Dual Short Upstream Open Reading Frames Control Translation of a Herpesviral Polycistronic mRNA

Article (PDF Available)inPLoS Pathogens 9(1):e1003156 · January 2013with37 Reads
DOI: 10.1371/journal.ppat.1003156 · Source: PubMed
Abstract
Author Summary Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiologic agent of multicentric Castleman's disease, primary effusion lymphoma and Kaposi's sarcoma. KSHV expresses a number of transcripts with the potential to generate multiple proteins, yet relies on the cellular translation machinery that is primed to synthesize only one protein per mRNA. Here we report that the viral transcript encompassing ORF35–37 is able to direct synthesis of two proteins and that the translational switch is regulated by two short upstream open reading frames (uORFs) in the native 5′ untranslated region. uORFs are elements commonly found upstream of mammalian genes that function to interfere with unrestrained ribosomal scanning and thus repress translation of the major ORF. The sequence of the viral uORF appears unimportant, and instead functions to position the translation machinery in a location that favors translation of the downstream major ORF, via a reinitiation mechanism. Thus, KSHV uses a host strategy generally reserved to repress translation to instead allow for the expression of an internal gene.
Dual Short Upstream Open Reading Frames Control
Translation of a Herpesviral Polycistronic mRNA
Lisa M. Kronstad
1
, Kevin F. Brulois
2
, Jae U. Jung
2
, Britt A. Glaunsinger
1
*
1 Department of Plant and Microbial Biology, University of California, Berkeley, Berkeley, California, United States of America, 2 Department of Molecular Microbiology and
Immunology, Keck School of Medicine, University of California, Los Angeles, Los Angeles, California, United States of America
Abstract
The Kaposi’s sarcoma-associated herpesvirus (KSHV) protein kinase, encoded by ORF36, functions to phosphorylate cellular
and viral targets important in the KSHV lifecycle and to activate the anti-viral prodrug ganciclovir. Unlike the vast majority of
mapped KSHV genes, no viral transcript has been identified with ORF36 positioned as the 59-proximal gene. Here we report
that ORF36 is robustly translated as a downstream cistron from the ORF35–37 polycistronic transcript in a cap-dependent
manner. We identified two short, upstream open reading frames (uORFs) within the 5 9 UTR of the polycistronic mRNA. While
both uORFs function as negative regulators of ORF35, unexpectedly, the second allows for the translation of the
downstream ORF36 gene by a termination-reinitiation mechanism. Positional conservation of uORFs within a number of
related viruses suggests that this may be a common c-herpesviral adaptation of a host translational regulatory mechanism.
Citation: Kronstad LM, Brulois KF, Jung JU, Glaunsinger BA (2013) Dual Short Upstream Open Reading Frame s Control Translation of a Herpesviral Polycistronic
mRNA. PLoS Pathog 9(1): e1003156. doi:10.1371/journal.ppat.1003156
Editor: Dirk P. Dittmer, University of North Carolina, United States of America
Received October 16, 2012; Accepted December 11, 2012; Published January 31, 2013
Copyright: ß 2013 Kronstad et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: Funding was provided by a Burroughs Wellcome Fund Investigators in the Pathogenesis of Infectious Disease Award and grant CA136367 to BAG, a
National Sciences and Engineering Research Council of Canada (NSERC) fellowship to LMK, and grants CA082057, CA31363, CA115284, DE019085, AI073099,
Hastings Foundation, and Fle tcher Jones Foundation to JUJ. The funders had no role in study design, data collection and analysis, decision to publish,or
preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: glaunsinger@berkeley.edu
Introduction
Translation initiation of eukaryotic mRNAs is dependent on the
59 mRNA cap and proceeds by ribosomal scanning until
recognition of an AUG codon in a favorable context [1,2]. As a
consequence of the translation machinery not engaging start
codons at internal positions within the mRNA, eukaryotic
transcripts generally encode only one functional protein. For the
majority of mRNAs the most 59-proximal AUG is selected,
however strategies exist to bypass upstream start codons to enable
downstream initiation. For example, leaky scanning can occur if
the nucleotides flanking the 59-proximal AUG are not in the
Kozak consensus sequence (ccRcc
AUGG), allowing the 40S
ribosomal subunit to instead engage a downstream methionine
codon [2,3]. Alternatively, when an upstream AUG is followed
shortly thereafter by an in-frame termination codon, ribosomes
can reinitiate translation, albeit with reduced efficiency, at a
downstream AUG. These upstream open reading frames (uORFs)
presumably permit translation of a downstream gene because
factors necessary for initiation have not yet dissociated during the
short elongation period. Notably, uORFs are common regulatory
elements in eukaryotic transcripts, and generally function to
reduce translation of the major ORF [3,4]. Additional, although
rare, examples of internal ORF translation also exist, for example
after ribosome shunting over a highly structured upstream
sequence [5–8], or upon direct 40S recruitment via internal
ribosome entry sites (IRESs) [9–13].
Viruses do not encode translation machinery and thus operate
under the constraints of host protein synthesis. However, the
compact nature of viral genomes has resulted in the evolution of
specialized strategies to maximize their coding capacity. Examples
of such mechanisms include translation of a large polyprotein that
is cleaved into multiple proteins, ribosomal frameshifting and non-
canonical translation mechanisms such as those described above
[14]. Accordingly, many viral mRNAs do not conform to the one
protein per mRNA cellular paradigm and require specialized
mechanisms to subvert the translational constraints of the host.
Kaposi’s sarcoma-associated herpesvirus (KSHV) is the etiologic
agent of several human cancers including multicentric Castleman’s
disease, primary effusion lymphoma and Kaposi’s sarcoma (KS),
one of the early AIDS-defining illnesses [15–17]. KSHV is a
double-stranded DNA virus of the c-herpesvirus subfamily,
possessing a ,165-kb genome and encoding an estimated 80 viral
proteins [17,18]. The viral genes closely resemble those of their
cellular counterparts in that they have canonical transcriptional
promoters, consensus pre-mRNA splice sites and 39-end formation
signals. However, one notable departure from the cellular
paradigm is the scarcity of poly(A) sites distributed throughout
the genome, with a single signal often allocated to several
consecutive ORFs. These gene clusters give rise to viral transcripts
with polycistronic coding potential, although in general only the
59-proximal gene is translated on each mRNA [19–21]. Most
genes are positioned as a 59 cistron by the use of multiple
transcriptional start sites upstream of common poly(A) signals
and/or alternative splicing [21,22]. To date, the only described
KSHV mechanism to enable translation of a 39-proximal ORF is
an IRES identified in the coding region of vCyclin (ORF72),
which allows for expression of vFLIP (ORF71) [23–25].
A previously described tricistronic KSHV mRNA encompasses
three partially overlapping open reading frames that are expressed
PLOS Pathogens | www.plospathogens.org 1 January 2013 | Volume 9 | Issue 1 | e1003156
with lytic kinetics (ORF35, 36, and 37). However, the mechanism
of translation initiation of the 59-distal ORF36 and ORF37
proteins has remained unresolved [26,27]. The function of the
protein product of the 59-proximal ORF35 is ill defined, although
it shares limited sequence similarity with the a-herpesvirus UL14
gene product, which has described heat shock protein-like
properties and functions to inhibit apoptosis during host cell
infection [28,29]. The second gene, ORF36, encodes a serine/
threonine kinase that activates the cellular c-Jun N-terminal kinase
(JNK) signaling pathway and phosphorylates the viral transcrip-
tional transactivator K-bZIP, two processes involved in the
progression from early to late viral gene expression [27,30,31].
Moreover, ORF36 sensitizes KSHV-infected cells to ganciclovir,
an anti-viral drug shown to reduce KSHV replication in cultured
cells and in patients [32–35]. The 39-proximal ORF37 expresses
SOX (shutoff and exonuclease), a viral protein responsible for
promoting widespread degradation of host mRNAs and also
thought to assist in viral DNA replication and packaging [36–38].
Here, we demonstrate that the ORF35–37 transcript is
functionally bicistronic, supporting translation of both ORF35
and ORF36, whereas ORF37 is expressed from a previously
uncharacterized monocistronic transcript. The polycistronic locus
lacks IRES activity, and both proteins are expressed in a cap-
dependent manner. Interestingly, translation of ORF36 occurs via
a reinitiation mechanism after engagement of one of two
overlapping short uORFs located in the 59-untranslated region
(UTR), which also regulate the relative expression levels of these
proteins. Thus, KSHV uses a host strategy normally reserved to
repress translation of the major ORF to instead permit expression
of a 39-proximal cistron on a viral polycistronic mRNA. Analysis
of homologous genetic loci from additional c-herpesviruses
similarly revealed the presence of dual short upstream ORFs
(uORFs), suggesting this may be a conserved mechanism of
translation initiation among these viruses.
Results
Identification of a functionally bicistronic KSHV mRNA
Two potential functionally polycistronic mRNAs are tran-
scribed from the KSHV ORF34–37 genetic locus during lytic
replication: a minor transcript encompassing ORFs 34, 35, 36,
and 37 (ORF34–37) and a major transcript encompassing ORFs
35, 36 and 37 (ORF35–37) (Figure 1A) [26,27]. Although both
ORF36 and ORF37 proteins play important roles in the viral
lifecycle, no transcripts were reported in which these ORFs were
present as the 59-proximal cistron [26,27]. To confirm this
observation, we searched for transcripts produced from this locus
in a B cell line (TREx BCBL1-RTA) that harbors KSHV in a
latent state but can be stimulated to engage in lytic replication.
RNA isolated from cells infected latently or lytically for 8–36 h
was Northern blotted with riboprobes specific for ORF36 or
ORF37. In infected cells, the ORF36 probe recognized transcripts
co-migrating with or larger than the polycistronic ORF35–37
mRNA but did not reveal any smaller, potentially monocistronic
species (Figure 1B). Results from ORF36 59 rapid amplification of
cDNA ends (RACE) experiments were in agreement with its
transcript initiating upstream of ORF35 at nucleotide position
55567 as previously reported by Haque et al. (Figure 1A, data not
shown) [18]. In contrast, the ORF37 probe reacted with
transcripts $3.4 kb and an additional ,1.7 kb transcript that
co-migrated with the control ORF37 monocistronic mRNA
(Figure 1C). Analysis of transcription start sites by 59 RACE (data
not shown), as well as similar observations in a related c-
herpesvirus further supported the presence of an ORF37
monocistronic transcript [39]. Thus, ORF37 is most likely
translated by the canonical cap-dependent scanning mechanism
and is present as a silent cistron on the ORF35–37 polycistronic
mRNA.
We next sought to evaluate directly whether the ORF35–37
transcript could support translation of ORF36 as a downstream
gene. 293T cells were first transfected with a plasmid expressing
the coding sequence of ORF35–37 downstream of the native viral
72-nt 59 UTR, and lysates were Western blotted using polyclonal
antisera specific for ORF36 or, as a control, ORF37. The ORF36
protein was readily translated from this polycistronic construct,
whereas the ORF37 protein was detected only in cells transfected
with the monocistronic ORF37 plasmid (Figure 1D, 1E). In these
and all subsequent experiments, Northern blotting of the mRNAs
produced from each transfection confirmed that the transcripts
were of the expected size and of equivalent abundance across
experiments (Figure 1D, 1E).
ORF35 is conserved between the a, b, and c-herpesvirus
subfamilies but its function remains unknown and antibodies are
not available to detect it in KSHV-infected cells [40]. ORF35 is
predicted to encode a 151-amino acid protein, and its start site
resides in a favorable Kozak context. Nonetheless, we considered
the possibility that ORF35 is not translated, instead serving as a
portion of the 59 UTR for ORF36. In order to directly compare
the levels of ORF35 and ORF36 protein produced from the
bicistronic construct, we engineered in-frame HA tags at the 59 or
39 end of each respective gene, maintaining the native viral 59
UTR (59 UTR HA-ORF35-ORF36-HA). Monocistronic versions
of each HA-tagged gene were also generated as controls (59 UTR
HA-ORF35, ORF36-HA). Importantly, Western blotting with HA
antibodies revealed that the ORF35 protein is produced from both
the monocistronic and bicistronic constructs (Figure 2A).
Although our data indicated that the ORF35–37 transcript is
functionally bicistronic, it was still formally possible that ORF36
translation occurred from a low-abundance monocistronic tran-
script generated by a cryptic internal promoter or splice site(s) in
the DNA plasmid. To address this possibility, we transfected cells
directly with in vitro transcribed monocistronic or bicistronic
mRNAs, and performed anti-HA Western blots to detect each
protein (Figure 2B). Again, both ORF35 and ORF36 protein were
produced from the bicistronic 59 UTR HA-ORF35-ORF36-HA
Author Summary
Kaposi’s sarcoma-associated herpesvirus (KSHV) is the
etiologic agent of multicentric Castleman’s disease,
primary effusion lymphoma and Kaposi’s sarcoma. KSHV
expresses a number of transcripts with the potential to
generate multiple proteins, yet relies on the cellular
translation machinery that is primed to synthesize only
one protein per mRNA. Here we report that the viral
transcript encompassing ORF35–37 is able to direct
synthesis of two proteins and that the translational switch
is regulated by two short upstream open reading frames
(uORFs) in the native 59 untranslated region. uORFs are
elements commonly found upstream of mammalian genes
that function to interfere with unrestrained ribosomal
scanning and thus repress translation of the major ORF.
The sequence of the viral uORF appears unimportant, and
instead functions to position the translation machinery in a
location that favors translation of the downstream major
ORF, via a reinitiation mechanism. Thus, KSHV uses a host
strategy generally reserved to repress translation to
instead allow for the expression of an internal gene.
Non-Canonical Translation Initiation of KSHV ORF36
PLOS Pathogens | www.plospathogens.org 2 January 2013 | Volume 9 | Issue 1 | e1003156
mRNA, as well as from the appropriate control monocistronic
mRNA, confirming that this locus is functionally polycistronic.
ORF36 translation is not IRES-dependent
The only other known example in KSHV of translation of a
downstream ORF from a polycistronic mRNA occurs via an IRES
[23–25]. We therefore used an established dual luciferase assay to
determine whether an IRES similarly resides upstream of ORF36.
The dual luciferase construct consists of a 59-proximal Renilla
luciferase gene that can be constitutively translated via a cap
dependent mechanism, followed by a 39-distal firefly luciferase
gene, which is not normally translated. The two genes are
separated by a defective encephalomyocarditis virus (DEMCV) to
prevent translational read-through [11,41]. Sequences of interest
are then inserted between the DEMCV and the firefly luciferase
gene, and IRES activity leads to the translation of firefly luciferase.
Sequences encompassing ORF35, ORF35–36 or ORF34–36 as
well as two known IRES elements (EMCV and KSHV ORF72)
were cloned into the dual luciferase construct. The capped and
polyadenylated in vitro transcribed mRNA was electroporated into
lytically infected TREx BCBL1-RTA cells (Figure 3A). The
integrity of the mRNAs was verified by Northern blotting (data not
shown). After 4 h, the ratio of firefly/Renilla luciferase activity was
measured to determine whether IRES activity was detectable in
the context of lytic infection. Although both the EMCV and
ORF72 control IRES elements supported translation of firefly
luciferase, none of the sequences upstream of ORF36 possessed
detectable IRES activity (Figure 3B).
Figure 1. Efficient translation of ORF36, but not ORF37, occurs from the full-length ORF35–37 tricistronic transcript. (A) A schematic
presentation of the ORF34–37 genetic locus showing the previously identified ORF34–37 and ORF35–37 polycistronic mRNAs with thin and thick lines
respectively. Coding potentials are indicated on the right. The ORF37-specific transcript is denoted as a dotted line. Start sites (SS) are indicated for
each transcript according to the nucleotide position described by Russo et al. [18]. The single poly(A) signal used by all four ORFs for transcription
termination is shown. (B–C) TREx BCBL1-RTA cells were mock treated (latent) or lytically reactivated for the indicated times. RNA was then isolated
and Northern blotted with a
32
P-labeled ORF36 (B) or ORF37 (C) strand-specific riboprobe. An additional higher molecular weight 293T-specific cross-
reacting band was also detected in the ORF36 control lane, denoted by *. (D–E) 293T cells were transfected with the indicated plasmid, and total RNA
and protein were isolated 24 h later. Protein lysates were resolved by SDS-PAGE and detected by Western blot with antibodies against ORF36 (D) or
ORF37 (E). Actin served as a loading control. To verify transcript integrity, RNA was Northern blotted with
32
P-labeled ORF36 (D) or ORF37 (E) DNA
probes or with a probe against the GFP co-transfection control.
doi:10.1371/journal.ppat.1003156.g001
Non-Canonical Translation Initiation of KSHV ORF36
PLOS Pathogens | www.plospathogens.org 3 January 2013 | Volume 9 | Issue 1 | e1003156
We next sought to determine whether ORF36 translation was
instead initiated via a cap-dependent mechanism by inserting a
strong 40 nucleotide hairpin (Hp7; DG=261 kcal/mol) after
nucleotide 32 within the 72 nucleotide native 59 UTR of the 59
UTR HA-ORF35-ORF36-HA construct (Figure 3C) [42]. Stable
hairpin structures (DG,230 kcal/mol) present near the 59 cap
dramatically reduce translation initiation by stalling the pre-
initiation complex [42]. Translation of both ORF35 and ORF36
was markedly reduced in the presence of Hp7 following either
DNA or RNA transfection (Figure 3D, S1A). Thus, recognition of
the 59 cap and subsequent 40S scanning are critical for translation
of both ORF35 and ORF36.
It is notable that ORF36 protein production is robust given that
its translation requires the pre-initiation complex to bypass the
relatively strong Kozak context surrounding the ORF35 start
codon (Aga
AUGG) and to scan through 424 nucleotides of
upstream sequence. To determine whether the context of the
ORF35 start codon influences the expression of ORF36, we
mutated the preferred nucleotide (A) at position 23 to the least
preferred nucleotide (U) (35 KCS wkn; Figure 3E). As expected,
ORF35 expression was reduced; however, surprisingly, this
mutation this did not significantly alter ORF36 expression,
arguing against a pure leaky scanning mechanism to explain
ribosomal access to the ORF36 start site (Figure 3F). Direct
transfection with in vitro transcribedmRNAsconfirmedthatthis
result was not due to induction of an alternative promoter (Figure
S1B). Thus, the relative strength of the ORF35 start site does not
dramatically influence ORF36 translation, suggesting that there is an
alternative mechanism in place that disfavors initiation at the 59 gene.
Two uORFs present in the 5 9 UTR control translation of
ORF35 and ORF36
We searched for features of the ORF35–37 sequence that might
contribute to translational start site selection. Within the 59 UTR we
noticed two short upstream ORFs (uORFs). The first nine codon
uORF, dubbed uORF1, spans KSHV nucleotides 55603 to 55629
and has an AUG residing in a relatively weak Kozak context
(Cgu
AUGA) [18]. The second 11 codon uORF (uORF2) spans
KSHV nucleotides 55626–55658 and overlaps with both the 39 end
of uORF1 and the ORF35 start codon (Figure 4A). To determine
the contribution of uORF1 towards ORF35 and ORF36 transla-
tion, we mutated the uORF1 start site (D1) (Figure 4A). ORF35
expression was elevated in the D1 mutant (Figure 4B). We
confirmed that the HA tag at the 59 end of ORF35 did not alter
this translational regulation by showing similar results upon
repositioning of the HA tag internally within ORF35 (Figure S2).
Thus, ORF35 expression undergoes modest negative regulation by
ribosomal engagement at the uORF1 start codon, although this
does not appear to influence ORF36 expression.
The uORF2 start codon is in a more favorable Kozak context
than that of uORF1, and disruption of the uORF2 AUG
(AUGRUUG; D2) or weakening the Kozak context of its start
codon (KCS2 wkn) increased ORF35 translation and severely
decreased translation of ORF36 in both DNA and RNA
transfection experiments (Figure 4C–D, S3). Notably, the D2
mutant was designed to ensure the uORF1 stop codon remains
intact, permitting the independent analysis of uORF1 and
uORF2. Unlike uORF1, uORF2 therefore plays a key role in
regulating expression of both genes in this polycistronic mRNA,
likely due to the strong context flanking the uORF2 AUG as
compared to the uORF1 start codon.
Although a few rare uORFs have been found to function in a
sequence-dependent manner [43–47], for most characterized
uORFs it is the act of translation rather than the peptide sequence
that mediates their function. The fact that 45% of the uORF2
amino acid sequence is altered in the construct bearing the HA tag
at the 59 end of ORF35 is in agreement with the amino acid
sequence of uORF2 not being the primary determinant of its
activity. Indeed, rebuilding the uORF2 mutants into a construct in
which the HA tag was moved to an internal position in ORF35
yielded indistinguishable results (Figure S4).
The above findings suggested that engagement of the translation
machinery at either uORF1 or uORF2 rather than the sequence
of the uORF-encoded peptide mediates their regulatory function.
We therefore sought to confirm that these uORFs were indeed
recognized by the translation machinery. Due to their small size,
uORF-generated peptides tend to be highly unstable and are very
difficult to detect. To circumvent this problem, we made a single
nucleotide change in each uORF to place them in frame with
ORF35 lacking its AUG (D35), thereby generating uORF-ORF35
fusions (Figure 4E). Thus, restoration of ORF35 expression is a
direct readout translation initiation from the uORF start codon. In
both cases, the uORF fusions restored ORF35 expression to levels
corresponding to the relative strength of the Kozak consensus
sequence of each uORF (Figure 4F). As expected, only the uORF2
fusion abrogated expression of ORF36 (Figure 4F).
Figure 2. The ORF35–37 mRNA is functionally bicistronic. (A)
Western blot analysis of 293T cells transfected with either N-terminally
HA-tagged ORF35 with the native 59 UTR (ORF35), C-terminally HA
tagged ORF36 (ORF36) or the full length 59 UTR HA-ORF35-ORF36-HA
(ORF35/ORF36) DNA constructs. Equivalent amounts of protein lysates
were resolved by SDS-PAGE and detected with anti-HA antibodies. (B)
293T cells were transfected with the indicated in vitro transcribed
capped and polyadenylated RNA. Protein lysates were harvested 4 h
post-transfection, resolved by SDS-PAGE and detected with anti-HA
antibodies. The ribosomal protein S6RP served as a loading control for
both experiments.
doi:10.1371/journal.ppat.1003156.g002
Non-Canonical Translation Initiation of KSHV ORF36
PLOS Pathogens | www.plospathogens.org 4 January 2013 | Volume 9 | Issue 1 | e1003156
Finally, to determine whether additional cis-acting elements
within ORF36 are required for its translation after uORF2
engagement, we replaced the ORF36 gene with a GFP reporter
(Figure 4G). GFP protein was expressed robustly as a downstream
gene from this construct, arguing against a requirement for an
element within ORF36 for its translation (Figure 4H). Similar to
our results with ORF36, disruption of uORF2 compromised
expression of GFP (Figure 4H), supporting a uORF2-dependent
mechanism as the primary pathway enabling translation of a
downstream gene from this locus.
ORF36 expression occurs via reinitiation after uORF
translation
Translation of a major ORF following engagement at a uORF
generally occurs via a termination-reinitiation event. The length of
a uORF is important for reinitiation, as it is thought that some of
the translation initiation accessory factors have not yet dissociated
prior to termination at the uORF stop codon [4]. In this regard,
translation of the downstream ORF decreases dramatically if the
time required to complete translation of the uORF is increased, for
example by increasing the ORF length or inserting secondary
Figure 3. Translation of ORF36 is independent of IRES activity and dependent on the 59 mRNA cap. (A) Diagram of dual luciferase
transcripts. (B) The indicated in vitro transcribed, polyadenylated transcripts were electroporated into lytically reactivated TREx BCBL1-RTA cells. A
dual luciferase assay was performed 4 h post-electroporation to determine the relative levels of firefly and Renilla luciferase activity. Experiment was
performed in triplicate, error bars represent the standard deviation between replicates. (C) Schematic of 59 UTR HA-ORF35-ORF36-HA containing a
DG=261 kcal/mol hairpin (Hp7) inserted after nucleotide position 32 in the native 59 UTR. (D) 293T cells were transfected with the indicated WT or
Hp7 plasmid shown in (C), and equivalent amounts of protein lysates were resolved by SDS-PAGE and Western blotted with anti-HA antibodies. S6RP
served as a loading control. RNA samples were examined by Northern blot analysis with a
32
P-labeled ORF36 DNA probe. GFP served as a co-
transfection control. 18S rRNA was used as a loading control. (E) Schematic of 59 UTR HA-ORF35-ORF36-HA indicating the nucleotide mutated to
weaken the Kozak context flanking the ORF35 AUG (35 KCS wkn). (F) 293T cells were transfected with the indicated WT or 35 KCS wkn plasmid shown
in (E), and equivalent amounts of protein lysates were resolved by SDS-PAGE and Western blotted with anti-HA antibodies. S6RP served as a loading
control. RNA samples were examined by Northern blot analysis with a
32
P-labeled ORF36 DNA probe. GFP served as a co-transfection control. 18S
rRNA was used as a loading control.
doi:10.1371/journal.ppat.1003156.g003
Non-Canonical Translation Initiation of KSHV ORF36
PLOS Pathogens | www.plospathogens.org 5 January 2013 | Volume 9 | Issue 1 | e1003156
Figure 4. Two uORFs mediate translational control of ORF35 and ORF36. (A) Schematic representation of the uORF organization indicating
the nucleotides mutated to disrupt the uORF1 AUG (D1). (B, D, F, H) 293T cells were transfected with the indicated wild-type or mutant plasmids, and
24 h post-transfection protein lysates were resolved by SDS-PAGE and Western blotted with anti-HA antibodies. S6RP or actin served as a loading
control. RNA samples were examined by Northern blot analysis with a
32
P-labeled ORF36 or GFP DNA probe. GFP served as a co-transfection control
Non-Canonical Translation Initiation of KSHV ORF36
PLOS Pathogens | www.plospathogens.org 6 January 2013 | Volume 9 | Issue 1 | e1003156
structure to stall the ribosome [48,49]. Therefore, we reasoned
that if ORF36 translation initiates using the same 40S ribosomal
subunit involved in translation of uORF2, then artificially
elongating uORF2 should inhibit ORF36 expression. This
experiment was performed on the construct backbone with the
ORF35 HA tag located internally to mimic the wild type length of
uORF2. Indeed, extension of uORF2 from 11 to 64 codons
(uORF2-long) resulted in a dramatic drop in ORF36 expression
(Figure 5A–B).
The rate-limiting step of reinitiation is postulated to be the re-
acquisition of the pre-initiation complex (eIF2-GTP-Met-tRNA
i
)
during ribosomal scanning, and thus a sequence of sufficient
length must be present downstream of the uORF for this to occur
[3,4]. We therefore evaluated how the distance between the
uORF2 stop codon and the subsequent start codon influences
reinitiation within the viral mRNA. Start codons in a favorable
Kozak context were inserted at two positions between the uORF2
stop codon and the ORF36 start site. We hypothesized that start
codons located close to uORF2 would not be as efficiently
recognized, and therefore they would not inhibit ORF36
expression. However, more distally located start codons should
better engage the initiation machinery, thereby preventing
translation from occurring at the authentic ORF36 start site. In
agreement with this prediction, a start codon positioned 16
nucleotides downstream of uORF2 did not strongly inhibit
ORF36 expression, whereas a methionine positioned 246 nucle-
otides after termination of uORF2 severely compromised ORF36
expression (Figure 5C–D). These data support the conclusion that
engagement of the ORF36 start codon is dependent on the
reacquisition of the pre-initiation complex after termination of
uORF2 translation.
The ORF36 start codon is accessed by linear scanning
Translation reinitiation at the internal ORF36 start codon could
occur either after linear scanning of the 40S complex through the
332-nucleotide intercistronic region between uORF2 and ORF36
or through shunting of the complex past this sequence and its
subsequent positioning proximal to ORF36. To distinguish
between these possibilities, two strong hairpins (Hp7) that impede
scanning were inserted within the 59-proximal or 39-proximal
coding region of ORF35 (Figure 5E). If the 40S ribosomal subunit
were shunted past these internal sequences, one or both of the
hairpins (depending on the location of the shunting sites) should
not compromise ORF36 translation [5,50]. However, we observed
a significant reduction in ORF36 expression in the presence of
either hairpin, arguing that the 40S complex scans in a linear
fashion through ORF35 (Figure 5F).
One potential caveat is that the insertion of t he hairpins
might dramatica lly a lter t he RNA folding landscape, disruptin g
a seconda ry struct ure required for shunting. To e xclude this
possibility, the single natural methionine codon present within
the coding region of ORF35, w as mutated to an arginine
(MidMut; Figure 5G). If th is internal sequence were bypassed
via shunting a fter uORF2 termination, the natural start co don
should not be able to compete with the ORF36 AUG for the
pre-initiation complex. Ho wever, we found that ORF36
expression was increased from the MidMut construct, arguing
against a shunting mechanism and further suggesting that t his
methionine no rmally engages a fraction of th e scan ning
ribosomes before they can reach the ORF36 star t codon
(Figure 5H). T ranslatio n of the peptide generated cann ot be
directly monitored due to the fact that it is only eight amino
acids. Collectively, these data support a model in which the
preferential recognition of uORF2 diverts ribosomes past the
ORF35 start codon, whereupon theyscaninalinearfashion
and reacquire the pre-initiation complex before reinitiating
translation at a downstream start codon.
Disruption of uORF2 alters ORF36 expression during lytic
infection
To confirm that uORF2 regulates ORF36 expression during
lytic KSHV infection, we engineered a uORF2 point mutant
(BAC16-D2; ATGRTTG) and a revertant mutant rescue
(BAC16-D2-MR; TTGRATG) within the recently described
KSHV BAC16 (Figure S5) [51]. BAC16-WT, BAC16-D2 and
BAC16-D2-MR were transfected into iSLK-PURO cells bearing a
doxycycline-inducible RTA expression system to enable lytic
reactivation [52]. Immunoblot analysis using polyclonal anti-sera
specific for ORF36 revealed that while ORF36 was readily
detectable at 48 h post-lytic reactivation in cells infected with WT
or the mutant rescue virus, deletion of the uORF2 start codon
severely compromised ORF36 expression (Figure 6). In contrast,
the uORF2 mutation had no effect on the levels of the KSHV
latent protein LANA or the lytic protein ORF57, confirming its
specificity for ORF36 (Figure 6). Thus, uORF2 plays a critical role
in enabling expression of the ORF36-encoded viral protein kinase
during lytic KSHV infection.
Conservation of uORFs within related c-herpesviruses
We examined whether the loci analogous to KSHV ORF35–
37 in several additional c-herpesviruses also possessed uORFs
within their 59 UTRs (Table S1). Indeed, we identified two 6–12
codon uORFs within the predicted 59 UTR of the locus in
Epstein Barr vir us (EBV), herpesvirus saimiri (HaSV-2) and
ateline herpesvirus 3 (AtHV-3) and one 11 codon uORF in good
context within the 59 UTR of the rhesus rhadinovirus (RRV)
locus (Figure 7A, 7B). The fact that the uORF po sitioning but not
the coding sequence is conserved supports the hypothesis that
their regulatory contribution relies on their ability to engage
translation complexes, rather than the actual peptide produced.
Furthermore, eigh t of the nine ORF35 homologs examined
contain #2 internal methionine codons, as would be predicted if
a termination- reinitiation mechanism was used to tran slate the
downstream gene (Table S1). Interestingly, in all c ases where two
uORFs are present, the first uORF is within a weaker Koza k
context than the second uORF, which overlaps the start codon of
each OR F35 homolog (EBV BGLF3.5, SaHV-2 ORF35, AtHV-
3 ORF35 and RRV ORF35). Thus, the conserv ation of uORFs
at this genetic locus suggests that using uORFs to enable
expression of a 39-proximal gene may be a conserved strategy for
translationa l control among these viruses. Howe ver, whether
these loci in deed encode a functional polycistronic mRNA and
are regulated by a similar uORF-based mechanism remains to be
experimentally verified.
in B, D and F. 18S rRNA was used as a loading control. (C) Diagram indicating the nucleotide mutations used to disrupt (D2) or weaken (KCS2 wkn) the
context of the uORF2 start codon. (E) The ORF35 start codon mutant (AUGRAGA; D35) and uORF fusion reporter RNAs are depicted schematically.
uORF1-D35 has the uORF1 stop codon disrupted (UGARUGG) while uORF2-D35 has one nucleotide deleted from uORF2 to shift the reading frame
+1(ARD). (G) Schematic of the bicistronic plasmid in which the ORF36 coding region was replaced with GFP. Because ORF36 partially overlaps with
ORF35, this required truncating the C-terminus of ORF35. The uORF2 AUG mutation to AGA is also shown.
doi:10.1371/journal.ppat.1003156.g004
Non-Canonical Translation Initiation of KSHV ORF36
PLOS Pathogens | www.plospathogens.org 7 January 2013 | Volume 9 | Issue 1 | e1003156
Figure 5. Ribosomal access to the ORF36 start codon occurs via linear scanning after termination of uORF translation. (A) Schematic
of the elongation of uORF2. The uORF2 stop codon and the four subsequent in-frame stop codons were mutated, artificially lengthening uORF2 from
11 to 64 amino acids. (B, D, F, H) 293T cells were transfected with the indicated wild-type or mutant plasmids, and 24 h post-transfection protein
lysates were resolved by SDS-PAGE and Western blotted with anti-HA antibodies. S6RP served as a loading control. RNA samples were examined by
Northern blot analysis with a
32
P-labeled ORF36 DNA probe. GFP served as a co-transfection control. 18S rRNA was used as a loading control. (C)
Schematic of AUG insertions at two locations in the ORF35 coding region, placed out of frame with ORF36. All AUGs were designed to have the two
dominant Kozak consensus sequence nucleotides (A at 23 and G at +4). (E) Schematic of the wild-type 59 UTR-HA-ORF35-ORF36-HA construct
Non-Canonical Translation Initiation of KSHV ORF36
PLOS Pathogens | www.plospathogens.org 8 January 2013 | Volume 9 | Issue 1 | e1003156
Discussion
In this study, we describe a novel functionally bicistronic viral
mRNA that is translated via a unique adaption of ribosomal
reinitiation. In other characterized examples of viral translation
via a reinitiation mechanism, expression of the downstream gene is
significantly tempered as a consequence of ribosomal engagement
at an upstream start codon [43,53–56]. Aside from being
bicistronic, translation from the KSHV ORF35–37 transcript is
unusual in that the protein product of ORF36 is at least as robustly
expressed as the 59 ORF35 despite the fact that the ORF35 start
codon is in a favorable sequence context. We reveal that a key
mechanism underlying this phenotype involves the position of a
short uORF overlapping the start codon of ORF35, which enables
translation of ORF36 (Figure 8). These findings provide the first
example of cap-dependent non-canonical translation in KSHV
and illustrate a novel strategy to translate polycistronic mRNA.
Several lines of evidence support the notion that ORF36 is
expressed in a cap-dependent manner as a 39-proximal cistron. No
transcript of an appropriate size with ORF36 as the 59-proximal
cistron was detected in KSHV-infected cells, in agreement with
the results of 59 RACE that indicated its transcription starts
upstream of ORF35 [26]. In addition, ORF36 protein expression
was detected after transfection of an in vitro transcribed bicistronic
RNA transcript. Finally, interfering with scanning from the 59
mRNA cap via insertion of a hairpin blocked ORF36 translation,
consistent with our failure to detect IRES activity within the locus.
This is in contrast with the sole functionally bicistronic KSHV
mRNA described to date, where an IRES is present within the
coding region of ORF72 allows for ORF71 expression in a cap-
independent manner [23–25].
Our results indicate that the ORF36 start codon is accessed via
a termination-reinitiation event after translation of uORF2. The
most 59 uORF (uORF1) resides in a weaker context than uORF2,
which overlaps the ORF35 start codon. Importantly, because the
stop codon of uORF1 overlaps with the start site of uORF2,
engagement of these uORFs is mutually exclusive. Therefore,
preferential initiation at uORF2 likely drives the enhanced
translation of ORF36 by causing ribosomes to bypass the
favorable ORF35 start codon. After translating uORF2, ribosomes
continue to scan through the following 332 nucleotides to reinitiate
at ORF36. In support of this model, lengthening uORF2 to
decrease the efficiency of reinitiation abrogated ORF36 expres-
sion. Furthermore, weakening the context surrounding the
uORF2 start codon enhanced ORF35 expression, suggesting that
the ORF35 start site is primarily reached by ribosomes that have
bypassed the AUG of uORF2, likely by leaky scanning. This
provides a rare example of a uORF enhancing translation of a
downstream major ORF.
To date, the only described short uORF that enables access to
the start codon of a downstream gene in a polycistronic transcript
was identified in hepatitis B virus (HBV). The HBV uORF,
dubbed C0, weakly inhibits the 59-proximal C ORF while
stimulating translation of the 39-proximal J and P proteins
[6,57]. However, the termination-reinitiation event described for
HBV may be facilitated by a shunting mechanism, as non-linear
scanning was found to occur in the homologous region in the
related duck hepatitis B virus [58]. This appears not to be the case
for ORF36 because insertion of strong hairpins within the coding
region upstream strongly compromises ORF36 expression, sug-
gesting that the ribosomes are scanning continuously from the 59
mRNA cap to the ORF36 start codon.
uORFs are common features found in the 59 UTRs of many
mammalian mRNAs [59]. They are widely recognized as cis-
regulatory elements and their presence generally correlates with
reduced translation of the major ORF by causing initiation to
instead occur by leaky scanning or a low-efficiency reinitiation
event, which is agreement with the function of uORF1 as a
negative regulator of ORF35 [4,59,60]. A few cases have been
described in which the ability of the uORF to repress downstream
translation is dependent on the amino acid sequence of the
encoded peptide [43–47]. For example, a uORF present in the 59
UTR of the human cytomegalovirus gp48 gene attenuates
downstream translation in a sequence-dependent fashion, likely
by delaying normal termination and preventing leaky scanning by
the 40S ribosomal subunit to reach the downstream AUG [43].
However, in general, engagement of the translation apparatus
rather than the translated product itself represses translation of the
major ORF. Indeed, regulation of the ORF35–37 transcript
appears independent of the uORF peptide sequence because the
59 HA-tagged construct had two amino acids mutated within
uORF2 yet still functioned to permit translation of ORF36.
Moreover, uORFs in homologous regions of the genome in related
c-herpesviruses lacked amino acid conservation. However, indi-
vidual amino acid substitutions in all of the uORF1 and uORF2
codons would be required to formally rule out a role for the
encoded peptides in the translational control of this mRNA.
Factors that influence the ability of a terminating ribosome to
resume scanning remain poorly understood. It has been shown
using chimeric preproinsulin mRNAs that efficient reinitiation
showing the location of the Hp7 insertion into the 59 or 39-proximal region of the ORF35 coding region. (G) Schematic of the wild-type 59 UTR-HA-
ORF35-ORF36-HA construct showing the location of the native AUG within the ORF35 codon region which has been mutated to AGA to generate the
MidMut construct.
doi:10.1371/journal.ppat.1003156.g005
Figure 6. Disruption of uORF2 alters ORF36 expression during
lytic infection. iSLK-PURO cells stably harboring the WT KSHV BAC16,
a uORF2 mutant BAC16 (BAC16-D2), or a mutant rescue BAC16 (BAC16-
D2-MR) were either untreated or lytically reactivated for 48 h. Protein
lysates were Western blotted with antibodies against ORF36, the viral
latent protein LANA and a viral lytic protein ORF57. S6RP served as a
loading control.
doi:10.1371/journal.ppat.1003156.g006
Non-Canonical Translation Initiation of KSHV ORF36
PLOS Pathogens | www.plospathogens.org 9 January 2013 | Volume 9 | Issue 1 | e1003156
progressively improves upon lengthening the intercistronic se-
quence up to 79 nucleotides [61]. Sufficient intercistronic
sequence length is thought to be necessary to allow time for the
scanning 40S ribosomal subunit to reacquire eIF2-GTP-Met-
tRNA
i
prior to encountering the downstream start codon,
although at what point the sequence length becomes inhibitory
is not known [4,49]. In the context of the viral ORF35–37
transcript, the ribosome is able to reinitiate translation with a high
frequency despite scanning 332 nucleotides after terminating
translation of uORF2, indicating that intergenic regions signifi-
cantly longer than 79 nucleotides still enable reinitiation.
Interestingly, a prior report identified a translational enhancer
element within the tricistronic S1 mRNA of avian reovirus that
functions to increase expression of a downstream cistron. This
occurs as a consequence of sequence complementarity to 18S
rRNA, which is reminiscent of the prokaryotic Shine-Dalgarno
sequence [62,63]. A similar strategy of having 18S rRNA
complementarity within a bicistronic mRNA was also found to
enhance the ability of the minor calicivirus capsid protein VP2 to
be translated by reinitiation [56,64]. Whether enhancer elements
exist in the KSHV uORF-ORF36 intercistronic region to facilitate
translation at the downstream cistron remains to be determined.
However, no critical reinitiation element exists downstream of the
ORF36 start codon, as replacement of these sequences with GFP
does not block its translation. This is distinct from the termination-
reinitiation mechanism described for certain retrotransposons,
which require complex downstream secondary structures [65].
The question arises as to what benefit is conferred by this finely
tuned strategy of translational control for both ORF35 and
ORF36. One possibility is that ORF35 and ORF36 are required
at different points during lytic infection and that during the course
of viral replication, conditions arise that favor translation of one
Figure 7. uORF1 and uORF2 are conserved among select c-herpesviruses. Alignment using ClustalW2 of (A) uORF1 or (B) uORF2 from KSHV,
EBV, SaHV-2, AtHV-3 and RRV. Consensus nucleotides are indicated (three: asterisk; two: dot). uORF length is indicated on the right, and the uORF
start codons are boxed.
doi:10.1371/journal.ppat.1003156.g007
Figure 8. Model of the mechanisms of translation initiation used to translate ORF35, ORF36 and ORF37. ORF35 translation is repressed
by uORF1 and uORF2. ORF36 is translated from a termination-reinitiation event after translation of uORF2. ORF37 is translated from an ORF37-specific
transcript generated from a promoter located within the coding region of ORF36.
doi:10.1371/journal.ppat.1003156.g008
Non-Canonical Translation Initiation of KSHV ORF36
PLOS Pathogens | www.plospathogens.org 10 January 2013 | Volume 9 | Issue 1 | e1003156
protein versus the other. This type of regulation occurs in the well-
characterized Saccharomyces cerevisiae GCN4 locus, where four short
uORFs modulate reinitiation at the major ORF depending on the
level of eIF2a phosphorylation [66–68]. Indeed, certain types of
cell stress have also been shown to influence non-canonical
translation of the cytomegalovirus UL138 gene [69]. Alternatively,
the uORFs may confer a tight level of regulation to ensure that
ORF36 is not synthesized at deleterious levels during infection.
For example, an EBV mutant that over-produces BGLF4 (the
ORF36 homolog) exhibited defects in viral replication [39].
Determining if and how this non-canonical mechanism of
translational control influences the KSHV lifecycle will be an
important future endeavor.
Materials and Methods
Plasmid constructs
pcDNA3.1(+)-ORF35–37 was generated by PCR-amplifying
the ORF35–37 genetic locus from the KSHV-BAC36 (kindly
provided by G. Pari [70]) and cloning it into the EcoRI/NotI sites
of pcDNA3.1(+) (Invitrogen). pcDNA3.1(+)-59 UTR-HA-ORF35
was assembled in a two-step process starting with the addition of
the N-terminal HA tag after the native start ATG (nucleotide
sequence: GCTTACCCATACGATGTAC CTGACTATGCG)
to the coding sequence amplified from the KSHV genome as
above, followed by an overlap extension PCR to insert the 72
nucleotide (nt) native 59 UTR. The final product was then inserted
into the pcDNA3.1(+) EcoRI/NotI restriction sites. pcDNA3.1(+)-
ORF36 was constructed by PCR-amplification of the ORF36
coding sequence or to add the in frame C-terminal HA tag
(GCTTACCCATACGATGTACCTG ACTATGCGTGA) fol-
lowed by insertion into EcoR1/Not1 restriction sites. pCDEF3-
ORF37 is described elsewhere [37]. HA-ORF35-ORF36-HA was
amplified from the KSHV-BAC36 using primers with additional
HA tag sequences and inserted into the EcoR1/Not1 sites of
pcDNA3.1(+). This was followed by scarless insertion of the native
59 UTR via two-step sequential overlap extension PCR [70]. To
construct 59 UTR-ORF35iHA-ORF36-HA, a backbone construct
consisting of 59UTR ORF35-ORF36-HA was first generated by
PCR-amplification from the KSHV-BAC36 with HA tag
sequences solely for ORF36 and inserted into the EcoR1/Not1
sites of pcDNA3.1(+). This construct was then linearized by
inverse PCR at nucleotide position 55795 followed by ligation-
independent cloning using InFusion (Clonetech) with primers
consisting of an HA tag flanked by 15 base pair regions of vector
overlap. A stable hairpin structure (Hp7 sequence: GG-
GGCGCGTGGTGGCGGCTGCAGCCGCCACCACGCGCC-
CC, [42]) was inserted into the 59 UTR at nucleotide position
55599, or within the ORF35 coding region at nucleotide position
55662 and at position 55862 [18]. For the 59 UTR HA-
ORF35D96-HA-GFP construct, HA-GFP was inserted between
the NotI/XbaI restriction sites in pcDNA3.1(+), and the 59 UTR-
HA-ORF35 D96 fragment was then inserted between the EcoRI/
NotI restriction sites upstream of HA-GFP. Two bicistronic, dual
luciferase constructs, a negative control (DEMCV; mutated IRES
sequence) and a positive control (DEMCV element+functional
EMCV) were kindly provided by P. Sarnow (Stanford University)
[11,41]. ORF72, ORF34–36, ORF35–36 and ORF35 PCR
amplicons were inserted into the EcoRI restriction site down-
stream of the DEMCV element and upstream of firefly luciferase.
The primers used to generate these constructs are listed in Table
S2.
Where specified, parental plasmids were subjected to site-
directed mutagenesis using the QuikChange kit (Stratagene) as per
the manufacturer’s protocol. The context of the ORF35 start
codon was weakened by mutating the wild type AgaAUGG to
UgaAUGG (35 KCS wkn). uORF1 and uORF2 mutants
(designated D1 and D2) were generated by substituting the AUG
start codon with AGA or UGA, respectively. The uORF2 Kozak
context was weakened by mutating the wild-type AccAUGA to
UuuAUGA (KCS2 wkn). The ORF35 start codon was disrupted
by mutating the wild type AUG to AGA (D35). The uORF1 fusion
to D35 was generated by mutating the uORF1 stop codon UGA to
UGG (uORF1-D35). The uORF2 fusion to D35 was generated by
deleting one nucleotide (A) located immediately prior to the
ORF35 start codon (uORF2-D35). Two codons within in the
ORF35 coding region were converted to AUGs in a strong
context: (1) AccAACU to AccAUGG and (2) AauUUUG to
AauAUGG. The native AUG residing at location 55778-80 within
the ORF35 coding region was mutated to an AGA (MidMut) [18].
uORF2 was lengthened from 11 to 64 codons by mutating the first
UAA stop codon to AGA, the second UAA stop codon to CAA,
the third UGA stop codon to CGA, and the fourth and fifth UAG
stop codon to CAG, resulting in the use of the next downstream
stop codon (uORF2-long).
BAC mutagenesis and DNA isolation
The KSHV BAC16 was modified as described previously [51]
use a two-step scarless Red recombination system [71]. Briefly,
BAC16 was introduced in GS1783 E. coli strain by electroporation
(0.1 cm cuvette, 1.8 kV, 200 V 25
mF). A linear DNA fragment
encompassing a kanamycin resistance expression cassette, an I-SceI
restriction site and flanking sequence derived from KSHV genomic
DNA was generated by PCR and subsequently electroporated into
GS1783 E. coli harboring BAC16 and transiently expressing gam, bet
and exo. Integration of the Kan
R
/I-SceI cassette was verified by
PCR and restriction enzyme digestion of the purified BAC16 DNA.
The second recombination event between the duplicated sequences
resulted in the loss Kan
R
/I-SceI cassette and the seamless
recirculation of the BAC16 DNA, yielding kanamycin-sensitive
colonies that were screened by replica plating. BAC16 DNA was
purified from chloramphenicol-resistant colonies using the Nucleo-
Bond 100 (Machery-Nagel) as per the manufactures instructions.
Cells, transfections and drug treatment
Human embryonic kidney 293T cells were maintained in
Dulbecco’s modified Eagle’s medium (DMEM) supplemented with
10% fetal bovine serum (FBS) (Gibco). The iSLK-PURO KSHV-
negative endothelial cell lines [51,52] were maintained in DMEM
supplemented with 10% FBS, penicillin (100 U/ml, Gibco) and
streptomycin (100
mg/ml, Gibco). To induce lytic reactivation of
KSHV, iSLK-PURO cells were treated with doxycycline (1
mg/
ml, BD Biosciences) and sodium butyrate (1 mM, Sigma). TREx
BCBL1-RTA [72] cells were maintained in RPMI supplemented
with 10% FBS, L-glutamine (200
mM, Invitrogen), penicillin
(100 U/ml), streptomycin (100
mg/ml) and hygromycin B
(50 mg/ml, Omega Scientific). To induce lytic reactivation of
KSHV, TREx BCBL1-RTA cells were split to 1610
6
cells/ml and
induced 24 h later with 2-O-tetradecanoylphorbol-13-acetate
(TPA; 20 ng/ml, Sigma), doxycycline (1
mg/ml) and ionomycin
(500 ng/ml, Fisher Scientific) [73].
For DNA transfections, constructs (1
mg/ml) were transfected
into subconfluent 293T cells grown in 12-well plates, either alone
or in combination with 0.1
mg/ml GFP as a co-transfection control
using Effectene reagent (Qiagen) or Lipofectamine 2000 (Invitro-
gen) following the manufacturers protocols. For RNA transfec-
tions, 3
mg/ml of mRNA in vitro transcribed using the mMessage
mMachine kit (Ambion) and polyadenylated with yeast poly(A)
Non-Canonical Translation Initiation of KSHV ORF36
PLOS Pathogens | www.plospathogens.org 11 January 2013 | Volume 9 | Issue 1 | e1003156
polymerase (Epicentre Technologies) was transfected into ,90%
confluent 293T cells grown in 12-well plates using Lipofectamine
2000. TREx BCBL1-RTA cells were transfected with 20
mgof
DNA per 10
7
cells via electroporation (250 V, 960 mF) with a
Gene Pulser II (Bio-Rad, Hercules, CA).
For BAC transfections and reconstitution, ,70% confluent
iSLK-PURO cells were grown in a 24-well plate followed by
transfection with 500 ng of BAC DNA via FuGENE 6 (Promega),
after 6 h, a further 500 ng BAC DNA was transfected with
Effectene, following the manufacturers protocols and subsequently
selected with 800
mg/ml hygromycin B to establish a pure
population. iSLK-PURO-BAC16 cells were then induced with
doxycycline (1
mg/mL) and sodium butyrate (1 mM) to enter the
lytic cycle of KSHV replication.
Luciferase assays
Luciferase activities were determined using the dual-luciferase
assay system (Promega) and a bench-top luminometer according to
manufacturer’s protocol. IRES activity was calculated by obtaining
the firefly/Renilla activity ratios for each of constructs containing the
putative IRES sequences or the positive controls and dividing them
by the ratio obtained from the DEMCV negative control. The value
of fold activation represents at least three independent experiments
with triplicate samples in each electroporation. Error bars represent
the standard deviation between replicates.
Western and Northern blots
Protein lysates were prepared in RIPA buffer [50 mM Tris-HCl
(pH 8.0), 150 mM NaCl, 1% (v/v) Nonidet P-40, 0.5% (w/v)
sodium deoxycholate, 0.1% (w/v) sodium dodecyl sulfate (SDS)]
containing protease inhibitors (Roche), and quantified by Bradford
assay. Equivalent quantities of each sample were resolved by SDS-
PAGE, transferred to a polyvinylidene difluoride membrane and
incubated with the following primary antibodies: mouse mono-
clonal GFP (1:2000, BD Biosciences), mouse monoclonal HA
(1:2000, Invitrogen), rabbit polyclonal ORF36 (1:5000, kindly
provided by Y. Izumiya [27]), goat polyclonal horseradish
peroxidase (HRP)-conjugated actin (1:500, Santa Cruz Biotech-
nology), rabbit polyclonal SOX J5803 (1:5000, [38]), rabbit
polyclonal ORF57 (1:5000, kindly provided by Z. Zheng [74],
rabbit polyclonal LANA #6 (1:1000) or mouse monoclonal S6RP
(1:1000, Cell Signaling) followed by incubation with HRP-
conjugated goat anti-mouse or goat anti-rabbit secondary
antibodies (1:5000 dilution) (Southern Biotechnology Associates).
Total cellular RNA was isolated for Northern blotting using
RNA-Bee (Tel-Test). The RNA was then resolved on 1.2–1.5%
agarose-formaldehyde gels, transferred to Nytran nylon mem-
branes (Whatman) and probed with
32
P-labeled DNA probes
made using either the RediPrime II random prime labeling kit (GE
Healthcare) or the Decaprime II kit (Ambion). Strand-specific
riboprobes specific for ORF36 and ORF37 were synthesized using
the Maxiscript T7 kit (Ambion) with
32
P-labelled UTP. The
probes used for Northern blot analysis spanned the following
regions according to the nucleotide positions described by Russo et
al. [18]: ORF35 probe: 55639–56091, ORF36 full-length probe:
55976–57310: ORF36-specific probe: 56093–56805: and ORF37
probe: 57273–58733. Results in each figure are representative of
at least three independent replicates of each experiment.
Sequence alignments
The uORF1 and uORF2 alignments were generated from data
obtained from the NIAID Virus Pathogen Database and Analysis
Resource (ViPR) online through the web site at http://www.
viprbrc.org.
Supporting Information
Figure S1 Translation of ORF36 is dependent on the 59
mRNA cap yet not strongly inhibited by the ORF35 start
codon. (A–B) 293T cells were transfected with the indicated in
vitro transcribed capped and polyadenylated RNA. The wild type
construct consists of 59UTR HA-ORF35-ORF36-HA. Hp7
contains a DG=261 kcal/mol hairpin inserted after nucleotide
position 32 in the native 59 UTR. 35 KCS wkn was generated by
mutating AgaAUGGRUgaAUGG to weaken the Kozak context
flanking the ORF35 AUG. Protein lysates were harvested 4 h
post-transfection, resolved by SDS-PAGE and detected with anti-
HA antibodies. The ribosomal protein S6RP served as a loading
control for both experiments.
(EPS)
Figure S2 The location of the HA tag does not influence
ORF35 expression or uORF1 regulation of ORF35. (A)
Schematic representation of the uORF1 mutations introduced into
a construct with the native 59 UTR-ORF35-ORF36-HA with an
HA tag positioned internally and in-frame with ORF35 (WT-iHA).
(B) 293T cells were co-transfected with the indicated WT-iHA, D1-
iHA and GFP. Protein lysates were harvested 24 h post transfection,
resolved by SDS-PAGE and Western blotted with anti-HA
antibodies to detect both ORF35 and ORF36. S6RP served as a
loading control. RNA samples were examined by Northern blot
analysis with a
32
P-labeled ORF36 DNA probe. GFP served as a co-
transfection control. 18S rRNA was used as a loading control.
(EPS)
Figure S3 uORF2 regulates translation of ORF35 and
ORF36. (A) Diagram indicating the nucleotide mutations used to
disrupt (D2) or weaken (KCS2 wkn) the context of the uORF2
start codon. (B) 293T cells were transfected with in vitro transcribed
capped and polyadenylated RNA to compare the wild type
bicistronic mRNA with the uORF2 start codon mutants. Protein
lysates were harvested 4 h post-transfection, resolved by SDS-
PAGE and detected with anti-HA antibodies. The ribosomal
protein S6RP served as a loading control for both experiments.
(EPS)
Figure S4 The location of the HA tag does not influence
bicistronic coding capacity. (A) Schematic representation of
the uORF2 mutations introduced into a construct with the native
59 UTR-ORF35-ORF36-HA with an HA tag positioned inter-
nally and in-frame with ORF35 (WT-iHA). (B) 293T cells were co-
transfected with the indicated WT-iHA, D2-iHA or KCS2 wkn-
iHA and GFP. Protein lysates were harvested 24 h post
transfection, resolved by SDS-PAGE and Western blotted with
anti-HA antibodies to detect both ORF35 and ORF36. S6RP
served as a loading control. RNA samples were examined by
Northern blot analysis with a
32
P-labeled ORF36 DNA probe.
GFP served as a co-transfection control. 18S rRNA was used as a
loading control.
(EPS)
Figure S5 Analysis of BAC16 uORF2 mutant and mutant
rescue clones. BAC16 WT, uORF2 mutant (BAC16-D2), or
mutant rescue (BAC16-D2-MR) DNA was isolated from GS1783
Escherichia coli, digested with NheI and subjected to pulse-field gel
electrophoresis. M, 1 Kb marker (Biorad) and MidRange I PFG
marker (NEB). Expected fragment sizes in base pairs: 35000,
28862, 25693, 20742, 9062, 8852, 7788, 7575, 6376, 5879, 5011,
4739, 4553, 4378, 3838 and 1663. NheI digestion does not
introduce or alter any NheI recognition sites.
(EPS)
Non-Canonical Translation Initiation of KSHV ORF36
PLOS Pathogens | www.plospathogens.org 12 January 2013 | Volume 9 | Issue 1 | e1003156
Table S1 Analysis of the region upstream of ORF35 in
the genomes of c-herpesviruses with the conserved
ORF34–37 genetic locus. A representative strain of each c-
herpesvirus deposited in the Virus Pathogen Database and
Analysis Resource that retains the arrangement of ORF34–37
genetic locus was included in the sequence analysis. The region
upstream of the ORF35 start codon ( #100 nucleotides) was used
as an arbitrary prediction of the 59UTR. The number of internal
AUG codons represents those located between the uORF2 stop
codon and the start codon of ORF36 within each respective
mRNA.
(DOCX)
Table S2 List of oligonucleotide primers. List of primer
used to generate constructs in this study.
(DOCX)
Acknowledgments
We would like to thank Drs. Peter Sarnow, Yoshihiro Izumiya, Zhi-Ming
Zheng and Gregory Pari for their generous sharing of reagents and Dr.
Carolina Arias for technical assistance. We are grateful to all members of
the Glaunsinger laboratory for helpful comments and critical reading of
this manuscript.
Author Contributions
Conceived and designed the experiments: LMK BAG, KFB. Performed
the experiments: LMK KFB. Analyzed the data: LMK KFB BAG.
Contributed reagents/materials/analysis tools: JUJ. Wrote the paper:
LMK BAG. Perfor med experiments related to figures 1–7: LMK.
Performed experiments related to figure 6: KFB.
References
1. Gebauer F, Hentze MW (2004) Molecular mechanisms of translational control.
Nat Rev Mol Cell Biol 5: 827–835.
2. Kozak M (1986) Point mutations define a sequence flanking the AUG initiator
codon that modulates translation by eukaryotic ribosomes. Cell 44: 283–292.
3. Kozak M (2001) Constraints on reinitiation of translation in mammals. Nucleic
Acids Res 29: 5226–5232.
4. Morris DR, Geballe AP (2000) Upstream open reading frames as regulators of
mRNA translation. Mol Cell Biol 20: 8635–8642.
5. Futterer J, Kiss-Laszlo Z, Hohn T (1993) Nonlinear ribosome migration on
cauliflower mosaic virus 35S RNA. Cell 73: 789–802.
6. Cao F, Tavis JE (2011) RNA elements directing translation of the duck hepatitis
B Virus polymerase via ribosomal shunting. J Viro l 85: 6343–6352.
7. Yueh A, Schneider RJ (2000) Translation by ribosome shunting on adenovirus
and hsp70 mRNAs facilitated by complementarity to 18S rRNA. Genes Dev 14:
414–421.
8. Pestova TV, Kolupaeva VG, Lomakin IB, Pilipenko EV, Shatsky IN, et al.
(2001) Molecular mechanisms of translation initiation in eukaryotes. Proc Natl
Acad Sci U S A 98: 7029–7036.
9. Jackson RJ (2005) Alternative mechanism s of initiati ng translation of
mammalian mRNAs. Biochem Soc Trans 33: 1231–1241.
10. Pelletier J, Sonenberg N (1988) Internal initiation of translation of eukaryotic
mRNA directed by a sequence derived from poliovirus RNA. Nature 334: 320–325.
11. Johannes G, Carter MS, Eisen MB, Brown PO, Sarnow P (1999) Identification
of eukaryotic mRNAs that are translated at reduced cap binding complex eIF4F
concentrations using a cDNA microarray. Proc Natl Acad Sci U S A 96: 13118–
13123.
12. Tsukiyama-Kohara K, Iizuka N, Kohara M, Nomoto A (1992) Internal
ribosome entry site within hepatitis C virus RNA. J Virol 66: 1476–1483.
13. Wilson JE, Powell MJ, Hoover SE, Sarnow P (2000) Naturally occurring
dicistronic cricket paralysis virus RNA is regulated by two internal ribosome
entry sites. Mol Cell Biol 20: 4990–4999.
14. Gale M, Jr., Tan SL, Katze MG (2000) Translational control of viral gene
expression in eukaryotes. Microbiol Mol Biol Rev 64: 239–280.
15. Soulier J, Grollet L, Oksenhendler E, Cacoub P, Cazals-Hatem D, et al. (1995)
Kaposi’s sarcoma-associated herpesvirus-like DNA sequences in multicentric
Castleman’s disease. Blood 86: 1276–1280.
16. Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM (1995) Kaposi’s
sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-
cavity-based lymphomas. N Engl J Med 332: 1186–1191.
17. Chang Y, Cesarman E, Pessin MS, Lee F, Culpeppe r J, et al. (1994)
Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi’s
sarcoma. Science 266: 1865–1869.
18. Russo JJ, Bohenzky RA, Chien MC, Chen J, Yan M, et al. (1996) Nucleotide
sequence of the Kaposi sarcoma-associated herpesvirus (HHV8). Proc Natl Acad
Sci U S A 93: 14862–14867.
19. Zheng ZM (2003) Split genes and their expression in Kaposi’s sarcoma-
associated herpesvirus. Rev Med Virol 13: 173–184.
20. Nador RG, Milligan LL, Flore O, Wang X, Arvanitakis L, et al. (2001)
Expression of Kaposi’s sarcoma-associated herp esvirus G protein-coupled
receptor monocistronic and bicistronic transcripts in primary effusion lympho-
mas. Virology 287: 62–70.
21. Majerciak V, Yamanegi K, Zheng ZM (2006) Gene structure and expression of
Kaposi’s sarcoma-associated herpesvirus ORF56, ORF57, ORF58, and ORF59.
J Virol 80: 11968–11981.
22. Talbot SJ, Weiss RA, Kellam P, Boshoff C (1999) Transcriptional analysis of
human herpesvirus-8 open reading frames 71, 72, 73, K14, and 74 in a primary
effusion lymphoma cell line. Virology 257: 84–94.
23. Low W, Harries M, Ye H, Du MQ, Boshoff C, et al. (2001) Internal ribosome
entry site regulates translation of Kaposi’s sarcoma-associated herpesvirus
FLICE inhibitory protein. J Virol 75: 2938–2945.
24. Grundhoff A, Ganem D (2001) Mechanisms governing expression of the v-FLIP
gene of Kaposi’s sarcoma-associated herpesvirus. J Virol 75: 1857–1863.
25. Bieleski L, Talbot SJ (2001) Kaposi’s sarcoma-associated herpesvirus vCyclin open
reading frame contains an internal ribosome entry site. J Virol 75: 1864–1869.
26. Haque M, Wang V, Davis DA, Zheng ZM, Yarchoan R (2006) Genetic
organization and hypoxic activation of the Kaposi’s sarcoma-associated
herpesvirus ORF34–37 gene cluster. J Virol 80: 7037–7051.
27. Izumiya Y, Izumiya C, Van Geelen A, Wang DH, Lam KS, et al. (2007)
Kaposi’s sarcoma-associated herpesvirus-encoded protein kinase and its
interaction with K-bZIP. J Virol 81: 1072–1082.
28. Yamauchi Y, Wada K, Goshima F, Takakuwa H, Daikoku T, et al. (2001) The
UL14 protein of herpes simplex virus type 2 translocates the minor capsid
protein VP26 and the DNA cleavage and packaging UL33 protein into the
nucleus of coexpressing cells. J Gen Virol 82: 321–330.
29. Yamauchi Y, Daikoku T, Goshima F, Nishiyama Y (2003) Herpes simplex virus
UL14 protein blocks apoptosis. Microbiol Immunol 47: 685–689.
30. Hamza MS, Reyes RA, Izumiya Y, Wisdom R, Kung HJ, et al. (2004) ORF36
protein kinase of Kap osi’s sarcoma herpesvirus activates the c-Jun N-terminal
kinase signaling pathway. J Biol Chem 279: 38325–38330.
31. Park J, Lee D, Seo T, Chung J, Choe J (2000) Kaposi’s sarcoma -associated
herpesvirus (human herpesvirus-8) open reading frame 36 protein is a serine
protein kinase. J Gen Virol 81: 1067–1071.
32. Kedes DH, G anem D (1997) Sensitivity of Kaposi’s sarcoma-associated
herpesvirus replication to antiviral drugs. Implications for potential therapy.
J Clin Invest 99: 2082–2086.
33. Casper C, Krantz EM, Corey L, Kuntz SR, Wang J, et al. (2008) Valganciclovir
for suppression of human herpesvirus-8 replication: a randomized, double-blind,
placebo-controlled, crossover trial. J Infect Dis 198: 23–30.
34. Cannon JS, Ham zeh F, Moore S, Nicholas J, Ambinder RF (1999) Human
herpesvirus 8-encoded thymidine kinase and phosphotransferase homolo gues
confer sensitivity to ganciclovir. J Virol 73: 4786–4793.
35. Martin DF, Kuppermann BD, Wolitz RA, Palestine AG, Li H, et al. (1999) Oral
ganciclovir for patients with cytomegalovirus retinitis treated with a ganciclovir
implant. Roche Ganciclovir Study Group. N Engl J Med 340: 1063–1070.
36. Covarrubias S, Gaglia MM, Kumar GR, Wong W, Jackson AO, et al. (2011)
Coordinated destruction of cellular messages in translation complexes by the
gammaherpesvirus host shutoff factor and the Mammalian exonuclease xrn1.
PLoS Pathog 7: e1002339.
37. Glaunsinger B, Ganem D (2004) Lytic KSHV infection inhibits host gene
expression by accelerating global mRNA turnover. Mol Cell 13: 713–723.
38. Glaunsinger B, Chavez L, Ganem D (2005) The exonuclease and host shutoff
functions of the SOX protein of Kaposi’s sarcoma-associated herpesvirus are
genetically separable. J Virol 79: 7396–7401.
39. Feederle R, Mehl-Lautscham AM, Bannert H, Delecluse HJ (2009) The Epstein-
Barr virus protein kinase BGLF4 and the exonuclease BGLF5 have opposite
effects on the regulation of viral protein production. J Virol 83: 10877–10891.
40. Masa SR, Lando R, Sarid R (2008) Transcriptional regulation of the open
reading frame 35 encoded by Kaposi’s sarcoma-associated herpesvirus. Virology
371: 14–31.
41. Chen CY, Sarnow P (1995) Initiation of protein synthesis by the eukaryotic
translational apparatus on circular RNAs. Science 268: 415–417.
42. Kozak M (1 989) Circumstances and mechanisms of inhibition of translation by
secondary structure in eucaryotic mRNAs. Mol Cell Biol 9: 5134–5142.
43. Cao J, Geballe AP (1995) Translational inhibition by a human cytomegalovirus
upstream open reading frame despite inefficient utilization of its AUG codon.
J Virol 69: 1030–1036.
44. Mize GJ, Ruan H, Low JJ, Morris DR (1998) The inhibitory upstream open
reading frame from mammalian S-adenosylmethionine decarboxylase mRNA
has a strict sequence specificity in critical positions. J Biol Chem 273: 32500–
32505.
Non-Canonical Translation Initiation of KSHV ORF36
PLOS Pathogens | www.plospathogens.org 13 January 2013 | Volume 9 | Issue 1 | e1003156
45. Lovett PS, Rogers EJ (1996) Ribosome regulation by the nascent peptide.
Microbiol Rev 60: 366–385.
46. Cao J, Geballe AP (1996) Coding sequence-dependent ribosomal arrest at
termination of tran slation. Mol Cell Biol 16: 603–608.
47. Luo Z, Sachs MS (1996) Role of an upstream open reading frame in mediating
arginine-specific translational control in Neurospora crassa. J Bacteriol 178:
2172–2177.
48. Luukkonen BG, Tan W, Schwartz S (1995) Efficiency of reinitiation of
translation on human immunodeficiency virus type 1 mRNAs is determined by
the length of the upstream open reading frame and by intercistronic distance.
J Virol 69: 4086–4094.
49. Donze O, Damay P, Spahr PF (1995) The first and third uORFs in RSV leader
RNA are efficiently translated: implications for translational regulation and viral
RNA packaging. Nucleic Acids Res 23: 861–868.
50. Dominguez DI, Ryabova LA, Pooggin MM, Schmidt-Puchta W, Futterer J, et
al. (1998) Ribosome shunting in caulif lower mosaic virus. Identification of an
essential and sufficient structura l element. J Biol Chem 273: 3669–3678.
51. Brulois KF, Chang H, Lee AS, Ensser A, Wong LY, et al. (2012) Construction
and manipulation of a new Kaposi’s sarcoma-associated herpesvirus Bacterial
artificial chromosome clone. J Virol 86: 9708–20.
52. Myoung J, Ganem D (2011) Generation of a doxycycline-inducible KSHV
producer cell line of endothelial origin: maintenance of tight latency with
efficient reactivation upon induction. J Virol Methods 174: 12–21.
53. Horvath CM, Williams MA, Lamb RA (1990) Eukaryotic coupled translation of
tandem cistrons: identification of the influenza B virus BM2 polypeptide. Embo J
9: 2639–2647.
54. Powell ML, Napthine S , Jackson RJ, Brierley I, Brown TD (2008)
Characterization of the termination-reinitiation strategy employed in the
expression of influenza B virus BM2 protein. Rna 14: 2394–2406.
55. Ahmadian G, Randhawa JS, Easton AJ (2000) Expression of the ORF-2 protein
of the human respiratory syncytial virus M2 gene is initiated by a ribosomal
termination-dependent reinitiation mechanism. Embo J 19: 2681–2689.
56. Meyers G (2003) Translatio n of the minor capsid protein of a calicivirus is
initiated by a novel termination-dependent reinitiation mechanism. J Biol Chem
278: 34051–34060.
57. Chen A, Kao YF, Brown CM (2005) Translation of the first upstream ORF in
the hepatitis B virus pregenomic RNA modulates translation at the core and
polymerase initiation codons. Nucleic Acids Res 33: 1169–1181.
58. Sen N, Cao F, Tavis JE (2004) Translation of duck hepatitis B virus reverse
transcriptase by ribosomal shunting. J Virol 78: 11751–11757.
59. Calvo SE, Pagliarini DJ, Mootha VK (2009) Upstream open reading frames
cause widespread reduction of protein expression and are polymorphic among
humans. Proc Natl Acad Sci U S A 106: 7507–7512.
60. Kozak M (1991) An analysis of vertebrate mRNA sequences: intimations of
translational control. J Cell Biol 115: 887–903.
61. Kozak M (1987) Effects of intercistronic length on the efficiency of reinitiation by
eucaryotic ribosomes. Mol Cell Biol 7: 3438–3445.
62. Racine T, Duncan R (2010) Facilitated leaky scanning and atypical ribosome
shunting direct downstream translation initiation on the tricistronic S1 mRNA of
avian reovirus. Nucleic Acids Res 38: 7260–7272.
63. Scheper GC, Voorma HO, Thomas AA (1994) Basepairing with 18S ribosomal
RNA in internal initiation of translation. FEBS Lett 352: 271–275.
64. Meyers G (2007) Characterization of the sequence element directing translation
reinitiation in RNA of the calicivirus rabbit hemorrhagic disease virus. J Virol
81: 9623–9632.
65. Kojima KK, Matsumoto T, Fujiwara H (2005) Eukaryotic transla tional coupling
in UAAUG stop-start codons for the bicistronic RNA translation of the non-long
terminal repeat retrotransposon SART1. Mol Cell Biol 25: 7675–7686.
66. Gaba A, Wang Z, Krishnamoorthy T, Hinnebusch AG, Sachs MS (2001)
Physical evidence for distinct mechanisms of translational control by upstream
open reading frames. EMBO J 20: 6453–6463.
67. Hinnebusch AG (1993) Gene-specific translational control of the yeast GCN4
gene by phosphorylation of eukaryotic initiation factor 2. Mol Microbiol 10:
215–223.
68. Hinnebusch AG (2005) Translational regulation of GCN4 and the general
amino acid control of yeast. Annu Rev Microbiol 59: 407–450.
69. Grainger L, Cicchini L, Rak M, Petrucelli A, Fitzgerald KD, et al. (2010) Stress-
inducible alternative translation initiation of human cytomegalovirus latency
protein pUL138. J Virol 84: 9472–9486.
70. Zhou FC, Zhang YJ, Deng JH, Wang XP, Pan HY, et al. (2002) Efficient
infection by a recombinant Kaposi’s sarcoma-associated herpesvirus cloned in a
bacterial artificial chromosome: application for genetic analysis. J Virol 76:
6185–6196.
71. Tischer BK, Smith GA, Osterrieder N (2010) En passant mutagenesis: a two step
markerless red recombination system. Methods Mol Biol 634: 421–430.
72. Nakamura H, Lu M, Gwack Y, Souvlis J, Zeichner SL, et al. (2003) Global
changes in Kaposi’s sarcoma-associated virus gene expression patterns following
expression of a tetracycline-inducible Rta transactivator. J Virol 77: 4205–4220.
73. Arias C, Walsh D, Harbell J, Wilson AC, Mohr I (2009) Activation of host
translational control pathways by a viral developmental swit ch. PLoS Pathog 5:
e1000334.
74. Majerciak V, Pripuzova N, McCoy JP, Gao SJ, Zheng ZM (2007) Targe ted
disruption of Kaposi’s sarcoma-associated herpesvirus ORF57 in the viral
genome is detrimental for the expression of ORF59, K8alpha, and K8.1 and the
production of infectious virus. J Virol 81: 1062–1071.
Non-Canonical Translation Initiation of KSHV ORF36
PLOS Pathogens | www.plospathogens.org 14 January 2013 | Volume 9 | Issue 1 | e1003156
    • "Indeed, internal translation, particularly of mammalian genes, is complex, varied, and poorly elu- cidated [18] , and therefore these putative novel observations will require extensive further studies. Secondly, to further validate our findings that internal translation is dependent on a functional cap, ribosomal scanning or GJA1-43k translation, we inserted a highly stable hairpin (HP7) into the 5′UTR (ΔG = −61 kcal/ mol; see Additional file 1: Methods and Additional file 2:Figure S1 ), previously described to efficiently prevent ribosomal scanning and cap-dependent translation [21,22]. Additionally, to generate a control readout of capindependent translation within the same transcript, we inserted (downstream of Cx43) both the encephalomyocarditis virus (EMCV) IRES sequence plus an enhanced green fluorescent protein (EGFP) reporter. "
    [Show abstract] [Hide abstract] ABSTRACT: Background Connexin 43 (Cx43), the most widely expressed gap junction protein, is associated with a number of physiological and pathological conditions. Many functions of Cx43 have been shown to be independent of gap junction formation and only require the expression of Cx43 C-terminal fragments. Recent evidence demonstrated that naturally occurring C-terminal isoforms can be generated via internal translation. Findings Here, we confirm that C-terminal domains of Cx43, particularly the major 20-kDa isoform, can be independently generated and regulated by internal translation of the same single GJA1 gene transcript that encodes full-length Cx43. Through direct RNA transfection experiments, we provide evidence that internal translation is not due to a bona fide cap-independent IRES-mediated mechanism, as upstream ribosomal scanning or translation is required. In addition to the mTOR pathway, we show for the first time, using both inhibitors and cells from knockout mice, that the Mnk1/2 pathway regulates the translation of the main 20-kDa isoform. Conclusions Internal translation of the Cx43 transcript occurs but is not cap-independent and requires translation upstream of the internal start codon. In addition to the PI3K/AKT/mTOR pathway, the major 20-kDa isoform is regulated by the Mnk1/2 pathway. Our results have major implications for past and future studies describing gap junction-independent functions of Cx43 in cancer and other pathological conditions. This study provides further clues to the signalling pathways that regulate internal mRNA translation, an emerging mechanism that allows for increased protein diversity and functional complexity from a single mRNA transcript.
    Full-text · Article · May 2014
    • "Although the role of uORFs in viruses remains largely unexplored, these regulatory elements permeate many viral families [14,858687 suggesting they may also control viral gene expression in instances where cellular stress pathways are engaged. In KSHV, the translational regulatory function of uORFs controlling the expression of ORF35 and ORF36, has been recently described [57]. The existence of a plethora of uORFs throughout the viral genome strongly indicates that this mechanism may be more widely used by KSHV than previously suspected. "
    [Show abstract] [Hide abstract] ABSTRACT: Productive herpesvirus infection requires a profound, time-controlled remodeling of the viral transcriptome and proteome. To gain insights into the genomic architecture and gene expression control in Kaposi's sarcoma-associated herpesvirus (KSHV), we performed a systematic genome-wide survey of viral transcriptional and translational activity throughout the lytic cycle. Using mRNA-sequencing and ribosome profiling, we found that transcripts encoding lytic genes are promptly bound by ribosomes upon lytic reactivation, suggesting their regulation is mainly transcriptional. Our approach also uncovered new genomic features such as ribosome occupancy of viral non-coding RNAs, numerous upstream and small open reading frames (ORFs), and unusual strategies to expand the virus coding repertoire that include alternative splicing, dynamic viral mRNA editing, and the use of alternative translation initiation codons. Furthermore, we provide a refined and expanded annotation of transcription start sites, polyadenylation sites, splice junctions, and initiation/termination codons of known and new viral features in the KSHV genomic space which we have termed KSHV 2.0. Our results represent a comprehensive genome-scale image of gene regulation during lytic KSHV infection that substantially expands our understanding of the genomic architecture and coding capacity of the virus.
    Full-text · Article · Jan 2014
  • [Show abstract] [Hide abstract] ABSTRACT: Technological advances in genome-wide transcript analysis, referred to as the transcriptome, using microarrays and deep RNA sequencing methodologies are rapidly extending our understanding of the genetic content of the gammaherpesviruses (γHVs). These vast transcript analyses continue to uncover the complexity of coding transcripts due to alternative splicing, translation initiation and termination, as well as regulatory RNAs of the γHVs. A full assessment of the transcriptome requires that our analysis be extended to the virion and exosomes of infected cells since viral and host mRNAs, miRNAs, and other noncoding RNAs seem purposefully incorporated to exert function upon delivery to naïve cells. Understanding the regulation, biogenesis and function of the recently discovered transcripts will extend beyond pathogenesis and oncogenic events to offer key insights for basic RNA processes of the cell.
    Article · May 2013
Show more