Content uploaded by Janina Tokarz
Author content
All content in this area was uploaded by Janina Tokarz on Feb 04, 2015
Content may be subject to copyright.
Available via license: CC BY 4.0
Content may be subject to copyright.
Zebrafish 20b-Hydroxysteroid Dehydrogenase Type 2 Is
Important for Glucocorticoid Catabolism in Stress
Response
Janina Tokarz
1
, William Norton
2
, Gabriele Mo
¨ller
1
, Martin Hrabe
´de Angelis
1,3
, Jerzy Adamski
1,3
*
1Helmholtz Zentrum Mu
¨nchen, German Research Center for Environmental Health, Institute of Experimental Genetics, Genome Analysis Center, Neuherberg, Germany,
2Centre Nationale de la Recherche Scientifique, Zebrafish Neurogenetics, Gif sur Yvette, France, 3Lehrstuhl fu
¨r Experimentelle Genetik, Technische Universita
¨tMu
¨nchen,
Freising-Weihenstephan, Germany
Abstract
Stress, the physiological reaction to a stressor, is initiated in teleost fish by hormone cascades along the hypothalamus-
pituitary-interrenal (HPI) axis. Cortisol is the major stress hormone and contributes to the appropriate stress response by
regulating gene expression after binding to the glucocorticoid receptor. Cortisol is inactivated when 11b-hydroxysteroid
dehydrogenase (HSD) type 2 catalyzes its oxidation to cortisone. In zebrafish, Danio rerio, cortisone can be further reduced
to 20b-hydroxycortisone. This reaction is catalyzed by 20b-HSD type 2, recently discovered by us. Here, we substantiate the
hypothesis that 20b-HSD type 2 is involved in cortisol catabolism and stress response. We found that hsd11b2 and hsd20b2
transcripts were up-regulated upon cortisol treatment. Moreover, a cortisol-independent, short-term physical stressor led to
the up-regulation of hsd11b2 and hsd20b2 along with several HPI axis genes. The morpholino-induced knock down of
hsd20b2 in zebrafish embryos revealed no developmental phenotype under normal culture conditions, but prominent
effects were observed after a cortisol challenge. Reporter gene experiments demonstrated that 20b-hydroxycortisone was
not a physiological ligand for the zebrafish glucocorticoid or mineralocorticoid receptor but was excreted into the fish
holding water. Our experiments show that 20b-HSD type 2, together with 11b-HSD type 2, represents a short pathway in
zebrafish to rapidly inactivate and excrete cortisol. Therefore, 20b-HSD type 2 is an important enzyme in stress response.
Citation: Tokarz J, Norton W, Mo
¨ller G, Hrabe
´de Angelis M, Adamski J (2013) Zebrafish 20b-Hydroxysteroid Dehydrogenase Type 2 Is Important for
Glucocorticoid Catabolism in Stress Response. PLoS ONE 8(1): e54851. doi:10.1371/journal.pone.0054851
Editor: Shree Ram Singh, National Cancer Institute, United States of America
Received August 30, 2012; Accepted December 17, 2012; Published January 22, 2013
Copyright: ß2013 Tokarz et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: Supported by a grant from the German Federal Ministry of Education and Research (BMBF) to the German Center Diabetes Research (DZD e.V.) and by
a Deutsche Forschungsgemeinschaft grant to J.A. (AD 127/10-1). The funders had no role in study design, data collection and analysis, decision to publish, or
preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: Adamski@helmholtz-muenchen.de
Introduction
Stress is an ancient evolutionary system that enables fast
reflexive actions to cope with environmental stressors or
dangerous situations, e.g., predators. In a life-threatening
situation, an organism must be ready to act. Instinctive
behaviors (fight-or-flight) are preferred over a precise but
tedious evaluation of the situation. In vertebrates, stressors are
perceived in the hypothalamus via input from the central and
peripheral nervous system and are then transmitted by hormone
cascades of the hypothalamus-pituitary-adrenal axis (HPA axis)
to the body for instant activation [1,2]. Because teleost fish do
not possess a discrete adrenal gland but do possess the
homologous interrenal cells embedded in the head kidney,
signal transduction occurs via the hypothalamus-pituitary-inter-
renal axis (HPI axis). The first hormone secreted by the
hypothalamus is corticotropin releasing hormone (CRH), which
stimulates the corticotropic and melanotropic cells of the
pituitary [3] to cleave the large proopiomelanocortin protein
(POMC) [4]. This cleavage allows adrenocorticotropic hormone
(ACTH) to be secreted into the circulation and to bind the
melanocortin 2 receptor (MC2R) on the surface of the
interrenal cells in teleost fish [5]. Upon this stimulus, the
interrenal cells enclosed in the head kidney synthesize and
release cortisol into the circulation [6]. The de novo biosynthesis
of cortisol in fish begins with the transport of cholesterol into
the mitochondria, which is mediated by steroidogenic acute
regulatory protein (StAR). Next, side chain cleavage of
cholesterol is catalyzed by monooxygenase P450scc (Cyp11a1).
Afterwards, 17alpha-hydroxylation (Cyp17), 3b-hydroxysteroid
dehydrogenation (Hsd3b), and 21-hydroxylation (Cyp21a1)
occur prior to the last step in cortisol biosynthesis, which is
11-hydroxylation mediated by 11-hydroxylase (Cyp11c1) [7].
As the major stress hormone, cortisol contributes to a general
activation of the organism and the preparation of the
appropriate stress response. The stimulation of gluconeogenesis
in the liver [7,8], proteolytic processes in the muscle, and
lipolysis in the adipose tissues [7] increase the plasma glucose
concentration to provide energy for stress responses. Further-
more, cortisol controls ionic and osmotic regulation, e.g., in
adaptation of euryhaline teleost fish to sea water [9], and
regulates immune functions, growth, and behavior [7,10].
Although the functions of cortisol during embryonic develop-
ment have not yet been entirely unraveled, the zygote is
maternally supplied with the hormone in several teleost species
(see [11] and references therein), indicating its importance
PLOS ONE | www.plosone.org 1 January 2013 | Volume 8 | Issue 1 | e54851
during embryonic development [1,12]. Indeed, recent studies
focusing on zebrafish demonstrate a crucial role for cortisol in
development [13–15] and ion transport [16].
Because it is a potent hormone that regulates a variety of vital
functions, chronic exposure to elevated cortisol concentrations
during either embryonic development or adult life causes several
adverse effects. Teleost fish embryos exposed to excess cortisol
show increased mortality and developmental defects [12,17,18].
Chronic stress and elevated cortisol concentrations impact growth,
reproduction, immune functions, and increased mortality caused
by diseases in adult fish [19–22].
Cortisol mediates its effects by binding to members of the
nuclear receptor family, which then translocate to the nucleus
and regulate the transcription of target genes. In humans and
teleost fish, cortisol is the unique and highly affine ligand of the
glucocorticoid receptor a(GRa) [7,23,24]. Additionally, in
humans the affinity of cortisol for the mineralocorticoid receptor
(MR) is comparable to that of aldosterone, the native MR
ligand [24]. Because cortisol is more abundant in the circulation
than aldosterone, permanent MR activation by cortisol in
mineralocorticoid-sensitive tissues can be avoided by the
expression of the cortisol-inactivating enzyme 11b-hydroxyste-
roid dehydrogenase (HSD) type 2 [25,26]. In teleost fish, the
native ligand of MR is not yet known because fish lack an
aldosterone biosynthetic pathway [27]. However, recent studies
provide evidence that 11-deoxycorticosterone might be the
ligand for the teleostean MR [28,29].
Cortisol levels are controlled by the ratio of de novo synthesis to
catabolism by the action of the respective enzymes involved. The
first enzyme in cortisol inactivation and catabolism is 11b-HSD
type 2, which catalyzes the conversion of cortisol to cortisone [30–
32]. Downstream enzymes in the catabolic pathway include
reductases, oxidoreductases, and hydroxylases that yield a broad
spectrum of glucocorticoids [7]. Analyses of the glucocorticoids
excreted from fish identified tetrahydro-derivatives of cortisol and
cortisone, including 20b-cortolone, 5b-dihydroxycortisone, corti-
sol, and cortisone [33–35]. Another putatively excreted glucocor-
ticoid, 4-pregnen-17a,20b,21-triol-3,11-dione (20b-hydroxycorti-
sone), was recently identified by us as the product of a cortisone
reduction catalyzed by the novel enzyme 20b-HSD type 2 in
various fish species [36]. Following the analyses of its expression in
zebrafish and the evaluation of its kinetic parameters, we
hypothesized a role for 20b-HSD type 2 in cortisol catabolism
and stress response in concert with 11b-HSD type 2 [36]. To
confirm this hypothesis, we investigated the regulation of both
11b-HSD type 2 and 20b-HSD type 2 in zebrafish embryos upon
cortisol treatment and after physical stress. We also elucidated the
physiological implications of a morpholino-induced knock down of
20b-HSD type 2. Furthermore, we determined the ability of 20b-
hydroxycortisone to activate the GRaand MR, and analyzed
conjugated and free glucocorticoids released into the fish holding
water.
Materials and Methods
Fish Stocks
All experiments were performed on embryos of the zebrafish
AB-EK strain and were in accordance with the EU directive
2010/63/EU as well as the German Animal Welfare Act.
Standard fish-keeping protocols were followed [37], and embryos
were obtained by natural spawning. Embryos were staged
according to Kimmel et al. [38].
Injection of Morpholino Antisense Nucleotides into
Zebrafish Embryos
Morpholino antisense nucleotides (Gene Tools, Philomath,
Oregon, USA) were designed to target the donor splice site of
exon 2 of hsd20b2 mRNA (Figure 1 A). The splicing morpholino
had the following sequence (59-GAATAAAATACT-
GACCTCTTCAGCA-39), while the control morpholino con-
tained five mismatches (59-GAATAAAATAgTcAgCTCTT-
gAcCA-39). The morpholinos were dissolved in water to final
concentrations of 375 mM and 500 mM. Embryos at the 1-cell
stage were injected with approximately 4 nL of morpholino into
the yolk using a FemtoJet injector equipped with a micromanip-
ulator (Eppendorf, Hamburg, Germany). The embryos were kept
in egg water (60 mg/L sea salt; Instant Ocean, Miami, Florida,
USA) at 28.5uC and were frequently monitored for viability and
developmental phenotypes. At 48 hpf, viable embryos were
collected and snap-frozen in liquid nitrogen for RNA isolation
and enzymatic assays.
Challenging Zebrafish Embryos with Cortisol
Zebrafish embryos (wild-type and morpholino-injected) were
kept in egg water at 28.5uC and treated with cortisol in two
different setups. For the 3–72 hpf exposure, zebrafish embryos
were challenged with cortisol (Sigma-Aldrich, Hamburg, Ger-
many; final concentrations of 10, 25, 50, 75, and 100 mg/L
(equivalent to 27.5, 69.0, 137.9, 206.9, and 275.9 mM, respective-
ly), which was dissolved in dimethylformamide (DMF; Merck,
Darmstadt, Germany) prior to its addition to the egg water. The
amount of DMF was used in a range of 0.1–1%. Treatment began
at 3 hpf and continued until 72 hpf. Samples for RNA isolation
contained 30 embryos each and were collected at 24 hpf, 48 hpf,
and 72 hpf and snap-frozen in liquid nitrogen. At each sampling
point, water was exchanged with fresh egg water containing the
respective treatment regimen. Controls, including a ‘‘no treat-
ment’’ control of egg water alone and solvent controls with the
appropriate amount of DMF were run concurrently with each
experiment. For the 3–24 hpf exposure, the egg water was
exchanged at 3 hpf with egg water containing 50 mg/L
(137.9 mM) cortisol. At 24 hpf, samples were collected and the
water was exchanged with normal egg water. Controls, including a
‘‘no treatment’’ control of egg water alone and a ‘‘solvent control’’
of 0.1% DMF until 24 hpf, were run concurrently with each
experiment. The embryos were monitored throughout the
experiments for viability and developmental abnormalities. In
both experiments, three samples were collected per sampling
point.
Challenging Zebrafish Larvae with a Physical Stressor
Larvae used for the analyses of stress responses were 5 dpf
because the stress axis is fully functional by this age [11]. Six pools
of 50 larvae each were subjected to a stressor regimen consisting of
swirling the fish for 30 sec in a 25 mL glass beaker containing
5 mL of egg water at 600 rpm. Subsequently, the larvae were
placed in a 28.5uC incubator and sampled at different time points
(5 min, 10 min, 20 min, 30 min, and 60 min) after the stress.
Control samples were taken before applying the stressor. Pools of
50 fish were divided into two aliquots and snap-frozen in liquid
nitrogen. One aliquot of each pool was used for RNA isolation.
Preparation of Embryos for Phenotypic Evaluation
Zebrafish embryos (wild-type and morpholino-injected) at
48 hpf and 72 hpf were fixed overnight in 4% paraformaldehyde
(Sigma-Aldrich, Hamburg, Germany) in PBS at 4uC, washed twice
Zebrafish Glucocorticoid Catabolism in Stress
PLOS ONE | www.plosone.org 2 January 2013 | Volume 8 | Issue 1 | e54851
in PBT (0.1% Tween-20 (Sigma-Aldrich, Hamburg, Germany) in
PBS), and dehydrated through 25%, 50%, 75%, and 100%
methanol (Merck, Darmstadt, Germany) in PBT for 3 min each at
room temperature. The embryos were stored in 100% methanol at
220uC or rehydrated through a reversed methanol in PBT series
for microscopy. The embryos were mounted in 3% methylcellu-
lose (Roth, Karlsruhe, Germany) and photographed with an
Axioplan stereomicroscope (Zeiss, Jena, Germany) using AxioVi-
sion software (Zeiss, Jena, Germany). The criterion for the
classification of ‘mild’ or ‘severe’ phenotypes was the degree of
altered somitogenesis (kinked tails versus truncated or no tails,
respectively) and the presence and size of pericardial edema
(present and small versus present and large, respectively). Embryos
with small pericardial edema resembled the mild category of
cortisol injected zebrafish embryos [15], while the embryos
classified here as ‘severe’ showed pericardial edema like those of
the moderate and severe category after cortisol microinjection
[15]. Some morphological alterations like a deformed yolk sac and
deformed or missing yolk sac extension were present in both
categories.
Steroid Extraction from Adult Zebrafish Holding Water
and LC-MS/MS Analysis
Six adult zebrafish between 1.5 and 2 years old were placed for
16 hr in 800 mL freshly prepared fish water (75 mg/L NaHCO
3
,
18 mg/L sea salt, and 8.4 mg/L CaSO
4
in H
2
O). Either mixed-
gender groups composed of three females and three males or all-
female and all-male groups were used. The experiment was
repeated three times using the same group of fish with a resting
period of at least 14 days in between. Conjugated reference
steroids, cortisol-21-glucuronide (100 nM; Steraloids, Newport,
Rhode Island, USA) and cortisone-21-sulfate (10 nM, Steraloids,
Newport, Rhode Island, USA), were added to freshly prepared fish
water and extracted following the same protocol. The extraction
method and differential elution of the free and conjugated steroids
were adapted from Payne et al. [39]. Solid phase extraction (SPE)
cartridges (Strata C18-E, 200 mg/6 mL, Phenomenex, Aschaffen-
burg, Germany) were equilibrated twice with 2 mL methanol and
twice with 2 mL water. Afterwards, 750 mL fish holding water
was extracted using a vacuum manifold. To separate the
conjugated from the unconjugated steroids, a differential elution
was performed by first eluting the conjugated steroids with 300 mL
47% methanol in water (v/v) three times. Subsequently, the free
steroids were eluted with 300 mL methanol three times. Both sets
of eluates were evaporated to dryness. The fraction containing the
free steroids was reconstituted in 300 mL methanol and stored at
220uC until analysis by LC-MS/MS. The fraction containing the
conjugated steroids was reconstituted in 500 mL 75 mM NaP
i
buffer pH 6.8. Forty-one units (U) b-glucuronidase (purified from
E. coli, Sigma-Aldrich, Hamburg, Germany) was added, and the
mixture was incubated overnight at 37uC with shaking. After the
digestion of the steroid-glucuronide conjugates, steroids were
extracted again by SPE. Strata C18-E 100 mg/1 mL cartridges
(Phenomenex, Aschaffenburg, Germany) were equilibrated twice
with 1 mL methanol and twice with 1 mL water, and the sample
was applied. After washing with 500 mL water, the conjugated
steroids were eluted twice with 200 mL 47% methanol before the
free steroids (the formerly glucuronidated steroids) were eluted
with 200 mL of methanol twice. The fractions were evaporated to
dryness, and the free steroids were reconstituted in 300 mL
methanol and stored at 220uC until analysis. The conjugated
steroids were reconstituted in 500 mL 75 mM NaP
i
buffer pH 5.1,
and 7 U sulfatase (crude extract) of Helix pomatia (Sigma-Aldrich,
Hamburg, Germany) was added. The mixture was incubated with
shaking for 4–5 h at 37uC. Subsequently, the steroids were
extracted by SPE again as described in the previous step, omitting
the elution step with 47% methanol. The eluate was evaporated to
dryness, and the steroids reconstituted in 300 mL methanol and
stored at 220uC until analysis.
The steroids were separated by HPLC on a reversed phase
Synergi Fusion RP18 column (15063 mm, 4 mm, Phenomenex,
Aschaffenburg, Germany) in 28% acetonitrile (v/v) and 0.1%
formic acid (v/v) in water as the running solvent at a flow rate of
0.45 mL/min. The steroids were detected by MS/MS using an
API4000 QTrap instrument (Applied Biosystems, Carlsbad,
California, USA) with the APCI ion source set to scan in multiple
Figure 1. Analyses of knock down efficiency of an
hsd20b2
splicing morpholino reveal reduction of enzymatic activity. (A) In the
genomic structure of zebrafish hsd20b2, exons are indicated by boxes and numbered. Below, the important short-chain dehydrogenase/reductase
motifs (single letter amino acid code) are denoted. ‘x’ denotes any amino acid residue, and when present, the subsequent number indicates the
number of6residues. The splice site targeted by the morpholino is indicated by a dash. Morpholino-induced mis-splicing is illustrated by the triangle
above the genomic structure. Exons are to scale, whereas the space between the exons does not reflect the respective intron size. (B) The analyses of
morpholino efficiency at the mRNA level by RT-PCR using primers that prime within the first and fourth exons demonstrate mis-splicing in
morpholino-injected fish (MO). The smaller PCR product is absent from samples of the control morpholino-injected fish embryos (C). The respective
morpholino concentration used is denoted. b-actin controls were included for normalization. (C) The knock down efficiency was analyzed by assaying
the enzymatic activity that converts cortisone to 20b-hydroxycortisone in morpholino (MO)- and control morpholino (C)-injected fish. The respective
morpholino concentration used is denoted and mean values with standard deviations from four biological replicates are presented. Significant levels
are indicated: ** p,0.01.
doi:10.1371/journal.pone.0054851.g001
Zebrafish Glucocorticoid Catabolism in Stress
PLOS ONE | www.plosone.org 3 January 2013 | Volume 8 | Issue 1 | e54851
reaction monitoring mode controlled by Analyst 1.5.1 software.
The source parameters were set as follows: Curtain Gas 20.0 psi,
Collision Gas 5 psi, Nebulizer Current 3.0 psi, Temperature
600uC, Ion Source Gas 1 40.0 psi, Entrance Potential 10.0 V, and
Collision Energy 33.0 V. Detected mass transitions (masses given
in Da) were as follows: cortisol 363.2/121.1, cortisone 361.2/
163.2, and 20a2/20b-hydroxycortisone 363.2/163.2 (isomers
distinguished by retention time). The chromatograms obtained
were evaluated with regard to the peak height of each analyte.
Frequent injections of reference substances were used to verify a
constant sensitivity throughout the sequential sample analysis.
RNA Isolation and Reverse Transcription Quantitative
Real-time PCR
For RNA isolation, collected zebrafish embryos were homog-
enized in 500 to 750 mL TRIzol Reagent (Invitrogen, Darmstadt,
Germany) using a syringe and needle (20 G). The volume used
depended on the age and number of embryos. To the samples in
TRIzol, 2/10 volumes chloroform (Merck, Darmstadt, Germany)
was added, and the samples were vigorously shaken for 15 sec and
incubated at room temperature for 3 min. To separate the phases,
the samples were centrifuged at 21,0006gat4uC for 15 min. The
aqueous phase was collected and mixed with 0.53 volumes 100%
ethanol (Merck, Darmstadt, Germany). This solution was applied
to a column of the RNeasy Mini Kit (Qiagen, Hilden, Germany)
and further purified including DNase I digestion according to
manufacturer’s instructions. The RNA concentration and purity
were determined by spectrophotometry. Only samples with an
OD
260 nm
/OD
280 nm
.1.95 were used in subsequent PCR
experiments.
One microgram RNA was used in cDNA synthesis according to
the manufacturer’s protocol (RevertAid First Strand cDNA
Synthesis Kit, Fermentas, St. Leon-Rot, Germany). Instead of
the supplied Oligo-dT
18
primer, an anchored oligo-dT
18
primer
(59-TTTTTTTTTTTTTTTTTTVN-39) was used at a final
concentration of 0.5 mM to prime the cDNA synthesis.
To verify the morpholino-induced mis-splicing, reverse tran-
scription PCR (RT-PCR) reactions were performed as described
[36] using primers with binding sites in the first and fourth exons
of the hsd20b2 transcript (forward 59-AGACAATGCAGAGT
GCTGCTGG-39and reverse 59-GCCCTCTGTGAAGTCTG
CCTG-39).
Primers for quantitative real-time PCR spanning at least one
exon-intron boundary were designed using Primer3 software
(http://biotools.umassmed.edu/bioapps/primer3_www.cgi) [40].
However, this approach could not be applied to the genes for
the melanocortin 2 receptor (mc2r) and corticotropin-releasing
factor (crh), which consist of only one and two exons, respectively.
The identity of all amplicons was verified by Sanger sequencing
using standard protocols. Database accession numbers, amplicon
lengths, and primer sequences for all of the reference and target
genes are listed in Table 1.
Real-time PCR amplifications were performed in triplicate
using Power SYBR Green PCR Mastermix (Applied Biosystems,
Carlsbad, California, USA). Assays consisted of 10 mL Mastermix,
6mL water, 1 mL of each primer at a final concentration of
0.5 mM and 2 mL cDNA diluted 1:20 in water. The reactions were
performed in 384-well plates (ThermoScientific, Waltham, Mas-
sachusetts, USA) on a TaqMan 7900HT cycler equipped with
SDS2.3 software (Applied Biosystems, Carlsbad, California, USA).
The following amplification protocol was employed: denaturation
at 95uC for 10 min, amplification and quantification repeated 39
times at 95uC for 15 sec and 60uC for 1 min, and a melting curve
program (95uC for 15 sec, 60–95uC with a heating rate of 0.1uC/
sec and continuous fluorescence measurement). The cycle
threshold (C
T
) value was determined by SDS2.3 software as the
cycle at which the fluorescence rose markedly above the
background fluorescence.
In cortisol challenge experiments, the fold changes of 20b-HSD
type 2 (hsd20b2) expression were calculated according to Pfaffl [41]
with normalization to one reference gene each. The b-actin
reference (actb1) was suitable. In the physical stress assay, the
normalization was performed using the BestKeeper software tool
developed by Pfaffl et al. [42] to calculate the fold changes of the
target genes. In this case, b-actin, elongation factor-1 a(eef1a1l1)
and ribosomal protein l8 (rpl8) were used as the reference genes.
With both normalization methods, the data was expressed as fold
changes from untreated control samples.
Enzyme Assay in Fish Embryos
Enzymatic assays for determination of the activity of 20b-HSD
type 2 in morpholino-injected embryos were performed as
described earlier [36]. Because the sample material was limited,
only 10 embryos were used per reaction and the incubation time
was prolonged to 24 hr. Briefly, the embryos were homogenized in
450 mL reaction buffer (100 mM NaP
i
pH 7.3, 1 mM EDTA,
0.05% BSA) using syringe and needle (20G). To 450 mL embryo
homogenate, 20 nM tritiated cortisone (American Radiolabeled
Chemicals, Saint Louis, Missouri, USA) and 50 mL NADPH+H
+
(5 mg/mL in reaction buffer, Fluka, Buchs, Switzerland) were
added and the samples were incubated at 28uC for 24 hr. Assays
were performed in four replicates. Reactions were terminated by
addition of 100 mL stop solution (0.5 M ascorbic acid, 1% acetic
acid (v/v) in methanol) and the steroids extracted using solid phase
extraction cartridges as described [36]. Steroids were analyzed by
HPLC using an Allure Biphenyl column (3 mm, 5062.1 mm,
Restek, Bad Homburg, Germany) with 23% acetonitrile in water
(v/v) as mobile phase. Conversion rates were obtained after
integration of chromatograms as described [36].
Reporter Gene Experiments
The coding sequence of the zebrafish MR (NM_001100403)
was synthesized by Genscript (Piscataway, New York, USA) and
subcloned into the vector pCS2+by GeneArt (Life Technologies,
Darmstadt, Germany) to obtain the expression plasmid
zfMR_pCS2+. The expression plasmid for the zebrafish GRa
(zGRa_pCS2+) and the reporter plasmid pMMTV-luc were kindly
provided by Dr. Marcel Schaaf (Institute of Biology, Leiden,
Netherlands). For reporter gene experiments, COS-1 cells (ATCC,
Wesel, Germany) were maintained in DMEM medium (PAA,
Pasching, Austria) supplemented with 10% fetal bovine serum
(PAA, Pasching, Austria), 100 U/mL penicillin, and 100 mg/mL
streptomycin (Invitrogen, Darmstadt, Germany) at 37uC and 5%
CO
2
in a humidified atmosphere. The cells were seeded at 5610
4
cells per well in 12-well plates and incubated for 24 hr. Cells were
transfected with the expression plasmids using X-tremeGENE HP
transfection reagent (Roche, Mannheim, Germany) according to
the manufacturer’s protocol. Plasmids encoding the receptors were
co-transfected with the reporter plasmid pMMTV-luc and the
plasmid pGL4.74[hRluc/TK] (for normalization; Promega, Mann-
heim, Germany) at the ratio pGL4.74 : pCS2+: pMMTV-luc 1:
10: 50. Cells were incubated for an additional 24 hr, the growth
medium was replaced, and the steroids (cortisol, cortisone,
aldosterone [all from Sigma-Aldrich, Hamburg, Germany], and
20b-hydroxycortisone [Steraloids, Newport, Rhode Island, USA])
dissolved in methanol were added at final concentrations of 0.1, 1,
10, 100, and 1000 nM. After the cells had been incubated an
additional 24 hr, the cells were lysed, and the firefly and renilla
Zebrafish Glucocorticoid Catabolism in Stress
PLOS ONE | www.plosone.org 4 January 2013 | Volume 8 | Issue 1 | e54851
luciferase activity were determined with the Dual-Luciferase
Reporter Assay System (Promega, Mannheim, Germany). Biolu-
minescence was measured with the GloMax Multi Detection
System (Promega, Mannheim, Germany) after the injection of
each luciferase assay reagent. Firefly luciferase signals were
normalized to renilla luciferase, and the background signal of
methanol-treated cells was subtracted. The three technical
replicates were averaged, and the mean values were calculated
from three biological replicates. The data were plotted and fit
according to a simple ligand-binding model by SigmaPlot 12.0
(Systat Software, Erkrath, Germany).
Statistical Analyses
For all qPCR experiments, statistical significance was tested by
using the REST2009 software [43], which is based on random-
ization and hypothesis tests. We increased the default value of
2000 iterations to 5000 iterations to achieve better-quality data.
The results of the 20b-HSD type 2 activity in morpholino knock
down animals were evaluated with Student’s t-test using SigmaPlot
12.0 (Systat Software, Erkrath, Germany). The appearance of the
developmental phenotype in cortisol challenged morphants was
tested for statistical significance by Fisher’s Exact test for count
data. This test was conducted using the R software package [44].
Results
Cortisol Treatment Led to an Increase in hsd20b2 and
hsd11b2 mRNA
Zebrafish 20b-HSD type 2 was identified and characterized by us
in a previous study [36]. We suggested a role for this novel enzyme in
glucocorticoid catabolism and potentially in stress response. To
determine if 20b-HSD type 2 expression is influenced by cortisol, we
challenged zebrafish embryos with cortisol at varying concentrations
in the range of 27.5 to 275.9 mM. As we attempted to elucidate the
mechanism of 20b-HSD type 2 action, we challenged the zebrafish
embryos with cortisol concentrations that were significantly higher
than physiological levels. Using quantitative real-time PCR analyses,
we observed an up-regulation of hsd20b2 expression (Figure 2). In
24 hpf embryos, a 2-to 7-fold induction wasdetected, whilein 48 hpf
embryos, hsd20b2 was significantly induced up to 18-fold after
treatment with 100 mg/L (275.9 mM) cortisol. The level remained
elevated 4- to 6-fold in 72 hpfold zebrafish larvae and at this stage the
expression of hsd20b2 was significantly higher than in DMF treated
fish at nearly all cortisol concentrations applied. In the cortisol
concentration range used, we observed no dosage dependency of the
hsd20b2 induction. Quantification of 11b-HSD type 2 mRNA
showed that this gene is also up-regulated at all stages, though only
in the moderate range of a 2- to 4-fold induction. We observed
significant changes in expression of hsd11b2 mostly starting at 48 hpf.
Hsd11b2 was also not induced in a dose-dependent manner; in 72 hpf
larvae alone, the degree of up-regulation was negatively correlated
with the cortisol concentration.
Inspired by these results, we determined whether a shorter
cortisol treatment would suffice to induce 20b-HSD type 2
expression, and whether up-regulation induced this way would
persist after cortisol removal. For the 3–24 hpf exposure, zebrafish
embryos were treated with 50 mg/L cortisol (137.9 mM) until
24 hpf and were kept afterwards in untreated egg water until
72 hpf. Quantification of hsd20b2 and hsd11b2 mRNA demon-
strated a significant increase of both transcripts (approximately 2-
fold) in cortisol-treated embryos at 24 hpf. Twenty-four hours post
treatment in the 48 hpf embryos, the induction of both genes was
even higher (8-fold for hsd20b2 and 2.5-fold for hsd11b2) but had
decreased to normal levels at 72 hpf 48 hours after the cortisol
challenge (Figure 3). Both hsd20b2 and hsd11b2 displayed a robust
induction of expression upon both 3–72 hpf and 3–24 hpf cortisol
treatment.
Table 1. Primer sequences for quantitative real-time PCR.
gene name accession number (Ensembl) primer sequences (5939) amplicon length (bp)
actb1 ENSDART00000055194 for AAGGCCAACAGGGAAAAGAT 110
rev GTGGTACGACCGGAGGCATAC
eef1a1l1 ENSDART00000023156 for CAAGGAAGTCAGCGCATACA 189
rev GCATCAAGGGCATCAAGAAG
rpl8 ENSDART00000140039 for CCCCTTTCGCTTCCTCTTT 185
rev GTCCTTCACGATTCCCTTGA
hsd20b2 ENSDART00000100769 for AATGGTTGAAAGGGGGAAAG 201
rev TTATGGGTCATGTTCGTGGA
hsd11b2 ENSDART00000141211 for GGGGGTCAAAGTTTCCACTA 165
rev TGGAAGAGCTCCTTGGTCTC
cyp11c1 ENSDART00000061572 for ATGAAGTGGCGCAGGATTT 215
rev CTCCACAGCCGAAATGAAG
star ENSDART00000016225 for AACAAGGGCAAGAAGCTCTG 207
rev CCCCCATTTGTTCCATGTTA
crh ENSDART00000038290 for TCTGTTGGAGGGGAAAGTTG 198
rev ATTTTGCGGTTGCTGTGAG
mc2r ENSDART00000077231 for CTCCGTTCTCCCTTCATCTG 126
rev ATTGCCGGATCAATAACAGC
doi:10.1371/journal.pone.0054851.t001
Zebrafish Glucocorticoid Catabolism in Stress
PLOS ONE | www.plosone.org 5 January 2013 | Volume 8 | Issue 1 | e54851
Zebrafish Glucocorticoid Catabolism in Stress
PLOS ONE | www.plosone.org 6 January 2013 | Volume 8 | Issue 1 | e54851
Physical Stress Increased hsd20b2 Expression
To determine if hsd20b2 is up-regulated upon a stressor regimen
independent of externally applied cortisol, we challenged 5 dpf
zebrafish larvae with a physical stress composed of swirling the
larvae for 30 sec. Samples were collected at different time points
after the stress to analyze the time-dependent changes in
expression levels. In this experiment, genes at different positions
in the hypothalamus-pituitary-interrenal axis (HPI axis) were
quantified to ensure accurate stress perception and transmission.
The mRNA level of the first transmitter CRH in the hypothal-
amus increased slightly but significantly after the swirling stress
and remained at this level for 60 min (Figure 4). The expression
level of the melanocortin 2 receptor mc2r fluctuated during the first
10 min after the stressor, increased significantly during the next
20 min and subsequently decreased to the mRNA level of
unstressed fish. Mc2r displayed a high variability between different
samples. The transcript amount of steroid acute regulatory protein
(star) increased 1.7-fold during the first 20 min after the stress and
remained at this level until 60 min post-challenge. The expression
levels of the gene encoding 11b-hydroxylase (cyp11c1) exhibited the
highest inter-individual variability after the stressor. Some samples
showed strong up-regulation of cyp11c1 shortly after the stressor,
while others displayed a marked decrease. Averaging these
observations resulted in no significant change to the mean levels
throughout the experiment (Figure 4). The mRNA of 11b-HSD
type 2, the enzyme that catalyzes the inactivation of cortisol,
steadily increased 1.5-fold 60 min post challenge compared with
the levels in the unstressed fish. Hsd20b2 was already induced 1.6-
fold 5 min after the stressor, and the mRNA levels increased to
2.2-fold 60 min after the stressor (Figure 4). Neither the hsd20b2
nor the hsd11b2 transcript decreased to unstressed levels through-
out the experiment. Although not as pronounced as the up-
regulation after the artificial cortisol treatment, the expression of
hsd20b2 and hsd11b2 was significantly induced after the application
of a stressor.
Cortisol-challenged hsd20b2 Morphants Displayed a
Developmental Phenotype
A transient knock down of hsd20b2 in zebrafish embryos was
performed to determine if 20b-HSD type 2 is essential to
glucocorticoid removal and the survival of the developing embryo.
Therefore, a morpholino was designed to target the donor splice
site of exon 2. Morpholino-induced mis-splicing should result in an
hsd20b2 transcript that lacks exon 2, which would result in the
translated 20b-HSD type 2 lacking the TGx
3
GxG motif of the
cofactor binding site. The loss of this motif is supposed to render
the enzyme totally inactive. Morpholinos were first injected at
varying concentrations to ensure a sufficient knock down, which
was verified by assaying mRNA levels and enzymatic activity. By
RT-PCR, wild-type hsd20b2 mRNA yielded a PCR fragment of
343 bp, while the mis-spliced PCR product was only 269 bp.
Figure 1 B shows that upon injection of 375 mM morpholino, the
wild-type PCR product decreased, while the shorter mis-spliced
product increased. The amount of mis-spliced product could be
increased by injecting 500 mM morpholino. However, monitoring
the knock down efficiency at the enzymatic level (Figure 1 C)
showed that injection of 500 mM morpholino did not further
reduce 20b-HSD type 2 activity. Therefore, we chose to inject
375 mM instead of 500 mM morpholino in the subsequent
experiments to reduce the possibility of toxic effects on zebrafish
development.
Figure 2. mRNA expression of
hsd20b2
and
hsd11b2
is increased by cortisol treatment. The effects of cortisol and its vehicle DMF were
examined in embryos at 24 hpf and 48 hpf and in larvae at 72 hpf. Final cortisol concentrations of 10, 25, 50, 75, and 100 mg/L are equivalent to 27.5,
69.0, 137.9, 206.9, and 275.9 mM, respectively. The fold changes of three replicates were calculated after normalization to b-actin and compared with
untreated fish embryos. White bars-the gene of interest in DMF treated fish; grey bars-the gene of interest in cortisol treated fish. Mean values with
standard deviations are shown. Significance levels are indicated as follows: * p,0.05, ** p,0.01.
doi:10.1371/journal.pone.0054851.g002
Figure 3. 3–24 hpf exposure to cortisol up-regulates
hsd20b2
and
hsd11b2
mRNA in 24 and 48 hpf larvae. Zebrafish embryos
were treated with cortisol and its vehicle DMF until 24 hpf and were
then placed in cortisol-free embryo water. The fold changes of hsd20b2
(A) and hsd11b2 (B) expression in three replicates were calculated after
normalization to b-actin and compared with untreated fish embryos.
Mean values with standard deviations are shown. White bars-0.1% DMF;
grey bars-50 mg/L cortisol (137.9 mM). Significance levels are indicated
as follows: * p,0.05, ** p,0.01.
doi:10.1371/journal.pone.0054851.g003
Zebrafish Glucocorticoid Catabolism in Stress
PLOS ONE | www.plosone.org 7 January 2013 | Volume 8 | Issue 1 | e54851
Despite the knock down of 20b-HSD type 2, the morphants
exhibited no developmental abnormalities under normal culture
conditions. To test our hypothesis that 20b-HSD type 2 is involved
in cortisol catabolism and stress response, we investigated the effect
of externally applied cortisol to the morphants, thereby mimicking
stress. Because a cortisol treatment with 10 mg/L up-regulated
hsd20b2 mRNA in wild-type zebrafish embryos without inducing a
visible developmental phenotype, this concentration was chosen to
challenge the 20b-HSD type 2 morphants. Abnormalities mani-
fested at 48 hpf and were characterized by an altered size and
shape of both the yolk-sac and yolk-sac extension, altered
somitogenesis, and kinked or shortened tails (Figure 5). The
phenotypes could be categorized as a ‘mild’ or a ‘severe’ form,
where the severe phenotype displayed strongly truncated tails. The
described developmental abnormalities persisted until 72 hpf, but
at this stage, strong pericardial edema was also observed (Figure 5,
Table 2).
20b-hydroxycortisone Activates Neither Zebrafish GRa
nor MR
To elucidate whether 20b-hydroxycortisone plays a role in
steroid signaling by binding and activating glucocorticoid and
mineralocorticoid receptors, we performed reporter gene exper-
iments. Receptor expression vectors were co-transfected with a
plasmid containing a luciferase gene driven by the MMTV
promoter, which comprises several glucocorticoid response
elements. COS-1 cells are frequently used for the reporter gene
Figure 4. Challenge of 5 dpf zebrafish larvae with a physical stressor up-regulates
hsd20b2
and
hsd11b2
mRNA. The fold changes of
target genes from six biological replicates were calculated after normalization to the geometric mean of three reference genes and compared with
unstressed fish. The time courses for crh,mc2r,star, cyp11c1, hsd11b2, and hsd20b2 are shown as mean values with standard deviations and
significant changes to unstressed fish are indicated as follows: * p,0.05, ** p,0.01.
doi:10.1371/journal.pone.0054851.g004
Zebrafish Glucocorticoid Catabolism in Stress
PLOS ONE | www.plosone.org 8 January 2013 | Volume 8 | Issue 1 | e54851
assays concerning GR because they lack an endogenous GR [23].
To ensure that the results obtained would be comparable, we used
COS-1 cells for the MR experiments as well, even though this cell
line expresses an endogenous MR. Hence, the results were
corrected for the background caused by the endogenous receptor.
For each receptor, dose-response curves were determined using
four steroidal ligands, namely cortisol, cortisone, 20b-hydroxy-
cortisone, and aldosterone (Figure 6). The zebrafish GRawas
strongly activated by cortisol, while all the other steroids, including
20b-hydroxycortisone, induced no significant luciferase expres-
sion. The zebrafish MR was substantially activated by aldosterone
and cortisol, whereas cortisone and 20b-hydroxycortisone stimu-
lated it only slightly at concentrations far above physiological
levels. The reporter gene experiments clearly demonstrated that
20b-hydroxycortisone does not bind or activate either the GRaor
the MR at physiological concentrations.
20b-hydroxycortisone is a Major Excretion Product
If 20b-HSD type 2 plays a role in cortisol catabolism, the
reaction product 20b-hydroxycortisone might be labeled for
excretion and released into the fish holding water. To determine
whether 20b-hydroxycortisone is labeled with glucuronic acid
and/or sulfates for excretion, we looked for glucocorticoids in the
adult zebrafish holding water. After the extraction and fraction-
Figure 5. 20b-HSD type 2 morphants display developmental abnormalities upon cortisol treatment. Animals are presented from a
lateral view, with the anterior end at left. Representative specimens of the ‘mild’ and the ‘severe’ phenotype of the cortisol-treated 20b-HSD type 2
morphants are shown. (A) Embryos at 48 hpf and (B) at 72 hpf. Black arrows point to yolk deformations, white arrows point to altered somitogenesis
resulting in kinked or truncated tails, and the asterisk denotes pericardial edema. WT-wild-type; MO-morpholino; C-control morpholino. Magnification
5x.
doi:10.1371/journal.pone.0054851.g005
Zebrafish Glucocorticoid Catabolism in Stress
PLOS ONE | www.plosone.org 9 January 2013 | Volume 8 | Issue 1 | e54851
ation of steroids from the water, the fractions of unconjugated,
glucuronidated, and sulfated glucocorticoids were analyzed
separately by LC-MS/MS. In our assay, conjugated glucocorti-
coids were only measurable after enzymatic hydrolysis. In all of the
fractions, we detected four different glucocorticoids, with 20b-
hydroxycortisone being the most abundant (Figure 7). In the
unconjugated fraction, ample amounts of cortisol, cortisone, and
20a-hydroxycortisone were found aside from 20b-hydroxycorti-
sone. In both the glucuronidated and sulfated steroid fractions, the
amount of 20b-hydroxycortisone was an order of magnitude
higher than all of the other glucocorticoids. We observed no
significant sex-specific differences in the excretion pattern,
although male fish seem to excrete slightly more 20b-hydro-
xycortisone than females do. Control extractions of glucocorticoids
from fish holding water that had been twice digested with b-
glucuronidase showed minor hydrolyzation of glucuronidated
Figure 6. 20b-hydroxycortisone is not a physiological ligand
for zebrafish GRaor MR. An analysis of reporter gene activation in
COS-1 cells mediated by zebrafish GRa(A) and zebrafish MR (B) using
four different steroidal ligands. Firefly luciferase values were normalized
to renilla luciferase and corrected for background. Mean values with
standard deviations are shown.
doi:10.1371/journal.pone.0054851.g006
Table 2. Distribution of phenotypes in hsd20b2 morphant
zebrafish larvae.
48 hpf-untreated controls
phenotype
animals
none
(%)
mild
(%)
p-value
(mild)
severe
(%)
p-value
(severe) n
WT 10060060060 135
MO 100600600.28 0601 87
C996216206085
48 hpf-0.1% DMF
phenotype
animals none
(%)
mild
(%)
p-value
(mild)
severe
(%)
p-value
(severe)
n
WT 10060060060 179
MO 99621610.26 161 0.25 91
C 10060060060 114
48 hpf-10 mg/L cortisol
phenotype
animals none
(%)
mild
(%)
p-value
(mild)
severe
(%)
p-value
(severe)
n
WT 10060060060 153
MO 52621 33619 ,2.2 e-16 1665 9.75 e-12 104
C9665565060 111
72 hpf-untreated controls
phenotype
animals none
(%)
mild
(%)
p-value
(mild)
severe
(%)
p-value
(severe)
n
WT 10060060060 146
MO 91611 464 0.013 467 0.0083 83
C996216206077
72 hpf-0.1% DMF
phenotype
animals none
(%)
mild
(%)
p-value
(mild)
severe
(%)
p-value
(severe)
n
WT 10060060060 188
MO 9467567 0.002 161 0.24 88
C9567567060 102
72 hpf-10 mg/L cortisol
phenotype
animals none
(%)
mild
(%)
p-value
(mild)
severe
(%)
p-value
(severe)
n
WT 9863263060 160
MO 37620 44612 ,2.2 e-16 1967,2.2 e-16 105
C86612 14612 060 110
Abbreviations: hpf-hours post fertilization; MO-morpholino-injected fish; C-
control morpholino-injected fish; n-number of larvae. The significant
appearance of the phenotype as determined by Fisher’s Exact Test is indicated
by a p-value below 0.001. Data were pooled from four experiments and
expressed as means 6SD.
doi:10.1371/journal.pone.0054851.t002
Zebrafish Glucocorticoid Catabolism in Stress
PLOS ONE | www.plosone.org 10 January 2013 | Volume 8 | Issue 1 | e54851
steroids after the first b-glucuronidase digestion (data not shown).
Therefore, after one deglucuronization step, the actual amount of
sulfated 20b-hydroxycortisone might be slightly lower than the
value measured. Control fish water without fish demonstrated no
steroid contamination. The results of the steroid extractions from
the fish holding water subjected to the same extraction protocol
but without the addition of b-glucuronidase or sulfatase exhibited
only a minor carry-over of the free steroids. Both of the conjugated
reference steroids, cortisol-21-glucuronide and cortisone-21-sul-
fate, were contaminated with free glucocorticoids but were only
hydrolyzed by b-glucuronidase and sulfatase, respectively, dem-
onstrating the functionality of the extraction method as well as the
digestion protocol (data not shown). Altogether, these observations
indicate that 20b-hydroxycortisone is indeed labeled with both
glucuronic acid and sulfates and can be considered a major
excreted glucocorticoid based on its high abundance in the
conjugated steroid fractions.
Discussion
Recently, we identified the novel enzyme 20b-HSD type 2 and
hypothesized that the enzyme plays a role in cortisol catabolism in
concert with 11b-HSD type 2 [36]. The results obtained
substantiate our hypothesis that 11b-HSD type 2 and 20b-HSD
type 2 are involved in cortisol catabolism and stress response. In
this study, we present data concerning the cortisol induction of
zebrafish 20b-HSD type 2 expression, the physiological implica-
tions of 20b-HSD type 2 knock down, and evidence that 20b-
hydroxycortisone is an excreted glucocorticoid.
To analyze whether the regulation of 20b-HSD type 2
expression is cortisol-dependent, we treated zebrafish embryos
with varying concentrations of cortisol. The chosen concentrations
were higher than physiological cortisol levels due to three reasons:
Firstly, we were primarily interested in elucidating the mechanistic
role of 20b-HSD type 2 in zebrafish. To ensure the observation of
a cortisol-dependent effect, we administered rather high concen-
trations. Secondly, comparable studies exposing zebrafish embryos
to cortisol are rare. To date, there were only two publications
[12,17] exposing zebrafish embryos to cortisol and in these studies
100 mg/L cortisol were necessary to observe an effect. We
designed our cortisol challenge experiments in accordance to these
studies. Thirdly, the chorion of zebrafish embryos represents a
major barrier for all kinds of chemicals. Studies on the
permeability of steroids were so far not performed, but cryopro-
tective compounds like glycerol or DMSO do not diffuse easily
across the chorion [45,46]. Thus, to ensure that cortisol diffused
into the embryo and exerted a measurable effect on the expression
of 20b-HSD type 2 and 11b-HSD type 2, rather high concentra-
tions of cortisol were chosen. Challenging wild-type embryos with
cortisol up-regulated the known catabolic enzyme 11b-HSD type
2. Moreover, 20b-HSD type 2 was induced even more strongly.
Neither gene’s up-regulation was dose-dependent, although in
72 hpf zebrafish larvae, 11b-HSD type 2 showed a negative
correlation between the degree of up-regulation and the cortisol
concentration. The reason for this observation is not clear but
could be due to the rather high cortisol concentrations used in our
experimental setup. A positive correlation of dosage and up-
regulation of both genes might be detectable if cortisol was applied
within a physiological concentration range.
Even a shorter cortisol exposure (3–24 hpf) of the zebrafish
embryos significantly increased the levels of hsd20b2 and hsd11b2
expression. Twenty-four hours after the removal of the cortisol
from the fish medium, the mRNA levels of both enzymes in 48 hpf
embryos were even higher than the levels observed while cortisol
Zebrafish Glucocorticoid Catabolism in Stress
PLOS ONE | www.plosone.org 11 January 2013 | Volume 8 | Issue 1 | e54851
remained in the fish medium. Despite the cortisol removal from
the medium, the cortisol concentration in the fish embryo was
likely still elevated, leading to the continued overexpression of both
11b-HSD type 2 and 20b-HSD type 2. The increased amount of
both enzymes is likely necessary to catabolize excess cortisol to
regain homeostasis. Alternatively, this effect may also reflect the
long half life of both the hsd20b2 and hsd11b2 transcripts. In the
72 hpf larvae 48 hours post challenge, the mRNA of both enzymes
decreased to wild-type levels. This observation might indicate that
cortisol inactivation has proceeded and the cortisol concentration
in the fish reached a level which is insufficient to stimulate the
hsd11b2 and hsd20b2 expression.
To elucidate whether 11b-HSD type 2 and 20b-HSD type 2 are
up-regulated by stress independently of artificial cortisol treatment,
we challenged zebrafish larvae with a physical stressor. This
stressor consisted of swirling and was adapted from Alsop and
Vijayan [11], who have shown that the stress axis is fully functional
by 97 hpf and that cortisol concentrations are significantly
elevated as early as 5 min after the 30 sec swirling stress. We
challenged 5 dpf zebrafish larvae with a 30 sec swirling stressor
and analyzed the expression of the HPI axis genes at various time
points after the stressor. Most HPI axis genes were up-regulated
upon physical stress (e.g., crh,mc2r, and star), while the levels of
cyp11c1 followed no visible trend due to high inter-individual
variability. Mc2r alone decreased to unstressed levels 60 min after
the stress, whereas crh and star remained slightly elevated
throughout the experiment. These observations demonstrate an
activated HPI axis and successful stress transmission. However, the
intensity and duration of up-regulation deviated slightly from the
results obtained by subjecting adult zebrafish to a 60 min vortex
stressor, after which mc2r,star, and cyp11c1 exhibited the highest
expression after 20 min, and crh had already peaked after 10 min
[47]. The mRNA levels of all four genes decreased to unstressed
levels by 60 min [47]. These discrepancies are most likely due to
the different approaches used in the stress challenges and the
different sources of RNA in our study compared with Fuzzen et al.
(2010) [47]. We subjected 5 dpf zebrafish larvae to a short-term
stressor, while Fuzzen et al. (2010) applied a long-term stressor to
adult zebrafish. In addition, Fuzzen et al. (2010) quantified the HPI
axis genes in the head kidney alone, which contrasts with our
approach of quantifying the mRNA of the whole larvae.
Nevertheless, the general results of both approaches are compa-
rable, and any differences may well reflect regulatory processes
that differ between larval and adult fish. Regarding the mRNA of
the cortisol-inactivating enzyme hsd11b2, Fuzzen et al. (2010)
detected a peak after 20 min and, after 60 min, observed mRNA
levels similar to those under unstressed conditions. After subjecting
the 5 dpf larvae to the short-term stressor, we observed a slight but
steady increase of hsd11b2 mRNA that reached 1.5-fold after
30 min and did not decrease until 60 min post-stress. The
potentially catabolic enzyme, hsd20b2, had already increased 1.6-
fold 5 min after the stressor, and it reached a 2.2-fold induction
after 60 min. The mRNA of both enzymes did not decrease to
unstressed levels during the experiment, indicating that cortisol
inactivation and putative excretion were probably involved in the
biochemical stress reduction even 60 min after the stressor was
perceived. The prolonged up-regulation of both catabolic enzymes
could protect the larvae from the adverse effect of stress on their
development.
Hsd20b2 expression analysis in early zebrafish development
revealed that its mRNA was maternally supplied to the zygote
[36]. To elucidate the impact of an hsd20b2 knock down on
zebrafish development, we designed a splicing morpholino. This
morpholino exerted its action after the onset of zygotic transcrip-
tion to avoid the potentially lethal effects of a translation-blocking
morpholino, whose action would arise directly after its injection.
The knock down of hsd20b2 was verified by the significant decrease
of both the 20b-HSD type 2 mRNA and activity levels in the
morphant fish larvae. Under normal culturing conditions, the
morphants displayed no developmental phenotype. However,
challenging hsd20b2 morphants with a cortisol concentration
sufficient to induce hsd20b2 expression but not to visibly harm
wild-type fish embryos led to developmental changes. Phenotyp-
ical abnormalities appeared first at 48 hpf and persisted and, in
some cases, intensified until 72 hpf. The observed developmental
abnormalities of the challenged morphants resembled a ‘cortisol
phenotype’ previously described by Hillegass et al. [17]. Compa-
rable tail deformations have also been observed after morpholino-
induced knock-down of the GRa[13,14], and pericardial edema
have formed upon microinjection of cortisol into zebrafish
embryos to mimick the influence of maternal stress on the fish
progeny [15]. Our results for the hsd20b2 morphants hint at an
impaired cortisol catabolism pathway assuming a vital role for
20b-HSD type 2 in reducing cortisol concentrations in concert
with 11b-HSD type 2.
Steroids exert their effects on the gene expression mediated by
members of the nuclear receptor family. Cortisol is the unique
ligand for the GR in teleost fish [7,23] and is also able to activate
the MR [28,29]. To rule out the involvement of 20b-hydro-
xycortisone in steroid signaling, reporter gene experiments were
performed that took zebrafish GRaand MR into account. While
zebrafish GRahas already been shown to bind cortisol with an
EC
50
value of 10 nM [23], the endogenous ligand for zebrafish
MR is not yet known. Teleost fish lack the capability to synthesize
aldosterone [27], but there is evidence that 11-deoxycorticosterone
might be the ligand for MR in teleost fish [28,29]. Our results for
zebrafish GRaconfirmed the high affinity binding of cortisol
published earlier [23], additionally demonstrating that no other
steroidal ligand tested here, including 20b-hydroxycortisone, was
able to activate this receptor. As expected, the ligand spectrum of
the zebrafish MR was broader than the spectrum of the GRa,as
the MR was activated by aldosterone and cortisol. Cortisone and
20b-hydroxycortisone induced MR reporter gene expression to a
negligible extent and only at high concentrations. This result
showed plainly that physiological concentrations of 20b-hydro-
xycortisone do not bind or activate either GRaor MR; 20b-
hydroxycortisone likely has no role in the steroid signaling
pathways of either receptor.
Being that it is not involved in steroid hormone signaling, we
investigated whether 20b-hydroxycortisone might be an excreted
end product of cortisol catabolism. In humans, cortisol is primarily
inactivated by 11b-HSD type 2 to yield cortisone [30], which is
reduced at the C4–C5 double bond and at the C3 and C20
carbonyl groups. The products that result are subsequently either
conjugated to increase their solubility in water or excreted in their
free form via the urine. In fish, it is generally accepted that cortisol
is metabolized along similar pathways [7]. Studies investigating
Figure 7. 20b-hydroxycortisone is the most abundant gluco-
corticoid in extracts from adult zebrafish holding water. The
measurement of four glucocorticoids in extracts from adult zebrafish
holding water was performed by a separate LC-MS/MS analysis of each
fraction: (A) unconjugated steroids; (B) glucuronidated steroids; (C)
sulfated steroids. Each bar represents the mean value of three
independent samples with standard deviations added. Sample abbre-
viations: X-mixed gender group; F-all female group; M-all male group;
X-E-mixed gender group, without addition of digestive enzymes; N-
water control without fish.
doi:10.1371/journal.pone.0054851.g007
Zebrafish Glucocorticoid Catabolism in Stress
PLOS ONE | www.plosone.org 12 January 2013 | Volume 8 | Issue 1 | e54851
glucocorticoid excretion in fish have been rare but indicate a more
varied picture because fish can excrete steroids via the gills and the
bile as well as the urine [33–35]. Steroid moieties in the bile of
rainbow trout included tetrahydro-derivatives of cortisol and
cortisone, 20b-cortolone, 5b-dihydrocortisone, cortisone, and
cortisol as the major excretion products [33,34]. Our analysis of
glucocorticoids in zebrafish holding water revealed 20b-hydro-
xycortisone to be the most abundant steroid in both the
conjugated and free steroid fractions. This high amount of 20b-
hydroxycortisone in the conjugated fractions, whether glucuroni-
dated and sulfated steroids, indicates that this steroid is predom-
inantly labeled for excretion. This observation suggests a putative
excretion pathway parallel to and independent of that described
above. Instead of the reduction of the C4–C5 double bond
followed by the reduction of C3 and C20 carbonyl groups, we
found a shorter pathway for cortisol catabolism and excretion.
This pathway involves only 11b-HSD type 2, 20b-HSD type 2,
glucuronosyltransferase, and sulfatase and can be quickly activated
upon a stressor. It can be speculated that both 11b-HSD type 2
and 20b-HSD type 2 are important in protecting the adult
zebrafish as well as the developing zebrafish embryo from
exogenous glucocorticoids, beside coping with endogenously
produced cortisol upon stress.
In humans, 11b-HSD type 1 catalyzes the reactivation of
cortisone to cortisol [48,49]. 11b-HSD type 1 does not exist in
zebrafish, but its ancestor, 11b-HSD type 3, was identified in the
zebrafish genome and suggested to fulfill 11b-HSD type 1
functions [50,51]. The action of 20b-HSD type 2 can be
considered to reduce the amount of cortisone available for
reconversion to cortisol by 11b-HSD type 3 [36]. However, up
to now there is no experimental evidence published for the
cortisone to cortisol conversion in zebrafish. Additionally, 11b-
HSD type 3 failed to catalyze this reaction in our hands (data not
shown). Thus, the question whether cortisone is indeed reactivated
to cortisol remains unanswered. Furthermore, it can only be
speculated that 20b-HSD type 2 is the enzyme responsible for
catalyzing the efflux of cortisone out of the putative cortisol
inactivation-reactivation cycle.
In summary, we have shown that zebrafish 11b-HSD type 2
and 20b-HSD type 2 transcripts are significantly up-regulated by
stress signals in the form of either cortisol treatment or the
application of an acute physical stressor independent of artificial
cortisol application. Morpholino-induced knock down of hsd20b2
caused no developmental phenotype under normal culturing
conditions, but after challenging the morphants with cortisol, we
observed abnormalities such as yolk deformations, altered
somitogenesis, and pericardial edema previously described in
connection with cortisol exposure [17] and disrupted cortisol
signaling [13–15]. The cortisol-dependent regulation of 11b-HSD
type 2 and 20b-HSD type 2 and the diminished capability of
hsd20b2 morphants to cope with an excess of cortisol demonstrates
the concerted action of both enzymes in cortisol inactivation.
Additionally, we have shown that the reaction product of 20b-
HSD type 2, 20b-hydroxycortisone, does not bind to or activate
either zebrafish GRaor MR. Instead of being involved in steroid
signaling pathways, 20b-hydroxycortisone is excreted predomi-
nantly after its conjugation into the fish holding water. Therefore,
11b-HSD type 2, together with the novel 20b-HSD type 2,
constitutes a rapid pathway in zebrafish to efficiently inactivate
cortisol and excrete it after stressful situations.
Acknowledgments
We are thankful to Dr. Marcel Schaaf (Institute of Biology, Leiden,
Netherlands) for kindly providing the expression plasmid zGRa_pCS2+
and the reporter plasmid pMMTV-luc. We are grateful to Michael Kobl,
Mark Haid, and Tobias Gaisbauer for fruitful discussions on the
manuscript. We thank Marion Schieweg, Andrea Kneuttinger, and
Katharina Franke for their excellent technical assistance.
Author Contributions
Conceived and designed the experiments: JT GM JA. Performed the
experiments: JT. Analyzed the data: JT WN GM MHA JA. Contributed
reagents/materials/analysis tools: MHA JA. Wrote the paper: JT GM JA.
References
1. Alsop D, Vijayan MM (2009) Molecular programming of the corticosteroid
stress axis during zebra fish development. Comparative biochemistry and
physiology Part A, Molecular & integrative physiology 153: 49–54.
2. Linda R (2007) Visceral sensory inputs to the endocrine hypothalamus. Frontiers
in neuroendocrinology 28: 50–60.
3. Olivereau M, Olivereau J (1988) Localization of CRF-like immunoreactivity in
the brain and pituitary of teleost fish. Peptides 9: 13–21.
4. Metz JR, Peters JJM, Flik G (2006) Molecular biology and physiology of the
melanocortin system in fish: a review. General and Comparative Endocrinology
148: 150–162.
5. Alderman SL, Bernier NJ (2009) Ontogeny of the corticotropin-releasing factor
system in zebrafish. General and Comparative Endocrinology 164: 61–69.
6. Alsop D, Vijayan M (2009) The zebrafish stress axis: molecular fallout from the
teleost-specific genome duplication event. General and Comparative Endocri-
nology 161: 62–66.
7. Mommsen TP, Vijayan MM, Moon TW (1999) Cortisol in teleosts: dynamics,
mechanisms of action, and metabolic regulation. Reviews of Fish Biology and
Fisheries 9: 211–268.
8. Vijayan MM, Pereira C, Grau EG, Iwama GK (1997) Metabolic responses
associated with confinement stress in tilapia: the role of cortisol. Comparative
biochemistry and physiology Part C, Pharmacology, toxicology and endocri-
nology 116: 89–95.
9. McCormick SD (2001) Endocrine control of osmoregulation in teleost fish.
American Zoologist 41: 781–794.
10. Barton BA (2002) Stress in fishes: a diversity of responses with particular
reference to changes in circulating corticosteroids. Integrative and comparative
biology 42: 517–525.
11. Alsop D, Vijayan MM (2008) Development of the corticosteroid stress axis and
receptor expression in zebrafish. American journal of physiology Regulatory,
integrative and comparative physiology 294: 711–719.
12. Hillegass JM, Villano CM, Cooper KR, White LA (2008) Glucocorticoids alter
craniofacial development and increase expression and activity of matrix
metalloproteinases in developing zebrafish (Danio rerio). Toxicological sciences
102: 413–424.
13. Pikulkaew S, Benato F, Celeghin A, Zucal C, Skobo T, et al. (2011) The
knockdown of maternal glucocorticoid receptor mRNA alters embryo
development in zebrafish. Developmental dynamics 240: 874–889.
14. Nesan D, Kamkar M, Burrows J, Scott IC, Marsden M, et al. (2012)
Glucocorticoid receptor signaling is essential for mesoderm formation and
muscle development in zebrafish. Endocrinology 153: 1288–1300.
15. Nesan D, Vijayan MM (2012) Embryo exposure to elevated cortisol level leads
to cardiac performance dysfun ction in zebrafish. Molecular a nd cellular
endocrinology 363: 85–91.
16. Kumai Y, Nesan D, Vijayan MM, Perry SF (2012) Cortisol regulates Na(+)
uptake in zebrafish, Danio rerio, larvae via the glucocorticoid receptor.
Molecular and Cellular Endocrinology 364: 113–125.
17. Hillegass JM, Villano CM, Cooper KR, White LA (2007) Matrix metallopro-
teinase-13 is required for zebra fish (Danio rerio) development and is a target for
glucocorticoids. Toxicological sciences 100: 168–179.
18. McCormick MI, Nechaev IV (2002) Influence of cortisol on developmental
rhythms during embryogenesis in a tropical damselfish. Journal of Experimental
Zoology 293: 456–466.
19. Pickering AD, Pottinger TG (1989) Stress responses and disease resistance in
salmonid fish: effects of chronic elevation of plasma cortisol. Fish Physiology and
Biochemistry 7: 253–258.
20. Pickering AD (1992) Rainbow trout husbandry: management of the stress
response. Aquaculture 100: 125–139.
21. Maule AG, Tripp RA, Kaattari SL, Schreck CB (1989) Stress alters immune
function and disease resistance in chinook salmon (Oncorhynchus tshawytscha).
Journal of Endocrinology 120: 135–142.
Zebrafish Glucocorticoid Catabolism in Stress
PLOS ONE | www.plosone.org 13 January 2013 | Volume 8 | Issue 1 | e54851
22. Schreck CB, Contreras-Sanchez W, Fitzpatrick MS (2001) Effects of stress on
fish reproduction, gamete quality, and progeny. Aquaculture 197: 3–24.
23. Schaaf MJ, Champagne D, van Laanen IHC, van Wijk DCWA, Meijer AH, et
al. (2008) Discovery of a functional glucocorticoid receptor beta-isoform in
zebrafish. Endocrinology 149: 1591–1599.
24. Funder JW (1997) Glucocorticoid and mineralocorticoid receptors: biology and
clinical relevance. Annual review of medicine 48: 231–240.
25. Bujalska I, Shimojo M, Ho wie A, Stewart PM (1997) Human 11beta-
hydroxysteroid dehydrogenase: studies on the stably transfected isoforms and
localization of the type 2 isozyme within renal tissue. Steroids 62: 77–82.
26. Shimojo M (1997) Immunodetection of 11beta-hydroxysteroid dehydrogenase
type 2 in human mineralocorticoid target tissues: evidence for nu clear
localization. Endocrinology 138: 1305–1311.
27. Jiang J-Q, Young G, Kobayashi T, Nagahama Y (1998) Eel (Anguilla japonica)
testis 11beta-hydroxylase gene is expressed in interrenal tissue and its product
lacks aldosterone synthesizing activity. Molecular and Cellular Endocrinology
146: 207–211.
28. Sturm A, Bury N, Dengreville L, Fagart J, Flouriot G, et al. (2005) 11-
Deoxycorticosterone is a potent agonist of the rainbow trout (Oncorhynchus
mykiss) mineralocorticoid receptor. Endocrinology 146: 47–55.
29. Pippal JB, Cheung CMI, Yao Y-Z, Brennan FE, Fuller PJ (2011) Character-
ization of the zebrafish (Danio rerio) mineralocorticoid receptor. Molecular and
Cellular Endocrinology 332: 58–66.
30. Edwards CRW, Benediktsson R, Lind say RS, Seckl JR (199 6) 11beta-
Hydroxysteroid dehydrogenases: key enzymes in determining tissue-specific
glucocorticoid effects. Steroids 61: 263–269.
31. Baker ME (2010) 11beta-hydroxysteroid dehydrogenase-type 2 evolved from an
ancestral 17beta-hydroxysteroid dehydrogenase-type 2. Biochemical and
biophysical research communications 399: 215–220.
32. Meyer A, Strajhar P, Murer C, Cunha TD, Odermatt A (2012) Species-specific
differences in the inhibition of human and zebrafish 11beta-hydroxysteroid
dehydrogenase 2 by thiram and organotins. Toxicology 301: 72–78.
33. Pottinger TG, Moran TA, Cranwell PA (1992) The biliary accumulation of
corticosteroids in rainbow trout, Oncorhynchus mykiss, during acute and
chronic stress. Fish Physiology and Biochemistry 10: 55–66.
34. Truscott B (1979) Steroid metabolism in fish. Identification of steroid moieties of
hydrolyzable conjugates of cortisol in the bile of trout Salmo gairdnerii. General
and Comparative Endocrinology 38: 196–206.
35. Vermeirssen ELM, Scott AP (1996) Excretion of free and conjugated steroids in
rainbow trout (Oncorhynchus mykiss): evidence for branchial excretion of the
maturation-inducing steroid, 17,20beta-dihyd roxy-4-pregnen-3-one. General
and Comparative Endocrinology 101: 180–194.
36. Tokarz J, Mindnich R, Norton W, Mo¨ller G, Hrabe´ de Angelis M, et al. (2012)
Discovery of a novel enzyme mediating glucocorticoid catabolism in fish:
20beta-hydroxysteroid dehydrogenase type 2. Molecular and Cellular Endocri-
nology 349: 202–213.
37. Westerfield M (2000) The Zebrafish Book. A guide for the laboratory use of
zebrafish (Danio rerio). Eugene: University of Oregon Press.
38. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF (1995) Stages
of embryonic development of the zebrafish. Developmental Dynamics 203: 253–
310.
39. Payne DW, Holtzclaw WD, Adashi EY (1989) A convenient, unified scheme for
the differential extraction of conjugated and unconjugated serum C19 steroids
on Sep-Pak C18-cartridges. Journal of steroid biochemistry 33: 289–295.
40. Rozen S, Skaletzky H (1999) Primer3 on the WWW for general users and for
biologist programmers. Methods in Molecular Biology 132: 365–368.
41. Pfaffl MW (2001) A new mathematical model for relative quantification in real-
time RT-PCR. Nucleic Acids Research 29: e45.
42. Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP (2004) Determination of
stable housekeeping genes, differentially regulated target genes and sample
integrity: BestKeeper-Excel-based tool using pair-wise correlations. Biotechnol-
ogy Letters 26: 509–515.
43. Pfaffl MW, Horgan GW, Dempfle L (2002) Relative expression software tool
(REST) for group-wise comparison and statistical analysis of relative expression
results in real-time PCR. Nucleic Acids Research 30: e36.
44. R Core Team (2012) R: A language and environment for statistical computing.
Vienna, Austria: R Foundation for Statistical Computing.
45. Harvey B, Kelley RN, Ashwood-Smith MJ (1983) Permeability of intact and
dechorionated zebra fish embryos to glycerol and dimethyl sulfoxide.
Cryobiology 20: 432–439.
46. Hagedorn M, Hsu E, Kleinhans FW, Wildt DE (1997) New approaches for
studying the permeability of fish embryos: toward successful cryopreservation.
Cryobiology 34: 335–347.
47. Fuzzen MLM, van der Kraak G, Bernier NJ (2010) Stirring up new ideas about
the regulation of the hypothalamic-pituitary-interrenal axis in zebrafish (Danio
rerio). Zebrafish 7: 349–358.
48. Tomlinson JW, Walker EA, Bujalska IJ, Draper N, Lavery GG, et al. (2004)
11beta-hydroxysteroid dehydrogenase type 1: a tissue-specific regulator of
glucocorticoid response. Endocrine reviews 25: 831–866.
49. Seckl JR, Walker BR (2001) Minireview: 11beta-hydroxysteroid dehydrogenase
type 1-a tissue-specific amplifier of glucocorticoid action. Endocrinology 142:
1371–1376.
50. Baker ME (2004) Evolutionary analysis of 11beta-hydroxysteroid dehydroge-
nase-type 1, -type 2, -type 3 and 17beta-hydroxysteroid dehydrogenase-type 2 in
fish. FEBS Letters 574: 167–170.
51. Baker ME (2010) Evolution of 11beta-hydroxysteroid dehydrogenase-type 1 and
11beta-hydroxysteroid dehydrogenase-type 3. FEBS letters 584: 2279–2284.
Zebrafish Glucocorticoid Catabolism in Stress
PLOS ONE | www.plosone.org 14 January 2013 | Volume 8 | Issue 1 | e54851
