyloid (1–42)-induce d cytotoxicity in di fferentiated PC 12 cells.
Phytother Res 24: 1567–1574.
14. Kataria H, Wadhwa R, Kaul SC, Kaur G (2012) Water Extract from the Leaves
of Withania somnifera Protect RA Differentiated C6 and IMR-32 Cells against
Glutamate-Induced Excitotoxicity. PLoS One 7(5): e37080. doi:10.1371/
journal.pone.0037080.
15. Katayama M, Mizuta I, Sakoyama Y, Kohyama-Koganeya A, Akagawa K, et
al. (1997) Differential expression of neuroD in primary cultures of cerebral
cortical neurons. Exp Cell Res 236: 412–417.
16. Elder GA, Friedrich VL Jr, Kang C, Bosco P, Gourov A, et al. (1998)
Requirement of heavy neurofilament subunit in the development of axons with
large calibers. J Cell Biol 143: 195–205.
17. Heikkila JJ (1993) Heat shock gene expression and development. II. An overview
of mammalian and avian developmental systems. Dev Genet 14: 87–91.
18. Loones MT, Chang Y, Morange M (2000) The distributio n of heat shock
proteins in the nervous system of the unstressed mouse embryo suggests a role in
neuronal and non-neuronal differentiation. Cell Stress Chaperones 5: 291–305.
19. Chiasserini D, Tozzi A, de Iure A, Tantucci M, Susta F, et al. (2011) Mortalin
Inhibition in Experimental Parkinson’s Disease. Movement Disorders 26: 1639–
1647.
20. Qu MY, Zhou Z, Xu SC, Chen CH, Yu ZP, et al. (2011) Mortalin
overexpression attenuates beta-amyloid-induced neurotoxicity in SH-SY5Y
cells. Brain Research 1368: 336–345.
21. Shih YY, Lee H, Nakagawara A, Juan HF, Jeng YM, et al. (2011) Nuclear
GRP75 binds retinoic acid receptors to promote neuronal differentiation of
neuroblastoma. PLoS One 6: e26236.
22. Perl AK, Dahl U, Wilgenbus P, Cremer H, Semb H, et al. (1999) Reduced
expression of neural cell adhesion molecule induces metastatic dissemination of
pancreatic beta tumor cells. Nat Med 5: 286–291.
23. Cavallaro U, Niedermeyer J, Fuxa M, Christofori G (2001) N-CAM modulates
tumour-cell adhesion to matrix by inducing FGF-receptor signalling. Nat Cell
Biol 3: 650–657.
24. Muhlenhoff M, Eckhardt M, Gerardy-Schahn R (1998) Polysialic acid: three-
dimensional structure, biosynthesis and function. Curr Opin Struct Biol 8: 558–
564.
25. Rutishauser U, Landmesser L (1996) Polysialic acid in the vertebrate nervous
system: a promoter of plasticity in cell-cell interactions. Trends Neurosci 19:
422–427.
26. Yang L, Dan HC, Sun M, Liu Q, Sun XM, et al. (2004) Akt/protein kinase B
signaling inhibitor-2, a selective small molecule inhibitor of Akt signaling with
antitumor activity in cancer cells overexpressing Akt. Cancer Res 64: 4394–
4399.
27. Shim JW, Koh HC, Chang MY, Roh E, Choi CY, et al. (2004) Enhanced
in vitro midbrain dopamine neuron differentiation, dopaminergic function,
neurite outgrowth, and 1-methyl-4-phenylpyridium resistance in mouse
embryonic stem cells overexpressing Bcl-XL. J Neurosci 24: 843–852.
28. Georgopoulou N, Hurel C, Politis PK, Gaitanou M, Matsas R, et al. (2006)
BM88 is a dual function molecule inducing cell cycle exit and neuronal
differentiation of neuroblastoma cells via cyclin D1 down-regulation and
retinoblastoma protein hypophosphorylation. J Biol Chem 281: 33606–33620.
29. Kataria H, Shah N, Kaul SC, Wadhwa R, Kaur G (2011) Water Extract of
Ashwagandha Leaves Limits Proliferation and Migration, and Induces
Differentiation in Glioma Cells. Evid Based Complement Alternat Med 2011,
Article ID 267614. doi:10.1093/ecam/nep188.
30. Sidell N, Altman A, Haussler MR, Seeger RC (1983) Effects of retinoic acid (RA)
on the growth and phenotypic expression of several human neuroblastoma cell
lines. Exp Cell Res 148: 21–30.
31. Guan K, Chang H, Rolletschek A, Wobus AM (2001) Embryonic stem cell-
derived neurogenesis. Retinoic acid induction and lineage selection of neuronal
cells. Cell Tissue Res 305: 171–176.
32. Kuboyama T, Tohda C, Komatsu K (2005) Neuritic regeneration and synaptic
reconstruction induced by withanolide A. Br J Pharmacol 144: 961–971.
Withania Induces Differentiation in IMR-32 Cells
PLOS ONE | www.plosone.org 11 January 2013 | Volume 8 | Issue 1 | e55316
33. Kuboyama T, Tohda C, Zhao J, Nakamura N, Hattori M, et al. (2002) Axon- or
dendrite-predominant outgrowth induced by constituents from Ashwagandha.
Neuroreport 13: 1715–1720.
34. Black MM, Chestnut MH, Pleasure IT, Keen JH (1991) Stable clathrin:
uncoating protein (hsc70) complexes in intact neur ons and their axonal
transport. J Neurosci 11: 1163–1172.
35. Yang J, Oza J, Bridges K, Chen KY, Liu AY (2008) Neural differentiation and
the attenuated heat shock response. Brain Res 1203: 39–50.
36. Westerheide SD, Bosman JD, Mbadugha BN, Kawahara TL, Matsumoto G, et
al. (2004) Celastrols as inducers of the heat shock response and cytoprotection.
J Biol Chem 279: 56053–56060.
37. Wadhwa R, Mitsui Y, Ide T, Kaul S (1995) The antiproliferative aspects of
mortalin (review). Int J Oncol 7: 69–74.
38. Wadhwa R, Taira K, Kaul SC (2002) An Hsp70 family chaperone, mortalin/
mthsp70/PBP74/Grp75: what, when, and where? Cell Stress Chaperone s 7:
309–316.
39. Hsu WM, Lee H, Juan HF, Shih YY, Wang BJ, et al. (2008) Identification of
GRP75 as an independent favorable prognostic marker of neuroblastoma by a
proteomics analysis. Clin Cancer Res 14: 6237–6245.
40. Shah N, Kataria H, Kaul SC, Ishii T, Kaur G, et al. (2009) Effect of the
alcoholic extract of Ashwagandha leaves and its components on proliferation,
migration, and differentiation of glioblastoma cells: combinational approach for
enhanced differentiation. Cancer Sci 100: 1740–1747.
41. Donnellan R, Chetty R (1998) Cyclin D1 and human neoplasia. Mol Pathol 51:
1–7.
42. Molenaar JJ, Ebus ME, Koster J, Santo E, Geerts D, et al. (2010) Cyclin D1 is a
direct transcriptional target of GATA3 in neuroblastoma tumor cells. Oncogene
29: 2739–2745.
43. Sallinen SL, Sallinen PK, Kononen JT, Syrjakoski KM, Nupponen NN, et al.
(1999) Cyclin D1 expression in astrocytomas is associated with cell proliferation
activity and patient prognosis. J Pathol 188: 289–293.
44. Molenaar JJ, Ebus ME, Geerts D, Koster J, Lamers F, et al. (2009) Inactivation
of CDK2 is synthetically lethal to MYCN over-expressing cancer cells. Proc Natl
Acad Sci U S A 106: 12968–12973.
45. Cesi V, Tanno B, Vitali R, Mancini C, Giuffrida ML, et al. (2002) Cyclin D1-
dependent regulation of B-myb activity in early stages of neuroblastoma
differentiation. Cell Death Differ 9: 1232–1239.
46. McClellan KA, Slack RS (2006) Novel functions for cell cycle genes in nervous
system development. Cell Cycle 5: 1506–1513.
47. Sumrejkanchanakij P, Eto K, Ikeda MA (2006) Cytoplasmic sequ estration of
cyclin D1 associated with cell cycle withdrawal of neuroblastoma cells. Biochem
Biophys Res Commun 340: 302–308.
48. Sumrejkanchanakij P, Tamamor i-Adachi M, Matsunaga Y, Eto K, Ikeda MA
(2003) Role of cyclin D1 cytoplasmic sequestration in the survival of postmitotic
neurons. Oncogene 22: 8723–8730.
49. Pestell RG, Albanese C, Reuten s AT, Segall JE, Lee RJ, et al. (1999) The cyclins
and cyclin-dependent kinase inhibitors in hormonal regulation of proliferation
and differentiation. Endocr Rev 20: 501–534.
50. Molenaar JJ, Ebus ME, Koster J, van Sluis P, van Noesel CJ, et al. (2008) Cyclin
D1 and CDK4 activity contribute to the undifferentiated ph enotype in
neuroblastoma. Cancer Res 68: 2599–2609.
51. Dole MG, Jasty R, Cooper MJ, Thompson CB, Nunez G, et al. (1995) Bcl-xL is
expressed in neuroblastoma cells and modulates chemotherapy-induced
apoptosis. Cancer Res 55: 2576–2582.
52. Sukumari-Ramesh S, Bentle y JN, Laird MD, Singh N, Vender JR, et al. (2011)
Dietary phytochemicals induce p53- and caspase-independent cell death in
human neuroblastoma cells. Int J Dev Neurosci 29: 701–710.
53. Singh AP, Lange TS, Kim KK, Brard L, Horan T, et al. (2012) Purified
cranberry proanthocyanidines (PAC-1A) cause pro-apoptotic signaling, ROS
generation, cyclophosphamide retention and cytotoxicity in high-risk neuro-
blastoma cells. Int J Oncol 40: 99–108.
54. Widodo N, Takagi Y, Shrestha BG, Ishii T, Kaul SC, et al. (2008) Selective
killing of cancer cells by leaf extract of Ashwagandha: components, activity and
pathway analyses. Cancer Lett 262: 37–47.
55. Evangelopoulos ME, Weis J, Kruttgen A (2005) Signalling pathways leading to
neuroblastoma differentiation after serum withdrawal: HDL blocks neuroblas-
toma differentiation by inhibition of EGFR. Oncogene 24: 3309–3318.
56. Evangelopoulos ME, Weis J, Kruttgen A (2009) Mevastatin-induced neurite
outgrowth of neuroblastoma cells via activation of EGFR. J Neurosci Res 87:
2138–2144.
57. Takahashi K, Piao S, Yamatani H, Du B, Yin L, et al. (2011) Estrogen induces
neurite outgrowth via Rho family GTPases in neuroblastoma cells. Mol Cell
Neurosci 48: 217–224.
58. Perez-Tenorio G, Stal O (2002) Activation of AKT/PKB in breast cancer
predicts a worse outcome among endocrine treated patients. Br J Cancer 86:
540–545.
59. Huang EJ, Reichardt LF (2003) Trk receptors: roles in neuronal signal
transduction. Annu Rev Biochem 72: 609–642.
60. Reichardt LF, Bixby JL, Hall DE, Ignatius MJ, Neugebauer KM, et al. (1989)
Integrins and cell adhesion molecules: neuronal receptors that regulate axon
growth on extracellular matrices and cell surfaces. Dev Neurosci 11: 332–347.
61. Martini R, Xin Y, Schachner M (1994) Restricted localization of L1 and N-
CAM at sites of contact between Schwann cells and neurites in culture. Glia 10:
70–74.
62. Huerta S, Srivatsan ES, Venkatesan N, Peters J, Moatamed F, et al. (2001)
Alternative mRNA splicing in colon cancer causes loss of expression of neural
cell adhesion molecule. Surgery 130: 834–843.
63. Horstkorte R, Muhlenhoff M, Reutter W, Nohring S, Zimmermann-Kordmann
M, et al. (2004) Selective inhibition of polysialyltransferase ST8SiaII by
unnatural sialic acids. Exp Cell Res 298: 268–274.
64. Kiss JZ, Rougon G (1997) Cell biology of polysialic acid. Curr Opin Neurobiol
7: 640–646.
65. Tanaka F, Otake Y, Nakagawa T, Kawano Y, Miyahara R, et al. (2000)
Expression of polysialic acid and STX, a human polysialyltransferase, is
correlated with tumor progression in non-small cell lung cancer. Cancer Res 60:
3072–3080.
66. Gallagher HC, Odumeru OA, Regan CM (2000) Regulation of neural cell
adhesion molecule polysialylation state by cell-cell contact and protein kinase C
delta. J Neurosci Res 61: 636–645.
67. Hildebrandt H, Becker C, Gluer S, Rosner H, Gerardy-Schahn R, et al. (1998)
Polysialic acid on the neural cell adhesion molecule correlates with expression of
polysialyltransferases and promotes neuroblastoma cell growth. Cancer Res 58:
779–784.
68. Fukuda M (1996) Possible roles of tumor-associated carbohydrate antigens.
Cancer Res 56: 2237–2244.
69. Mahal LK, Charter NW, Angata K, Fukuda M, Koshland DE Jr, et al. (2001) A
small-molecule modulator of poly-alpha 2,8-sialic acid expression on cultured
neurons and tumor cells. Science 294: 380–381.
70. Miyazaki T, Angata K, Seeberger PH, Hindsgaul O, Fukuda M (2008) CMP
substitutions preferentially inhibit polysialic acid synthesis. Glycobiology 18:
187–194.
71. Yoshida Y, Kurosawa N, Kanematsu T, Kojima N, Tsuji S (1996) Genomic
structure and promoter activity of the mouse polysialic acid synthase gene
(mST8Sia II). Brain-specific expression from a TATA-less GC-rich sequence.
J Biol Chem 271: 30167–30173.
72. Takashima S, Yoshida Y, Kanematsu T, Kojima N, Tsuji S (1998) Genomic
structure and promoter activity of the mouse polysialic acid synthase (mST8Sia
IV/PST) gene. J Biol Chem 273: 7675–7683.
73. Nakagawa S, Kim JE, Lee R, Chen J, Fujioka T, et al. (2002) Localization of
phosphorylated cAMP response element-binding protein in immature neurons
of adult hippocampus. J Neurosci 22: 9868–9876.
74. Bruses JL, Rutishauser U (1998) Regulation of neural cell adhesion molecule
polysialylation: evidence for nontranscriptional control and sensitivity to an
intracellular pool of calcium. J Cell Biol 140: 1177–1186.
75. Ray SD, Fariss MW (1994) Role of cellular energy status in tocopheryl
hemisuccinate cytoprotection against ethyl methanesulfonate-induced toxicity.
Arch Biochem Biophys 311: 180–190.
76. Chambers AF, Matrisian LM (1997) Changing views of the role of matrix
metalloproteinases in metastasis. J Natl Cancer Inst 89: 1260–1270.
77. Deb S, Gottschall PE (1996) Increased production of matrix metalloproteinases
in enriched astrocyte and mixed hippocampal cultures treated with beta-amyloid
peptides. J Neurochem 66: 1641–1647.
78. Noujaim D, van Golen CM, van Golen KL, Grauman A, Feldman EL (2002) N-
Myc and Bcl-2 coexpression induces MMP-2 secretion and activation in human
neuroblastoma cells. Oncogene 21: 4549–4557.
79. Deryugina EI, Quigley JP (2006) Matrix metalloproteinases and tumor
metastasis. Cancer Metastasis Rev 25: 9–34.
80. Arato-Ohshima T, Sawa H (1999) Over-expression of cyclin D1 induces glioma
invasion by increasing matrix metalloproteinase activity and cell motility.
Int J Cancer 83: 387–392.
Withania Induces Differentiation in IMR-32 Cells
PLOS ONE | www.plosone.org 12 January 2013 | Volume 8 | Issue 1 | e55316

Supplementary resource (1)

... The alcoholic root extract of WS showed antiproliferative effect through modulation of cell division pathway in prostate cancer cells (Aalinkeel et al., 2010) whereas alcoholic fruit extract of WS showed alteration of chromatin structure in liver cancer cells (Abutaha, 2015). The methanolic extract of WS and its principal phytoconstituents found to arrest cell cycle at G2/M phase (Okamoto et al., 2016) (Das et al., 2014) (Setty Balakrishnan et al., 2017 (Roy et al., 2013) (Alfaifi et al., 2016) (Tang et al., 2019) and reducing the expression of checkpoint proteins of cell cycle (Stan et al., 2008a,b) (Lv and Wang, 2015) (Kim et al., 2017) (Kataria et al., 2013) (McKenna et al., 2015 in panel of cancer cells. Cyclin B1 is a crucial regulatory subunit of Cdk1 for mitotic promotion of cells and has emerged as a target to attenuate cell proliferation (Androic et al., 2008). ...
... Posttranslational modification of NCAM by addition of polysialic acid is associated with the metastatic capability of neuroblastoma cells (Elkashef et al., 2016). The water (Kataria et al., 2013) and alcoholic (Shah et al., 2009) leaf extracts of WS tested at molecular level in neuroblastoma cells induced the expression of NCAM with concurrent reduction in its polysialylation which was further validated in vivo by the same research group (Kataria et al., 2016). As cited before in the previous section, triethylene glycol derivatives from WS also showed anti-metastatic effect by suppressing protein expression of vimentin and MMPs (Oh et al., 2018). ...
Article
Ethnopharmacological relevance Withania somnifera (L.) Dunal (WS) is one of the most-studied Rasayana botanicals used in Ayurveda practice for its immunomodulatory, anti-aging, adaptogenic, and rejuvenating effects. The botanical is being used for various clinical indications, including cancer. Several studies exploring molecular mechanisms of WS suggest its possible role in improving clinical outcomes in cancer management. Therefore, research on WS may offer new insights in rational development of therapeutic adjuvants for cancer. Aim of this review The review aims at providing a detailed analysis of in silico, in vitro, in vivo and clinical studies related to WS and cancer. It suggests possible role of WS in regulating molecular mechanisms associated with carcinogenesis. The review discusses potential of WS in cancer management in terms of cancer prevention, anti-cancer activity, and enhancing efficacy of cancer therapeutics. Material and methods The present narrative review offers a critical analysis of published literature on WS studies in cancer. The reported studies were analysed in the context of pathophysiology of cancer, commonly referred as ‘cancer hallmarks’. The review attempts to bridge Ayurveda knowledge with biological insights into molecular mechanisms of cancer. Results The critical analysis suggests an anti-cancer potential of WS with a key role in cancer prevention. The possible mechanisms for these effects are associated with the modulation of apoptotic, proliferative, and metastatic markers in cancer. WS can attenuate inflammatory responses and enzymes involved in invasion and metastatic progression of cancer. The properties of WS are likely to be mediated through withanolides, which may activate tumor suppressor proteins to restrict proliferation of cancer cells, regulate the genomic instability, and energy metabolism of cancer cells. The reported studies indicate the need for deeper understanding of molecular mechanisms of WS in inhibiting angiogenesis and promoting immunosurveillance. Additionally, WS can augment efficacy and safety of cancer therapeutics. Conclusion The experimentally-supported evidence of immunomodulatory, anti-cancer, adaptogenic, and regenerative attributes of WS suggest its therapeutic adjuvant potential in cancer management. The adjuvant properties of withanolides can modulate multidrug resistance and reverse chemotherapy-induced myelosuppression. These mechanisms need to be further explored in systematically designed translational and clinical studies that will pave the way for integration of WS as a therapeutic adjuvant in cancer management.
... Many studies suggest the medicinal herbs as immune-stimulants in different optimal doses, frequency and duration have proved to a promising role in enhancing the immunity of the fish Bricknell and Dalmo 2005;Bowden 2008;Magnad ottir 2006). Among these plant extractions, Withania coagulan, which belongs to the family Solanaceae, is well known for their many pharmaceutical properties such as anti-diabetic, anti-microbial, anti-fungal, anti-oxidant etc. (Kataria et al. 2013). Further, Studies indicate a higher amount of magnesium, calcium, potassium in W. coagulans (Ullah et al. 2013). ...
Article
Full-text available
This study aimed to assess the Withania coagulans fruit extract's effects on growth and haematological parameters of Labeo rohita. Healthy fish (n ¼ 120) were divided in four groups. Experimental diet was prepared with different extraction of W. coagulans (0%, 1%, 1.5% and 2%). Diet was provided for eight weeks to all groups except the control group which fed on basal diet. The 1.5% and 2% W. coagulans extracts lead improvement in feed conversion ratio and specific fish growth rate; haematological parameters in fish group fed with 2% of W. coagulans showed increased in WBC, RBC, Hb, MCHC, PCV. The values of plasma proteins and lysozyme activity were higher in the experimental group compared control group. Fish fed with W. coagulans extracts showed increased of immunity and less mortality respect to others. It suggested that W. coagulans could be considered valuable support for the improve growth and immunity in Labeo rohita. ARTICLE HISTORY
... Our results of the W. somnifera water extract were consistent with those obtained by Kataria and co-workers 59 , who conducted their study on IMR-32 neuroblastoma cells by treating them by 5.0 % water extract of W. somnifera leaves, which led to ≈ 85 % reduction in PSA-positive cells with a significant increase in the NCAM level, and a significant reduction in the migration rate and malignancy of these cells. This effect of the extract was accompanied by the inhibition of cell proliferation in a dose-dependent manner with inducing cell differentiation 59 . ...
Article
Full-text available
It has been known for several decades that alterations in glycosylation patterns play an important role in the metastasis of cancer cells but thus far few drugs have been developed specifically targeting these molecules. Polysialic acid (PSA) is a developmentally regulated cell-surface glycan consisting of sialic acid monomers attached by α-2,8-glycosidic linkages which, in mammals, is mainly expressed on neural cell adhesion molecule (NCAM). Polysialylated NCAM is abundant in embryonic tissues, and limited to areas of persistence of neuronal plasticity in adults. Up-regulation of PSA has been reported in highly metastatic cancers where it appears to be associated with tumour progression. In this study we tested the ability of crude extracts of the Ayurvedic medicinal plants, namely Withania somnifera (ashwaghanda) and Bacopa monnieri (Brahmi), to inhibit PSA expression in a model of human tumour cell line. Throughout cell lines including; HCT 116 colorectal carcinoma, Kelly neuroblastoma and 1321N1 brain astrocytoma, high PSA signals determined by in-situ immunostaining, were observed in Kelly cell line, thus was used as a model. The crude water and hexane extracts of Withania somnifera roots, at a non-cytotoxic concentration (2.5 mg/ml) as determined by MTT assay, were found to cause < 50 % (p ≤ 0.0096) inhibition of PSA expression as determined by ELISA, compared to same extracts from the Bacopa Monnieri. We proposed a therapeutic approach in which tumour motility can be reduced through inhibition of PSA expression by compounds present in W. somnifera roots without targeting cell survival processes. Industrial relevance. Metastases is the major cause of cancer mortality worldwide, despite major improvements in the detection and evaluation of more targeted drugs. We proposed a new strategy in which metastasis is prevented by maintaining the adhesive properties of cancer cells by blocking their detachment and motility. This may be achieved with inhibitors of PSA which appears to play an important role in attenuating the adhesive properties of tumour cells. Withania somnifera provides a promising source of such agents as suggested by our results. Further isolation and purification will be needed to identify the potential bioactive compounds present in Withania somnifera. This could lead to development of new efficacious anti-metastatic agents that have the advantage of not having any cytotoxicity which can be used in adjuvant therapy in combination with currently used chemotherapeutic agents; indeed it may be possible to lower the doses of these toxic drugs to reduce side effects.
... Cuscuta reflexa (Giant dodder) in cell lines [5], Swiss albino mice [6], human red blood cells [7] and human cancer cell lines [8]. Ashwagandha or Indian ginseng Withania somnifera has immunomodulatory and anti-cancer effects [9][10][11][12][13][14]. Glycyrrhiza glabra (Liquorice) expresses promising antimicrobial, cytotoxic and anti-cancer effects [15,16]. ...
Preprint
Full-text available
UNANI MEDICINE AND CANCER Christer Sundqvist. Prepublished article, 2020 Petrafoundation, Helsinki, Finland https://www.petrafoundation.com/en/foundation Unani medicine is an alternative medical system originating in ancient Greece almost 2500 years back. It is now practiced primarily in India. Herbal remedies, dietary practices and alternative therapies characterize Unani medicine. Let us study what it can offer for a cancer patient.
... The combined use of WA and Withanone demonstrated anti-invasive and anti-angiogenic activity mediated by down-regulation of hnRNP-K, Vascular endothelial growth factor (VEGF), and Matrix Metalloproteinases-3 (MMP-3) in both In Vitro and In Vivo studies (52). Water extracts of ashwagandha (ASH-WEX) led to several anti-tumor effects like promotion of differentiation on neuronal cells, apoptosis induction, morphological changes, cell cycle arrest in G0/G1 phase and downregulation of EMT markers like MMP-2, MMP-9 thus suggesting that ASH-WEX prevents the extracellular matrix (ECM) remodeling and invasion in neuroblastoma (53). Similar results were also obtained from In Vivo studies like reduced intracranial tumor volumes and downregulation of multiple tumors promoting proteins like NF-kB, p-Akt, VEGF and cyclin D1 in the rat model of orthotopic glioma allograft that further strengthens the antiglioma efficacy of the ASH-WEX (54). ...
Article
Full-text available
Increasing herbal formulations have been used to treat several diseases including cancer. W. somnifera (Ashwagandha) is one such plant the extracts of which have been tested against a number of ailments including cancer, which remains as one of the most dreadful diseases on the globe. The ever-increasing number of cancer related mortality demands the development of novel chemopreventive agents with minimum side effects. Different compounds isolated from various parts of the plant like root, stem, and leaves have been reported to display significant anti-cancerous and immunomodulating properties and thus can be used alone or in combination with other chemotherapeutic drugs for cancer treatment. Through this review, we highlight the importance of W. somnifera in countering the potential oncogenic signaling mediators that are modulated by active constituents of W. somnifera in a variety of cancer types. Further, we hope that active constituents of W. somnifera will be tested in clinical trials so that they can be used as an important adjuvant in the near future for the effective treatment of cancer.
... Differentiation of neuroblastoma cells paves way for eliminating the tumor forming cells thereby retaining normalcy of the body cells. [ 21] This finding of differentiation ability of the plant extracts of Cuminum cyminum were then studied. ...
Article
Since time immemorial, Cuminum cyminum seeds have been famous for their integral role that they have played in the indian diet. They have been shown to have neuro-protective activity. The present study was done to evaluate the neuroprotective action of C.cyminum seed against Tri-methyltin (TMT-organotin) induced toxicity, in IMR32, a human neuroblastoma cell line. TMT is known for its hippocampal specific neurotoxic effects. Preliminary phytochemical analysis was carried out for the aqueous, petroleum ether and ethyl acetate fractions of the extract which were then subjected for cytotoxic studies. The assessment of cytotoxic protection by ethyl acetate, aqueous and petroleum ether fractions of the seeds against TMT induced toxicity was done using MTT cell viability assay. Results showed that it conferred no protection against the neurotoxic cell death. However, an interesting finding from this study was that on treating the IMR32 human neuroblastoma cells with extracts alone in varying concentrations (10ug/ml, 25ug/ml and 50ug/ml), they ethyl acetate fraction showed the potential to induce differentiation of neuroblastoma cells. Therapy for neuroblastoma heavily relies on the ability of the drug to cause differentiation in the cells, curbing the proliferation and metastasis of the cells. Thus, further exploration of the extract can lead to a potent anti-cancer agent against human neuroblastoma cells.
Article
This study aimed to assess the Withania coagulans fruit extract's effects on growth and haematological parameters of Labeo rohita. Healthy fish (n = 120) were divided in four groups. Experimental diet was prepared with different extraction of W. coagulans (0%, 1%, 1.5% and 2%). Diet was provided for eight weeks to all groups except the control group which fed on basal diet. The 1.5% and 2% W. coagulans extracts lead improvement in feed conversion ratio and specific fish growth rate; haematological parameters in fish group fed with 2% of W. coagulans showed increased in WBC, RBC, Hb, MCHC, PCV. The values of plasma proteins and lysozyme activity were higher in the experimental group compared control group. Fish fed with W. coagulans extracts showed increased of immunity and less mortality respect to others. It suggested that W. coagulans could be considered valuable support for the improve growth and immunity in Labeo rohita.
Article
Full-text available
Chemotherapy is one of the prime treatment options for cancer. However, the key issues with traditional chemotherapy are recurrence of cancer, development of resistance to chemotherapeutic agents, affordability, late-stage detection, serious health consequences, and inaccessibility. Hence, there is an urgent need to find innovative and cost-effective therapies that can target multiple gene products with minimal adverse reactions. Natural phytochemicals originating from plants constitute a significant proportion of the possible therapeutic agents. In this article, we reviewed the advances and the potential of Withania somnifera (WS) as an anticancer and immunomodulatory molecule. Several preclinical studies have shown the potential of WS to prevent or slow the progression of cancer originating from various organs such as the liver, cervix, breast, brain, colon, skin, lung, and prostate. WS extracts act via various pathways and provide optimum effectiveness against drug resistance in cancer. However, stability, bioavailability, and target specificity are major obstacles in combination therapy and have limited their application. The novel nanotechnology approaches enable solubility, stability, absorption, protection from premature degradation in the body, and increased circulation time and invariably results in a high differential uptake efficiency in the phytochemical’s target cells. The present review primarily emphasizes the insights of WS source, chemistry, and the molecular pathways involved in tumor regression, as well as developments achieved in the delivery of WS for cancer therapy using nanotechnology. This review substantiates WS as a potential immunomodulatory, anticancer, and chemopreventive agent and highlights its potential use in cancer treatment.
Chapter
Ageing is an innate indispensable physiological process largely conceived as general decline in body functions and defense mechanisms. While ageing per se is not a disease, there are many age-related pathologies, modulation of which is considered as anti-ageing in several ways. Chronic stress often triggers senescence-inducing mechanisms manifested as premature/rapid ageing. The latter is associated with a high incidence of stress-related disorders such as cancer, neurodegeneration, metabolic disorders and muscle/bone dysfunctions. Cell culture system provides an easy and convenient experimental system to study mechanisms of natural (replicative) and stress-induced ageing. We, over the years, have researched molecular mechanisms of ageing and age-related pathologies, and their modulation with natural compounds using cell culture as a model system. Among several others, bioactives from Ashwagandha (Withania somnifera) have emerged as useful natural compounds with a variety of activities and are hence predicted to assist in health care in stress and disease states. In this chapter, we describe highlights of our research work demonstrating the therapeutic potential of Ashwagandha leaves that offer advantage over roots in terms of availability, processing and being enriched with active compounds.
Article
Full-text available
Cancer is one of the fastest growing diseases, with an estimated worldwide incidence of 10 million new cases per year. Mortality is high, with >7 million deaths per year. In the last two decades, great advances have been made in cancer therapy; however, the success rates still remain unsatisfactory. Current conventional anticancer therapies are associated with adverse effects, drug resistance, and cancer recurrence. In Unani system of medicine, Cancer is known as Sartān, an Arabic word which means "crab". In the classical Unani literature, Sartān (Cancer) has been mentioned with great description, causes, origin, expansion, metastasis and all of clinical presentations. Renowned physicians like Buqrat, Jalinoos, Razi, Ibn Sina, Tabri and Jurjani gave the details of Sartān and its management. Through this paper, an attempt has been made to highlight the strength of Unani medicine in Sartān.
Article
Full-text available
Polysialic acid (PSA) is a carbohydrate composed of a linear homopoly- mer of a-2-8-linked sialic acid residues and is mainly attached to the neural cell adhesion molecule (NCAM). Because of the large negative charge of PSA, presence of PSA attenuates the adhesive property of NCAM and increases the cellular motility. PSA expression on NCAM is developmentally regulated, and PSA plays important roles in formation and remodeling of the neural system through regulation of the adhesive property of NCAM. Expression of the polysialated form of NCAM has been also demonstrated in some malignant tumors, such as Wilms' tumor and small cell lung cancer. Despite the possible importance as an onco- developmental antigen, however, significance of PSA expression in most malignant tumors has not been revealed. Therefore, PSA expression in non-small cell lung cancer was assessed in the present study. PSA was expressed only in 5 (20.8%) of 24 pathological stage I cases, whereas it was expressed in most stage IV cases (76.8%, 11 of 14 cases). PSA expression was correlated with nodal metastasis and distant metastasis, but not with local extent of the primary tumor. Next, expression of polysialyltrans- ferase genes (PST and STX genes) which controlled formation of PSA, was examined. The PST gene was constantly expressed in both normal lung tissue and tumor tissue of all cases. In contrast, the STX gene was not expressed in normal lung tissue of any case, and STX gene expression in tumor tissue was closely correlated with tumor progression. The STX gene was expressed only in 1 (4.2%) of 24 stage I cases, whereas it was expressed in most stage IV cases (85.7%, 12 of 14 cases). These results suggested that the PSA and STX genes could be new targets of cancer therapy as well as important clinical markers.
Article
Full-text available
Glutamate neurotoxicity has been implicated in stroke, head trauma, multiple sclerosis and neurodegenerative disorders. Search for herbal remedies that may possibly act as therapeutic agents is an active area of research to combat these diseases. The present study was designed to investigate the neuroprotective role of Withania somnifera (Ashwagandha), also known as Indian ginseng, against glutamate induced toxicity in the retinoic acid differentiated rat glioma (C6) and human neuroblastoma (IMR-32) cells. The neuroprotective activity of the Ashwagandha leaves derived water extract (ASH-WEX) was evaluated. Cell viability and the expression of glial and neuronal cell differentiation markers was examined in glutamate challenged differentiated cells with and without the presence of ASH-WEX. We demonstrate that RA-differentiated C6 and IMR-32 cells, when exposed to glutamate, undergo loss of neural network and cell death that was accompanied by increase in the stress protein HSP70. ASH-WEX pre-treatment inhibited glutamate-induced cell death and was able to revert glutamate-induced changes in HSP70 to a large extent. Furthermore, the analysis on the neuronal plasticity marker NCAM (Neural cell adhesion molecule) and its polysialylated form, PSA-NCAM revealed that ASH-WEX has therapeutic potential for prevention of neurodegeneration associated with glutamate-induced excitotoxicty.
Article
In order to define the role of cyclin D1 in the progression of malignant glioma, cells over-expressing cyclin D1 were constructed (a-1 cells). They exhibited significantly increased invasiveness as compared with mock-transfected cells. Since cellular invasion is thought to depend on extracellular-matrix degradation, we determined whether cyclin-D1 expression modifies the activity of matrix metalloproteinases (MMPs). Increased gelatinolytic activity of latent type MMP-2 (proMMP-2) and active MMP-2 was observed in a-1 cells. Moreover, cyclin-D1 expression was associated with increased activation of proMMP-9 through MMP-3. Wound assays showed an increase of cell motility in a-1 cells. Cyclin-D1 expression was found to be associated with up-regulation of Rac1, which modulates the formation of ruffling membranes and cell motility. Our results show that cyclin D1 may modulate invasive ability by increasing MMP activity and cell motility, and suggests a novel function of cyclin D1 in the progression of malignant gliomas. Int. J. Cancer 83:387–392, 1999. © 1999 Wiley-Liss, Inc.
Article
Neurofilaments (NFs) are prominent components of large myelinated axons. Previous studies have suggested that NF number as well as the phosphorylation state of the COOH-terminal tail of the heavy neurofilament (NF-H) subunit are major determinants of axonal caliber. We created NF-H knockout mice to assess the contribution of NF-H to the development of axon size as well as its effect on the amounts of low and mid-sized NF subunits (NF-L and NF-M respectively). Surprisingly, we found that NF-L levels were reduced only slightly whereas NF-M and tubulin proteins were unchanged in NF-H–null mice. However, the calibers of both large and small diameter myelinated axons were diminished in NF-H–null mice despite the fact that these mice showed only a slight decrease in NF density and that filaments in the mutant were most frequently spaced at the same interfilament distance found in control. Significantly, large diameter axons failed to develop in both the central and peripheral nervous systems. These results demonstrate directly that unlike losing the NF-L or NF-M subunits, loss of NF-H has only a slight effect on NF number in axons. Yet NF-H plays a major role in the development of large diameter axons.
Article
: Growing evidence supports the notion of a functional relationship between the presence of the β-amyloid (Aβ) peptide and the production of inflammatory mediators in and around neuritic plaques of Alzheimer's disease. Tissue remodeling enzymes that are critical in peripheral inflammatory responses are the matrix metalloproteinases (MMPs), enzymes produced by neurons and glia. Thus, it was of interest to determine whether Aβ may alter the expression of MMPs in glial and neuronal cultures. It was demonstrated that Aβ (1–40) is a potent stimulator of MMP-9 and MMP-2 activity in addition to inducing the expression of a lower molecular weight, unidentified gelatinase activity in mixed hippocampal and astrocyte cultures. Shorter fragments of Aβ were less effective in stimulating the production of these enzymes. The lower molecular weight activity was observed only in response to Aβ, and not after treatment with various cytokines. In addition, both cultures express MMP-3 (stromelysin-1) in response to Aβ peptides. These results suggest that MMPs may play a role in the development or progression of neuritic plaques, i.e., abnormal neurite outgrowth.
Article
An important positive regulator of the cell cycle, cyclin D1, is often amplified and overexpressed in malignancies. Cyclin D1 aberrations were analysed in grade II–IV astrocytomas by fluorescence in situ hybridization (FISH), mRNA in situ hybridization and immunohistochemistry. Proliferation activity was determined by Ki-67MIB-1 immunolabelling and mitotic counting. High cyclin D1 expression was observed in grade IV astrocytomas (grades II–III versus grade IV; mRNA expression: p < 0·001; immunoexpression: p = 0·013), and correlated with poor patient survival (p < 0·001, n = 46). Upregulated cyclin D1 expression was also closely associated with poor patient prognosis in grade II–III astrocytomas (p < 0·001, n = 30). Cyclin D1 gene was not found to be amplified (n = 7). Cell proliferation activity was significantly increased in tumours exhibiting high cyclin D1 mRNA levels (Ki-67MIB-1: p < 0·001; mitotic count: p < 0·001) and high cyclin D1 protein expression (Ki-67MIB-1: p = 0·002; mitotic count: p = 0·012). These results indicate that increased production of cyclin D1 is closely associated with high cell proliferation activity and aggressive behaviour in diffusely infiltrating astrocytomas. Copyright © 1999 John Wiley & Sons, Ltd.
Article
Polysialic acid is a unique cell surface polysaccharide found in the capsule of neuroinvasive bacteria and as a highly regulated post-translational modification of the neural cell adhesion molecule. Recent progress has been achieved in research on both the physicochemical properties of polysialic acid and the biosynthetic pathways leading to polysialic acid expression in bacteria and mammals.
Article
The chemical investigation on the n-hexane extract of Withania somnifera roots has yielded octacosane, oleic and stearic fatty acids, stigmasterone, stigmasterol, sitostanone, oleanolic acid along with the ergosterol and 1,4-dioxane derivatives as new compounds. The isolation of alkenyl-1,4-dioxane compound is rare, whereas the ergosterol derivative may have biogenetic significance in the lactone formation in the E ring of withanolides. The presence of a 1,4-dioxane derivative in the nonpolar extract of roots assumes importance as this type of compound has not been reported earlier from W. somnifera. The structures of new compounds were elucidated by spectroscopic methods and chemical transformations.