ArticlePDF Available

ΔNp63 regulates Erk signaling via MKP3 to inhibit cancer metastasis

Authors:

Abstract and Figures

Reduced expression of the p53 family member p63 has been suggested to play a causative role in cancer metastasis. Here, we show that ΔNp63α, the predominant p63 isoform, plays a major role in regulation of cell migration, invasion and cancer metastasis. We identified mitogen-activated protein (MAP) kinase phosphatase 3 (MKP3) as a downstream target of ΔNp63α that is required for mediating these effects. We show that ΔNp63α regulates extracellular signal-regulated protein kinases 1 and 2 (Erk1/2) activity via MKP3 in both cancer and non-transformed cells. We further show that exogenous ΔNp63α inhibits cell invasion and is dependent on MKP3 upregulation for repression. Conversely, endogenous pan-p63 ablation results in increased cell migration and invasion, which can be reverted by reintroducing the ΔNp63α isoform alone, but not by other isoforms. Interestingly, these effects require Erk2, but not Erk1 expression, and can be rescued by enforced MKP3 expression. Moreover, MKP3 expression is reduced in invasive cancers, and reduced p63 expression increases metastatic frequency in vivo. Taken together, these results suggest an important role for ΔNp63α in preventing cancer metastasis by inhibition of Erk2 signaling via MKP3.Oncogene advance online publication, 17 December 2012; doi:10.1038/onc.2012.564.
Np63 reduces phosphorylated Erk1/2 in nuclei and attenuates Erk1/2 signaling. MDA-MB-231 cells stably expressing ΔNp63α (p63) or an empty vector control (V) were subjected to Q-PCR analysis for MKP3 mRNA levels (a) and protein expression (b). The Q-PCR data are presented as means and s.e. from three experiments performed in triplicate (c) MDA-MB-231 cells were transduced with retrovirus encoding ΔNp63α. A mixed population of ΔNp63α-positive (p63 (+)) and ΔNp63α-negative (p63 (−)) cells was assessed by immunofluorescence for p63 expression and phosphorylated Erk1/2 levels, and the nuclei were counterstained with 4,6-diamidino-2-phenylindole (DAPI). Arrows denote cells with high levels of nuclear phosphorylated Erk1/2. Scale bar=20 μm. (d) Cells with high levels of phosphorylated Erk1/2 were scored for both p63 (−) and p63 (+) cells. Data are presented as percentage of cells with high phosphorylated Erk1/2 over total p63 (−) or p63 (+) cells. At least 100 cells in total from five random fields were scored for each of six experiments. Results are presented as means and s.e. (e) MDA-MB-231 cells stably expressing ΔNp63α (p63) or vector control (V) were subjected to cellular fractionation to separate the nuclear from the cytosolic fractions, which were then subjected to western blotting as shown. (f) MDA-MB-231 cells stably expressing ΔNp63α (p63) or vector control (V) were subjected to Q-PCR analysis for mRNA levels of MMP1 and MMP9. Results are presented as means and s.e. from three experiments performed in triplicate.
… 
Np63α, but not other p63 isoforms, inhibits cell migration and invasion. (a, b) MCF-10A and FaDu cells stably expressing shRNA specific for pan-p63 (shp63) or green fluorescent protein (GFP) (shC) were subjected to cell migration (a) or invasion assays (b), using transwell systems. Migratory and invasive cells were fixed and stained with crystal violet and quantitated as described in the Materials and methods section. Results are presented as means and s.e. from three experiments. (c) MCF-10A cells infected with recombinant lentivirus encoding shRNA specific for p63 (shp63) or GFP as a control (shC) were grown in fresh normal growth media (see Materials and methods section) for 2 h before fixation. Cells were then immunostained for phospho-paxillin (pTyr118) and counterstained with 4,6-diamidino-2-phenylindole (DAPI). A representative figure from two independent experiments performed in triplicate is shown. Note the punctuated staining of focal adhesion complexes in p63-ablated cells in contrast to the organized peripheral staining in control cells (insets). Scale bars=20 μm. (d, e) MCF-10A cells infected with recombinant lentivirus encoding shRNA specific for p63 (shp63) or GFP as a control (shC) were transiently transfected with mouse Myc-tagged ΔNp63α, ΔNp63γ, TAp63α, TAp63γ or a vector control (V) as shown. Cells were subjected to western blotting (d) or to invasion assays using transwell systems (e). Results are presented as means and s.e. from two independent experiments. *P<0.05; **P<0.01.
… 
Content may be subject to copyright.
ΔNp63α regulates Erk signaling via MKP3 to inhibit cancer
metastasis
Johann Bergholz1,2, Yujun Zhang2, Junfeng Wu1, Le Meng1, Erica M. Walsh1, Arun Rai1,
Michael Y. Sherman1, and Zhi-Xiong Jim Xiao1,2,*
1Department of Biochemistry, Boston University School of Medicine, Boston, MA 02118. U.S.A
2Center of Growth, Metabolism and Aging, College of Life Sciences and State Key Laboratory of
Biotherapy, Sichuan University, Chengdu, 610014. China
Abstract
Reduced expression of the p53 family member p63 has been suggested to play a causative role in
cancer metastasis. Here we show that ΔNp63α, the predominant p63 isoform, plays a major role in
regulation of cell migration, invasion, and cancer metastasis. We identified MAP Kinase
Phosphatase 3 (MKP3) as a downstream target of ΔNp63α that is required for mediating these
effects. We show that ΔNp63α regulates Extracellular Signal-Regulated Protein Kinase 1 and 2
(Erk1/2) activity via MKP3 in both cancer and non-transformed cells. We further show that
exogenous ΔNp63α inhibits cell invasion and is dependent on MKP3 up-regulation for repression.
Conversely, endogenous pan-p63 ablation results in increased cell migration and invasion, which
can be reverted by reintroducing the ΔNp63α isoform alone, but not by other isoforms.
Interestingly, these effects require Erk2, but not Erk1 expression, and can be rescued by enforced
MKP3 expression. Moreover, MKP3 expression is reduced in invasive cancers, and reduced p63
expression increases metastatic frequency in vivo. Taken together, these results suggest an
important role for ΔNp63α in preventing cancer metastasis by inhibition of Erk2 signaling via
MKP3.
Keywords
p63; MKP3; Erk; metastasis; cancer
Introduction
The p63 gene is expressed from two different promoters that generate isoforms either with a
p53-homologous transactivation domain (TAp63) or without this domain (ΔNp63).
Additionally, alternative splicing gives rise to three different C-termini (α, β, and γ), for a
total of six isoforms. The DNA-binding and oligomerization domains are shared by all
isoforms and are highly homologous to those of p53. Further, p63α isoforms contain a
Sterile Alpha Motif (SAM), important for protein-protein interactions, and a post-inhibitory
domain for intramolecular inhibition of gene transactivation (1–3). p63 has been shown to
Users may view, print, copy, download and text and data- mine the content in such documents, for the purposes of academic research,
subject always to the full Conditions of use: http://www.nature.com/authors/editorial_policies/license.html#terms
*Correspondence: Zhi-Xiong Jim Xiao, College of Life Sciences, Sichuan University, Chengdu, 610014. China, jimzx@scu.edu.cn,
Phone: 86-28-8851-5509, Fax: 86-28-8851-5509.
Supplementary Information accompanies the paper on the Oncogene website (http://www.nature.com/onc).
Conflict of interest
The authors declare no conflict of interest.
NIH Public Access
Author Manuscript
Oncogene. Author manuscript; available in PMC 2014 July 09.
Published in final edited form as:
Oncogene. 2014 January 9; 33(2): 212–224. doi:10.1038/onc.2012.564.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
possess pleiotropic functions, including regulation of cell proliferation, survival, apoptosis,
differentiation, senescence, and aging (4, 5). Mutations in the p63 gene have been associated
with human autosomal dominant developmental diseases affecting primarily the skin and
orofacial and limb morphogenesis, including ectrodactyly-ectodermal dysplasia-cleft lip/
palate (EEC) syndrome, and ankyloblepharon-ectodermal dysplasia-clefting (AEC)
syndrome (6, 7). Mice lacking all p63 isoforms exhibit early post-natal lethality, and severe
developmental defects, including a complete lack of all stratified epithelia and ectodermal
appendages, severe craniofacial defects, and limb truncation (8, 9). It has been shown that
p63 is essential for epithelial stem cell maintenance and epithelial differentiation (10, 11). In
addition, p63 deficiency leads to increased cellular senescence and an aging phenotype in
mice (12).
A role for p63 in cancer development is demonstrated by a genetic study in which p63
haploinsufficiency in p53+/− mice markedly increases metastatic frequency (13). Further
studies show that TAp63+/− and TAp63−/− mice develop spontaneous carcinomas and
sarcomas that are highly metastatic (14). Moreover, TAp63 specifically functions in the
female germline to protect genomic integrity (15, 16).
ΔNp63α is the predominant p63 isoform expressed in basal epithelial cells and is essential
for epithelial development (3, 17). ΔNp63α regulates the expression of several adhesion
molecules, including integrins β1, β4 and α6, and the demosome protein PERP (18, 19),
which implicates it in cell invasion. Loss of ΔNp63α expression results in cell detachment
and anoikis (18), while expression of ΔNp63α inhibits TAp73-mediated apoptosis (20, 21).
In line with these observations, ΔNp63α cooperates with Ras to promote skin stem cell
proliferation and tumorigenesis (22). Furthermore, ΔNp63α is frequently over-expressed in
low-grade squamous cell carcinoma (SCC) (23–25). On the other hand, reduced p63
expression is associated with progression in a variety of cancers, including esophageal SCC,
prostate cancer, and melanoma (26–28). Together, these data suggest that ΔNp63α may
promote early stages of tumor development, but acts to inhibit cancer metastasis.
However, little is known about the molecular effects by which ΔNp63α, the predominant
p63 isoform in cancer cells, affects tumor progression. Here, using breast cancer models, we
uncovered an unexpected link to Extracellular signal-Regulated protein Kinases 1 and 2
(Erk1/2). Sustained Erk1/2 activity promotes tumorigenesis by inducing cell growth and
proliferation, and it is often up-regulated in advanced cancers (29–31). Moreover, invasive
cancer cells have higher Erk1/2 activity (32), which drives cell migration, invasion and
metastasis (33–35). Mitogen-Activated Protein (MAP) Kinase Phosphatase 3 (MKP3; also
known as DUSP6 or Pyst1) specifically dephosphorylates Erk1/2, thus restraining signal
strength and duration, and acting as a putative tumor suppressor (36, 37).
In this study, based on microarray analyses, we uncovered that unlike TAp63 isoforms,
ΔNp63α directly activates transcription of MKP3, leading to specific regulation of Erk2
signaling. Thus, we demonstrate that the ΔNp63α isoform plays a critical role in inhibiting
cancer cell migration, invasion, and metastasis via a novel signaling mechanism that
engages the Erk pathway.
Results
ΔNp63α up-regulates MKP3 expression
To identify ΔNp63α downstream targets through which ΔNp63α executes its biological
functions, we profiled gene expression of cells expressing wild type ΔNp63α in comparison
to that of cells expressing mutant derivatives or a vector control using Affymetrix gene chip
analysis. Accordingly, we stably expressed wild type or mutant ΔNp63α in human breast
Bergholz et al. Page 2
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
cancer Hs-578T cells. These cells are highly invasive but not tumorigenic (38), and have no
detectable p63 protein expression. The C306R mutation maps to the DNA-binding domain
and is associated with EEC syndrome, while the C526W mutation is associated with AEC
syndrome and is located in the SAM domain, thus affecting p63α isoforms exclusively (6,
7).
Upon analysis of the microarray, we observed that MAP Kinase Phosphatase 3 (MKP3)
gene expression was up-regulated by wild type ΔNp63α to a much greater extent than by the
mutant derivatives (Figure 1a). This conclusion was validated by quantitative PCR (Q-PCR)
analysis (Figure 1b) and western blotting (Figure 1c).
To explore the clinical relevance of p63-mediated regulation of MKP3 in cancer
development, we analyzed the online microarray database Oncomine™, and observed a
clear correlation between decreased p63 and MKP3 gene expression and cancer progression
in human cancer specimens. Figure 1d showed that expression of both p63 and MKP3 is
decreased in invasive ductal breast carcinoma, compared to normal breast tissue (39), and
Figure 1e showed similar results using a different dataset. These observations implicate a
clear correlation between down-regulation of p63 and MKP3 and breast cancer progression.
ΔNp63α modulates Erk1/2 signaling
Since MKP3 is an important negative regulator of Erk1/2, we reasoned that ΔNp63α might
regulate Erk1/2 signaling through its modulation of MKP3 expression. To test this
hypothesis, we stably expressed ΔNp63α in MDA-MB-231 cells, a highly invasive and
tumorigenic human breast cancer cell line with no detectable p63 protein expression.
Consistent with our previous results, ΔNp63α significantly up-regulated MKP3 expression
at both the mRNA and protein levels (Figures 2a and 2b). Elevated MKP3, however, did not
significantly result in down-regulation of Erk1/2 protein phosphorylation (Figure 2b). This
was likely due to the presence of hyper-activated Ras(G13D) and Raf(I326T) mutations in
MDA-MB-231 cells (40), which overpower the effects of MKP3 on Erk1/2 phosphorylation.
Since MKP3 can inhibit Erk1/2 translocation to the nucleus (41), we investigated whether
ΔNp63α affects the intracellular distribution of phosphorylated Erk1/2. We immunostained
for p63 protein and for phosphorylated Erk1/2 in MDA-MB-231 cells with or without stable
expression of ΔNp63α. Strikingly, cells that lacked ΔNp63α expression exhibited strong
nuclear phosphorylated Erk1/2 (arrows, Figure 2c), whereas cells with ΔNp63α expression
showed a uniform distribution of Erk1/2 phosphorylation between the cytosol and the
nucleus. Indeed, approximately forty percent of ΔNp63α-negative cells exhibited strong
staining of nuclear Erk1/2 phosphorylation, while less than fifteen percent of ΔNp63α-
positive cells showed a similar pattern (Figure 2d). In addition, cellular fractionation
experiments showed that ΔNp63α expression resulted in decreased phosphorylated Erk1/2 in
the nuclear fraction, as we expected, while no significant changes were observed in the
much more abundant cytosolic fraction of phosphorylated Erk1/2 (Figure 2e). Furthermore,
the expression of two well-established Erk1/2 transcriptional targets, MMP1 and MMP9 (42,
43), was markedly decreased upon ΔNp63α expression (Figure 2f). Accordingly, MMP1 and
MMP9 expression is decreased in human invasive breast cancer biopsies, as assessed by
Oncomine™ (Supplementary Figure S1a). Together, these data indicate that ΔNp63α
negatively regulates Erk1/2 signaling via MKP3.
ΔNp63α inhibits cell invasion in an MKP3-dependent manner
It is well documented that Erk1/2 dysregulation causatively promotes cell migration,
invasion, and cancer metastasis (33–35). We therefore asked whether ΔNp63α expression
inhibits Erk1/2 and inhibits cancer cell invasion. As shown in Figures 3a and 3b, expression
of ΔNp63α in MDA-MB-231 cells significantly reduced cell invasion. We next examined
Bergholz et al. Page 3
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
whether ΔNp63α-mediated MKP3 induction is responsible for these effects. Again, ΔNp63α
significantly reduced MDA-MB-231 cell invasion, which was significantly reversed by
simultaneous MKP3 knockdown using specific shRNAs (Figures 3c, 3d and 3e, and
Supplementary Figure S1b). Furthermore, MKP3 ablation restored MMP1 and MMP9
expression in MDA-MB-231 cells expressing ΔNp63α, as assessed by Q-PCR (Figure 3f).
Together, these results indicate that ΔNp63α-mediated MKP3 modulation is an important
mechanism for regulating cancer cell invasion.
Endogenous ΔNp63α regulates MKP3 expression and Erk1/2 activation
Since exogenous ΔNp63α up-regulates MKP3 expression and inhibits cell invasion, we next
determined whether endogenous ΔNp63α executes a similar biological function. Human
non-transformed mammary epithelial MCF-10A cells and human head and neck squamous
cell carcinoma (SCC) FaDu cells express abundant p63, with ΔNp63α as the major protein
isoform. When tested, the shRNA against pan-p63 (shp63-1; referred to as shp63 hereafter)
effectively ablated endogenous p63 in both MCF-10A and FaDu cells (Figures 4a and 4b).
Two other shRNA constructs (shp63-2 and shp63-3) were equally effective in knocking
down p63 (Supplementary Figures S2a and S2b). Ablation of p63 by shRNA resulted in a
significant decrease in MKP3 expression in both MCF-10A and FaDu cells, as assessed by
Q-PCR (Figure 4a and Supplementary Figure S2a), and markedly reduced MKP3 protein
levels with a concomitant increase in phosphorylated Erk1/2 (Figure 4b and Supplementary
Figure S2b), whereas no significant changes in total Erk1/2 protein or Mek phosphorylation
levels were observed (Figure 4b).
In order to further investigate the molecular mechanism by which ΔNp63α regulates MKP3
expression, we asked whether ΔNp63α directly binds to the promoter of the MKP3 gene.
Computational analysis of the human MKP3 gene and promoter revealed several potential
p63/p53 binding sites, including a putative p63 binding site located 141 base pairs upstream
from the translational start site (Figure 4c). Chromatin immunoprecipitation (ChIP) using a
specific p63 antibody showed direct binding of p63 to this site (Figure 4d), suggesting that
ΔNp63α exerts direct transcriptional regulation on MKP3. Consistently, knockdown of p63
resulted in marked increases in MMP1 and MMP9 expression in both MCF-10A and FaDu
cells (Figure 4e). Taken together, these findings indicate that MKP3 is a direct ΔNp63α
transcriptional target, and that ΔNp63α negatively regulates Erk1/2 activity via MKP3.
p63 ablation enhances cell migration and invasion
Next, we investigated the biological consequences of p63-mediated modulation of Erk1/2
activity, focusing on cell migration and invasion. Knockdown of all p63 isoforms in
MCF-10A and FaDu cells led to a dramatic increase in cell migration and invasion (Figures
5a and 5b). In addition, p63 knockdown in MCF-10A cells resulted in a morphological
change from cuboidal and cobblestone-like to elongated and spindle-like morphology
(Supplementary Figure S2d). To study the underlying mechanism by which p63 modulates
cell migration, we examined the distribution of focal adhesions by immunostaining for
phospho-paxillin, a component of the focal adhesion complex. It has been shown that large
focal adhesions orderly assembled around the periphery of the cells are indicative of low cell
motility due to poor turnover of the focal adhesion complex (44, 45). As shown in Figure 5c,
while control MCF-10A cells exhibited a normal staining pattern of large focal adhesions
around the periphery, knockdown of p63 in these cells led to a punctuated and disorganized
pattern of small focal adhesions, indicative of increased turnover and enhanced motility.
To investigate whether a particular p63 isoform(s) specifically mediates these effects, we
introduced Myc-tagged murine ΔNp63α, ΔNp63γ, TAp63α, or TAp63γ into MCF-10A cells
that were ablated for endogenous p63, followed by western blot analysis (Figure 5d), and
Bergholz et al. Page 4
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
cell invasion assays (Figure 5e and Supplementary Figure S3a). Reintroduction of ΔNp63α
fully restored the non-invasive phenotype, similar to that of parental cells, while expression
of ΔNp63γ exhibited only a marginal effect in cell invasion. In sharp contrast, reintroduction
of TAp63α or TAp63γ exhibited hardly any effect, despite abundant expression of these
proteins (Figure 5d and 5e). These results demonstrate that ΔNp63α is the primary p63
isoform that regulates cell invasion in this system.
p63 ablation-induced cell motility is dependent on Erk2, but not Erk1, and can be rescued
by enforced MKP3 expression
Our results indicate that loss of ΔNp63α leads to both higher Erk1/2 activity and increased
cell migration/invasion. We then investigated whether up-regulation of Erk1/2 activity is
responsible for the observed increases in cell invasion upon p63 ablation. Indeed, inhibition
of Erk1/2 phosphorylation with a pharmacological Mek inhibitor, U0126 (Supplementary
Figure S3b), completely restored the non-invasive phenotype (Figure 6a). Accordingly,
U0126 treatment clearly inhibited MMP1 and MMP9 up-regulation elicited by p63
knockdown in MCF-10A cells (Supplementary Figure S3c).
Since Erk1 and Erk2 possess similar biochemical activities, we studied the effect of Erk1 or
Erk2 specific ablation upon p63 knockdown in MCF-10A cells (Figure 6b). Surprisingly,
knockdown of Erk1 had little effect on cell invasion. In sharp contrast, knockdown of Erk2
alone significantly reduced invasion of p63-deficient cells (Figure 6c and Supplementary
Figure S3d). Notably, simultaneous knockdown of Erk1 and Erk2 did not reduce cell
invasion further, compared to Erk2 knockdown alone.
We then examined focal adhesions by immunostaining for phospho-paxillin. The p63-
deficient cells again exhibited a punctuated, disorganized pattern of focal adhesions.
Knockdown of Erk2 in these cells led to formation of large focal adhesions organized
around the periphery of the cell, similar to those of the control cells (Figure 6d). On the
other hand, knockdown of Erk1 did not affect focal adhesion patterns observed in either the
control cells or in cells defective of p63 (Figure 6d). Together, these results demonstrate that
ΔNp63α-mediated modulation of focal adhesions and cell migration/invasion is dependent
on Erk2, but not on Erk1.
Next, we studied the role of MKP3 in p63-mediated regulation of cell motility. In line with
our previous results, ablation of MKP3 in MCF-10A cells led to an increase in MMP1
expression and to a much higher level of MMP9 expression (Supplementary Figure S4a).
Knockdown of p63 in MCF-10A cells reproducibly led to increased cell migration and
invasion, concomitant with a reduction in MKP3 protein expression and increased Erk1/2
phosphorylation (Figure 7). Importantly, exogenous expression of MKP3 in these cells
(Figure 7a) effectively reduced cell migration and invasion (Figures 7b and 7c, and
Supplementary Figure S4b). In addition, MKP3 over-expression in p63-ablated MCF-10A
cells also restored focal adhesion organization back to large complexes orderly arranged
around the periphery of the cells (Figure 7d). These data strongly support an important role
for MKP3 in negative regulation of cell migration and invasion.
Reduced p63 expression enhances metastasis in vivo
We further investigated the pathological role of reduced ΔNp63α expression in breast cancer
metastasis. We chose to use MCF-10A cells because they express abundant endogenous
ΔNp63α protein, yet they are non-tumorigenic. However, MCF-10A cells expressing
hyperactive murine Her2/Neu (V664E; referred to as NeuT) are tumorigenic in a nude
mouse model, as we have shown previously (46). Thus, we transformed MCF-10A cells by
stable transfection with NeuT. These cells exhibited neoplastic phenotypes, including loss of
Bergholz et al. Page 5
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
contact inhibition and formation of foci when grown in monolayer (Supplementary Figure
S5a). Notably, p63 knockdown in NeuT-expressing cells resulted in increased cell invasion,
compared to NeuT cells expressing a control shRNA (Supplementary Figures S4b and S4c).
We then injected MCF-10A-NeuT cells with or without p63 ablation into the lateral tail vein
of recipient nude mice, an established lung metastasis model (44). Forty-five days after
injection, mice were euthanized and their lungs dissected and inspected for metastatic
nodules (Figure 8a). Three out of five mice injected with NeuT-shp63 cells exhibited three,
four, and five large metastatic nodules each, visible on the surface of the lungs, whereas
only one out of six mice injected with NeuT-shC cells formed just one observable metastatic
nodule (Figure 8b). Furthermore, histological analysis demonstrated normal lung
architecture in the majority of the control mice, while lungs from mice injected with NeuT-
shp63 cells showed frequent infiltration of metastatic cells (Figure 8c). Taken together, these
results highlight the importance of ΔNp63α reduction as an important factor in promoting
metastasis in vivo.
Discussion
In this study, we demonstrated that the major protein isoform of p63, ΔNp63α, plays a
critical role in modulation of cell migration and invasion, as well as cancer metastasis, in an
Erk2-dependent pathway. First, exogenous expression of wild type ΔNp63α, but not of the
disease-associated mutant derivatives, inhibits cancer cell invasion. Second, ΔNp63α
transcriptionally up-regulates MKP3, which in turn inhibits Erk1/2 signaling and reduces
cell motility. Third, knockdown of p63 promotes cell migration and invasion, which is
effectively rescued by expression of MKP3 or ΔNp63α, but not by ΔNp63γ or TAp63
isoforms. Fourth, knockdown of p63 facilitates turnover of focal adhesions and cell
invasion, which is overcome by ablation of Erk2, but not Erk1. Furthermore, reduction of
p63 markedly enhances metastasis in a lung metastasis model, which is reminiscent of
clinical observations in which expression of both p63 and MKP3 are inversely correlated
with cancer progression.
Erk1/2 signaling plays a pivotal role in regulating cell migration via multiple mechanisms,
including induction of membrane protrusion and regulation of focal adhesion turnover (47).
Here, we reproducibly observe punctuated, small focal adhesions upon p63 ablation,
concomitant with increased Erk1/2 activity. These data are consistent with the notion that
reduction of ΔNp63α stimulates Erk1/2 activity and promotes cell migration. Interestingly, it
has been shown that Erk2 is responsible for Ras-induced epithelial-to-mesenchymal
transition (EMT) and increased cell migration and invasion (48). Our data show that
reduction of only Erk2, but not Erk1, effectively reverses p63 ablation-induced cell
migration. These studies suggest that Erk2 is a major effector that integrates a variety of
different signals in regulation of cell migration. It is plausible that Erk2 specifically
phosphorylates components of the focal adhesion complex to impact its turnover.
In addition to migration, Erk1/2 can also promote cell invasion by transcriptional up-
regulation of genes involved in cell invasion, such as MMP1, MMP2, and MMP9 (42, 43,
49). Our gain- and loss-of-function experiments demonstrate that ΔNp63α modulates Erk1/2
activity via MKP3, which in turn regulates MMP1 and MMP9 expression. Hence, reduced
ΔNp63α expression leads to up-regulation of MMP1 and MMP9, thereby promoting cell
invasion. Interestingly, it has been shown that ΔNp63α can induce transcription of Id-3,
which then inhibits Ets-1-mediated MMP2 gene expression and cell invasion (50). Notably,
Erk1/2 can phosphorylate and activate Ets-1 to stimulate MMP1 and MMP9 gene expression
and cell invasion (42, 43). Therefore, it is likely that ΔNp63α regulates cell invasion via
direct modulation of Erk1/2 activity. It has been reported, however, that p53 can indirectly
impact transcription of MMP1 and MMP9 via various transcriptional factors such as AP-1
Bergholz et al. Page 6
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
and NF-kB (51, 52). Although our data strongly suggest that ΔNp63α modulates MMP1 and
MMP9 gene expression via Erk1/2, we cannot rule out the possibility that ΔNp63α may also
modulate MMP1 and MMP9 expression via different mechanisms. Furthermore, Fukushima
and colleagues (53) reported that loss of ΔNp63α in certain urothelial carcinoma cell lines
results in increased N-Cadherin expression, leading to increased Erk1/2 signaling. In this
study using mammary epithelial or head and neck SCC systems, we did not detect any
significant changes in N-Cadherin expression. It remains possible that ΔNp63α modulates
Erk1/2 activity by different mechanisms in a cell context-dependent manner.
Erk1/2 activity is tightly controlled spatially and temporally. Aberrant Erk1/2 activity in
advanced cancers has often been linked to up-regulated Ras and/or Raf signaling or
increased receptor tyrosine kinase activity (54). However, accumulating evidence indicate
that dephosphorylation plays an equally important role for regulation of Erk1/2 activity (55–
57). MKP3 specifically dephosphorylates both the threonine and tyrosine residues in the
activation loop of Erk1/2, an important mechanisms for restraining Erk1/2 activity (58). In
this study, we demonstrate that ΔNp63α regulates Erk1/2 activity in an MKP3-dependent
manner. We show that ΔNp63α up-regulates MKP3 expression leading to inhibition of cell
invasion, which is markedly rescued by ablation of MKP3. Notably, knockdown of p63
induces cell invasion, which is fully reverted by ectopic expression of MKP3, yet p63
ablation-induced cell migration is only partially reverted by MKP3. These results suggest
that MKP3 is a critical player in p63-mediated modulation of cell invasion, while additional
factors are important for p63-mediated regulation of cell migration.
Activation of Erk1/2 due to p63 ablation could arise from activation of upstream kinases in
the MAP kinase cascade. However, despite repeated efforts, we did not detect significant
changes in Mek phosphorylation, suggesting that p63 modulates Erk1/2 activity via MKP3,
rather than by enhancing upstream kinase activity.
The two major p63 isoforms, TAp63 and ΔNp63, have been shown to execute overlapping
as well as distinct biological functions. Recently, Flores and colleagues (14) showed that
TAp63 suppresses metastasis through coordinate regulation of Dicer and miR-130b (14).
Our study demonstrates that ΔNp63α impacts the Erk1/2 pathway, leading to inhibition of
cell migration and invasion, in accordance with the observations that reduced ΔNp63α
expression up-regulates genes involved in cell motility and induces cell invasion in SCC and
keratinocyte cell lines (59–61). Thus, both TAp63 and ΔNp63 function to inhibit metastasis
likely through different mechanisms.
In this study, we show that two human disease-associated mutations in ΔNp63α, C304R in
the DNA binding domain and C526W in the SAM domain, do not up-regulate MKP3, and
can not affect cell migration and invasion (unpublished data). These observations highlight
the importance of DNA-binding activity and protein-protein interaction via the SAM domain
for the function of ΔNp63α in regulation of cell motility. Our data also show that, unlike
ΔNp63α, ΔNp63γ is unable to rescue MCF-10A cell invasion elicited by p63 ablation.
Notably, it was reported that ablation of p63α and p63β, but leaving p63γ expression intact,
resulted in much increased cell invasion, compared to pan-p63 knockdown (62), suggesting
that ΔNp63γ might promote cell invasion. Although we have not observed these effects of
ΔNp63γ in our system, it might be possible that the level of expression and the ratio between
different p63 isoforms affect the results observed.
More recently, it has been shown that mutant p53 (mtp53) promotes metastasis through
inhibition of p63. Piccolo and colleagues (63) show that mtp53 inhibits the anti-metastatic
activity of p63 by forming a trimeric complex between mtp53, Smad2 and p63 upon TGFβ
stimulation. In addition, Vousden and colleagues (64) show that expression of mtp53
Bergholz et al. Page 7
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
(R175H or R273H) in p53 null H1299 cells results in increased invasion, which can be
reversed by TAp63α expression, suggesting that mtp53 suppresses endogenous TAp63 to
promote cell invasion. In this study, we observe that inhibition of ΔNp63α in MCF-10A and
FaDu cells increases migration and invasion. Importantly, MCF-10A cells express wild type
p53, while FaDu cells express truncated p53 from one allele and DNA binding mutant (p53-
R248L) from the other allele (65). Thus, the ability of ΔNp63α to suppress migration and
invasion is likely independent of p53. However, it remains possible that reduced p63 may
cooperate with mtp53 to promote cell migration/invasion. Clearly, the interplay between
different p63 isoforms, mutant p53 proteins, and p53 family members can largely determine
the overall anti-metastatic activity.
Here, we uncovered that the ΔNp63α-MKP3-Erk2 pathway is an important mechanism in
controlling cell migration and invasion. Whether this axis represents a true physiological
pathway in vivo and whether dysregulation of this pathway is pathologically relevant are
critical questions. It is well documented that activation of Erk1/2 is a causative factor for
cancer progression and metastasis (32). Accumulating evidence clearly indicate a clinical
correlation between reduction of p63 and/or MKP3 expression and cancer progression,
including SCC, breast, lung, and pancreatic cancers (26–28, 39, 56, 57, 66). Interestingly, in
human head and neck SCC where ΔNp63α is often over-expressed, expression of MKP3 is
also increased (67, 68). Furthermore, using an established lung metastasis model, we show
that reduction of p63 significantly increases metastasis in mice. Notably, Her2/Neu can
transform MCF-10A cells and promotes rapid tumor formation in nude mice, yet these
tumors exhibit limited metastatic potential (46). Interestingly, we showed that knockdown of
p63 significantly enhances the metastatic potential of these cells, indicating that reduction of
ΔNp63α greatly potentiates Her2-mediated malignant activity.
Altogether, this study demonstrates that dysregulation of the ΔNp63α-MKP3-Erk2 pathway
is important for cancer metastasis. Further studies will be necessary to decipher the specific
contribution from each p63 isoform and their interactions with other p53 family members so
as to develop strategies for more efficacious treatments and preventions against cancer
metastasis.
Materials and Methods
Cell culture
Human non-transformed mammary epithelial MCF-10A cells were maintained in
DMEM:F12 media [1:1 mixture of Dulbecco's modified Eagle's medium (DMEM) and
Ham's F12 medium with reduced Ca2+ (0.04 mM; Invitrogen Inc., Carlsbad, CA)],
supplemented with 20 ng/mL epidermal growth factor (Invitrogen Inc., Carlsbad, CA), 100
ng/mL cholera toxin (Sigma, St. Louis, MO), 10 g/mL insulin (Sigma, St. Louis, MO), 500
ng/mL (95%) hydrocortisone (Sigma, St. Louis, MO), and 5% of Chelex-treated horse
serum (Invitrogen Inc., Carlsbad, CA). Human head and neck squamous cell carcinoma
FaDu cells, human breast cancer MDA-MB-231 cells, and HEK-293T cells were maintained
in DMEM supplemented with 10% fetal bovine serum (FBS; Invitrogen Inc., Carlsbad, CA).
Human breast cancer Hs-578T cells were cultured in DMEM supplemented with 10% FBS
and 10 g/mL of insulin. All cells were grown in media supplemented with 1% l-glutamine
and 1% penicillin-G/streptomycin sulfate at 37 °C in a humidified incubator under 5% CO2.
Plasmid transfections, viral infections and RNA interference
Transient transfections were carried out using Lipofectamine 2000 (Invitrogen Inc.,
Carlsbad, CA). Expression plasmids include myc-tagged murine pcDNA3-ΔNp63α,
pcDNA3-ΔNp63γ, pcDNA3-TAp63α and pcDNA3-TAp63γ, murine pMSCVpuro-ΔNp63α,
Bergholz et al. Page 8
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
and human myc-tagged pSG5-MKP3. Retrovirus were amplified by transfecting HEK-293T
cells with 3µg each of Gag/Pol and Env packaging plasmids and the retroviral expression
plasmid using Lipofectamine 2000. Lentivirus were amplified by transfecting HEK-293T
cells with 1.2 µg each of Gag/Pol, Tat and Env, 2.4 µg Vsv-g packaging plasmids, and 24 µg
of the lentiviral expression plasmid using TransIT (Mirus, Madison, WI). Lentiviral-based
shRNA against GFP, human p63, Erk1 and Erk2 in pLKO.1puro backbones were obtained
from Open Biosystems. The shRNA against human MKP3 is in a pSICOR(puro) plasmid.
Western blot analysis and immunofluorescence
Cells were lysed in EBC250 lysis buffer (69). Nuclear extraction was performed with
cytoskeletal (CSK) buffer (10 mM PIPES (pH 6.8), 100 mM NaCl, 300 mM sucrose, 3 mM
MgCl2, 1 mM EGTA, 1 mM DTT, 10 mM NaF, 0.1% Triton X-100, 1 mM ATP). Proteins
were resolved by SDS-PAGE, transferred to polyvinylidene difluoride membranes (NEN
LifeSciences, Waltham, Massachusetts) and hybridized to an appropriate primary antibody
and HRP-conjugated secondary antibody for subsequent detection by enhanced
chemiluminescence (Thermo Fisher Scientific Inc., Rockford, IL). For immunostaining,
cells grown on coverslips were fixed with 3.7% formaldehyde in PBS, permeabilized with
0.1% Triton X-100 in PBS, blocked with 1% bovine serum albumin (BSA) in PBS, and
sequentially incubated with primary and secondary antibodies prepared in 4% BSA.
Coverslips were mounted with ProLong Gold antifade reagent with DAPI (Invitrogen Inc.,
Carlsbad, CA). Using an Axiovert 200M microscope (Carl Zeiss, Germany) under 40% or
100% objective lenses, fluorescent images were acquired using an AxioCam MRm (Carl
Zeiss, Germany) and processed with AxioVision 4 software. Monoclonal antibody specific
for p63 (4A4) and goat anti-actin antibody (C-11) were purchased from Santa Cruz
Biotechnology (Santa Cruz, CA). Rabbit anti-MKP3 (3058), rabbit anti-phospho-Erk1/2
(9109), rabbit anti-Erk1/2 (9102), rabbit anti-phospho-Mek (9121), rabbit anti-Mek (9122),
and rabbit anti-phospho-paxillin (pTyr118; 2541) antibodies were purchased from Cell
Signaling (Danvers, MA). Goat anti-mouse IgG-HRP (sc-2005), goat anti-rabbit IgG-HRP
(sc-2004), and donkey anti-goat IgG-HRP (sc-2020) secondary antibodies for western
blotting were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Secondary
antibodies used for immunostaining, including goat anti-mouse Alexa Fluor 488 (A11001),
goat anti-rabbit Alexa Fluor 488 (A11008) and goat anti-rabbit Alexa Fluor 594 (A11012),
were purchased from Invitrogen (Carlsbad, CA).
Affymetrix array and Q-PCR analysis
Total RNA was isolated using TRIzol (Gibco Life Technologies, Rockville, MD) or RNeasy
Mini Kit (Qiagen, Chatsworth, CA), followed by reverse transcription using SuperScript III
First-Strand Synthesis System (Invitrogen Inc., Carlsbad, CA). Array analysis was
performed using U133Av2.0 human gene chip (Affymetrix, Santa Clara, CA) in two
independent experiments. Q-PCR was performed in a 7300 Real-Time PCR System
(Applied Biosystems, Foster City, CA) using QuantiTect SYBR Green PCR Kit (Qiagen,
Chatsworth, CA) according to manufacturer’s instructions. Primers used for Q-PCR are
listed in Table S1 in the Supplementary Material.
Assays for cell migration and invasion
Cell migration was measured using 6.5 mm, 8.0 µm-pore polycarbonate membrane transwell
inserts (BD Biosciences, San Jose, CA). Cell invasion was measured using matrigel-coated
inserts (BD Biosciences, San Jose, CA). Cells (1.0 × 105 to 2.5 × 105) were suspended in
serum-free DMEM (for MDA-MB-231 and FaDu cells) or DMEM:F12 (for MCF-10A cells)
media containing 0.5% gelatin, and seeded into the inner chamber. The outer chamber was
filled with normal growth media (as described previously for each cell type) containing
0.5% gelatin. Cells were incubated for 16 to 24 hours. Non-migrating cells were carefully
Bergholz et al. Page 9
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
removed with a cotton swab. Migrating cells were stained with 0.5% crystal violet in 70%
ethanol for ten minutes at room temperature, and photographed under a Zeiss light
microscope. At least 100 cells in total from five random fields were counted. Alternatively,
the stained cells were lyzed with 2% SDS in PBS and subjected to spectrophotometric
analysis at 570 nm.
In vivo metastasis assays
MCF-10A cell were infected with pBABE-NeuT or pBABE. Puromycin-resistant cells were
then infected with lentivirus expressing shRNA against p63 (NeuT-shp63) or GFP (NeuT-
shC). 1.0×106 NeuT-shC or NeuT-shp63 cells in 200 µL PBS were injected into the lateral
tail vein of six NCr nude six-week old female mice (CrTac:NCr-Foxn1nu; Taconic). Mice
were observed daily and euthanized after 45 days. During the course of the experiment, one
NeuT-shp63 mouse died for reasons unclear. The lungs were dissected and inspected for
metastatic nodules. Lungs were then fixed overnight in 3.7% formaldehyde, embedded in
paraffin, and sectioned onto microscope slides for haematoxylin and eosin (H&E) staining
and histological analysis. All animal studies were approved by the Institutional Animal Care
and Use Committee.
Statistical analysis
Quantitative data was analyzed statistically using student’s t-test to assess significance. Data
are presented as means ± standard error (SE), as noted on figure legends.
Bioinformatic analysis of gene expression
Oncomine™ (Compendia Bioscience, Ann Arbor, MI) was used for analysis and
visualization.
Supplementary Material
Refer to Web version on PubMed Central for supplementary material.
Acknowledgments
We thank Dr. Frank McKeon (Harvard Medical School, Boston, MA) for providing the myc-tagged murine
pcDNA3-ΔNp63α, pcDNA3-ΔNp63γ, pcDNA3-TAp63α and pcDNA3-TAp63γ expression plasmids, and Dr. Tyler
Jacks (Massachusetts Institute of Technology, Cambridge, MA) for providing a plasmid encoding shRNA against
human MKP3. We also thank Dr. Xixi Cao (Baylor College of Medicine) for help with Oncomine™ bioinformatics
analysis. This work was supported by NIH grants (CA79804 and GM70017) and by the National Key Basic
Research Program (973 Program) of China (2012CB910700) to Z-X. X., and United States Department of Defense
Congressionally Directed Medical Research Programs grant (W81XWH-10-1-0161) to J.B.
References
1. Serber Z, Lai HC, Yang A, Ou HD, Sigal MS, Kelly AE, et al. A C-terminal inhibitory domain
controls the activity of p63 by an intramolecular mechanism. Mol Cell Biol. 2002 Dec 1; 22(24):
8601–8611. [PubMed: 12446779]
2. Thanos CD, Bowie JU. p53 Family members p63 and p73 are SAM domain-containing proteins.
Protein Sci. 1999 Aug 1; 8(8):1708–1710. [PubMed: 10452616]
3. Yang A, Kaghad M, Wang Y, Gillett E, Fleming MD, Dötsch V, et al. p63, a p53 homolog at
3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative
activities. Mol Cell. 1998 Sep 1; 2(3):305–316. [PubMed: 9774969]
4. Candi E, Cipollone R, Rivetti di Val Cervo P, Gonfloni S, Melino G, Knight R. p63 in epithelial
development. Cell Mol Life Sci. 2008 Oct 1; 65(20):3126–3133. [PubMed: 18560758]
5. Melino G. p63 is a suppressor of tumorigenesis and metastasis interacting with mutant p53. Cell
Death Differ. 2011 Jul 15.
Bergholz et al. Page 10
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
6. Celli J, Duijf P, Hamel BC, Bamshad M, Kramer B, Smits AP, et al. Heterozygous germline
mutations in the p53 homolog p63 are the cause of EEC syndrome. Cell. 1999 Oct 15; 99(2):143–
153. [PubMed: 10535733]
7. McGrath JA, Duijf PH, Doetsch V, Irvine AD, de Waal R, Vanmolkot KR, et al. Hay-Wells
syndrome is caused by heterozygous missense mutations in the SAM domain of p63. Hum Mol
Genet. 2001 Feb 1; 10(3):221–229. [PubMed: 11159940]
8. Yang A, Schweitzer R, Sun D, Kaghad M, Walker N, Bronson RT, et al. p63 is essential for
regenerative proliferation in limb, craniofacial and epithelial development. Nature. 1999 Apr 22;
398(6729):714–718. [PubMed: 10227294]
9. Mills AA, Zheng B, Wang XJ, Vogel H, Roop DR, Bradley A. p63 is a p53 homologue required for
limb and epidermal morphogenesis. Nature. 1999 Apr 22; 398(6729):708–713. [PubMed:
10227293]
10. Senoo M, Pinto F, Crum CP, McKeon F. p63 Is essential for the proliferative potential of stem
cells in stratified epithelia. Cell. 2007 May 4; 129(3):523–536. [PubMed: 17482546]
11. Shalom-Feuerstein R, Lena AM, Zhou H, De La Forest Divonne S, Van Bokhoven H, Candi E, et
al. ΔNp63 is an ectodermal gatekeeper of epidermal morphogenesis. Cell Death Differ. 2010 Dec
3.
12. Keyes WM, Wu Y, Vogel H, Guo X, Lowe SW, Mills AA. p63 deficiency activates a program of
cellular senescence and leads to accelerated aging. Genes Dev. 2005 Sep 1; 19(17):1986–1999.
[PubMed: 16107615]
13. Flores ER, Sengupta S, Miller JB, Newman JJ, Bronson R, Crowley D, et al. Tumor predisposition
in mice mutant for p63 and p73: evidence for broader tumor suppressor functions for the p53
family. Cancer Cell. 2005 Apr 1; 7(4):363–373. [PubMed: 15837625]
14. Su X, Chakravarti D, Cho MS, Liu L, Gi YJ, Lin Y-L, et al. TAp63 suppresses metastasis through
coordinate regulation of Dicer and miRNAs. Nature. 2010 Oct 21; 467(7318):986–990. [PubMed:
20962848]
15. Gonfloni S, Di Tella L, Caldarola S, Cannata SM, Klinger FG, Di Bartolomeo C, et al. Inhibition
of the c-Abl-TAp63 pathway protects mouse oocytes from chemotherapy-induced death. Nat Med.
2009 Oct 1; 15(10):1179–1185. [PubMed: 19783996]
16. Suh E-K, Yang A, Kettenbach A, Bamberger C, Michaelis AH, Zhu Z, et al. p63 protects the
female germ line during meiotic arrest. Nature. 2006 Nov 30; 444(7119):624–628. [PubMed:
17122775]
17. Candi E, Rufini A, Terrinoni A, Dinsdale D, Ranalli M, Paradisi A, et al. Differential roles of p63
isoforms in epidermal development: selective genetic complementation in p63 null mice. Cell
Death Differ. 2006 Jun 1; 13(6):1037–1047. [PubMed: 16601749]
18. Carroll DK, Carroll JS, Leong C-O, Cheng F, Brown M, Mills AA, et al. p63 regulates an adhesion
programme and cell survival in epithelial cells. Nat Cell Biol. 2006 Jun 1; 8(6):551–561.
[PubMed: 16715076]
19. Ihrie RA, Marques MR, Nguyen BT, Horner JS, Papazoglu C, Bronson RT, et al. Perp is a p63-
regulated gene essential for epithelial integrity. Cell. 2005 Mar 25; 120(6):843–856. [PubMed:
15797384]
20. Rocco JW, Leong C-O, Kuperwasser N, DeYoung MP, Ellisen LW. p63 mediates survival in
squamous cell carcinoma by suppression of p73-dependent apoptosis. Cancer Cell. 2006 Jan 1;
9(1):45–56. [PubMed: 16413471]
21. DeYoung MP, Johannessen CM, Leong C-O, Faquin W, Rocco JW, Ellisen LW. Tumor-specific
p73 up-regulation mediates p63 dependence in squamous cell carcinoma. Cancer Res. 2006 Oct 1;
66(19):9362–9368. [PubMed: 17018588]
22. Keyes WM, Pecoraro M, Aranda V, Vernersson-Lindahl E, Li W, Vogel H, et al. ΔNp63α is an
oncogene that targets chromatin remodeler Lsh to drive skin stem cell proliferation and
tumorigenesis. Cell Stem Cell. 2011 Feb 4; 8(2):164–176. [PubMed: 21295273]
23. Hibi K, Trink B, Patturajan M, Westra WH, Caballero OL, Hill DE, et al. AIS is an oncogene
amplified in squamous cell carcinoma. Proc Natl Acad Sci USA. 2000 May 9; 97(10):5462–5467.
[PubMed: 10805802]
Bergholz et al. Page 11
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
24. Massion PP, Taflan PM, Jamshedur Rahman SM, Yildiz P, Shyr Y, Edgerton ME, et al.
Significance of p63 amplification and overexpression in lung cancer development and prognosis.
Cancer Res. 2003 Nov 1; 63(21):7113–7121. [PubMed: 14612504]
25. Weber A, Bellmann U, Bootz F, Wittekind C, Tannapfel A. Expression of p53 and its homologues
in primary and recurrent squamous cell carcinomas of the head and neck. Int J Cancer. 2002 May
1; 99(1):22–28. [PubMed: 11948487]
26. Haqq C, Nosrati M, Sudilovsky D, Crothers J, Khodabakhsh D, Pulliam BL, et al. The gene
expression signatures of melanoma progression. Proc Natl Acad Sci USA. 2005 Apr 26; 102(17):
6092–6097. [PubMed: 15833814]
27. Su H, Hu N, Shih J, Hu Y, Wang Q-H, Chuang EY, et al. Gene expression analysis of esophageal
squamous cell carcinoma reveals consistent molecular profiles related to a family history of upper
gastrointestinal cancer. Cancer Res. 2003 Jul 15; 63(14):3872–3876. [PubMed: 12873975]
28. Vanaja DK, Cheville JC, Iturria SJ, Young CYF. Transcriptional silencing of zinc finger protein
185 identified by expression profiling is associated with prostate cancer progression. Cancer Res.
2003 Jul 15; 63(14):3877–3882. [PubMed: 12873976]
29. Dumesic PA, Scholl FA, Barragan DI, Khavari PA. Erk1/2 MAP kinases are required for
epidermal G2/M progression. J Cell Biol. 2009 May 4; 185(3):409–422. [PubMed: 19414607]
30. Yamamoto T, Ebisuya M, Ashida F, Okamoto K, Yonehara S, Nishida E. Continuous ERK
activation downregulates antiproliferative genes throughout G1 phase to allow cell-cycle
progression. Curr Biol. 2006 Jun 20; 16(12):1171–1182. [PubMed: 16782007]
31. Vicent S, López-Picazo JM, Toledo G, Lozano MD, Torre W, Garcia-Corchón C, et al. ERK1/2 is
activated in non-small-cell lung cancer and associated with advanced tumours. Br J Cancer. 2004
Mar 8; 90(5):1047–1052. [PubMed: 14997206]
32. Adeyinka A, Nui Y, Cherlet T, Snell L, Watson PH, Murphy LC. Activated mitogen-activated
protein kinase expression during human breast tumorigenesis and breast cancer progression. Clin
Cancer Res. 2002 Jun 1; 8(6):1747–1753. [PubMed: 12060612]
33. Krueger JS, Keshamouni VG, Atanaskova N, Reddy KB. Temporal and quantitative regulation of
mitogen-activated protein kinase (MAPK) modulates cell motility and invasion. Oncogene. 2001
Jul 12; 20(31):4209–4218. [PubMed: 11464287]
34. McCawley LJ, Li S, Wattenberg EV, Hudson LG. Sustained activation of the mitogen-activated
protein kinase pathway. A mechanism underlying receptor tyrosine kinase specificity for matrix
metalloproteinase-9 induction and cell migration. J Biol Chem. 1999 Feb 12; 274(7):4347–4353.
[PubMed: 9933637]
35. Webb CP, Van Aelst L, Wigler MH, Woude GF. Signaling pathways in Ras-mediated
tumorigenicity and metastasis. Proc Natl Acad Sci USA. 1998 Jul 21; 95(15):8773–8778.
[PubMed: 9671754]
36. Ekerot M, Stavridis M, Delavaine L, Mitchell M, Staples C, Owens D, et al. Negative feedback
regulation of FGF signalling by DUSP6/MKP-3 is driven by ERK1/2 and mediated by Ets factor
binding to a conserved site within the DUSP6/MKP-3 gene promoter. Biochem J. 2008 Mar 6.
37. Li C, Scott DA, Hatch E, Tian X, Mansour SL. Dusp6 (Mkp3) is a negative feedback regulator of
FGF-stimulated ERK signaling during mouse development. Development. 2007 Jan 1; 134(1):
167–176. [PubMed: 17164422]
38. Fu SW, Schwartz A, Stevenson H, Pinzone JJ, Davenport GJ, Orenstein JM, et al. Correlation of
expression of BP1, a homeobox gene, with estrogen receptor status in breast cancer. Breast Cancer
Res. 2003 Jan 1; 5(4):R82–R87. [PubMed: 12817998]
39. Zhao H, Langerød A, Ji Y, Nowels KW, Nesland JM, Tibshirani R, et al. Different gene expression
patterns in invasive lobular and ductal carcinomas of the breast. Mol Biol Cell. 2004 Jun 1; 15(6):
2523–2536. [PubMed: 15034139]
40. Hollestelle A, Elstrodt F, Nagel JHA, Kallemeijn WW, Schutte M. Phosphatidylinositol-3-OH
kinase or RAS pathway mutations in human breast cancer cell lines. Mol Cancer Res. 2007 Feb 1;
5(2):195–201. [PubMed: 17314276]
41. Karlsson M, Mathers J, Dickinson RJ, Mandl M, Keyse SM. Both nuclear-cytoplasmic shuttling of
the dual specificity phosphatase MKP-3 and its ability to anchor MAP kinase in the cytoplasm are
Bergholz et al. Page 12
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
mediated by a conserved nuclear export signal. J Biol Chem. 2004 Oct 1; 279(40):41882–41891.
[PubMed: 15269220]
42. Jinnin M, Ihn H, Mimura Y, Asano Y, Yamane K, Tamaki K. Matrix metalloproteinase-1 up-
regulation by hepatocyte growth factor in human dermal fibroblasts via ERK signaling pathway
involves Ets1 and Fli1. Nucleic Acids Res. 2005 Jan 1; 33(11):3540–3549. [PubMed: 15972796]
43. Liu S, Liang Y, Huang H, Wang L, Li Y, Li J, et al. ERK-dependent signaling pathway and
transcriptional factor Ets-1 regulate matrix metalloproteinase-9 production in transforming growth
factor-beta1 stimulated glomerular podocytes. Cell Physiol Biochem. 2005 Jan 1; 16(4–6):207–
216. [PubMed: 16301820]
44. Yang S, Zhang JJ, Huang X-Y. Orai1 and STIM1 are critical for breast tumor cell migration and
metastasis. Cancer Cell. 2009 Feb 3; 15(2):124–134. [PubMed: 19185847]
45. Webb DJ, Donais K, Whitmore LA, Thomas SM, Turner CE, Parsons JT, et al. FAK-Src signalling
through paxillin, ERK and MLCK regulates adhesion disassembly. Nat Cell Biol. 2004 Feb 1;
6(2):154–161. [PubMed: 14743221]
46. Meng L, Gabai VL, Sherman MY. Heat-shock transcription factor HSF1 has a critical role in
human epidermal growth factor receptor-2-induced cellular transformation and tumorigenesis.
Oncogene. 2010 Sep 16; 29(37):5204–5213. [PubMed: 20622894]
47. Huang C, Jacobson K, Schaller MD. MAP kinases and cell migration. J Cell Sci. 2004 Sep 15;
117(Pt 20):4619–4628. [PubMed: 15371522]
48. Shin S, Dimitri CA, Yoon S-O, Dowdle W, Blenis J. ERK2 but not ERK1 induces epithelial-to-
mesenchymal transformation via DEF motif-dependent signaling events. Mol Cell. 2010 Apr 9;
38(1):114–127. [PubMed: 20385094]
49. Kuo L, Chang H-C, Leu T-H, Maa M-C, Hung W-C. Src oncogene activates MMP-2 expression
via the ERK/Sp1 pathway. J Cell Physiol. 2006 Jun 1; 207(3):729–734. [PubMed: 16453304]
50. Higashikawa K, Yoneda S, Tobiume K, Saitoh M, Taki M, Mitani Y, et al. DeltaNp63alpha-
dependent expression of Id-3 distinctively suppresses the invasiveness of human squamous cell
carcinoma. Int J Cancer. 2009 Jun 15; 124(12):2837–2844. [PubMed: 19267405]
51. Liu J, Zhan M, Hannay JA, Das P, Bolshakov SV, Kotilingam D, et al. Wild-type p53 inhibits
nuclear factor-kappaB-induced matrix metalloproteinase-9 promoter activation: implications for
soft tissue sarcoma growth and metastasis. Molecular cancer research : MCR. 2006 Nov; 4(11):
803–810. [PubMed: 17077165]
52. Sun Y, Wenger L, Rutter JL, Brinckerhoff CE, Cheung HS. p53 down-regulates human matrix
metalloproteinase-1 (Collagenase-1) gene expression. The Journal of biological chemistry. 1999
Apr 23; 274(17):11535–11540. [PubMed: 10206959]
53. Fukushima H, Koga F, Kawakami S, Fujii Y, Yoshida S, Ratovitski E, et al. Loss of
DeltaNp63alpha promotes invasion of urothelial carcinomas via N-cadherin/Src homology and
collagen/extracellular signal-regulated kinase pathway. Cancer Res. 2009 Dec 15; 69(24):9263–
9270. [PubMed: 19934319]
54. Downward J. Targeting RAS signalling pathways in cancer therapy. Nat Rev Cancer. 2003 Jan 1;
3(1):11–22. [PubMed: 12509763]
55. Zhang Z, Kobayashi S, Borczuk AC, Leidner RS, Laframboise T, Levine AD, et al. Dual
specificity phosphatase 6 (DUSP6) is an ETS-regulated negative feedback mediator of oncogenic
ERK-signaling in lung cancer cells. Carcinogenesis. 2010 Jan 22.
56. Furukawa T, Sunamura M, Motoi F, Matsuno S, Horii A. Potential tumor suppressive pathway
involving DUSP6/MKP-3 in pancreatic cancer. Am J Pathol. 2003 Jun 1; 162(6):1807–1815.
[PubMed: 12759238]
57. Okudela K, Yazawa T, Woo T, Sakaeda M, Ishii J, Mitsui H, et al. Down-regulation of DUSP6
expression in lung cancer: its mechanism and potential role in carcinogenesis. Am J Pathol. 2009
Aug 1; 175(2):867–881. [PubMed: 19608870]
58. Maillet M, Purcell N, Sargent M, York A, Bueno O, Molkentin J. Dusp6 (MKP3) null mice show
enhanced ERK1/2 phosphorylation at baseline and increased myocyte proliferation in the heart
affecting disease susceptibility. J Biol Chem. 2008 Aug 27.
Bergholz et al. Page 13
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
59. Barbieri CE, Tang LJ, Brown KA, Pietenpol JA. Loss of p63 leads to increased cell migration and
up-regulation of genes involved in invasion and metastasis. Cancer Res. 2006 Aug 1; 66(15):
7589–7597. [PubMed: 16885358]
60. Higashikawa K, Yoneda S, Tobiume K, Taki M, Shigeishi H, Kamata N. Snail-induced down-
regulation of DeltaNp63alpha acquires invasive phenotype of human squamous cell carcinoma.
Cancer Res. 2007 Oct 1; 67(19):9207–9213. [PubMed: 17909026]
61. Kommagani R, Leonard M, Lewis S, Romano R, Sinha S, Kadakia M. Regulation of VDR by
{Delta}Np63{alpha} is associated with inhibition of cell invasion. J Cell Sci. 2009 Jul 21.
62. Lindsay J, McDade SS, Pickard A, McCloskey KD, McCance DJ. The role of
{delta}Np63{gamma} in epithelial to mesenchymal transition. J Biol Chem. 2010 Dec 2.
63. Adorno M, Cordenonsi M, Montagner M, Dupont S, Wong C, Hann B, et al. A Mutant-p53/Smad
complex opposes p63 to empower TGFbeta-induced metastasis. Cell. 2009 Apr 3; 137(1):87–98.
[PubMed: 19345189]
64. Muller PAJ, Caswell PT, Doyle B, Iwanicki MP, Tan EH, Karim S, et al. Mutant p53 Drives
Invasion by Promoting Integrin Recycling. Cell. 2009 Dec 1; 139(7):1327–1341. [PubMed:
20064378]
65. Eicheler W, Zips D, Dörfler A, Grénman R, Baumann M. Splicing mutations in TP53 in human
squamous cell carcinoma lines influence immunohistochemical detection. J Histochem Cytochem.
2002 Feb 1; 50(2):197–204. [PubMed: 11799138]
66. Xu S, Furukawa T, Kanai N, Sunamura M, Horii A. Abrogation of DUSP6 by hypermethylation in
human pancreatic cancer. J Hum Genet. 2005 Jan 1; 50(4):159–167. [PubMed: 15824892]
67. Ginos MA, Page GP, Michalowicz BS, Patel KJ, Volker SE, Pambuccian SE, et al. Identification
of a gene expression signature associated with recurrent disease in squamous cell carcinoma of the
head and neck. Cancer Res. 2004 Jan 1; 64(1):55–63. [PubMed: 14729608]
68. Talbot SG, Estilo C, Maghami E, Sarkaria IS, Pham DK, O-charoenrat P, et al. Gene expression
profiling allows distinction between primary and metastatic squamous cell carcinomas in the lung.
Cancer Res. 2005 Apr 15; 65(8):3063–3071. [PubMed: 15833835]
69. Ying H, Chang DLF, Zheng H, McKeon F, Xiao Z-XJ. DNA-binding and transactivation activities
are essential for TAp63 protein degradation. Mol Cell Biol. 2005 Jul 1; 25(14):6154–6164.
[PubMed: 15988026]
Bergholz et al. Page 14
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 1.
Wild type ΔNp63α, but not disease-associated mutants, up-regulates MKP3 expression.
Hs-578T cells were transduced with a recombinant retrovirus encoding wild type murine
ΔNp63α (WT), a mutant derivative (C306R or C526W), or a vector control (V). Puromycin-
resistant cells were subjected to gene expression profiling by Affymetrix array in two
independent experiments performed in triplicate (a), to Q-PCR analysis for MKP3 mRNA
levels (b), or to western blotting for MKP3 protein expression (c). The Q-PCR data are
presented as means and standard errors (SE) from three independent experiments performed
in triplicate. *: P < 0.05 compared to V; **: P < 0.01 compared to V; #: P < 0.05 compared
Bergholz et al. Page 15
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
to WT; ##: P < 0.01 compared to WT. (d and e) Box plots representing p63 and MKP3
expression from breast tumor samples at different stages. Oncomine™ (Compendia
Bioscience, Ann Arbor, MI) was used for analysis and visualization. (d) Zhao Breast
dataset. (e) TCGA Breast dataset.
Bergholz et al. Page 16
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 2.
ΔNp63 reduces phosphorylated Erk1/2 in nuclei and attenuates Erk1/2 signaling. MDA-
MB-231 cells stably expressing ΔNp63α (p63) or an empty vector control (V) were
subjected to Q-PCR analysis for MKP3 mRNA levels (a) and protein expression (b). The Q-
PCR data are presented as means and SE from three experiments performed in triplicate (P =
0.032) (c) MDA-MB-231 cells were transduced with retrovirus encoding ΔNp63α. A mixed
population of ΔNp63α-positive [p63 (+)] and ΔNp63α-negative [p63 (−)] cells was assessed
by immunofluorescence for p63 (green) expression and phosphorylated Erk1/2 (red) levels,
and the nuclei were counterstained with DAPI (blue). Arrows denote cells with high levels
Bergholz et al. Page 17
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
of nuclear phosphorylated Erk1/2. Scale bar = 20 µm. (d) Cells with high levels of
phosphorylated Erk1/2 were scored for both p63 (−) and p63 (+) cells. Data are presented as
percentage of cells with high phosphorylated Erk1/2 over total p63 (−) or p63 (+) cells. At
least 100 cells in total from five random fields were scored for each of six experiments.
Results are presented as means and SE. (e) MDA-MB-231 cells stably expressing ΔNp63α
(p63) or vector control (V) were subjected to cellular fractionation to separate the nuclear
from the cytosolic fractions, which were then subjected to western blotting as shown. (f)
MDA-MB-231 cells stably expressing ΔNp63α (p63) or vector control (V) were subjected to
Q-PCR analysis for mRNA levels of MMP1 and MMP9. Results are presented as means and
SE from three experiments performed in triplicate.
Bergholz et al. Page 18
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 3.
ΔNp63α inhibits cell invasion in an MKP3-dependent manner. (a) MDA-MB-231 cells
stably expressing ΔNp63α (p63) or a vector control (V) were subjected to transwell assays
for cell invasion. Twenty-four hours after plating, invading cells were fixed and stained with
crystal violet and photographed under a light microscope. Representative pictures are
shown. (b) Results from invasion assay were quantitated as described in the Materials and
Methods section and presented as means and SE from three independent experiments. (c)
Stable MDA-MB-231 cells were transduced with recombinant lentivirus encoding an
shRNA specific for MKP3 (shMKP3) or for GFP as a control (shC) and subjected to western
Bergholz et al. Page 19
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
blotting. (d and e) Stable MDA-MB-231 cells were subjected to transwell assay for
invasiveness. Results are presented as means and SE from three independent experiments.
(f) Stable MDA-MB-231 cells were subjected to Q-PCR analysis for mRNA levels of
MMP1 and MMP9.
Bergholz et al. Page 20
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 4.
ΔNp63α regulates MKP3 expression and Erk1/2 activity. (a) MCF-10A and FaDu cells were
infected with recombinant lentivirus encoding shRNA specific for pan-p63 (shp63) or for
GFP as a control (shC). ΔNp63 and MKP3 mRNA levels were analyzed by Q-PCR. Results
are presented as means and SE from three independent experiments performed in triplicate.
(b) Whole-cell lysates were subjected to western blotting as indicated. (c) Diagram of the
MKP3 gene and promoter locus highlighting a putative p63 binding site, and the primers
(arrows) used for PCR amplification of the immunoprecipitated DNA. (d) Binding of p63 to
this putative binding site was assessed in FaDu cells by chromatin immunoprecipitation
Bergholz et al. Page 21
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
(ChIP) using a specific p63 antibody (4A4) or a control mouse IgG, followed by PCR
amplification. (e) MCF-10A cells infected with recombinant lentivirus encoding shRNA
specific for p63 (shp63) or GFP as a control (shC) were subjected to Q-PCR analyses for
MMP1 and MMP9 mRNA levels. Results are presented as means and SE from three
experiments performed in triplicate. *: P < 0.05; **: P < 0.01.
Bergholz et al. Page 22
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 5.
ΔNp63α, but not other p63 isoforms, inhibits cell migration and invasion. (a and b)
MCF-10A and FaDu cells stably expressing shRNA specific for pan-p63 (shp63) or GFP
(shC) were subjected to cell migration (a) or invasion assays (b), using transwell systems.
Migratory and invasive cells were fixed and stained with crystal violet and quantitated as
described in the Materials and Methods section. Results are presented as means and SE from
three experiments. (c) MCF-10A cells infected with recombinant lentivirus encoding shRNA
specific for p63 (shp63) or GFP as a control (shC) were grown in fresh normal growth
media (see Materials and Methods) for two hours prior to fixation. Cells were then
Bergholz et al. Page 23
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
immunostained for phospho-paxillin (pTyr118; green) and counterstained with DAPI (blue).
A representative figure from two independent experiments performed in triplicate is shown.
Note the punctuated staining of focal adhesion complexes in p63-ablated cells in contrast to
the organized peripheral staining in control cells (insets). Scale bars = 20 µm. (d and e)
MCF-10A cells infected with recombinant lentivirus encoding shRNA specific for p63
(shp63) or GFP as a control (shC) were transiently transfected with mouse Myc-tagged
ΔNp63α, ΔNp63γ, TAp63α, TAp63γ, or a vector control (V) as shown. Cells were subjected
to western blotting (d) or to invasion assays using transwell systems (e). Results are
presented as means and SE from two independent experiments. *: P < 0.05; **: P < 0.01.
Bergholz et al. Page 24
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 6.
p63 ablation-induced cell motility and invasion requires Erk2, but not Erk1. (a) MCF-10A
cells infected with lentivirus encoding an shRNA specific for pan-p63 (shp63) or GFP as a
control (shC) were subjected to cell invasion assays using transwell systems in the presence
of 10 µM U0126 (+) or DMSO as a vehicle control (−). Results are presented as means and
SE from three independent experiments. (b) MCF-10A cells expressing shRNA against p63
(shp63) or GFP as a control (shC) were infected with a lentivirus encoding shRNA against
Erk1 and/or Erk2, or a control shRNA against GFP (shC). Cells were subjected to western
blotting (b) or to cell invasion assays (c). Results from invasion assays are presented as
Bergholz et al. Page 25
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
means and SE from three independent experiments. *: P < 0.05; **: P < 0.01; #: P < 0.05
compared to shC-C (first column). (d) MCF-10A cells expressing shRNAs as indicated
above were grown in fresh normal growth media for two hours prior to fixation. Cells were
then immunostained for phospho-paxillin (pTyr118; green) and counterstained with DAPI
(blue). Representative figures from two independent experiments performed in triplicate are
shown. A magnified view of the respective boxed area is shown below each image. Note the
organized peripheral staining of focal adhesion complexes in p63-ablated cells with reduced
Erk2 expression. Scale bar = 20 µm.
Bergholz et al. Page 26
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 7.
MKP3 expression overcomes p63 ablation-induced cell migration and invasion. MCF-10A
cells expressing shRNA against p63 (shp63) or a control shRNA against GFP (shC) were
transiently transfected with MKP3 or a vector control (Ctrl). Cells were subjected to western
blotting (a), or cell migration (b) and invasion assays (c), using transwell systems.
Migratory and invasive cells were fixed and stained with crystal violet and quantitated as
described in the Materials and Methods section. Results are presented as means and SE from
three independent experiments. (d) MCF-10A cells expressing shRNAs and expression
vectors as indicated were grown in fresh normal growth media for two hours prior to
Bergholz et al. Page 27
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
fixation. Cells were then immunostained for phospho-paxillin (pTyr118; green) and
counterstained with DAPI (blue). Two independent experiments were performed in
triplicate. Representative pictures are shown. A magnified view of the respective boxed area
is shown below each image. Scale bar = 20 µm.
Bergholz et al. Page 28
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
Figure 8.
Reduced p63 expression enhances metastasis in vivo. MCF-10A cells transformed with
NeuT were infected with lentivirus expressing shRNA against p63 (NeuT-shp63) or GFP
(NeuT-shC). NCr nude mice were injected intravenously with 1.0×106 NeuT-shC or NeuT-
shp63 cells. Mice were observed daily and euthanized after 45 days. (a) Lungs were
dissected, fixed, and inspected for metastatic nodules on their surface. Arrows point to
metastatic nodules. Scale bar = 1.0 cm. (b) Graph represents the number of metastatic
nodules in the lungs per mouse. A horizontal line indicates the mean for each group. (c)
Lungs were fixed, embedded in paraffin, sectioned, and stained by H&E for histological
Bergholz et al. Page 29
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
analysis. Metastatic nodules are indicated by arrows on the top panel and by a T on the
bottom panel. Scale bars = 200 µm.
Bergholz et al. Page 30
Oncogene. Author manuscript; available in PMC 2014 July 09.
NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript
... Owing to the lack of a full transactivation (TA) domain at their N termini, ΔN isoforms of p63, including ΔNp63α, were previously assumed to be merely antagonists of p53 as well as TA isoforms of p63 and p73 [1, 8.]. However, mounting evidence demonstrates that ΔNp63s can also stimulate a vast body of target genes involved in cell proliferation, survival, differentiation, and motility [9][10][11][12]. Like TAp63α, ΔNp63α contains a unique C terminus comprised of a sterile alpha motif and a transinhibitory domain, which mediates protein interaction and transactivity regulation, conferring p63α some functions distinct from those of other isoforms [1,7,13]. ...
... Plasmids of pCMV-Flag-MM1, pLVX-MM1, pcDNA-ΔNp63α, and pcDNA-ΔNp63α(C306R) have been described previously [9,17]. Myc-tagged HERC3 (Wt HERC3) and its C1018A mutant (Mut HERC3) in pCMV vectors were obtained from Dr. Hochrainer [19]. ...
... ΔNp63α transactivates HERC3 gene to increase its expression ΔNp63α functions as a transcription factor that exerts its transactivity via binding to promoter regions of its target genes. To check whether down-regulation of MM1 induced by ΔNp63α depends on its ability to transactivate downstream genes, we used a plasmid of ΔNp63α with a C306R point mutation, which fails to bind to p63 response elements [9]. The results demonstrate that, compared to wild-type Fig. 2 HERC3 is a novel E3 ligase of MM1 mediating its ubiquitination and proteasomal degradation. ...
... Owing to alternative splicing in the C-terminus, the TA and ΔN classes of p63 can give rise to five different isoforms: α, β, γ, δ, and ε. Researchers have found that ΔNp63α is expressed in epithelial cells, functions in cell adhesion and inhibits cancer metastasis [13,17]. The N-terminal SH2 (nSH2)-TID (transactivation inhibitory domain) (nSH2-TID) of ΔNp63α forms a scaffold for the enzymatic complex, transmitting extrinsic signals from phosphopeptides to three distinct regions of PIK3CA. ...
... TQ can be seen in the center of the model. Xia's lab recently showed that ΔNp63α, a key inhibitor of metastasis, is a direct FOXO3a transcriptional target and can drive Akt1 activation through interactions with oncogenic PIK3CA hotspot mutants [13,17]. In vitro, we showed that the activating effects of p. H1047R are slightly stronger than those of p. H1047L in the TNBC cell line BT-549. ...
Article
Full-text available
Background Nigella sativa (N. sativa) exhibits anti-inflammatory, antioxidant, antidiabetic, antimetastatic and antinociceptive effects and has been used to treat dozens of diseases. Thymoquinone (TQ) is an important and active component isolated from N. sativa seeds. Inhibition of cancer-associated activating PIK3CA mutations is a new prospective targeted therapy in personalized metastatic breast cancer (MBC). TQ is reported to be an effective inhibitor of the PI3K/Akt1 pathway in MBC. This study aimed to evaluate the in vitro antitumor effect of TQ in the context of two PIK3CA hotspot mutations, p. H1047R and p. H1047L.Methods and resultsMolecular dynamics, free energy landscapes and principal component analyses were also used to survey the mechanistic effects of the p. H1047R and p. H1047L mutations on the PI3K/Akt1 pathway. Our findings clearly confirmed that the p. H1047R and p. H1047L mutants could reduce the inhibitory effect of ΔNp63α on the kinase domain of PIK3CA, resulting in increased activity of PI3K downstream signals. Structurally, the partial disruption of the interaction between the ΔNp63α DNA binding domain and the PIK3CA kinase domain at residues 114–359 and 797–1068 destabilizes the conformation of the activation loop and modifies the PIK3CA/ΔNp63α complex. Alongside these structural changes, we found that TQ treatment resulted in high PI3K/Akt1 pathway inhibition in p. H1047R and p. H1047L-expressing cells versus wild-type cells.Conclusions These two PIK3CA hotspot mutations therefore not only contribute to tumor progression in patients with MBC but may also serve as targets for the development of novel small molecule therapeutic strategies.
... ΔNp63α has an inhibitory role on cell migration and invasion as it downregulates several genes that promote epithelial-to-mesenchymal transition and cancer cell invasion and metastasis [11,26,29,34,35]. In addition, the inhibitory effect of ERK3 on cell migration in tongue squamous cell carcinoma cell line by downregulating Rac1 level was also reported [36]. ...
... ΔNp63α is overexpressed in many human cancers, such as skin cancer, head and neck cancers, lung cancers, and esophageal squamous cell carcinomas [6,[40][41][42]. ΔNp63α exhibits an inhibitory role on cell migration and invasion, in part by downregulating EMT and Akt pathway [10,11,29,34,35,43,44]. Hence, the role of ΔNp63α in cancer development and progression is complex and seems to be tissue-type dependent. ...
Article
Full-text available
Background p63, a member of the p53 gene family, is an important regulator for epithelial tissue growth and development. ∆Np63α is the main isoform of p63 and highly expressed in Non-melanoma skin cancer (NMSC). Extracellular signal-regulated kinase 3 (ERK3) is an atypical mitogen-activated protein kinase (MAPK) whose biochemical features and cellular regulation are distinct from those of conventional MAPKs such as ERK1/2. While ERK3 has been shown to be upregulated in lung cancers and head and neck cancers, in which it promotes cancer cell migration and invasion, little is known about the implication of ERK3 in NMSCs. Methods Fluorescent immunohistochemistry was performed to evaluate the expression levels of ΔNp63α and ERK3 in normal and NMSC specimens. Dunnett’s test was performed to compare mean fluorescence intensity (MFI, indicator of expression levels) of p63 or ERK3 between normal cutaneous samples and NMSC samples. A mixed effects (ANOVA) test was used to determine the correlation between ΔNp63α and ERK3 expression levels (MFI). The regulation of ERK3 by ΔNp63α was studied by qRT-PCR, Western blot and luciferase assay. The effect of ERK3 regulation by ΔNp63α on cell migration was measured by performing trans-well migration assay. Results The expression level of ∆Np63α is upregulated in NMSCs compared to normal tissue. ERK3 level is significantly upregulated in AK and SCC in comparison to normal tissue and there is a strong positive correlation between ∆Np63α and ERK3 expression in normal skin and skin specimens of patients with AK, SCC or BCC. Further, we found that ∆Np63α positively regulates ERK3 transcript and protein levels in A431 and HaCaT skin cells, underlying the upregulation of ERK3 expression and its positive correlation with ∆Np63α in NMSCs. Moreover, similar to the effect of ∆Np63α depletion, silencing ERK3 greatly enhanced A431 cell migration. Restoration of ERK3 expression under the condition of silencing ∆Np63α counteracted the increase in cell migration induced by the depletion of ∆Np63α. Mechanistically, ERK3 inhibits the phosphorylation of Rac1 G-protein and the formation of filopodia of A431 skin SCC cells. Conclusions ERK3 is positively regulated by ∆Np63α and mediates the role of ∆Np63α in suppressing cell migration in NMSC.
... ΔNp63α has an inhibitory role on cell migration and invasion as it downregulates several genes that promote epithelial-to-mesenchymal transition and cancer cell invasion and metastasis [11,26,29,34,35]. ...
... ΔNp63α is overexpressed in many human cancers, such as skin cancer, head and neck cancers, lung cancers, and esophageal squamous cell carcinomas [6,[40][41][42]. ΔNp63α exhibits an inhibitory role on cell migration and invasion, in part by downregulating EMT and Akt pathway [10,11,29,34,35,43,44]. Hence, the role of ΔNp63α in cancer development and progression is complex and seems to be tissue-type dependent. ...
Preprint
Full-text available
Background: p63, a member of the p53 gene family, is an important regulator for epithelial tissue growth and development. ∆Np63α is the main isoform of p63 and highly expressed in Non-melanoma skin cancer (NMSC). Extracellular signal-regulated kinase 3 (ERK3) is an atypical mitogen-activated protein kinase (MAPK) whose biochemical features and cellular regulation are distinct from those of conventional MAPKs such as ERK1/2. While ERK3 has been shown to be upregulated in lung cancers and head and neck cancers, in which it promotes cancer cell migration and invasion, little is known about the implication of ERK3 in NMSCs. Methods: Fluorescent immunohistochemistry was performed to evaluate the expression levels of DNp63a and ERK3 in normal and NMSC specimens. Dunnett’s test was performed to compare mean fluorescence intensity (MFI, indicator of expression levels) of p63 or ERK3 between normal cutaneous samples and NMSC samples. A mixed effects (ANOVA) test was used to determine the correlation between DNp63a and ERK3 expression levels (MFI). The regulation of ERK3 by DNp63a was studied by qRT-PCR, Western blot and luciferase assay. The effect of ERK3 regulation by DNp63a on cell migration was measured by performing trans-well migration assay. Results: The expression level of ∆Np63α is upregulated in NMSCs compared to normal tissue. ERK3 level is significantly upregulated in AK and SCC in comparison to normal tissue and there is a strong positive correlation between ∆Np63α and ERK3 expression in normal skin and skin specimens of patients with AK, SCC or BCC. Further, we found that ∆Np63α positively regulates ERK3 transcript and protein levels in A431 and HaCaT skin cells, underlying the upregulation of ERK3 expression and its positive correlation with ∆Np63α in NMSCs. Moreover, similar to the effect of ∆Np63α depletion, silencing ERK3 greatly enhanced A431 cell migration. Restoration of ERK3 expression under the condition of silencing ∆Np63α counteracted the increase in cell migration induced by the depletion of ∆Np63α. Mechanistically, ERK3 inhibits the phosphorylation of Rac1 G-protein and the formation of filopodia of A431 skin SCC cells. Conclusions: ERK3 is positively regulated by ∆Np63α and mediates the role of ∆Np63α in suppressing cell migration in NMSC.
... Cells at 40-50% confluence were infected with recombinant Lentivirus encoding or an empty vector in the presence of 10 μg/mL polybrene, followed by 12 h. Lentiviral-based shRNAs specific for green fluorescent protein (GFP, GCATCAAGGTGAACTTCAA), p63 (1# CCGTTTCGTCAGAACACACAT; 2# GAGTGGAATGACTTCAACTTT) or p53 (GAGGGATGTTTGGGAGATGTA) were constructed as previous described [25]. ...
Article
Full-text available
TGF-β signaling plays a pivotal role in promoting tumor cell migration and cancer metastasis. ΔNp63α and TAp63α are two major isoforms of p53-related p63 protein. Our recent study has shown that TGF-β1 promotes ΔNp63α protein degradation to facilitate cancer metastasis. However, whether TAp63α is involved in TGF-β1-induced cancer metastasis remains unclear. In this study, we show that, in human pancreatic cancer MIA PaCa-2 cells harboring p53-R248W allele, TGF-β1 can significantly inhibit TAp63α protein stability in a Smad pathway-independent manner. Lysosome inhibitor, chloroquine, but not proteasome inhibitor MG132, can rescue TGF-β1-induced downregulation of TAp63α protein. In addition, we show that either TGF-β1 treatment or silencing of TAp63α can dramatically increase migration of MIA PaCa-2 cells. Importantly, the restored expression of TAp63α can effectively block TGF-β1-induced migration of MIA PaCa-2 cells. Mechanistically, we show that TGF-β1 promotes TAp63α protein degradation, leading to upregulation of p53-R248W protein expression, and consequently resulting in elevated MIA PaCa-2 cell migration. Together, this study indicates that lysosomal degradation is an important way for regulating TAp63α protein fate and highlights that TGF-β1-TAp63α-mutant p53 axis is critically important in pancreatic cancer metastasis.
... Western blot analysis, quantitative polymerase chain reaction (Q-PCR) assay, and immunofluorescence staining were performed as described [22] [24]. Antibodies specific for FBXO3 (sc-514625), p63 (sc-71825), and desmoplakin (sc-33555) were purchased from Santa Cruz Biotechnology (California, USA). ...
Article
Full-text available
Transforming growth factor-β (TGF-β) signaling plays a critical role in promoting epithelial-to-mesenchymal transition (EMT), cell migration, invasion, and tumor metastasis. ΔNp63α, the major isoform of p63 protein expressed in epithelial cells, is a key transcriptional regulator of cell adhesion program and functions as a critical metastasis suppressor. It has been documented that the expression of ΔNp63α is tightly controlled by oncogenic signaling and is frequently reduced in advanced cancers. However, whether TGF-β signaling regulates ΔNp63α expression in promoting metastasis is largely unclear. In this study, we demonstrate that activation of TGF-β signaling leads to stabilization of E3 ubiquitin ligase FBXO3, which, in turn, targets ΔNp63α for proteasomal degradation in a Smad-independent but Erk-dependent manner. Knockdown of FBXO3 or restoration of ΔNp63α expression effectively rescues TGF-β-induced EMT, cell motility, and tumor metastasis in vitro and in vivo. Furthermore, clinical analyses reveal a significant correlation among TGF-β receptor I (TβRI), FBXO3, and p63 protein expression and that high expression of TβRI/FBXO3 and low expression of p63 are associated with poor recurrence-free survival (RFS). Together, these results demonstrate that FBXO3 facilitates ΔNp63α degradation to empower TGF-β signaling in promoting tumor metastasis and that the TβRI-FBXO3-ΔNp63α axis is critically important in breast cancer development and clinical prognosis. This study suggests that FBXO3 may be a potential therapeutic target for advanced breast cancer treatment.
... For example, TAp63α induces p21 expression, whereas ΔNp63α inhibits p21 expression [18]. However, ΔNp63α upregulates the expression of MKP3, Hsp70, and caspase-1 [19][20][21]. Furthermore, post-translational modifications of p63 usually affect its function and stabilization. ...
Article
Pan-histone deacetylase (HDAC) inhibitors can induce the expression of phosphatase and tensin homolog deleted on chromosome 10 (PTEN) protein. However, the underlying mechanism by which this occurs remains unclear. In this study, we show that pan-HDAC inhibitors, including trichostatin A, suberoylanilide hydroxamic acid, and sodium butyrate, were able to induce PTEN mRNA and protein expression via the acetylation of the transcription factor ΔNp63α by inhibiting HDAC1 and HDAC3. ΔNp63α enhanced PTEN promoter activity by binding two newly identified recognition sites on it. Unfortunately, the inhibition of HDAC1 or HDAC3 failed to activate PTEN, as knockdown of HDAC1 inhibited both membrane-bound and nuclear PTEN, and knockdown of HDAC3 only induced cytoplasmic PTEN. Furthermore, the overexpression of ΔNp63α downregulated membrane-bound PTEN but enhanced the nuclear translocation of PTEN, leading to the cisplatin resistance of oral cancer cells. PTEN accumulated in the nuclei of cancerous cells and normal cells when ΔNp63α was highly expressed in specimens from patients with squamous cell carcinoma of the tongue. However, inhibiting either HDAC1 or HDAC6 prevented the nuclear translocation of PTEN and attenuated cisplatin resistance. These results suggest that chemotherapeutic inhibitors of HDAC1 or HDAC6, together with cisplatin, might improve outcomes for patients with squamous cell carcinoma of the tongue.
... Short hairpin RNA constructs targeting human USP4 or Twist1 were generated using pLKO.1-puro vector as described [67]. All plasmid constructs used in this study were confirmed by DNA sequencing. ...
Article
Full-text available
Lung cancer stem cells (CSCs) play a pivotal role in tumor development, drug resistance, metastasis and recurrence of lung cancer. Thus, it is of great importance to study the mechanism by which CSCs are regulated. In this study, we demonstrate that the deubiquitinase USP4 is critically important in promoting lung cancer stemness. Silencing of USP4 leads to reduction of Oct4 and Sox2 expression, decreased CD133+ cell population and inhibition of tumorsphere formation. Conversely, ectopic expression of USP4 significantly enhances lung cancer cell stemness, which is effectively rescued by simultaneous silencing of Twist1. Mechanistically, we identified USP4 as a novel deubiquitinase of Twist1. USP4 binds to, deubiquitinates and stabilizes Twist1 protein. Furthermore, we show that USP4 expression is elevated in human lung cancer specimens and is positively correlated with Twist1 expression. High expression of USP4/Twist1 is associated with poor clinical outcomes of lung cancer patients. Together, this study highlights an important role for USP4 in lung cancer stemness and suggests USP4 as a potential target for lung cancer diagnosis and treatment.
... Here, we provide a detailed mechanism through canonical TGFβ signaling and its microRNA targets for the regulation of ∆Np63. Previously, multiple studies have focused on characterizing molecular pathways downstream of ΔNp63 that contribute to cancer progression and metastasis (9,13,18,19,44,46,47). In this study, we aimed to elucidate the regulatory network upstream of ΔNp63 and emphasize its importance in cancers. ...
Article
Full-text available
Np63 is a transcription factor of the p53 family and has crucial functions in normal development and disease. The expression pattern of ∆Np63 in human cancer suggests dynamic regulation of this isoform during cancer progression and metastasis. Many primary and metastatic tumors express high levels of ∆Np63, while ∆Np63 loss is crucial for tumor dissemination, indicating an oscillatory expression of ∆Np63 during cancer progression. Here we use genetically engineered orthotopic mouse models of breast cancer to show that while depletion of ΔNp63 inhibits primary mammary adenocarcinoma development, oscillatory expression of ΔNp63 in established tumors is crucial for metastatic dissemination in breast cancer. A TGFβ-regulated microRNA network acted as upstream regulators of this oscillatory expression of ΔNp63 during cancer progression. This work sheds light on the pleiotropic roles of ∆Np63 in cancer and unveils critical functions of TGFβ in the metastatic process.
Article
Full-text available
The TP63 gene, which encodes the p63 protein, is involved in multiple biological processes including embryonic development and tumorigenesis. ΔNp63α, the predominant isoform of p63 in epithelial cells, acts as an oncogene in early stage tumors, but paradoxically acts as a potent anti‐metastatic factor in advanced cancers. Here, we report that ΔNp63α is a direct target of hsa‐miR‐522 (miR‐522). Induced expression of miR‐522 reduced the levels of ΔNp63α, predisposing breast epithelial cells to a loss of epithelial and acquisition of mesenchymal morphology, resulting in accelerated collective and single cell migration. Restoration of ΔNp63α repressed miR‐522‐induced migration. Interestingly, overexpression of miR‐522 did not affect breast epithelial cell proliferation, suggesting that miR‐522 acts specifically through ΔNp63α in this context. Furthermore, expression of miR‐522‐3p and p63 were negatively correlated in human cancer samples. Thus, miR‐522 might be a causative factor for breast tumorigenesis and cancer metastasis. In summary, our results reveal a novel miR‐522/p63 axis in cell migration, and thus suggest a potential strategy for therapeutic treatment of cancer metastasis.
Article
Full-text available
Aberrant expression of microRNAs (miRNAs) and the enzymes that control their processing have been reported in multiple biological processes including primary and metastatic tumours, but the mechanisms governing this are not clearly understood. Here we show that TAp63, a p53 family member, suppresses tumorigenesis and metastasis, and coordinately regulates Dicer and miR-130b to suppress metastasis. Metastatic mouse and human tumours deficient in TAp63 express Dicer at very low levels, and we found that modulation of expression of Dicer and miR-130b markedly affected the metastatic potential of cells lacking TAp63. TAp63 binds to and transactivates the Dicer promoter, demonstrating direct transcriptional regulation of Dicer by TAp63. These data provide a novel understanding of the roles of TAp63 in tumour and metastasis suppression through the coordinate transcriptional regulation of Dicer and miR-130b and may have implications for the many processes regulated by miRNAs.
Article
Full-text available
p63 is critical for epithelial development yet little is known about the transcriptional programmes it regulates. By characterising transcriptional changes and cellular effects following modulation of p63 expression, we have defined a vital role for p63 in cellular adhesion. Knockdown of p63 expression caused downregulation of cell adhesion-associated genes, cell detachment and anoikis in mammary epithelial cells and keratinocytes. Conversely, overexpression of the TAp63 or Np63 isoforms of p63 upregulated cell adhesion molecules, increased cellular adhesion and conferred resistance to anoikis. Apoptosis induced by loss of p63 was rescued by signalling downstream of 4 integrin. Our results implicate p63 as a key regulator of cellular adhesion and survival in basal cells of the mammary gland and other stratified epithelial tissues.
Article
Full-text available
p63, a member of p53 family, has a significant role in the development and maintenance of stratified epithelia. However, a persistent dispute remained over the last decade concerning the interpretation of the severe failure of p63-null embryos to develop stratified epithelia. In this study, by investigating both p63-deficient strains, we demonstrated that p63-deficient epithelia failed to develop beyond ectodermal stage as they remained a monolayer of non-proliferating cells expressing K8/K18. Importantly, in the absence of p63, corneal-epithelial commitment (which occurs at embryonic day 12.5 of mouse embryogenesis) was hampered 3 weeks before corneal stem cell renewal (that begins at P14). Taken together, these data illustrate the significant role of p63 in epithelial embryogenesis, before and independently of other functions of p63 in adult stem cells regulation. Transcriptome analysis of laser captured-embryonic tissues confirmed the latter hypothesis, demonstrating that a battery of epidermal genes that were activated in wild-type epidermis remained silent in p63-null tissues. Furthermore, we defined a subset of novel bona fide p63-induced genes orchestrating first epidermal stratification and a subset of p63-repressed mesodermal-specific genes. These data highlight the earliest recognized action of ΔNp63 in the induction epidermal morphogenesis at E11.5. In the absence of p63, a mesodermal program is activated while epidermal morphogenesis does not initiate.
Article
Cell migration is a complex, highly regulated process that involves the continuous formation and disassembly of adhesions (adhesion turnover). Adhesion formation takes place at the leading edge of protrusions, whereas disassembly occurs both at the cell rear and at the base of protrusions. Despite the importance of these processes in migration, the mechanisms that regulate adhesion formation and disassembly remain largely unknown. Here we develop quantitative assays to measure the rate of incorporation of molecules into adhesions and the departure of these proteins from adhesions. Using these assays, we show that kinases and adaptor molecules, including focal adhesion kinase (FAK), Src, p130CAS, paxillin, extracellular signal-regulated kinase (ERK) and myosin light-chain kinase (MLCK) are critical for adhesion turnover at the cell front, a process central to migration.
Article
p53 mutations, occurring in two-thirds of all human cancers, confer a gain of function phenotype, including the ability to form metastasis, the determining feature in the prognosis of most human cancer. This effect seems mediated at least partially by its ability to physically interact with p63, thus affecting a cell invasion pathway, and accordingly, p63 is deregulated in human cancers. In addition, p63, as an 'epithelial organizer', directly impinges on epidermal mesenchimal transition, stemness, senescence, cell death and cell cycle arrest, all determinant in cancer, and thus p63 affects chemosensitivity and chemoresistance. This demonstrates an important role for p63 in cancer development and its progression, and the aim of this review is to set this new evidence that links p63 to metastasis within the context of the long conserved other functions of p63.
Article
The p53 homolog p63 is essential for development, yet its role in cancer is not clear. We discovered that p63 deficiency evokes the tumor-suppressive mechanism of cellular senescence, causing a striking absence of stratified epithelia such as the skin. Here we identify the predominant p63 isoform, ΔNp63α, as a protein that bypasses oncogene-induced senescence to drive tumorigenesis in vivo. Interestingly, bypass of senescence promotes stem-like proliferation and maintains survival of the keratin 15-positive stem cell population. Furthermore, we identify the chromatin-remodeling protein Lsh as a new target of ΔNp63α that is an essential mediator of senescence bypass. These findings indicate that ΔNp63α is an oncogene that cooperates with Ras to promote tumor-initiating stem-like proliferation and suggest that Lsh-mediated chromatin-remodeling events are critical to this process.